Available via license: CC BY-NC-ND 4.0
Content may be subject to copyright.
International Journal of Pharmaceutics: X 4 (2022) 100139
Available online 13 November 2022
2590-1567/© 2022 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
In vitro synergistic activity of cisplatin and EGFR-targeted nanomedicine of
anti-Bcl-xL siRNA in a non-small lung cancer cell line model
☆
Phuoc Vinh Nguyen
a
,
b
, Katel Herv´
e-Aubert
a
, Laurie Lajoie
c
, Yoann Misericordia
a
,
Igor Chourpa
a
, St´
ephanie David
a
, Emilie Allard-Vannier
a
,
*
a
EA6295 Nanom´
edicaments et Nanosondes, Universit´
e de Tours, Tours, France
b
School of Medicine, Vietnam National University Ho Chi Minh city, Ho Chi Minh city, Viet Nam
c
ISP UMR1282, INRAE, ´
equipe BioMAP, Universit´
e de Tours, Tours, France
ARTICLE INFO
Keywords:
NSCLC
EGFR-targeted nanomedicine
BcL-xL
Cisplatin
Gene delivery
scFv
ABSTRACT
Apoptosis is an important process that directly affects the response of cancer cells to anticancer drugs. Among
different factors involved in this process, the BcL-xL protein plays a critical role in inhibiting apoptosis induced
by chemotherapy agents. Henceforth, its downregulation may have a synergistic activity that lowers the
necessary dose of anticancer agents. In this study, anti-Bcl-xL siRNA were formulated within an EGFR-targeted
nanomedicine with scFv ligands (NM-scFv) and its activity was tested in the non-small cell lung cancer (NSCLC)
cell line H460. The obtained NMs-scFv anti-Bcl-xL were suitable for intravenous injection with sizes around 100
nm, a high monodispersity level and good siRNA complexation capacity. The nanocomplex's functionalization
with anti-EGFR scFv ligands was shown to allow an active gene delivery into H460 cells and led to approximately
63% of gene silencing at both mRNA and protein levels. The NM-scFv anti-Bcl-xL improved the apoptotic activity
of cisplatin and reduced the cisplatin IC
50
value in H460 cells by a factor of around three from 0.68 ±0.12
μ
M to
2.21 ±0.18
μ
M (p <0.01), respectively, in comparison to that of NM-scFv formulated with control siRNA (p >
0.05).
1. Introduction
Lung cancer is the leading cause of cancer-related deaths in the
world, with approximately 1.8 death cases in 2020 (18% of all death
cases caused by cancer) (Bade and Dela Cruz, 2020; Ferlay et al., 2021).
It is a heterogenous cancer that can be divided into two principal forms
including non-small cell lung cancer (NSCLC) and small-cell lung cancer
(SCLC) (Osmani et al., 2018). NSCLC represents approximately 85% of
all lung cancer patients, and around 40% of patients suffering from this
subtype are at an advanced stage when they are diagnosed (Herbst et al.,
2018; Osmani et al., 2018).
Due to the comorbility caused by NSCLC, several treatment strategies
have been developed and proven their effectiveness, including radio-
therapy, chemotherapy, targeted therapy, immunotherapy or the com-
bination of them. Despites these efforts, the 5-year survival of NSCLC
remains relatively low (approximately 20–30%) because of diagnosis at
advanced stages (Min and Lee, 2021). Furthermore, the conventional
chemotherapy remains the mainstay treatment option for NSCLC despite
of the remarkable progress in immunotherapy with anti-PD1 and anti-
PDL1 agents. However, the drug resistance phenomenon is silently
emerging and poses a direct threat to the treatment effectiveness (Kim,
2016; Sosa Iglesias et al., 2018). Different mechanisms of chemotherapy
resistance have been studied and demonstrated in NSCLC, such as i) an
enhancement in DNA repair capacity by upregulating ERCC1 or DNA
polymerase, in drug efux by activating several drug export transporters
(ATP7A/B, ABCC1/MRP1, ABCC3/MRP3, P-gp), in drug detoxication
by increasing the intracellular concentration of glutathione, in pro-
survival signal pathways (EGFR, STAT3, PI3k/Akt, MAPK, NF-kB), and
in EMT- a related factor to the metastasis or ii) a decrease in drug uptake
by down-regulating Na
+
/K
+
-ATPase pumb or CTR1 protein, in cell cycle
arrest by an overexpression in anti-apoptotic proteins (Bcl-xL, Bcl-2)
(Kim, 2016; Min and Lee, 2021; Mirzaei et al., 2021a; Sosa Iglesias
Abbreviations: scFv, single chain variable fragment; NSCLC, non-small cell lung cancer; EGFR, epidermal growth factor receptor; BcL-xL, B-cell lymphoma-extra
large.
☆
This article was originally submitted to IJP on 02-March-22 but the paper was transferred to IJP:X on 11-Nov-2022.
* Corresponding author.
E-mail address: emilie.allard@univ-tours.fr (E. Allard-Vannier).
Contents lists available at ScienceDirect
International Journal of Pharmaceutics: X
journal homepage: www.sciencedirect.com/journal/international-journal-of-pharmaceutics-x
https://doi.org/10.1016/j.ijpx.2022.100139
International Journal of Pharmaceutics: X 4 (2022) 100139
2
et al., 2018).
Among different chemotherapy agents used for NSCLC patients,
platinum compounds with cisplatin (CIS) as the gold standard is the
main treatment regimen. It can be administered in combination with
third-generation anticancer drugs such as gemcitabine, vinorelbine or
taxanes (Alexander et al., 2020; ˇ
Suti´
c et al., 2021). However, its appli-
cation is more and more limited by severe side effects and a drug-
resistance phenomenon, such as the overexpression of anti-apoptotic
proteins that leads to an impair in apoptosis in cancer cells (Duma
et al., 2019; Huang et al., 2007). Indeed, CIS causes DNA damages and
induces cellular apoptosis, involving the upregulation of apoptotic
proteins such as Bax or Bak and the downregulation of anti-apoptotic
proteins (BcL-2 and Bcl-xL) (Huang et al., 2007; Lei et al., 2007;
Zhang et al., 2018). It has been proven that the overexpression of Bcl-xL
and Bcl-2 can delay the apoptosis process caused by several cytotoxic
drugs including CIS (Huang et al., 2007; Lei et al., 2007). In fact, CIS
causes the cell death and cell cycle arrest through the formation of DNA
lesion that can be delayed or even deactivated by the overexpression of
Bcl-xL. Therefore, the downregulation of such anti-apoptotic proteins
may have a therapeutic activity on cancer cells' sensitivity to anticancer
drugs (Kim et al., 2004).
Gene therapy involving small interfering RNAs (siRNAs) has
emerged as one of the most promising solutions for the specic down-
regulation of these cancer-related proteins (Fire et al., 1998; Singh et al.,
2018; Subhan and Torchilin, 2019). siRNAs' mechanism of action is
based on their interfering activity with cancer-associated target genes
that leads to the protein downregulation and contributes actively to an
enhancement in the therapy efciency. siRNAs can bring about sub-
stantial benets to cancer therapy thanks to their potency, specicity
and ability to target any cancer-related genes (Lochmatter and Mullis,
2011; Vinh Nguyen et al., 2020). In case of cisplatin, several studies have
proven the potency of siRNAs in reversing cisplatin resistance by down-
regulating several important tumor-promoting factors such as EZH2,
H1F-1a, EGFR, STAT3, Nrf2, ID1, Nek2, Akt1 (Mirzaei et al., 2021a).
Despite their potential, naked siRNA applications are unfeasible in
clinical settings due to their intrinsic nature and because of the presence
of intra- and extracellular barriers (Ben Djemaa et al., 2018; Vinh
Nguyen et al., 2020). For extracellular barriers, naked siRNAs are prone
to be degraded by nucleases in the bloodstream or eliminated by renal
clearance (Mirzaei et al., 2021b). In terms of intracellular barriers, even
if they can escape from enzymatic degradation, there is a high chance
that their highly negative charges hinder their penetration through the
negative cell membrane into their nal active site (cytoplasm). For all
previous reasons, siRNAs need to be delivered by an appropriate system
and nanomedicines are one of the most promising siRNA carriers (Ben
Djemaa et al., 2019).
The current study is performed to apply a novel nanomedicine that
has been previously developped and optimized by our team in the active
delivery of anti-Bcl-xL siRNAs into NSCLC cells. Our nanomedicine is
functionalized with anti-EGFR scFv ligands to target EGFR-
overexpressing H460 cells (Vinh Nguyen et al., 2020). The EGFR is a
receptor in the family of tyrosine kinases that is strictly related to cancer
development, metastasis and resistance (Dhomen et al., 2012; Mansour
et al., 2018; Tan et al., 2016; Van den Eynde et al., 2011). The EGFR-
overexpression is a common phenomenon and can be observed up to
80% in NSCLC cases (Liang et al., 2010; Salimath et al., 2015; Vinh
Nguyen et al., 2021). Taking into account the EGFR-overexpression and
the important role of Bcl-xL in NSCLC treatment, anti-Bcl-xL siRNAs
were complexed with our targeted nanomedicine (NM-scFv). After-
wards, the Bcl-xL downregulation at both the transcriptional and
translational levels induced by our NM-scFv was assessed and compared
to a non-targeted nanomedicine (NM). The therapeutic activity of the
nalized NM-scFv was then evaluated by an apoptosis assay in combi-
nation or not with cisplatin. Finally, the synergistic activity of our tar-
geted nanomedicine combined with cisplatin was studied using a cell
viability assay.
2. Materials and methods
2.1. Preparation of targeted nanomedicine with anti-EGFR scFv ligands
for anti-Bcl-xL siRNA delivery
2.1.1. Synthesis of the targeted nanovector (NV-scFv)
The NV-scFv's synthesis was based on our previously published
protocol including three steps: (i) the coupling of a near-infrared uo-
rescent dye onto the silanized SPION's surface, (ii) the covering of the
silanized SPIONs with a polyethylene glycol (PEG) layer and (iii) the
functionalization of the PEGylated SPIONs with 100% humanized anti-
EGFR scFv ligands (Vinh Nguyen et al., 2020).
2.1.2. Formulation of the targeted nanomedicine (NM-scFv)
Anti-Bcl-xL siRNA (sequence 5′-GACUGUGGCCGGCGUGGUU/AAC-
CACGCCGGCCACAGUC-3′, Sigma-Aldrich, St. Quentin Fallavier,
France) and scramble or control siRNA (Ambion®, New-York, U.S.A)
were complexed with NVs-scFv and two cationic polymers namely chi-
tosan (MW =110–150 kDa, degree of acetylation ≤40 mol%) and poly-
L-arginine (PLR, MW =15–70 kDa, Sigma-Aldrich Chimie GmbH, St.
Quentin Fallavier, France), to obtain the corresponding NM-scFv anti-
Bcl-xL and NM-scFv control, respectively, according to the previously
published protocol (Vinh Nguyen et al., 2020). Briey, siRNAs were
precomplexed with PLR while chitosan was mixed with NVs-scFv. The
complexed siRNA/PLR was then added into the mixture of NV-scFv/
chitosan and homogenized using micropipette mixing and vortexing.
The nal siRNA concentration was xed at 50 nM for internalization
assay, 100 nM for qRT-PCR and Western blot assays, and 2000 nM for
physico-chemical characterization. The mass ratio (MS) was used to
determine the NV-scFv/siRNA ratio. The cationic polymers' content was
dened as the charge ratio or the molar ratio of the positive charges of
polymers and the negative charges of siRNA. All these ratios were
optimized in our previous publication and xed at 10 to obtain the
optimal siRNA transfection efciency (Vinh Nguyen et al., 2020).
2.2. Physico-chemical characterization
2.2.1. Size and zeta potential analysis
The hydrodynamic diameter (D
H
), the polydispersity index (PDi),
and the zeta potential (ζ) were determined using a Nanosizer apparatus
(Zetasizer®, Malvern Instrument, UK). The measurement was performed
in NaNO
3
0.01 M to x the ionic strength. The D
H
was based on intensity
measurements and were achieved at 25 ◦C. All measurment were per-
formed in triplicate.
2.2.2. siRNA complexation capacity
To verify the siRNA complexation capacity of our NMs-scFv, the
electrophoresis technique on agarose gel was employed. An agarose gel
at 1% (m/v) was prepared containing 0.01% (v/v) of ethidium bromide
(EtBr) to visualize free siRNA. NMs and NMs-scFv were formulated twice
at 2000 nM in siRNA. The rst sample of each formulation was diluted
with water and the second was diluted with heparin 10 g/L at a dilution
factor of 2:1 (v/v). A loading buffer was added and a nal content
corresponding to 16 pmol of siRNA per well was deposited. The
migration of samples on the gel was conducted in a Tris-acetate-EDTA
(TAE) 1×buffer for 15 min at 150 V. The visualization of free siRNA
was made with UV-imaging using the EvolutionCapt software on a
Fusion-Solo.65.WL imager (Vilber Lourmat, Marne-La-Vall´
ee, France).
2.3. Cell culture experiments
2.3.1. Cell culture
Luciferase stably expressing human non-small cell lung cancer
(H460-Luc) was a gift from CIPA TAAM CNRS UPS44, Orl´
eans, France.
H460-Luc cells were cultured at 37 ◦C in an atmosphere containing 5%
of CO
2
. The culture medium was made of RPMI-1640 medium
P.V. Nguyen et al.
International Journal of Pharmaceutics: X 4 (2022) 100139
3
supplemented with 10% of FBS, 2 mM of L-glutamine, 1% of penicillin/
streptomycin. Cell harvesting was carried out with trypsin/EDTA
(0.05%) at 80% of conuence.
2.3.2. Internalization assay
The cellular internalization level of NMs and NMs-scFv into H460-
Luc cells was determined and compared by tracking the near-infrared
uorescence from grafted dyes on NVs (Dylight™680 dye) using ow
cytometry. H460-Luc cells were seeded in a 12-well plate at 1.5 ×10
5
cells/well. After 24 h, NMs and NMs-scFv prepared with anti-Bcl-xL
siRNAs in reduced-serum Opti-MEM were added to the cells at a nal
concentration of 50 nM in siRNA (or 6.58 mg of iron/L) for 4 h. After 4 h,
a cell culture medium of 20% of serum was added at a dilution factor of
1:1 (v/v) for 20 h. Non-treated cells were used as negative controls. After
24 h, the cells were washed, harvested, and analyzed by ow cytometry
(Gallios ow cytometer, Beckman Coulter, U.S.A). All experiments were
triplicated and treated using Flowing Software 2.5.1 (Turku Bioscience
Centre, Turku, Finland).
2.3.3. Cell transfection
H460-Luc cells were seeded at 3 ×10
6
cells/well in 6-well plates for
24 h. On the transfection day, anti-Bcl-xL siRNAs were complexed
within Lipofectamine™ RNAiMAX, NMs, and NMs-scFv and diluted with
serum-reduced medium Opti-MEM at a dilution factor of 1:10 (v/v) to
obtain the siRNA nalized concentration of 100 nM. Afterwards, the
culture medium was removed, and the cells were washed twice with the
HBSS buffer. 1 mL/well of each formulation with complexed siRNAs was
added and the transfection was performed for 4 h. The negative control
was made with Opti-MEM without adding siRNA. After 4 h, 1 mL of the
culture medium enriched in serum (20%) was added and maintained at
37 ◦C for another 20 h for qRT-PCR analysis or 44 h for Western Blot
assay.
2.3.4. RNA extraction and qRT-PCR analysis
At 24 h after cell transfection, total-RNAs were isolated from
cultured cells using the NucleoSpin RNA kit (Macherey-Nagel, Hoerdt,
Germany) according to the manufacturer's protocol, and subsequently
reverse transcribed into complementary DNAs (cDNAs) by the Rever-
tAid First Strand cDNA Synthesis Kit (Thermo Scientic™, Paisley, UK).
The synthesized cDNAs of the targeted gene (Bcl-xL) and the reference
gene (GAPDH) were assessed, using their specic forward and reverse
primers and the TakyonTM No Rox SYBR® MasterMix dTTP Blue
(Eurogentec, Seraing, Belgium), on a 96-well plate with the CFX96 Real-
Time PCR Detection System (BioRad) thermal cycler. GAPDH, an
endogenous reference gene, was used as a relative quantication stan-
dard to determine the relative expression of Bcl-xL mRNA level in this
analysis. The sequence of the specic primers used in this analysis were
as follows: forward primer 5′-ATCTCTTTCTCTCCCTTCAG/
CTTTCTGGGAAAGCTTGTAG-3′and reverse primer 5′- TTCAGT-
GACCTGACATCCCA/TCCACAAAAGTATCCCAGCC-3′for Bcl-xL and
forward primer 5′-CTTTTGCGTCGCCAG/TTGATGGCAACAATATCCAC-
3′and reverse primer 5′- CAAAAGGGTCATCATCTCTGC/AGTTGT-
CATGGATGACCTTGG-3′for GAPDH. All specic primers were pur-
chased from Eurogentec (Seraing, Belgium). Non-treated cells and the
commercialized transfection reagent (Lipofectamine™ RNAiMAX,
Invitrogen, Carlsbad, U.S.A), abbreviated as Lipofectamine, were used
as negative and positive controls, respectively. To calculate the relative
gene expression of Bcl-xL in each sample, the ΔΔCq method was applied.
In this method, the number of quantication cycles (Cq) of the targeted
gene (Bcl-xL) and that of the reference gene (GAPDH) of each sample
were obtained after qPCR. For each replica, the expression of the Bcl-xL
gene was normalized to GAPDH gene expression levels to determine
ΔCq (ΔCq =Cq
(Bcl-xL)
– Cq
(GAPDH)
). The ΔCq was averaged and then
normalized to that of the non-treated cells to determine the ΔΔCq
(ΔΔCq =ΔCq
(sample)
– ΔCq
(non-treated cells)
). The ΔΔCq was then expo-
nentially transformed to nd the ΔΔCq expression, which was equal to
2
- ΔΔCq
(Bustin, 2004). From that, a normalized, relative gene expression
value of Bcl-xL was determined.
2.3.5. Western blot analysis
At 48 h after cell transfection, cells were harvested and lysed in a
lysis buffer (RIPA buffer +Protease Inhibitor Cocktail, Thermo Fisher
Scientic, Rockford, USA). Cell lysates were centrifuged at 20.000 g for
20 min at 4 ◦C, and the protein content in supernatants was determined
using a BCA protein assay kit (Sigma-Aldrich Chimie GmbH, St. Quentin
Fallavier, France). Equal amounts of protein lysate (around 20
μ
g of
protein) were electrophoretically separated on 4–12% polyacrylamide
gels and transferred to nitrocellulose membranes using an iBlot® 2 (life
technologies, Carlsbad, CA). After blocking with milk in TBS-Tween 20
1×at 5% (MT) during 1 h, at room temperature and under constant
agitation, each membrane was incubated with the anti-BcL-xL mono-
clonal antibody (Abcam, Cambridge, UK, dilution 1/1000 in MT) or the
anti-GAPDH one (ThermoFisher scientic, Rockford, USA, dilution 1/
1000 in MT) for 2 h and subsequently incubated for 1 h with the IgG
anti-rabbit secondary antibody antibody (ThermoFisher scientic,
Rockford, USA, dilution 1/1000 in MT), both at room temperature and
under moderate agitation. After washing, bound antibodies were
detected by an enhanced chemiluminescence kit using the ECL
(Enhanced ChemiLuminescence) solution (ThermoFisher scientic,
Rockford, USA). The percentage of the BcL-xL protein expression in each
sample was estimated by normalizing to the corresponding GAPDH
protein and comparing to those in non-treated cells using the quanti-
cation function of Imager Fusion-Solo.65.WL (Vilber Lourmat, Marne-la-
Vall´
ee, France).
2.3.6. Apoptosis assay
H460-Luc cells were seeded at 3 ×10
4
cells/well in 12-well plates for
24 h. NM-scFv anti-Bcl-xL, NM-scFv control at 100 nM in siRNA were
then transfected in the similar conditions used in qPCR assays for a nal
volume of 600
μ
L/well. For non-treated cells or cells treated with
cisplatin alone (a gift from CHU Bretonneau Pharmacy, Tours, France),
abbreviated as CIS, the NM-scFv was replaced by the Opti-MEM me-
dium. At 24 h of incubation, 3.66
μ
L or 11
μ
L of CIS at 330
μ
M was added
into each well to obtain nal concentrations at 2
μ
M or 6
μ
M, respec-
tively. After 48 h of incubation, cells were harvested and washed twice
with PBS 1×buffer. Annexin V labelled with Alexa™488 and Propidium
Iodide (PI) were added according to the recommendation from the
manufacturer (Thermo Scientic™). Cells treated with free anti-Bcl-xL
siRNAs, NMs-scFv anti-Bcl-xL, or NMs-scFv control in the absence of
CIS were used as controls. The proportions of cells in early and late
apoptosis were obtained by acquisition of 10,000 cells with MACS-
Quant®10 ow cytometer (Miltenyi).
2.3.7. Cell viability assay
The IC
50
values of cisplatin in H460-Luc cells treated or non-treated
with NM-scFv were determined to evaluate chemotherapy efciency. To
this end, H460-Luc cells were seeded at 3 ×10
3
cells/well in 96-well
plates for 24 h. After 24 h, the transfection with anti-BcL-xL siRNAs
complexed in NM-scFv was performed in the same conditions of qPCR
assays but for a nal volume of 100
μ
L/well. For cells treated with CIS
alone, the NM-scFv was replaced with the Opti-MEM medium. At 24 h of
incubation, 6.5
μ
L of CIS at 3300
μ
M, 330
μ
M, 33
μ
M, 3.3
μ
M, 0.33
μ
M
and 1.96
μ
L of CIS at 330
μ
M and 33
μ
M was added into wells to obtain a
nal range of CIS concentrations of 200, 20, 6.33, 2, 0.633, 0.2, and
0.02
μ
M. The plate was incubated for another 48 h. After this incubation
time, 100
μ
L of the CellTiter-Glo® reagent (Promega, USA) was added in
each well and the luminescence assay was performed using a microplate
reader. By comparing the light emission of each sample to that of non-
treated cells, the percentage of live cells for each concentration of CIS
and in each condition was determined. The IC
50
values were subse-
quently calculated and the cell viability was statistically compared using
GraphPad Prism® v7 (GraphPad Software, San Diego, U.S.A). For
P.V. Nguyen et al.
International Journal of Pharmaceutics: X 4 (2022) 100139
4
negative and positive controls, the medium of H460-Luc cells and H
2
O
2
at 20 mM were used, respectively. Moreover, another cellular viability
test was performed in the same conditions with NM-scFv anti-Bcl-xL,
NM-scFv control, non-formulated siRNA anti-Bcl-xL, and NV-scFv and in
absence of CIS.
2.4. Statistics
Values were expressed as means ±standard deviations (SD). Dif-
ferences of cell viability between groups in cell viability assay were
compared using the Student's one-tailed t-test. The difference was
considered signicant when the obtained p-values were lower than 0.05.
All experiments were triplicated and the obtained data were treated with
the GraphPad Prism® v7 (GraphPad Software, San Diego, CA, U.S.A).
3. Results and discussion
3.1. Formulation and characterizations of NM-scFv anti-Bcl-xL
3.1.1. Formulation and physico-chemical characterizations
Our NM-scFv formulation was based on the complexation between
targeted nanovectors (NVs-scFv), anti-Bcl-xL siRNAs, and two cationic
polymers. This nanoformulation can be divided into two principal steps
including the synthesis of NVs-scFv and the complexation between these
nanovectors, the cationic polymers and anti-Bcl-xL siRNAs (Fig. 1.).
The synthesis of NVs and NVs-scFv was identical to that of our pre-
vious publication (Vinh Nguyen et al., 2020). As expected, the physico-
chemical properties of the obtained NV and NV-scFv (size around 75 nm
and slightly negatively charged around −2 mV) were comparable to
those previously described (Table SI 1). These results prove that the
synthesis pathway is highly reproducible, which sets a strong basis for
further scale-up.
Afterwards, the NVs and NVs-scFv were complexed with anti-Bcl-xL
siRNAs, chitosan and PLR using the optimized component ratios, which
had been obtained previously (Vinh Nguyen et al., 2020). Table 1
showed the colloidal properties of the NMs and the NMs-scFv anti-Bcl-
xL. All NMs and NMs-scFv were approximately 100 nm in size, with a
low polydispersity index (<0.3), and bare slightly positive charges.
These physico-chemical properties are suitable for intravenous injection
(IV) and similar to those of NMs or NMs-scFv formulated with control
siRNA, reecting a high reproducibility for our formulation with
different kinds of siRNAs (Vinh Nguyen et al., 2020). According to the
literature, current siRNA delivery systems using electrostatic forces are
usually challenged by the lack of reproducibility and a large size of the
nalized complex (Ben Djemaa et al., 2019). At this point, our NM-scFv
system presents several advantages including i) a good reproducibility
for several sequences of siRNAs and ii) a smaller size and a higher
monodispersity for IV administration. Taking a previous study of our
team with NMs functionalized with cell penetrating peptide (CPP) but
using similar components (SPIONs, chitosan, PLR and siRNA) as an
example, the obtained NMs had a larger size around 175 nm, a higher
PDi of 0.34 and +14.2 mV in charge (Ben Djemaa et al., 2018). In that
study, the component ratios were not similar (MR =10, CR =2, CS =
30), leading to another organization of the serval components. In
another study of Veiseh et al., the authors used SPIONs covered by
polyethylene glycol (PEG)-grafted with chitosan, and polyethylenimine
(PEI) to deliver siRNA into cancer cells. Despite the chemical conjuga-
tion used in that study, the nalized NMs had a bigger size (111.9 ±
52.4 nm) than that of our NM-scFv. Besides, the authors had to use a
double concentration in siRNA (around 200 nM) to obtain a comparable
GFP silencing efciency to that obtained with our NM-scFv (Veiseh
et al., 2010; Vinh Nguyen et al., 2020). These results demonstrate the
robustness and the high reproducibility level of our formulation in
comparison to other nanoplatforms described in the literature for siRNA
delivery in spite of their relatively weak electrostatic forces.
3.1.2. siRNA complexation capacity
One of the most challenging issues for the therapeutic applications of
siRNAs is their degradation by nucleases (Ben Djemaa et al., 2019).
Therefore, an efcient siRNA delivery system must be able to success-
fully protect siRNAs from nucleases. In a preliminary study, we
demonstarted that if siRNAs are fully complexed within our NMs, they
will be well protected from the degradation using ribonuclease A (Bru-
niaux et al., 2017). Therefore, in the current study, we rst studied the
complexation capacity between our NM-scFv and siRNAs using the
electrophoresis assay.
Fig. 1. Schematic representation of NM-scFv anti-Bcl-xL formulation.
Table 1
Physico-chemical properties of NMs and NMs-scFv for anti-Bcl-xL siRNA
delivery.
Batch D
H
(nm) PDi ζ (mV)
NM anti-Bcl-xL 99.0 ±2.5 0.27 ±0.004 +7.7 ±1.3
NM-scFv anti-Bcl-xL 104.3 ±2.9 0.25 ±0.003 +10.0 ±1.2
P.V. Nguyen et al.
International Journal of Pharmaceutics: X 4 (2022) 100139
5
In the case of the anti-Bcl-xL siRNA, since we planned to use the
siRNA dose at 100 nM and 2000 nM for further in vitro and in vivo studies
respectively, NMs and NMs-scFv anti-Bcl-xL were prepared at 2000 nM
for siRNA complexation tests. As shown in Fig. 2A, the gel agarose
electrophoresis was made for NMs and NMs-scFv anti-Bcl-xL with/
without added heparin. On one hand, without heparin addition, no
uorescent band of free siRNAs was detected for both NMs and NMs-
scFv anti-Bcl-xL. On the other hand, when heparin is added, the NMs
and NMs-scFv anti-Bcl-xL were destabilized and free siRNAs were
liberated. As a result, uorescent bands corresponding to liberated Bcl-
xL siRNAs at the same intensity as naked siRNAs were observed for both
NMs and NMs-scFv. All aforementioned results demonstrated that at the
siRNA dose of 2000 nM, siRNAs were successfully and completely
complexed in our NMs. In the literature, the application of cationic
polymers such as chitosan and PLR has been described to be able to
complex and protect efciently siRNAs. For instance, Kim et al. suc-
ceeded in formulating nanoparticles via electrostatic complexation be-
tween negatively-charged hyaluronic acid and cationic poly L-arginine
(PLR) and siRNAs. Those obtained NPs were showed to be stable in
several serum concentrations and possessed a bigger size than our NM-
scFv (Kim et al., 2009).
3.1.3. Targeting and internalization assay into H460-Luc cells
To conrm the active targeting property of anti-EGFR scFv ligands
grafted on NM-scFv, cellular uptake levels of NMs and NMs-scFv anti-
Bcl-xL into EGFR-overexpressing H460-Luc cells were compared after
24 h of incubation. As shown in Fig. 2B, by monitoring the uorescence
signal of Dylight™680 attached on the inorganic core of the nano-
vectors, a better internalization level by a factor of 1.5 (p <0.01) was
achieved for our targeted NMs-scFv in comparison to that of non-
targeted NMs, revealing the in vitro active targeting properties of our
nanoplatforms. In our previous publication for the same kind of NM-scFv
in triple negative breast cancer cells MDA-MB-231, a similar factor of
difference was observed (Vinh Nguyen et al., 2020). This observation is
really encouraging, as this strategy has been proven potential as a mean
to develop a novel nanomedicine able to simultaneously target several
kinds of cancers.
3.2. Transfection efciency of siRNA anti-Bcl-xL in NSCLC cells
3.2.1. Downregulation of Bcl-xL mRNA in cancer cells treated with NM-
scFv anti-Bcl-xL
To determine whether anti-Bcl-xL siRNAs were successfully deliv-
ered into cancer cells and exerted their activity, a Bcl-xL gene silencing
experiment in H460-Luc cells with NMs and NMs-scFv anti-Bcl-xL was
performed. The non-targeted and targeted NMs anti-Bcl-xL were incu-
bated with H460 cells for 24 h. After 24 h of transfection, the quanti-
tative PCR (qPCR) technique was used to evaluate the gene silencing
effect performed by our NM-scFv and NM anti-Bcl-xL at the mRNA level.
To this end, the normalized relative gene expression values of Bcl-xL
gene in H460-Luc cells treated with NMs and NMs-scFv anti-Bcl-xL
were determined.
As shown in Fig. 3A, our positive control, Lipofectamine, exerted a
near perfect gene silencing effect compared to the non-treated cells.
Both NMs and NMs-scFv showed a Bcl-xL gene knockdown activity. This
result revealed that anti-Bcl-xL siRNAs loaded in either NMs or NMs-
scFv were able to cross the membrane barriers, got access to the cyto-
plasm and performed their interfering activity on the target mRNAs.
However, a greater gene silencing activity by a factor of 1.9 was ob-
tained for NMs-scFv compared to NMs (p <0.01), which conrmed the
benet of using anti-EGFR scFv ligands as targeting moieties. In addi-
tion, our NMs-scFv have been proven appropriate for IV administration,
whereas available commercialized transfection reagents including Lip-
ofectamine are not (Vinh Nguyen et al., 2020). Moreover, the treatment
with Lipofectamine was traumatic for the cells, as reected by abnormal
cellular morphology visible under microscope observation after the in-
cubation, whereas such phenomenon was not observed in the case of
H460 cells treated with our NM-scFv.
3.2.2. Downregulation of Bcl-xL protein in H460 cells treated with NM-
scFv anti-Bcl-xL
At the protein level, Western blot analysis was performed at 48 h
after transfection to evaluate the transfection efciency of our NMs.
Fig. 3B illustrates the expression of Bcl-xL protein in H460-Luc cancer
cells induced by NMs, NMs-scFv, and Lipofectamine as positive control.
A better downregulation activity by a factor of 1.7 was achieved for
NMs-scFv compared to NMs. As expected, this transfection efciency is
lower than that of the positive control (62.8% vs 84.9%). Nevertheless,
our NM-scFv has earned its place among the most effective siRNA
Fig. 2. A) Gel agarose electrophoresis assay to detect free anti-Bcl-xL siRNA in NM and NM-scFv with (+) or without (−) heparin. B) Dylight™680 uorescence
signal of H460-Luc cells non-treated or treated with NM anti-Bcl-xL and NM-scFv anti-Bcl-xL after 24 h of contact. All experiments were in triplicate, and one
representative experiment is presented.
P.V. Nguyen et al.
International Journal of Pharmaceutics: X 4 (2022) 100139
6
nanovectors whose transfection efciency varies from 60% to 88% (Ben
Djemaa et al., 2019). In our previous study, a transfection efciency of
around 68% was obtained in triple negative breast cancer cell-line
(MDA-MB-231) with a model anti-GFP siRNA (Vinh Nguyen et al.,
2020). In these studies, there is a difference in the nature and localiza-
tion of the target proteins. The GFP gene is articially introduced into
MDA-MB-231 cells and are located in the cell cytoplasm, whereas the
Bcl-xL one is mainly present on the outer membrane of mitochondria
even if it also present in the cytosol, endoplasmic reticulum and nucleus
(Popgeorgiev et al., 2018). As a result, the transfection of anti-Bcl-xL
siRNAs are theoretically much more difcult than that of GFP. For
example, by using a nanocomplex made of dendrimers functionalized
with aptamers as targeting moieties for the delivery of anti-Bcl-xL
shRNA, Ayatollahi et al. obtained a reduction of 55% in Bcl-xL expres-
sion (Ayatollahi et al., 2017). In another study of Taghavi et al. using
targeted carbon nanotubes, a gene silencing effect for Bcl-xL gene of
around 41.7% was achieved (Taghavi et al., 2016). In our case, a com-
parable gene knockdown activity was obtained with our NM-scFv for a
new kind of cancer cell-line and a therapeutic siRNA. This result high-
lights clearly the interest of our nanosystem in the delivery of different
kinds of siRNAs. Consequently, this potency may be useful to target
simultaneously different cancer-associated genes in regardless of their
localization in cancer cells.
3.3. Synergistic activity of NM-scFv anti-Bcl-xL and cisplatin
In the literature, the downregulation of the Bcl-xL protein was
proven useful when it comes to enhance chemotherapy efciency in
various kinds of cancer including the NSCLC (Andriani et al., 2006; Lei
et al., 2007). As the inhibitory activity of our NMs-scFv anti-Bcl-xL was
Fig. 3. Bcl-xL mRNA (A) and Bcl-xL protein (B) expression determined by qPCR after 24 h and by Western Blot after 48 h, respectiveley in H460-Luc cells treated
with Lipofectamine™RNAimax, NM anti-Bcl-xL or NM-scFv anti-Bcl-xL. Results are the mean values ±SD of three separate experiments.
Fig. 4. Apoptosis assay using ow cytometry after staining with annexin V-FITC/propidium iodide (PI). H460 cells were treated with NM-scFv control or NM-scFv
anti-Bcl-xL with/without cisplatin. A) Cells were classied as healthy cells (Annexin V−, PI−), early apoptotic cells (Annexin V+, PI−), late apoptotic cells (Annexin
V+, PI+), and damaged cells (Annexin V−, PI+). B) Percentage of H460 cells in early and late apoptosis among different treatment options. This experiment was in
duplicate and one representative experiment is presented.
P.V. Nguyen et al.
International Journal of Pharmaceutics: X 4 (2022) 100139
7
proven for H460 cells, their therapeutic activity, especially their syn-
ergistic activity with chemotherapeutic agents, were evaluated in the
current study. To this aim, the apoptotic and cytotoxic activity of
cisplatin (CIS), an anticancer medication normally used as the mainstay
for NSCLC treatment, was evaluated in H460-Luc cells, treated either
with the combination of our NM-scFv anti-Bcl-xL and CIS or with CIS
alone.
3.3.1. Apoptosis assay
Firstly, an apoptosis assay was carried out to determine whether our
NM-scFv anti-Bcl-xL can enhance the apoptotic activity of cisplatin
(Fig. 4). As shown in the Fig. 4, in absence of cisplatin, all negative
controls with NM-scFv anti-Bcl-xl or NM-scFv control did not show any
impact on the H460-Luc cells' apoptosis. The cancer cells treated with
these formulations presented a negligible proportion of cells entering in
the early or in the late apoptosis (around 1%). When cisplatin was
added, at both concentrations of 2
μ
M or 6
μ
M, a remarkable increase in
the cellular population in early apoptosis and in late apoptosis was
achieved for the combination of NM-scFv anti-Bcl-xL +cisplatin
compared to the use of cisplatin alone (an increase by a factor of 1.7 and
1.3 at 2
μ
M and a factor of 1.45 and 1.1 at 6
μ
M, respectively). In
addition, at both concentrations of cisplatin, the combination of control
NM-scFv formulated with scramble siRNA and cisplatin did not show
any impact in the percentage of cells entering in apoptosis, compared to
CIS alone. Especially, the apoptotic activity, as mainly reected by the
percentage of cancer cells in early apoptosis, of the combination NM-
scFv anti-Bcl-xL +cisplatin at 2
μ
M was found to be comparable to
that of the monotherapy of cisplatin at 6
μ
M (11.4% vs 12.3%, respec-
tively). All these results revealed that: i) without the chemotherapy
agent, the NM-scFv anti-Bcl-xL does not have any impact on the
apoptosis process of H460-Luc cancer cells in the present treatment
scheme, ii) there is a synergistic activity between NM-scFv anti-Bcl-xL +
cisplatin that helped to improve the apoptotic or therapeutic activity of
this anticancer agent, and iii) the addition of our NM-scFv anti-Bcl-xL in
the treatment may help to reduce the CIS dose by a factor of three and is
certainly helpful to reduce both its side effects and the emergence of
drug resistance.
3.3.2. Cellular viability test
To better conrm the synergistic activity between our NM-scFv anti-
Bcl-xL and cisplatin, a cellular viability test was carried out in H460 cells
treated with different NMs-scFv (anti-Bcl-xL or control), non-formulated
siRNA anti-Bcl-xL or NVs-scFv. As shown in Fig. 5, no cytotoxicity was
observed for H460 cells treated with these formulations, reecting that
at the tested concentration of 100 nM in siRNA (13.3 g of iron/L), none
of these nanoparticles have an impact on the viability of this cancer cell
line. Nevertheless, the IC
50
value of H460-cells treated with NMs-scFv
anti-Bcl-xL siRNA +CIS was effectively and signicantly reduced in
comparison to those treated with NMs-scFv control +CIS, or CIS alone
(0.68 ±0.12
μ
M vs 3.11 ±0.17
μ
M and 2.2 ±0.18
μ
M, respectively). In
comparison to the study of Lopez-Ayllon et al., the IC
50
value of CIS for
H460 cells was determined to be 1.02
μ
M, which is lower than that in
our study. This difference is probably due to the time dependent activity
of CIS. Indeed, Lopez-Ayllon et al. incubated CIS on the cancer cells for
72 h, whereas it was reduced to 48 h in our study (Lopez-Ayllon et al.,
2014). Besides, statistical analysis showed that the cellular viability for
the cells treated with NMs-scFv anti-Bcl-xL +CIS was signicantly lower
than that corresponding to single treatment with CIS (p <0.01) and
NMs-scFv control +CIS (p <0.01), while no signicant difference in the
survival rate was obtained between control NMs-scFv +CIS and CIS
alone (p >0.05).
These results indicate clearly that the Bcl-xL protein downregulation
induced by our NM-scFv anti-Bcl-xL provides a synergistic effect with
CIS, in enhancing its cytotoxic activity on H460 cells. The same phe-
nomenon has been also observed in the literature, as the use of gene
therapy to down-regulate anti-apoptotic proteins such as Bcl-2 or Bcl-xL
were useful to improve the therapeutic activity of different chemo-
therapeutic drugs in a broad range of tumors (Cao et al., 2007; Kim et al.,
2004). For example, in a study of Lei et al., the authors showed that the
suppression of Bcl-xL led to a greater growth inhibition of another kind
of CIS-resistant lung cancer (A549) cells that demonstrated also the
perspective of this strategy (Lei et al., 2007). In another study of Mu
et al., the combination of anti-Bcl-xL siRNAs and cisplatin resulted also
in a better anticancer activity at in vivo level than the monotherapy of
cisplatin in prostate cancer (Mu et al., 2009). Besides, the synergistic
activity of the combination between other anticancer agents such as
doxorubicin and anti-Bcl-xL interfering RNA has been also conrmed
(Ebrahimian et al., 2017). One of the most outstanding example was that
of Taghavi et al., the authors used targeted carbon nanotubes modied
with branched PEI-PEG and aptamers as a vehicle for shRNA delivery in
gastric cancer. A reduction of 58.9% in Bcl-xL expression was obtained
in cells treated with the targeted nanoparticles. Astonishingly, in com-
bination with doxorubicin, a remarkable synergistic activity was clearly
demonstrated, as reected by a remarkable reduction in IC
50
value by a
factor of 58 in cancer cells treated with the targeted NPs in comparison
to that of cells treated with free drug (Taghavi et al., 2016). In another
study of Kim et al., the authors used PEI-PEG nanoparticles functional-
ized with aptamers as active targeting for the co-delivery of anti-Bcl-xL
shRNAs and doxorubicin. Interestingly, the authors demonstrated that
IC
50
values of such targeted nanoparticles were approximately 17-fold
less than those for the mixture of shRNA delivered by lipofectamine
and free drug, highlighting the benet of co-encapsulate anti-cancer
drugs and iRNAs within a nanosystem (Kim et al., 2010). Therefore, the
encapsulation of an anticancer agent is scheduled for the next step of the
current study that may help to better improve the anticancer activity of
our targeted NM-scFv.
Furthermore, in some kinds of tumors such as bone cancer, the in-
hibition of Bcl-xL protein was shown to be more effective to enhance the
Fig. 5. A) Viability of H460 cells treated with NM-scFv, NV-scFv and non-formulated siRNA at 100 nM in siRNA (13.3 g of iron/L); B) Viability of H460-Luc cells
treated with different concentrations of cisplatin (CIS) alone or in combination with NM-scFv anti-Bcl-xL siRNA or NM-scFv control for 48 h of incubation. Results are
the mean values ±SD of three separate experiments.
P.V. Nguyen et al.
International Journal of Pharmaceutics: X 4 (2022) 100139
8
efciency of chemotherapy than that of Bcl-2 (de Jong et al., 2018). In
lung cancer, a study of Leech et al. showed that the treatment of NSCLC
cells (A549 cells) with anti-Bcl-xL antisense oligodesoxynucleotides at
600 nM that inhibited from 70% to 90% Bcl-xL expression, had an
effective apoptotic activity. In contrast, the same treatment did not show
any effect on the apoptosis of small cells lung cancer cells (Leech et al.,
2000). These ndings reveal that the Bcl-xL inhibition with siRNAs is a
specic treatment for the NSCLC. All together, these observations sug-
gest that the role of each member of the Bcl-2 family in each kind of
cancer needs to be claried and the choice of appropriate target proteins
is a prerequisite to the treatment success. In our case, thanks to the
exibility in the choice of siRNAs, our nanoformulation is suitable for
different kinds of siRNAs and therefore can be used to target different
(onco)proteins. In particular, a mix of different siRNAs to target simul-
taneously different (onco)proteins may be achieved with our
nanosystem.
In addition, the synergistic activity between our NM-scFv anti-Bcl-xL
and chemotherapy agents may contribute also to the ght against the
emergence of resistance by reducing the administration dose of these
anticancer agents. Indeed, several studies have revealed that the Bcl-xL
overexpression is a frequent phenomenon in cancer and strictly related
to the chemoresistance of the NSCLC (Andriani et al., 2006; Lu et al.,
2021). Consequently, a new strategy to better exploit the Bcl-xL gene
therapy was introduced in this study and might be a potential solution to
reduce the CIS dose used in clinical. Especially, in the case of patients
with severe side effects caused by CIS, a lower necessary dose can help to
improve both drug effectiveness and tolerance. For further studies, the
potential of our NM-scFv formulated with Bcl-xL siRNAs in CIS-resistant
cancer cells will be evaluated both in vitro and in vivo.
4. Conclusion
In the frame of this study, a targeted nanomedicine with anti-EGFR
scFv moieties was applied for the active delivery of anti-Bcl-xL siRNA
into NSCLC cells. The obtained results demonstrate that our NM-scFv
anti-Bcl-xL was suitable for IV administration in terms of physico-
chemical properties, providing complete complexation with the
formulated siRNA, then delivered them actively and efciently into their
active site. Consequently, much greater downregulation of the target
gene (Bcl-xL) was achieved in cancer cells treated with our functional-
ized NM-scFv than in those with the non-functionalized NM, which was
conrmed both at the mRNA and protein levels. Ultimately, the syner-
gistic activity of our NM-scFv anti-Bcl-xL in combination with cisplatin
was proven in vitro in NSCLC H460 cells, as reected by an enhancement
in its apoptotic and cytotoxic activity with a signicant reduction by a
factor of three in the IC
50
value of the combination compared to that of
the solitary CIS treatment. Furthermore, the high level of reproducibility
of this nanoformulation and the capacity of actively targeting a broad
range of EGFR-positive cancers are proofs of its potential for in vivo and
clinical translation in an attempt to reduce the necessary dose of
chemotherapy in cancer treatment.
CRediT authorship contribution statement
Phuoc Vinh Nguyen: Conceptualization, Investigation, Writing –
original draft. Katel Herv´
e-Aubert: Conceptualization, Funding acqui-
sition, Writing – review & editing, Supervision. Laurie Lajoie: Investi-
gation, Writing – review & editing. Yoann Misericordia: Investigation,
Writing – review & editing. Igor Chourpa: Project administration,
Writing – review & editing. St´
ephanie David: Investigation, Writing –
review & editing. Emilie Allard-Vannier: Conceptualization, Funding
acquisition, Writing – review & editing, Supervision.
Declaration of Competing Interest
The authors declare that they have no conict of interest.
Data availability
The authors do not have permission to share data.
Acknowledgments
The authors would like to thank Dr Nicolas Aubrey and Fanny
Boursin (team BioMAP, INRAE 1282, Tours University) for scFv pro-
duction and characterization. This work was supported by the ‘Can-
c´
eropˆ
ole Grand Ouest’ and especially by the Emergence CGO 2019
NANOTIF project. This work was also supported by the French National
Research Agency under the program “Investissements d'avenir” Grant
Agreement LabEx MAbImprove (ANR-10-LABX-53-01).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.ijpx.2022.100139.
References
Alexander, M., Kim, S.Y., Cheng, H., 2020. Update 2020: Management of Non-Small Cell
Lung Cancer. Lung 198, 897–907. https://doi.org/10.1007/s00408-020-00407-5.
Andriani, F., Perego, P., Carenini, N., Sozzi, G., Roz, L., 2006. Increased Sensitivity to
Cisplatin in Non-Small Cell Lung Cancer Cell Lines after FHIT Gene transfer.
Neoplasia 8, 9–17. https://doi.org/10.1593/neo.05517.
Ayatollahi, S., Salmasi, Z., Hashemi, M., Askarian, S., Oskuee, R.K., Abnous, K.,
Ramezani, M., 2017. Aptamer-targeted delivery of Bcl-xL shRNA using alkyl
modied PAMAM dendrimers into lung cancer cells. Int. J. Biochem. Cell Biol. 92,
210–217. https://doi.org/10.1016/j.biocel.2017.10.005.
Bade, B.C., Dela Cruz, C.S., 2020. Lung Cancer 2020. Clin. Chest Med. 41, 1–24. https://
doi.org/10.1016/j.ccm.2019.10.001.
Ben Djemaa, S., David, S., Herv´
e-Aubert, K., Falanga, A., Galdiero, S., Allard-Vannier, E.,
Chourpa, I., Munnier, E., 2018. Formulation and in vitro evaluation of a siRNA
delivery nanosystem decorated with gH625 peptide for triple negative breast cancer
theranosis. Eur. J. Pharm. Biopharm. Off. J. Arbeitsgemeinschaft Pharm.
Verfahrenstechnik EV 131, 99–108. https://doi.org/10.1016/j.ejpb.2018.07.024.
Ben Djemaa, S., Munnier, E., Chourpa, I., Allard-Vannier, E., David, S., 2019. Versatile
electrostatically assembled polymeric siRNA nanovectors: can they overcome the
limits of siRNA tumor delivery? Int. J. Pharm. 567, 118432 https://doi.org/
10.1016/j.ijpharm.2019.06.023.
Bruniaux, J., Djemaa, S.B., Herv´
e-Aubert, K., Marchais, H., Chourpa, I., David, S., 2017.
Stealth magnetic nanocarriers of siRNA as platform for breast cancer theranostics.
Int. J. Pharm. 532, 660–668. https://doi.org/10.1016/j.ijpharm.2017.05.022.
Bustin, S.A., 2004. A-Z of Quantitative PCR. International University Line, La Jolla, CA.
Cao, X., Rodarte, C., Zhang, L., Morgan, C.D., Littlejohn, J., Smythe, W.R., 2007. Bcl2/
bcl-xl inhibitor engenders apoptosis and increases chemo-sensitivity in
mesothelioma. Cancer Biol. Ther. 6, 246–252. https://doi.org/10.4161/
cbt.6.2.3626.
de Jong, Y., Monderer, D., Brandinelli, E., Monchanin, M., van den Akker, B.E., van
Oosterwijk, J.G., Blay, J.Y., Dutour, A., Bov´
ee, J.V.M.G., 2018. Bcl-xl as the most
promising Bcl-2 family member in targeted treatment of chondrosarcoma.
Oncogenesis 7, 74. https://doi.org/10.1038/s41389-018-0084-0.
Dhomen, N.S., Mariadason, J., Tebbutt, N., Scott, A.M., 2012. Therapeutic Targeting of
the Epidermal Growth factor Receptor in Human Cancer. Crit. Rev. Oncog. 17,
31–50. https://doi.org/10.1615/CritRevOncog.v17.i1.40.
Duma, N., Santana-Davila, R., Molina, J.R., 2019. Non–small cell lung cancer:
epidemiology, screening, diagnosis, and treatment. Mayo Clin. Proc. 94, 1623–1640.
https://doi.org/10.1016/j.mayocp.2019.01.013.
Ebrahimian, M., Taghavi, S., Mokhtarzadeh, A., Ramezani, M., Hashemi, M., 2017. Co-
delivery of Doxorubicin Encapsulated PLGA Nanoparticles and Bcl-xL shRNA using
Alkyl-Modied PEI into Breast Cancer Cells. Appl. Biochem. Biotechnol. 183,
126–136. https://doi.org/10.1007/s12010-017-2434-3.
Ferlay, J., Colombet, M., Soerjomataram, I., Parkin, D.M., Pi˜
neros, M., Znaor, A., Bray, F.,
2021. Cancer statistics for the year 2020: an overview. Int. J. Cancer 149, 778–789.
https://doi.org/10.1002/ijc.33588.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C.C., 1998. Potent
and specic genetic interference by double-stranded RNA in Caenorhabditis elegans.
Nature 391, 806–811. https://doi.org/10.1038/35888.
Herbst, R.S., Morgensztern, D., Boshoff, C., 2018. The biology and management of non-
small cell lung cancer. Nature 553, 446–454. https://doi.org/10.1038/nature25183.
Huang, Z., Lei, X., Zhong, M., Zhu, B., Tang, S., Liao, D., 2007. Bcl-2 small interfering
RNA sensitizes cisplatin-resistant human lung adenocarcinoma A549/DDP cell to
cisplatin and diallyl disulde. Acta Biochim. Biophys. Sin. 39, 835–843. https://doi.
org/10.1111/j.1745-7270.2007.00356.x.
Kim, E.S., 2016. Chemotherapy Resistance in Lung Cancer. In: Ahmad, A., Gadgeel, S.
(Eds.), Lung Cancer and Personalized Medicine, Advances in Experimental Medicine
and Biology. Springer International Publishing, Cham, pp. 189–209. https://doi.org/
10.1007/978-3-319-24223-1_10.
P.V. Nguyen et al.
International Journal of Pharmaceutics: X 4 (2022) 100139
9
Kim, R., Emi, M., Tanabe, K., Toge, T., 2004. Therapeutic potential of antisense Bcl-2 as a
chemosensitizer for cancer therapy. Cancer 101, 2491–2502. https://doi.org/
10.1002/cncr.20696.
Kim, E.-J., Shim, G., Kim, K., Kwon, I.C., Oh, Y.-K., Shim, C.-K., 2009. Hyaluronic acid
complexed to biodegradable poly L-arginine for targeted delivery of siRNAs. J. Gene
Med. 11, 791–803. https://doi.org/10.1002/jgm.1352.
Kim, E., Jung, Y., Choi, H., Yang, J., Suh, J.-S., Huh, Y.-M., Kim, K., Haam, S., 2010.
Prostate cancer cell death produced by the co-delivery of Bcl-xL shRNA and
doxorubicin using an aptamer-conjugated polyplex. Biomaterials 31, 4592–4599.
https://doi.org/10.1016/j.biomaterials.2010.02.030.
Leech, S.H., Olie, R.A., Gautschi, O., Simes-Wst, A.P., Tschopp, S., Hner, R., Hall, J.,
Stahel, R.A., Zangemeister-Wittke, U., 2000. Induction of apoptosis in lung-cancer
cells followingbcl-xL anti-sense treatment. Int. J. Cancer 86, 570–576. https://doi.
org/10.1002/(SICI)1097-0215(20000515)86:4<570::AID-IJC20>3.0.CO;2-T.
Lei, X., Huang, Z., Zhong, M., Zhu, B., Tang, S., Liao, D., 2007. Bcl-XL small interfering
RNA sensitizes cisplatin-resistant human lung adenocarcinoma cells. Acta Biochim.
Biophys. Sin. 39, 344–350. https://doi.org/10.1111/j.1745-7270.2007.00286.x.
Liang, Z., Zhang, J., Zeng, X., Gao, J., Wu, S., Liu, T., 2010. Relationship between EGFR
expression, copy number and mutation in lung adenocarcinomas. BMC Cancer 10,
376. https://doi.org/10.1186/1471-2407-10-376.
Lochmatter, D., Mullis, P.E., 2011. RNA interference in mammalian cell systems. Horm.
Res. Paediatr. 75, 63–69. https://doi.org/10.1159/000322817.
Lopez-Ayllon, B.D., Moncho-Amor, V., Abarrategi, A., C´
aceres, I.I., Castro-Carpe˜
no, J.,
Belda-Iniesta, C., Perona, R., Sastre, L., 2014. Cancer stem cells and cisplatin-
resistant cells isolated from non-small-lung cancer cell lines constitute related cell
populations. Cancer Med. 3, 1099–1111. https://doi.org/10.1002/cam4.291.
Lu, Y., Bian, D., Zhang, X., Zhang, H., Zhu, Z., 2021. Inhibition of Bcl-2 and Bcl-xL
overcomes the resistance to the third-generation EGFR tyrosine kinase inhibitor
osimertinib in non-small cell lung cancer. Mol. Med. Rep. 23 (1), 48 https://doi.org/
10.3892/mmr.2020.11686.
Mansour, A.M., Abdelrahim, M., Laymon, M., Elsherbeeny, M., Sultan, M., Shokeir, A.,
Mosbah, A., Abol-Enein, H., Awadalla, A., Cho, E., Sairam, V., Park, T.D., Shahid, M.,
Kim, J., 2018. Epidermal growth factor expression as a predictor of
chemotherapeutic resistance in muscle-invasive bladder cancer. BMC Urol. 18, 100.
https://doi.org/10.1186/s12894-018-0413-9.
Min, H.-Y., Lee, H.-Y., 2021. Mechanisms of resistance to chemotherapy in non-small cell
lung cancer. Arch. Pharm. Res. 44, 146–164. https://doi.org/10.1007/s12272-021-
01312-y.
Mirzaei, S., Gholami, M.H., Hashemi, F., Zabolian, A., Hushmandi, K., Rahmanian, V.,
Entezari, M., Girish, Y.R., Sharath Kumar, K.S., Aref, A.R., Makvandi, P.,
Ashrazadeh, M., Zarrabi, A., Khan, H., 2021a. Employing siRNA tool and its
delivery platforms in suppressing cisplatin resistance: Approaching to a new era of
cancer chemotherapy. Life Sci. 277, 119430 https://doi.org/10.1016/j.
lfs.2021.119430.
Mirzaei, S., Mahabady, M.K., Zabolian, A., Abbaspour, A., Fallahzadeh, P., Noori, M.,
Hashemi, F., Hushmandi, K., Daneshi, S., Kumar, A.P., Aref, A.R., Samarghandian, S.,
Makvandi, P., Khan, H., Hamblin, M.R., Ashrazadeh, M., Zarrabi, A., 2021b. Small
interfering RNA (siRNA) to target genes and molecular pathways in glioblastoma
therapy: current status with an emphasis on delivery systems. Life Sci. 275, 119368
https://doi.org/10.1016/j.lfs.2021.119368.
Mu, P., Nagahara, S., Makita, N., Tarumi, Y., Kadomatsu, K., Takei, Y., 2009. Systemic
delivery of siRNA specic to tumor mediated by atelocollagen: combined therapy
using siRNA targeting Bcl-xL and cisplatin against prostate cancer. Int. J. Cancer
125, 2978–2990. https://doi.org/10.1002/ijc.24382.
Osmani, L., Askin, F., Gabrielson, E., Li, Q.K., 2018. Current WHO guidelines and the
critical role of immunohistochemical markers in the subclassication of non-small
cell lung carcinoma (NSCLC): moving from targeted therapy to immunotherapy.
Semin. Cancer Biol. 52, 103–109. https://doi.org/10.1016/j.
semcancer.2017.11.019.
Popgeorgiev, N., Jabbour, L., Gillet, G., 2018. Subcellular Localization and Dynamics of
the Bcl-2 Family of Proteins. Front. Cell Dev. Biol. 6, 13. https://doi.org/10.3389/
fcell.2018.00013.
Salimath, S., Jayaraj, B.S., Mahesh, P.A., 2015. Epidermal growth factor receptor (EGFR)
expression in non-small cell lung carcinoma (NSCLC) and survival. In: 11.1 Lung
Cancer. Presented at the Annual Congress 2015. European Respiratory Society,
p. PA4255. https://doi.org/10.1183/13993003.congress-2015.PA4255.
Singh, A., Trivedi, P., Jain, N.K., 2018. Advances in siRNA delivery in cancer therapy.
Artif. Cells Nanomed. Biotechnol. 46, 274–283. https://doi.org/10.1080/
21691401.2017.1307210.
Sosa Iglesias, V., Giuranno, L., Dubois, L.J., Theys, J., Vooijs, M., 2018. Drug Resistance
in Non-Small Cell Lung Cancer: a potential for NOTCH Targeting? Front. Oncol. 8,
267. https://doi.org/10.3389/fonc.2018.00267.
Subhan, M.A., Torchilin, V.P., 2019. Efcient nanocarriers of siRNA therapeutics for
cancer treatment. Transl. Res. 214, 62–91. https://doi.org/10.1016/j.
trsl.2019.07.006.
ˇ
Suti´
c, M., Vuki´
c, A., Baranaˇ
si´
c, J., F¨
orsti, A., Dˇ
zubur, F., Samarˇ
zija, M., Jakopovi´
c, M.,
Brˇ
ci´
c, L., Kneˇ
zevi´
c, J., 2021. Diagnostic, predictive, and prognostic biomarkers in
non-small cell lung cancer (NSCLC) management. J. Pers. Med. 11, 1102. https://
doi.org/10.3390/jpm11111102.
Taghavi, S., HashemNia, A., Mosaffa, F., Askarian, S., Abnous, K., Ramezani, M., 2016.
Preparation and evaluation of polyethylenimine-functionalized carbon nanotubes
tagged with 5TR1 aptamer for targeted delivery of Bcl-xL shRNA into breast cancer
cells. Colloids Surf. B: Biointerfaces 140, 28–39. https://doi.org/10.1016/j.
colsurfb.2015.12.021.
Tan, X., Lambert, P.F., Rapraeger, A.C., Anderson, R.A., 2016. Stress-Induced EGFR
trafcking: Mechanisms, Functions, and Therapeutic Implications. Trends Cell Biol.
26, 352–366. https://doi.org/10.1016/j.tcb.2015.12.006.
Van den Eynde, M., Baurain, J.F., Mazzeo, F., Machiels, J.P., 2011. Epidermal growth
factor receptor targeted therapies for solid tumours. Acta Clin. Belg. 66, 10–17.
https://doi.org/10.2143/ACB.66.1.2062508.
Veiseh, O., Kievit, F.M., Fang, C., Mu, N., Jana, S., Leung, M.C., Mok, H., Ellenbogen, R.
G., Park, J.O., Zhang, M., 2010. Chlorotoxin bound magnetic nanovector tailored for
cancer cell targeting, imaging, and siRNA delivery. Biomaterials 31, 8032–8042.
https://doi.org/10.1016/j.biomaterials.2010.07.016.
Vinh Nguyen, P., Herv´
e-Aubert, K., David, S., Lautram, N., Passirani, C., Chourpa, I.,
Aubrey, N., Allard-Vannier, E., 2020. Targeted nanomedicine with anti-EGFR scFv
for siRNA delivery into triple negative breast cancer cells. Eur. J. Pharm. Biopharm.
S0939641120303040 https://doi.org/10.1016/j.ejpb.2020.10.004.
Vinh Nguyen, P., Allard-Vannier, E., Chourpa, I., Herv´
e-Aubert, K., 2021. Nanomedicines
functionalized with anti-EGFR ligands for active targeting in cancer therapy:
biological strategy, design and quality control. Int. J. Pharm. 120795 https://doi.
org/10.1016/j.ijpharm.2021.120795.
Zhang, Z., Jin, F., Lian, X., Li, M., Wang, G., Lan, B., He, H., Liu, G.-D., Wu, Y., Sun, G.,
Xu, C.-X., Yang, Z.-Z., 2018. Genistein promotes ionizing radiation-induced cell
death by reducing cytoplasmic Bcl-xL levels in non-small cell lung cancer. Sci. Rep.
8, 328. https://doi.org/10.1038/s41598-017-18755-3.
P.V. Nguyen et al.
