Available via license: CC BY 4.0
Content may be subject to copyright.
RESEARCH ARTICLE
Genetic associations with resistance to
Meloidogyne enterolobii in guava (Psidium sp.)
using cross-genera SNPs and comparative
genomics to Eucalyptus highlight evolutionary
conservation across the Myrtaceae
Carlos Antonio Fernandes Santos
1☯
, Soniane Rodrigues da Costa
2☯
, Leonardo Silva
Boiteux
3
, Dario GrattapagliaID
4
*, Orzenil Bonfim Silva-JuniorID
4☯
1Embrapa Semi-Arid, Petrolina, Pernambuco, Brazil, 2Graduate program in Genetic Resources,
Universidade Estadual de Feira de Santana, Feira de Santana, Bahia, Brazil, 3Embrapa Vegetable Crops
(CNPH), Brasilia, Distrito Federal, Brazil, 4Embrapa Genetic Resources and Biotechnology (CENARGEN),
Brası
´lia, Distrito Federal, Brazil
☯These authors contributed equally to this work.
*dario.grattapaglia@embrapa.br
Abstract
Tropical fruit tree species constitute a yet untapped supply of outstanding diversity of taste
and nutritional value, barely developed from the genetics standpoint, with scarce or no geno-
mic resources to tackle the challenges arising in modern breeding practice. We generated a
de novo genome assembly of the Psidium guajava, the super fruit “apple of the tropics”, and
successfully transferred 14,268 SNP probesets from Eucalyptus to Psidium at the nucleo-
tide level, to detect genomic loci linked to resistance to the root knot nematode (RKN) Meloi-
dogyne enterolobii derived from the wild relative P.guineense. Significantly associated loci
with resistance across alternative analytical frameworks, were detected at two SNPs on
chromosome 3 in a pseudo-assembly of Psidium guajava genome built using a syntenic
path approach with the Eucalyptus grandis genome to determine the order and orientation
of the contigs. The P.guineense-derived resistance response to RKN and disease onset is
conceivably triggered by mineral nutrients and phytohormone homeostasis or signaling with
the involvement of the miRNA pathway. Hotspots of mapped resistance quantitative trait
loci and functional annotation in the same genomic region of Eucalyptus provide further indi-
rect support to our results, highlighting the evolutionary conservation of genomes across
genera of Myrtaceae in the adaptation to pathogens. Marker assisted introgression of the
resistance loci mapped should accelerate the development of improved guava cultivars and
hybrid rootstocks.
PLOS ONE
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 1 / 20
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Fernandes Santos CA, Rodrigues da
Costa S, Silva Boiteux L, Grattapaglia D, Silva-
Junior OB (2022) Genetic associations with
resistance to Meloidogyne enterolobii in guava
(Psidium sp.) using cross-genera SNPs and
comparative genomics to Eucalyptus highlight
evolutionary conservation across the Myrtaceae.
PLoS ONE 17(11): e0273959. https://doi.org/
10.1371/journal.pone.0273959
Editor: Zhenhai Han, Institute for Horticultural
Plants, China Agricultural University, CHINA
Received: August 17, 2022
Accepted: October 14, 2022
Published: November 2, 2022
Peer Review History: PLOS recognizes the
benefits of transparency in the peer review
process; therefore, we enable the publication of
all of the content of peer review and author
responses alongside final, published articles. The
editorial history of this article is available here:
https://doi.org/10.1371/journal.pone.0273959
Copyright: ©2022 Fernandes Santos et al. This is
an open access article distributed under the terms
of the Creative Commons Attribution License,
which permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Introduction
Among the economically important species of family Myrtaceae, and within the large group
encompassing ~3,500 fleshy fruit species in the family [1] the guava (Psidium guajava L.)
stands out as the most commercially relevant crop [2]. Native to tropical America and widely
distributed in subtropical and tropical countries, guava is frequently referred to as a super fruit
due to its high polyphenolic and multivitamin content with important ethnopharmacological
properties [3,4]. Notwithstanding its recognized nutraceutical value, the estimated worldwide
annual production in 2018 was only 6.75 million tons [5], just a fraction of the 129.6 million
tons of apple, for example [6]. Guava still experiences the status of a very large number of
mostly unknown tropical fruits of outstanding taste and nutritional value that are either undo-
mesticated or mostly unexploited from the genetics, genomics and breeding standpoint.
Despite the availability of extensive genetic variation in the genus Psidium, the genetic basis
of current guava cultivars is narrow, resulting in significant susceptibility to some diseases [7].
Following the first report of its occurrence in guava in Brazil [8], the root-know nematode
(RKN) Meloidogyne enterolobii is currently the most economically important pathogen of
guava in the Neotropics [9,10]. Meloidogyne enterolobii (= M.mayaguensis) is a highly polyph-
agous species with a host range similar to that of the two major RKN species, M.incognita and
M.javanica [11]. However, M.enterolobii is a greater agricultural threat with wider virulence
profile, having the ability of ‘breaking down’ a wide range of resistance factors effective against
other major Meloidogyne species in many crops [11,12].
While controlling polyphagous RKN species by crop rotation in woody perennials is not an
alternative, chemical control is increasingly banned due to environmental and human health
concerns. The deployment of natural plant resistance is thus the most sustainable alternative
toward intensive crop production. Major advances have been made in species of Prunus with a
suite of resistance genes to RKN species finely mapped or cloned and used in breeding for
durable resistance [13,14]. In contrast, despite the current use of resistant rootstocks, very lit-
tle is known about genes and defense mechanisms underlying the RKN resistance in other
mainstream woody crops such as coffee and grapevine [15]. Sources of resistance to M.entero-
lobii have been detected in wild Psidium relatives but not in P.guajava accessions [9]. The
deployment of interspecific (P.guajava × P.guineense) rootstock hybrids with resistance
derived from P.guineense Swartz is currently the only viable management strategy (Fig 1).
Nevertheless, cultivar development could be more efficient by the still unexploited prospects
of introgressing disease resistance genes from P.guineense into P.guajava.
Progress has been made in the Myrtaceae family by generating genomic resources for forest
trees and to a much lesser extent for fruit species [16]. Major emphasis has been in Eucalyptus
species, for which a reference genome for E.grandis [17] and a multi-species SNP platform
EuCHIP60K [18] are available. Alike Eucalyptus,Psidium displays a chromosome number
x= 11, a basic complement largely conserved across the family [19,20]. Recently, a chromo-
some-level assembly of the P.guajava genome corroborated its high collinearity to the E.
grandis genome [21]. To date several microsatellites have been published for Psidium [22,23],
while SNP marker data have only been generated for Psidium guajava using genotyping by
sequencing methods based on complexity reduction with restriction enzyme digestion [24,
25]. This approach is well known to suffer from poor data reproducibility and portability
across experiments, especially in heterozygous genomes [26,27]. Conversely, cross-genera
transferability of Eucalyptus SNPs genotyped with the gold-standard Illumina Infinium™
EuCHIP60K platform to Psidium had been demonstrated early on [18], opening solid possibil-
ities of genome-wide diversity and association studies in Psidium using high quality and porta-
ble SNP data across genomes.
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 2 / 20
Data Availability Statement: The Psidium guajava
genome assembly was deposited at DDBJ/ENA/
GenBank under the accession JAGHRR000000000.
The version described in this article is
JAGHRR010000000. These resources were
deposited under the BioProject ID PRJNA713343.
All experimental SNP genotype data and
phenotypic data for the binary and quantitative (RF)
RKN resistance traits are made available in
supporting S1 File.
Funding: This work was supported by competitive
grants "NEXTFRUT" grant # 0193.001.198/2016
from Fundac¸ão de Amparo àPesquisa do Distrito
Federal (FAP-DF) to DG, CNPq (Conselho Nacional
de Desenvolvimento Cientı
´fico e Tecnolo
´gico)
grants 485472/2012-0 e 302525/2017-3 to C.A.F.
S. and Coordenac¸ão de Aperfeic¸oamento de
Pessoal de Nı
´vel Superior (CAPES), Finance Code
001. S.R.C. had a doctoral fellowship from
Fundac¸ão de Amparo àPesquisa do Estado da
Bahia, FAPESB. C.A.F.S., L.S.B and D.G had
research productivity grants from CNPq. There was
no additional external funding received for this
study and the funders had no role in study design,
data collection and analysis, decision to publish, or
preparation of the manuscript.
Competing interests: The authors have declared
that no competing interests exist.
Fig 1. (A) Psidium guajava plant attacked by M.enterolobii root knot nematode (left) and a P.guajava grafted plant
onto a resistant P.guajava x P.guineense hybrid (right); (B) healthy roots of resistant P.guajava x P.guineense hybrid
and (C) M.enterolobii RKN infected roots of a susceptible P.guajava plant.
https://doi.org/10.1371/journal.pone.0273959.g001
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 3 / 20
Association mapping has allowed important advances in mapping resistance loci to a wide
array of Meloidogyne species across distinct hosts providing tools to assist breeding [28]. In
this work, we generated a de novo assembly of the P.guajava genome and successfully trans-
ferred a large number of SNP probesets from Eucalyptus to Psidium at the nucleotide level to
carry out an association study for M.enterolobii resistance response. Using these resources, we
describe the detection of genomic regions harboring resistance loci to RKN derived from the
wild relative P.guineense. Additionally, our results highlight the evolutionary conservation of
genomes across genera of Myrtaceae in the adaptation to pathogens.
Material and methods
Psidium guajava × P.guineense association mapping population
To provide the best opportunity for recombination, an association mapping population was
created by allowing open pollination among F
1
interspecific root–stock hybrids (‘BRS Guarac¸a
´’
=P.guajava × P.guineense). A total of 189 outbred F
2
plants from open pollinated fruits har-
vested from 22 BRS Guarac¸a
´F
1
hybrid trees were evaluated for M.enterolobii reaction in a
controlled inoculation experiment at Embrapa Semi-Arid, Petrolina-PE, Brazil. Sample collec-
tion from native Psidium populations was granted by the Brazilian Institute of the Environ-
ment (IBAMA), authorization number CGEN Nº001-B/2013.
Meloidogyne enterolobii inoculation and plant reaction evaluation
Seedlings of individual F
2
plants (with 25 cm in height) were inoculated with 10,000 eggs
+ second-stage juveniles (J2). The M.enterolobii inoculum was extracted from guava roots col-
lected in a commercial area in the city of Petrolina-PE, using classic methods [29]. Each plant
was inoculated with 2 mL of the suspension in each one of two hollows in the soil at a distance
of 1.5 cm from the stem and 2.5 cm deep. At 120 days after inoculation, the plants were col-
lected and the roots were carefully washed in water within a plastic container to avoid loss of
nematode eggs. A qualitative binary phenotype of presence/absence of root galls and a quanti-
tative Reproduction Factor (RF) trait were measured. Individual roots (5 grams) were pro-
cessed, using a blender for 30 sec. Eggs and J2 were counted, determining the total number of
nematodes (final population) and the reproduction factor (RF = final nematode population/
the initial inoculum), was calculated [30]. Plants were classified as resistant when a
reduction 90% in RF was observed in relation to the susceptible plants [29]. For the subse-
quent quantitative analysis, the RF values were transformed into ffiffiffiffiffiffi
RF
pþ0:5due to the fre-
quent occurrence of individuals with zero or very low RF values.
Genetic material and SNP genotyping
DNA extraction was performed from young leaves using an optimized protocol for high qual-
ity DNA from woody plants [31]. Plants were genotyped with the Infinium EUChip60K con-
taining 60,904 Eucalyptus SNPs [18]. SNPs on the EUChip60K are coded with the
chromosome number followed by the physical address in base pairs on version 1.1 of the E.
grandis genome [17] which were then updated to the version 2.0 genome deposited at https://
jgi.doe.gov/data-and-tools/. SNP genotyping was performed at GeneSeek (Lincoln, NE, USA).
Quality control of informative SNPs
Due to the complexity of the cross-genera genotyping assay, a clustering procedure was
applied to the Psidium derived EUChip60K intensity data. We used the standard GenCall algo-
rithm in GenomeStudio 2.0 (Illumina, Inc. San Diego, USA) following its best practices and
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 4 / 20
criteria described earlier [18]. After these QC steps, and in order to extract the maximum
amount of quality genotypic data, the optiCall algorithm was used to ascertain genotypes at
common and low-frequency variants [32].
Allelic association tests and analyses of mixed linear models
Allelic and genotypic association tests were employed, respectively, to test for the association
between single SNP alleles and genotypes and the binary presence/absence of root galls and
the RF phenotype. Allelic and genotypic association tests were carried out with a Fisher’s exact
test and Cochran-Armitage trend test, respectively. Bonferroni correction and the Benjamini
& Hochberg (B&H) and Benjamini & Yekutieli (B&Y) ‘false discovery rate’ (FDR) procedures
were implemented with PLINK [33]. A mixed linear model (MLM) analysis was carried out
with the transformed RF phenotype using TASSEL 5.2.65 [34]. An ‘identical by state’ (IBS)
matrix estimated in PLINK 1.9 [33] was used to account for the confounding effects of both
population and family structure.
Comparative genomic analyses of Eucalyptus associated SNPs in the
Psidium genome
At the time of this study, a genome sequence assembly was not available for P.guajava or P.
guineense. To allow bona fide comparative genomic analyses of the associated genomic regions
using Eucalyptus SNPs onto the Psidium genome, we sequenced the genome of the Psidium
guajava S
2
plant UENFGO8.1–10 derived from two generations of selfing using PACBIO
Sequel I technology. The FALCON-Unzip v.1.1.5 pipeline [35] was applied to produce an ini-
tial assembly. Contigs were aligned to the Eucalyptus grandis v2.0 genome sequence in Phyto-
zome v13 [36] using the Cactus whole-genome multiple alignment program [37]. To obtain
the full value of the Cactus protocol and to mitigate the effect of the fragmentary assembly on
alignment quality, we aligned the contigs to a set of three chromosome-level related genomes.
We included the E.grandis (Myrtaceae) and the most likely sister to Myrtaceae, the Punica
granatum (Lythraceae), as well as Vitis vinifera (Vitaceae) as the ultimate outgroup. The tree
topology was generated starting from proteome data to reconstruct phylogenies that chart the
relationships among these organisms. Protein sequences into the genomes were downloaded
from the NCBI repository. For P.guajava proteins, the Augustus pipeline [38] was run on the
contig assembly using the extrinsic evidence provided by aligning RNA-Seq data available for
the species in NCBI SRA. Single-copy genes in the BUSCOv3 program [39,40] were used to
identify shared subsets from the different sets of protein data across the genomes. Proteins
were aligned using MAFFT and filtered with trimAl, and the maximum likelihood tree was
built using RAxML [39,41] to estimate the species phylogeny. The final non-overlapping
whole-genome multiple alignments with ProgressiveCactus described as a HAL file [42] were
extracted for the eleven chromosomes of the E.grandis and linked further using the algorithm
implemented in Ragout2 [43].
The reference genome assembly using synteny in Ragout2 was used to ensure consistency
of the transference of the SNP probesets from the target genome of the P.guajava. For this
purpose, starting from a BED file with probesets coordinate annotation on the E.grandis
genome, we used the halLiftOver procedure in the HAL package to perform a base-by-base
mapping between guava and Eucalyptus. The output which refers to the probeset sequences in
the E.grandis genome to their corresponding locations in guava was written in the PSL format
and then converted to the AXT format using the program utilities in the Kent’s Utilities pack-
age from the UCSC Genome Browser tools [44]. The corresponding locations and sequence
content of probesets in guava were inspected to accept only those that matched the same
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 5 / 20
original positions in the query genome and recovered the same assayed substitution at the
nucleotide-level. Otherwise, the probeset location was called erroneous and discarded. Finally,
we performed a transcript consistency analysis using the comprehensive transcript set pro-
vided for the E.grandis genome assembly. We used the CAT pipeline [45] for each of one of
46,280 transcripts in the E.grandis annotation to determine their contig location and orienta-
tion in the contigs into the P.guajava genome with respect to the alignments between the two
genomes from the HAL file and extrinsic evidences based on public mRNA-Seq data. After the
comparative annotation of protein-coding genes, an evaluation of the putative effects of
genetic variants was carried out using a database prepared using the SnpEff v5.0c pipeline [46].
Results
EUChip60K performance in Psidium
A total of 6,879 SNPs were successfully assayed from the 60,904 EuCHIP60K SNPs using the
GenCall clustering algorithm with a call rate CR0.90 and no minimum allele frequency
(MAF) threshold. The normalized X-Y intensity data for these 6,879 SNPs were exported from
Genome Studio (GS) and genotypes ascertained using the optiCall algorithm (default options)
resulting in 6,225 SNPs. When a MAF 0.01 was applied to the 6,879 SNPs only 521 SNPs
were retained with the standard GenCall algorithm in GS, while optiCall delivered 4,143 poly-
morphic SNPs, an eight-fold improvement (S1 File).
Phenotypic evaluation
Out of the 189 originally inoculated plants, 175 ultimately survived to final evaluation. For the
binary phenotype, 92 resistant plants were free of M.enterolobii induced galls while 83 plants
displayed conspicuous root galls and were classified as susceptible. The untransformed Repro-
duction Factor (RF) phenotype varied from zero to 2.53 and when considered in a simple
binary fashion only six of the 175 plants were scored with a reproduction factor RF>1.0, thus
classified as susceptible, while all others, with RF <1.0, were rated as resistant (S1 File).
Although these binary counts fitted the same epistatic models proposed earlier in an inbred F
2
population [47] only one out of the 4,143 SNP data segregated in a 1:2:1 ratio indicating that
the population did not behave as a regular inbred F
2
from a single F
1
plant but rather, as
expected, as a mixture of outbred crossed offspring.
Allelic and genotypic association analyses
Following multiple test corrections three and four SNPs displayed significant allelic and geno-
typic association respectively for the binary trait of M.enterolobii galls according to the
Cochran-Armitage trend test (with adjusted p-value <5.0E-3) (Table 1). The combination of
allelic and genotypic association tests indicated two SNPs (viz. EuBR03s29615246 and
EuBR03s30383415) in significant association with the overall resistance reaction. The SNP
EuBR03s30383415 found significant by both the allelic and genotypic association, was later
found significantly associated by the MLM analysis as well. The additional SNPs also on chro-
mosome 3, EuBR03s16993500, EuBR03s37875650, EuBR03s21599380 showed variable signal
depending on the statistical association test employed and were not considered further.
Association mapping with a mixed linear model
The MLM analysis incorporating population and kinship covariates resulted in one SNP
(EuBR03s30383415) associated with M.enterolobii resistance using TASSEL following
the specified threshold p-value of <5.0E
-04
, with coefficient of determination (R
2
) of 0.107
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 6 / 20
(Fig 2;Table 2), suggesting that factors residing in this genomic region may explain a consider-
able fraction of the M.enterolobii resistance phenotype. Three additional SNPs were suggestive
of association, one also on chromosome 3 and the other two on different chromosomes. Two
of the four SNPs detected in the MLM analysis, namely EuBR03s30383415 and
EuBR03s16993500, both on chromosome 3, had also been detected by both the allelic and the
genotypic association analyses.
Genome assembly of P.guajava and comparative genomic analyses to the
E.grandis genome
The assembled contigs for our whole genome shotgun of P.guajava totaled 359.4 Mb into 510
sequences and covered 78% of the 463 Mb genome size estimated for P.guajava by flow
cytometry [19]. This assembly was deposited at DDBJ/ENA/GenBank under the accession
JAGHRR000000000. The version described in this article is JAGHRR010000000. These
resources were registered under the BioProject ID PRJNA713343. These contigs were further
linked to provide a reference genome assembly from the whole-genome alignments against the
E.grandis assembly using a syntenic path approach. Some of the original contigs were broken
to fit into the hierarchical block construction, suggesting the presence of rearrangements of
the homologous sequences between the two genomes across large segments (>10 kbp). At
smaller distances in the range of the probeset sequence length (100 bp) the resulting syntenic
path covered 32.1% of our de novo guava’s assembly, which allowed us to successfully reallo-
cate 14,268 probesets of the EucHIP60k. These probesets are distributed across 377 contigs
(328 Mb) into the assembly. Comparative transcript identification resulted in the annotation
of 21,240 protein-coding loci. Importantly, out of the 4,143 SNP probesets that detected poly-
morphism, 1,241 were fully converted between the genomes at the nucleotide-level resolution
and matched the original allelic variation of the SNP into the genotyping assay. A detailed
analysis was therefore possible for these variant positions in the P.guajava genome. Prediction
of effects at these genomic variants revealed diverse types of impact on 6,201 transcripts in the
Table 1. SNP markers displaying allelic and genotypic associations and corresponding adjusted p-values for the binary trait presence/absence of Meloidogyne enter-
olobii galls in 175 outbred F
2
plants derived from open pollination among F
1
hybrid Psidium guajava ×P.guineense plants. SNPs are coded with the chromosome
number followed by the physical address in base pairs on version 2.0 of the E.grandis genome.
SNP marker Chromosome Adjusted p-value
Bonferroni FDR/B&HFDR/B&Y
Allelic association—Fisher’s exact test
EuBR03s29615246 03 6.26E
-16
6.26E
-16
5.21E
-15
EuBR03s16993500 03 1.48E
-05
7.40E
-06
6.16E
-05
EuBR03s30383415 03 0.002022 0.000674 0.005616
EuBR03s37875650 03 0.05376 0.01344 0.112
EuBR03s11126682 03 0.5225 0.1045 0.8705
Genotypic association—Cochran-Armitage trend test
EuBR03s29615246 03 2.84E
-07
2.84
E-07
2.37
E-06
EuBR03s37875650 03 0.000289 0.000145 0.001203
EuBR03s30383415 03 0.001052 0.000351 0.002921
EuBR03s21599380 03 0.001934 0.000484 0.004028
EuBR03s16993500 03 0.03814 0.007628 0.06355
EuBR03s7520846 03 0.05023 0.008372 0.06974
False discovery rate (FDR) Benjamini & Hochberg (B&H).
False discovery rate (FDR) Benjamini & Yekutieli (B&Y).
https://doi.org/10.1371/journal.pone.0273959.t001
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 7 / 20
P.guajava genome from which 2,379 have putative homologues in the E.grandis genome
assembly. A SNP annotation file (VCF) (S2 File) and an Illumina GenomeStudio™2.0 cluster
file (EGT) for the successfully reallocated probesets are provided (S3 File). The EGT file will be
particularly valuable for processing and quality control of SNP data for future Psidium geno-
typing experiments using the EucHIP60K.
Fig 2. Manhattan plot of the association analysis for M.enterolobii root knot nematode (RKN) resistance in guava from a MLM analysis. Significantly
associated SNPs (see Table 2) are labeled and those for which SNP probesets were reallocated on the Psidium guajava genome are highlighted by orange
dots.
https://doi.org/10.1371/journal.pone.0273959.g002
Table 2. SNPs displaying significant associations and their coefficients of determination (R
2
) according to a mixed linear model (MLM) analyses in TASSEL for
reproduction factor of Meloidogyne enterolobii root know nematode in 175 outbred F
2
plants derived from open pollination among F
1
hybrid Psidium guajava ×P.
guineense plants. SNPs are coded with the chromosome number followed by the physical address in base pairs on version 2.0 of the E.grandis genome.
SNP Eucalyptus/Psidium chromosome p-value R
2
EuBR03s30383415 03 4.59E
-04
0.107
EuBR03s16993500 03 6.70E
-04
0.097
EuBR10s18721868 10 7.26E
-04
0.094
EuBR08s16771330 08 8.51E
-04
0.115
https://doi.org/10.1371/journal.pone.0273959.t002
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 8 / 20
The probe sequences for the M.enterolobii resistance associated SNPs EuBR03s29615246
and EuBR03s30383415 spaced by 768 kbp on the Eucalyptus genome were found spaced nearly
470 kbp apart onto a single sequence of the P.guajava assembly that spans 3.14 Mbp in size
(JAGHRR010000008.1). The physical interval covered by this contig in the pseudo-assembly
of the Psidium guajava using the syntenic path alignment approach to the Eucalyptus grandis
assembly corresponds to a genomic region of about 7.45 Mb along Chromosome 3 (coordi-
nates 27,580,466 to 35,980,336 of the Egrandisv2.0).
Our pipeline for protein-coding gene annotation predicted 102 gene models with coordi-
nates within the contig of the Psidium guajava assembly containing the probes for SNPs
EuBR03s29615246 and EuBR03s30383415. The gene density of 32.5 genes/Mbp is similar to its
corresponding putative orthologous region in the Eucalyptus grandis assembly, which has a
density of 36.1 genes/Mbp (269 gene models distributed along 7.5 Mbp). Interestingly, the
comparison of the repertoire of putative NBS-LRR genes between the genomes along this
orthologous region shows a different picture. While the Eucalyptus genome contains 31 mod-
els of physical arrangement in this gene family within this locus, we could identify only 2 mod-
els within the corresponding region in the Psidium guajava assembly.
In terms of the predicted impact based exclusively on a bioinformatics analysis, these two
SNPs are variants with moderate effect causing non-synonymous changes in respect to the
conceptual translation of the transcripts J3R85_001472 /Eucgr.C01744 (Uniprot id:
A0A059CPK6) and J3R85_001443/Eucgr.C01791 (Uniprot id: A0A059CPT9), respectively.
SNP EuBR03s30383415 is also a modifier variant occurring downstream to the gene locus for
J3R85_001444/ Eucgr.C01790 (Uniprot id: A0A059CQ27). The physical location, correspond-
ing probesets and features of the predicted variant genes for these two associated SNPs on
chromosome 3 are summarized (Fig 3;Table 3) and further discussed below.
Discussion
The EuCHIP60K provides genome-wide SNP genotyping in Psidium
Our genetic association experiment was driven by successful genotyping and precise realloca-
tion of SNP probesets from the Eucalyptus genome to a de novo assembly of the Psidium
genome. Typically, for poorly funded orphan crops, SNP genotyping has been carried out by
one of the several methods of restriction enzyme-based reduced representation sequencing
[48]. This approach has recently been used to investigate the genetic diversity of Psidium gua-
java [24], as well as related species of the genus [25]. These methods offer the advantage of
simultaneous SNP discovery and genotyping with no upfront costs, but suffer from well-
known pitfalls and limitations in data quality, reproducibility and especially portability across
experiments, particularly for highly heterozygous genomes [26,48,49]. Although SNPs data-
sets are generated, the ascertained SNPs vary across experiments and as such they do not con-
stitute a true legacy genomic resource for future widespread and long-term use by the
community, nor they allow consolidation of data across studies in the same manner as the
fixed content chip-based SNPs data and resource we have described and provided in this
work.
Although fixed content chips are currently the gold standard for SNP genotyping, success-
ful attempts to transfer platforms across species and genera have been limited to domestic ani-
mals [50], showing a linear decrease of 1.5% in SNP call rate per million years divergence and
exponential decay of polymorphisms retention [51], consistent with theoretical expectations
[52]. In plants, to the best of our knowledge no large-scale transferability evaluations of SNP
arrays across genera have been reported. The 6,879 out of 60,904 SNPs successfully transferred
from Eucalyptus to Psidium in this work corroborate our earlier estimates of ~10%
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 9 / 20
Fig 3. Schematic diagrams of the physical scaffold location of the three main SNPs on chromosomes 3 and 10 of
the Psidium guajava genome associated with RKN resistance with their corresponding p-values and associated
functionally relevant defense genes annotated (see text and Table 3 for details). Coordinates are centered at the
SNP (blue diamond) and expand 10 Kbp to both sides.
https://doi.org/10.1371/journal.pone.0273959.g003
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 10 / 20
Table 3. Summary of the main features of two SNP variants associated with RKN resistance on chromosome 3 and chromosome 10 of Psidium guajava likely to cause functional or regulation
changes on predicted genes (see text for details).
Feature EuBR03s30383415 EuBR03s29615246 EuBR10s18721868
P.guajava assembly
scaffold
JAGHRR010000008.1 JAGHRR010000008.1 JAGHRR010000188.1
P.guajava assembly
locus
147,466 621,264 594,966
Reference allele G G C
Major allele (A)
associated with the
RKN resistant
phenotype)
A A T
Minor allele (B)
associated with the
RKN susceptible
phenotype
G G C
Minor allele frequency 0.253 0.467 0.271
Counts of genotype
AA
102 86 97
Counts of genotype
AB
57 9 56
Counts of genotype
BB
6 71 8
Downstream gene
variant
ncbi: J3R85_001444; uniprot:EUGRSUZ_C01790 - -
Intron variant - - -
Missense variant ncbi: J3R85_001443; uniprot ortholog:EUGRSUZ_C01791 ncbi: J3R85_001472; uniprot ortholog:EUGRSUZ_C01744
synonymous_variant ncbi:J3R85_0015914; uniprot ortholog:EUGRSUZ_J01461
Protein name EUGRSUZ_C01790: ENT domain-containing protein; EUGRSUZ_C01791:DUF642 EUGRSUZ_C01744: F-box domain-containing protein EUGRSUZ_J01461: Histone acetyltransferase
SNP probe sequence
[variant SNP site]
GTGCCCTATGAGTCGAAGGGCAAAGGCGGGTTCAAGCGCGCTGTCCTGCGGTTCCAGGCC
[A/G]
TGTCCATGAGGACCAGGATCATGTTCTACAGCACGTTCTACACCATGAGGAGTGACGATT
ATTGGGCACTATGCCACGGCTGTTGCTGATTTAACCCTTACTAGCCTCCATAATGTCACT
[A/G]
AGAGAGGGCTTTGGGTCATGGGCAATGGTCATGGTTTGCAAAGGTTGAGGTCTTTGATAG
CGTACAATGTACATTCTGCCCATCGTGCCACAATTGTTGCAGAGGTGGGACCATCAAGTG
[C/T]
GGGGGGATTTCTGTTTCCAAGGCCAAGCTCCACAAGAGAAAGAATAATGAGGAAATTGAA
https://doi.org/10.1371/journal.pone.0273959.t003
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 11 / 20
transferability [18] consistent with the estimated divergence time of 60–65 Million years (90%
decrease in SNP calling rate) between tribes Eucalypteae and Myrteae [53], with a slightly
higher than theoretically expected polymorphism retention of 6.8% (4,143 SNPs in 60,904) fol-
lowing data clustering with the optiCall algorithm. Although almost 7,000 SNPs, out of which
4,143 were informative in this particular population, might seem a small number, it represents
a substantial increase in high quality marker availability for P.guajava, opening great prospects
for genetic and breeding applications. We speculate that this higher-than-expected SNP reten-
tion might be due to the deliberate design of the Eucalyptus multispecies EUChip60K toward
conserved genomic regions [18], likely subject to stronger purifying selection allowing better
opportunity for polymorphism retention of targeted sites.
M.enterolobii resistance in P.guajava reveals evolutionary conservation of
chromosome 3 loci across genera of Myrtaceae
Despite the limited power of our genetic association experiment, all analytical approaches con-
sistently pointed to a clear-cut signal involving two SNPs (EuBR03s29615246 and
EuBR03s30383415) associated with M.enterolobii resistance on a specific sequence of the
assembly of Psidium guajava (JAGHRR010000008.1) syntenic to chromosome 3 of Eucalyptus
grandis (Chr03:27,580,466–35,980,336). This result is supported by the accurate sequence-level
reallocation of SNP probesets from Eucalyptus chromosome 3 on our de novo P.guajava
genome assembly, and corroborated by the highly conserved syntenic relationship between
these two genomes [21]. In fact, a number of studies in Eucalyptus have reported disease resis-
tance loci for different fungal pathogens also pathogenic in Psidium on chromosome 3 [54–
59]. Genome annotations have also highlighted the highest densities of clusters and superclu-
sters of NBS-LRR (nucleotide binding site-leucine-rich repeat) resistance genes on Eucalyptus
chromosomes 3, 5, 6, 8 and 10 [60]. Observations at the gene level have shown extensive synte-
nic blocks of 778 genes in 522 gene families shared between Eucalyptus chromosome 3 and
Populus chromosome XVIII, with the most common family represented by 33 disease resis-
tance genes [17]. All these evidences not only provide further indirect support to our results,
but also contribute to highlight a seemingly strong evolutionary conservation of the role of
chromosome 3 across genera of Myrtaceae and possibly beyond, in the adaptation to different
pathogens. Furthermore, the detection of major effect loci encompassing regions with
NBS-LRR genes has been a common feature for resistance to RKNs across many pathosystems
of both annual [28] and woody perennial [15] crops. To the best of our knowledge, our report
is the first for a species in the large family Myrtaceae.
Associated SNPs are located within or in close proximity to functionally
relevant defense genes in the Psidium genome
The precise nucleotide-level reallocation of Eucalyptus SNP probesets onto the Psidium
genome and functional effect prediction, allowed an in-depth examination of the two SNPs
located in gene loci likely linked to the defense response on chromosome 3. This, in turn,
allowed proposing plausible molecular mechanisms underlying the resistance response at the
gene level with an emphasis for the SNPs on chromosome 3 (Fig 3;Table 3). Although we are
fully aware that conclusive proof will require additional experimental evidence beyond the
scope of this initial SNP discovery, we contend that the following discussion provides a poten-
tial roadmap to guide follow-up experiments. Furthermore, we tested and excluded the
hypothesis that the gene loci underlying the significant SNPs could be orthologs to the Ma
gene, a large-spectrum Meloidogyne species resistance locus described in Prunus linkage group
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 12 / 20
7 (Prupe.7G065400) [14]. Thus, the gene loci discussed below more likely represent novel
sources of RKN resistance, possibly specific to Myrtaceae.
SNP EuBR03s29615246 is located in the gene J3R85_001472 and its Eucalyptus ortholog
gene Eucgr.C01744 (Uniprot id: A0A059CPK6). This gene codes for a F-box protein belonging
to the leucine-rich repeat (LRR) family involved in cell cycle control and glucose signaling,
with orthology relationship to Arabidopsis EBF1/EBF2 [61]. In Arabidopsis, EBF1 and EBF2
play a specific role in the recognition of the EIN3 (ethylene-insensitive3) transcription factor
(s) and facilitate their subsequent SCF-dependent ubiquitylation and degradation via the ubi-
quitin/26S proteasome pathway [62]. This pathway is established as an important posttran-
scriptional mechanism that allows eukaryotic cells to respond rapidly to signal molecules and
changes in environmental conditions [63].
On the same contig where EuBR03s29615246 resides, the second SNP, EuBR03s30383415,
was detected as associated. This SNP was declared significant by all analytical approaches,
ranked as the strongest association with the lowest p-value in the MLM analysis (Tables 1and
2;Fig 3). This SNP results in a non-synonymous change on the product of the gene
J3R85_001443, which is an ortholog of Eucgr.C01791 (Uniprot id: A0A059CPT9) in Eucalyp-
tus. Its product is a protein that contains a DUF642 domain and a galactose-binding-like
domain fold, and it is member of a group of seven proteins in Eucalyptus that have orthology
relationships to a group of ten proteins in Arabidopsis. Remarkably, two members of this
group are AT4G32460 (BIIDXI locus) and AT2G41800 (TEEBE locus), recently reported as
highly induced genes by auxin during early interaction between the susceptible A.thaliana
ecotype Columbia and the RKN M.incognita [64]. SNP EuBR03s30383415 is also predicted to
cause an allelic change in the region downstream of another gene of P.guajava, J3R85_001444,
which has orthology relationship to Eucgr.C01790 (Uniprot id: A0A059CQ27) in Eucalyptus.
This gene codes for a protein containing an EMSY N-terminal domain (PF03735), a central
Agenet domain (PTHR31917), and a probable coiled-coil motif at the C-terminus. The Agenet
domain is member of the superfamily Agenet/Tudor [65] and in plants it was suggested to act
as a link between DNA replication, transcription and chromatin remodeling during flower
development [66], a process involving hormonal regulation in which auxin plays a major role
[67].
Based on these findings, we speculate about the possibility of SNPs EuBR03s29615246 and
EuBR03s30383415 being important leads to identify underlying genes in the Psidium guajava
assembly, highly syntenic to chromosome 3 in Eucalyptus, whose expression is likely to
undergo changes during pathogen invasion due to effects of chemical modulation of plant hor-
mone levels or signaling contributing to the resistant response in P. guajava × P.guineense
plants. Although this hypothesis awaits gene expression experiments to be tested, we have
advanced our discussion based on available evidences regarding the disease status of RKN
infected trees.
M.enterolobii resistance might be triggered by mineral nutrients and
phytohormone homeostasis or signaling subject to miRNAs modulation
Studies in guava [68], coffee [69], peach and almond [70] have shown that disease status of
RKN infected trees is related to symptoms triggered by nutritional imbalances in the concen-
tration of nitrogen, calcium, manganese and magnesium in several tissues in adult plants. Fur-
thermore, because our binary phenotypic data fitted the same epistatic models proposed
earlier [47], we further considered the hypothetical involvement of a second genetic locus
interacting with the underlying genes on chromosome 3. Particularly, the associated SNP
EuBR10s18721868 (Table 2;Fig 3) residing on the 700 kb long sequence JAGHRR010000188.1
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 13 / 20
of the P.guajava assembly looked promising enough in demanding further investigation.
EuBR10s18721868 is a synonymous variant inside of gene J3R85_016994 whose ortholog in
Eucalyptus is Eucgr.J01461 on chromosome 10. This gene encodes a CREB-binding protein
(CBP)/p300 protein of the subfamily of highly conserved histone acetyltransferase (HAT) and
histone deacetylase (HDAC). These proteins are involved in various physiological events and
their homologs in plants, the HAC genes, were recently suggested to be involved in ethylene
signaling [71].
Studies in animals, plants, and viruses have suggested that microRNA function may affect
synonymous codon choices in the vicinity of its target sites [72]. Following that suggestion, we
performed a preliminary search for individual miRNA in the scaffold JAGHRR010000188.1,
that resulted in two different families of miRNA namely miR172 and miR393. MicroRNA
miR393 has been shown to take part in plant metal homeostasis, uptake and accumulation of
various nutrient ions under low-nutrient conditions including nitrogen and divalent cations
[73,74]. microRNA identification on this sequence showed the highest number of loci for
miR172 and it also contains one of the only two loci that were found to code for miR393 in the
genome assembly of P.guajava.
Interestingly, nitrogen supply has shown to promote the upregulation of miR393 for target-
ing auxin receptor genes that encode F-box proteins such as that encoded by the gene
J3R85_001472 impacted by the SNP EuBR03s29615246 on chromosome 3. These proteins are
involved in ubiquitin-mediated degradation of specific substrates during auxin signaling cat-
ions [74]. Moreover, miR393 targets transcripts that code for basic helix-loop-helix (bHLH)
transcription factors and for the auxin receptors TIR1, AFB1, AFB2, and AFB3. Studies have
shown that miR393/AFB3 is a unique N-responsive module that controls root system architec-
ture in response to external and internal N availability in Arabidopsis [75]. The miR172 family
has a recognized role in damping the expression of genes encoding the APETALA2 (AP2)
transcription factor members of a large family of the AP2/EREBP family from Arabidopsis
thaliana and other plants, which are responsible in part for mediating the response to ethylene
[74].
Although we are aware that the preliminary analysis described above lacks direct supportive
experimental data to ascertain the impact of miRNAs on Psidium response to RKN infection,
these conjectures fit both the epistatic interaction model described previously [47] and the
emerging view that specific developmental or stress events can be frequently subject to modu-
lation by diverse miRNA families [74]. Therefore, it could be postulated that this region on
chromosome 10 might constitute a distinct locus epistatic to the genetic locus on chromosome
3 harboring SNPs EuBR03s29615246 and EuBR03s30383415 potentially contributing to the M.
enterolobii resistance response.
Concluding remarks
We mapped two genomic regions associated with resistance to M.enterolobii in a member of
the Myrtaceae. Comparative genomics driven by significantly associated SNPs and a de novo
assembly of the P.guajava genome support our conclusion that the continuous physical stretch
of nearly 3.14 Mbp, encompassing a single sequence of Psidium guajava largely syntenic to
Eucalyptus grandis chromosome 3, harboring SNPs EuBR03s29615246 and
EuBR03s30383415, may constitute a resistance locus for RKN response derived from the wild
relative P.guineensis. Detailed functional annotations and positioning of the gene loci targeted
by these SNPs allowed us to provide a roadmap to putative underlying molecular mechanisms
of resistance response at the gene level, to guide follow-up experimental work. Further indirect
support to our data comes from a number of previous reports mapping resistance loci in the
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 14 / 20
syntenic genomic region in Eucalyptus, a region housing the highest density of NBS-LRR resis-
tance genes and showing elevated synteny and gene retention in the genome evolution of
woody plants. Additional SNPs were detected on other chromosomes suggesting that other
loci besides those on chromosome 3 likely participate in the response, notably on chromosome
10, also supported by indirect evidences from Eucalyptus mapping studies.
Controlling RKN species by the introgression of resistance loci represents a promising
alternative to environmentally undesirable nematicides. This has been the preferred approach
in a growing number of mainstream woody crops, such as Prunus, grapevine and coffee. Our
work represents the first association study in a fruit crop of the large group of fleshy members
of the Myrtaceae family, engaging the guava fruit in this select group of fruit crop that have
been the subject of genomic investigation. Our contribution should advance the development
of new guava cultivars through the development of inexpensive SNP based assays to monitor
the introgression of the P.guineense-derived resistance into guava cultivars and rootstocks,
and foster comparative genomic studies in other species of the genus that endure the damaging
effects of this pathogenic nematode.
Supporting information
S1 File. Phenotypic data for the binary and quantitative (RF) RKN resistance traits and
SNP genotype data for the 4,143 probesets in the EucHIP60K that have passed quality con-
trol using Genome Studio and displayed polymorphism following the optiCall analysis
(SNP Call Rate 90% and MAF 0.05). Normalized X-Y data for the 6,879 successfully
assayed SNPs (Call Rate 90%) were exported from GS and genotypes were ascertained using
the optiCall algorithm (default options).
(XLSX)
S2 File. SNP annotation file (VCF format) for the 14,268 Eucalyptus probesets in the
EucHIP60K successful reallocated onto the Psidium guajava genome assembly using
whole-genome alignment and extraction of synteny blocks. This file highlights the 1,241
SNPs that were polymorphic in our study (GT =“0/1”) and also displays the functional effect
predictions resulting from the allelic changes at these genomic variants on the protein-coding
loci in the P.guajava assembly using SnpEff terms (ANN field). Homology relationship with
the protein-coding loci in the E.grandis assembly was inferred with the Comparative Annota-
tion Toolkit program.
(VCF)
S3 File. Diploid Cluster file (EGT format of Illumina GenomeStudio™2.0 software) for the
EucHIP60K Infinium assay for Psidium sp. genotyping. Cluster positions were derived from
a set of 70 diverse samples of Psidium guajava,Psidium guineensis and their F
1
hybrids using
the GenTrain algorithm. It corresponds to the SNP data from the 14,268 successful reallocated
probesets onto the P.guajava assembly while the remaining SNP data were “zeroed”. This file
is provided to help processing and quality control of SNP data for future Psidium sp. genotyp-
ing using the EucHIP60K.
(EGT)
Acknowledgments
We would like to thank Dr. Alexandre Pio Viana, from the State University of the North Flu-
minense Darcy Ribeiro for providing leaf tissue of the P.guajava selfed S
2
plant UENFGO8.1–
10 used to generate the de novo P.guajava genome assembly. We also wish to thank Dr.
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 15 / 20
Priscila Grynberg and Dr. Marcos Costa, from Embrapa Genetic Resources and Biotechnol-
ogy, for carrying the preliminary bioinformatics analysis on the miRNA identification.
Author Contributions
Conceptualization: Carlos Antonio Fernandes Santos, Leonardo Silva Boiteux.
Data curation: Soniane Rodrigues da Costa, Orzenil Bonfim Silva-Junior.
Formal analysis: Carlos Antonio Fernandes Santos, Orzenil Bonfim Silva-Junior.
Funding acquisition: Carlos Antonio Fernandes Santos, Dario Grattapaglia.
Investigation: Carlos Antonio Fernandes Santos, Soniane Rodrigues da Costa, Leonardo Silva
Boiteux, Dario Grattapaglia.
Methodology: Carlos Antonio Fernandes Santos, Soniane Rodrigues da Costa, Orzenil Bonfim
Silva-Junior.
Project administration: Dario Grattapaglia.
Resources: Carlos Antonio Fernandes Santos, Leonardo Silva Boiteux, Dario Grattapaglia.
Software: Orzenil Bonfim Silva-Junior.
Validation: Leonardo Silva Boiteux, Orzenil Bonfim Silva-Junior.
Writing – original draft: Carlos Antonio Fernandes Santos, Leonardo Silva Boiteux, Dario
Grattapaglia, Orzenil Bonfim Silva-Junior.
Writing – review & editing: Dario Grattapaglia, Orzenil Bonfim Silva-Junior.
References
1. Biffin E, Lucas EJ, Craven LA, Ribeiro da Costa I, Harrington MG, Crisp MD. Evolution of exceptional
species richness among lineages of fleshy-fruited Myrtaceae. Annals of Botany. 2010; 106(1):79–93.
https://doi.org/10.1093/aob/mcq088 PMID: 20462850
2. Mitra SK. Important Myrtaceae fruit crops. Acta Horticulturae. 2010; 849:33–8. https://doi.org/10.17660/
ActaHortic.2010.849.2
3. Gutie
´rrez RMP, Mitchell S, Solis RV. Psidium guajava: A review of its traditional uses, phytochemistry
and pharmacology. Journal of Ethnopharmacology. 2008; 117(1):1–27. https://doi.org/10.1016/j.jep.
2008.01.025 PMID: 18353572
4. Morais-Braga MFB, Carneiro JNP, Machado AJT, dos Santos ATL, Sales DL, Lima LF, et al. Psidium
guajava L., from ethnobiology to scientific evaluation: Elucidating bioactivity against pathogenic micro-
organisms. Journal of Ethnopharmacology. 2016; 194:1140–52. https://doi.org/10.1016/j.jep.2016.11.
017 PMID: 27845266
5. Altendorf S. Minor tropical fruits—Mainstreaming a niche market. In: FAO, editor. Food outlook—Bian-
nual Report on Global Food Markets. 2018. Rome—Italy: FAO; 2018. p. 67–75.
6. FAOSTAT statistical database [Internet]. Food and Agricultural Organization, Rome (Date accessed:
March 10, 2022). 2021 [cited March 10, 2022]. https://search.library.wisc.edu/catalog/
999890171702121.
7. Sitther V, Dhekney S, Pramanik S, Zee FTP, Yadav AK. Assessment of Genetic Diversity in Psidium
guajava L. using Simple Sequence Repeat Markers. Hortscience. 2012; 47(9):S200–S1.
8. Carneiro RMDG, Moreira WA, Almeida MRA, Gomes ACMM. Primeiro registro de Meloidogyne maya-
guensis em goiabeira no Brasil. Nematologia Brasileira. 2001; 25(2):223–8.
9. Carneiro RMDG, de Freitas VM, Mattos JK, Castro JMC, Gomes CB, Carneiro RG. Major guava nema-
todes and control prospects using resistance on Psidium spp. and non-host crops. ActaHortic. 2012;
959:41–9. Epub 959. https://doi.org/10.17660/ActaHortic.2012.959.4
10. Singh N. Emerging problem of guava decline caused by Meloidogyne enterolobii and Fusarium oxy-
sporum f.sp. psidii. Indian Phytopathology. 2020; 73(2):373–4. https://doi.org/10.1007/s42360-020-
00198-y
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 16 / 20
11. Castagnone-Sereno P. Meloidogyne enterolobii (= M. mayaguensis): profile of an emerging, highly
pathogenic, root-knot nematode species. Nematology. 2012; 14(2):133–8. https://doi.org/10.1163/
156854111X601650
12. Koutsovoulos GD, Poullet M, Elashry A, Kozlowski DKL, Sallet E, Da Rocha M, et al. Genome assembly
and annotation of Meloidogyne enterolobii, an emerging parthenogenetic root-knot nematode. Scientific
Data. 2020; 7(1):324. https://doi.org/10.1038/s41597-020-00666-0 PMID: 33020495
13. Claverie M, Dirlewanger E, Bosselut N, Van Ghelder C, Voisin R, Kleinhentz M, et al. The Ma gene for
complete-spectrum resistance to Meloidogyne species in Prunus is a TNL with a huge repeated c-termi-
nal post-LRR region. Plant Physiology. 2011; 156(2):779. https://doi.org/10.1104/pp.111.176230
PMID: 21482634
14. Van Ghelder C, Esmenjaud D, Callot C, Dubois E, Mazier M, Duval H. Ma Orthologous Genes in Prunus
spp. Shed Light on a Noteworthy NBS-LRR Cluster Conferring Differential Resistance to Root-Knot
Nematodes. Frontiers in Plant Science. 2018; 9:1269. https://doi.org/10.3389/fpls.2018.01269 PMID:
30254651
15. Saucet SB, Van Ghelder C, Abad P, Duval H, Esmenjaud D. Resistance to root-knot nematodes Meloi-
dogyne spp. in woody plants. New Phytologist. 2016; 211(1):41–56. https://doi.org/10.1111/nph.13933
PMID: 27128375
16. Grattapaglia D, Vaillancourt RE, Shepherd M, Thumma BR, Foley W, Ku¨lheim C, et al. Progress in Myr-
taceae genetics and genomics: Eucalyptus as the pivotal genus. Tree Genetics & Genomes. 2012; 8
(3):463–508. https://doi.org/10.1007/s11295-012-0491-x
17. Myburg AA, Grattapaglia D, Tuskan GA, Hellsten U, Hayes RD, Grimwood J, et al. The genome of
Eucalyptus grandis. Nature. 2014; 510(7505):356–62. https://doi.org/10.1038/nature13308 PMID:
24919147
18. Silva-Junior OB, Faria DA, Grattapaglia D. A flexible multi-species genome-wide 60K SNP chip devel-
oped from pooled resequencing of 240 Eucalyptus tree genomes across 12 species. New Phytologist.
2015; 206(4):1527–40. https://doi.org/10.1111/nph.13322 PMID: 25684350
19. Coser SM, Ferreira MFdS, Ferreira A, Mitre LK, Carvalho CR, Clarindo WR. Assessment of genetic
diversity in Psidium guajava L. using different approaches. Scientia Horticulturae. 2012; 148:223–9.
https://doi.org/10.1016/j.scienta.2012.09.030
20. Tuler AC, Carrijo TT, Peixoto AL, Garbin ML, da Silva Ferreira MF, Carvalho CR, et al. Diversification
and geographical distribution of Psidium (Myrtaceae) species with distinct ploidy levels. Trees. 2019; 33
(4):1101–10. https://doi.org/10.1007/s00468-019-01845-2
21. Feng C, Feng C, Lin X, Liu S, Li Y, Kang M. A chromosome-level genome assembly provides insights
into ascorbic acid accumulation and fruit softening in guava (Psidium guajava). Plant Biotechnology
Journal. 2020; 19(4):717–30. https://doi.org/10.1111/pbi.13498 PMID: 33098334
22. Kumar C, Kumar R, Singh SK, Goswami AK, Nagaraja A, Paliwal R, et al. Development of novel g-SSR
markers in guava (Psidium guajava L.) cv. Allahabad Safeda and their application in genetic diversity,
population structure and cross species transferability studies. PLOS ONE. 2020; 15(8):e0237538.
https://doi.org/10.1371/journal.pone.0237538 PMID: 32804981
23. Risterucci AM, Nansot G, Grangeon R, Lepitre V, de Reeper A, Argout X, et al. Development of Guava
Microsatellite (SSR) Markers Using the SAT Software. In: Rohde W, Fermin G, editors. II International
Symposium on Guava and Other Myrtaceae. Acta Horticulturae. 849. Leuven 1: Int Soc Horticultural
Science; 2010. p. 113–9.
24. Diaz-Garcia L, Padilla-Ramirez JS. Development of single nucleotide polymorphism markers and
genetic diversity in guava (Psidium guajava L.). Plants People Planet. https://doi.org/10.1002/ppp3.
10295
25. Grossi LL, Fernandes M, Silva MA, de Oliveira Bernardes C, Tuler AC, dos Santos PHD, et al. DArT-
seq-derived SNPs for the genus Psidium reveal the high diversity of native species. Tree Genetics &
Genomes. 2021; 17(2):23. https://doi.org/10.1007/s11295-021-01505-y
26. Myles S. Improving fruit and wine: what does genomics have to offer? Trends in Genetics. 2013; 29
(4):190–6. https://doi.org/10.1016/j.tig.2013.01.006 PMID: 23428114
27. Lowry DB, Hoban S, Kelley J, L., Lotterhos K, E., Reed L, K., Antolin M, F., et al. Breaking RAD: an eval-
uation of the utility of restriction site-associated DNA sequencing for genome scans of adaptation.
Molecular Ecology Resources. 2016; 17(2):142–52. https://doi.org/10.1111/1755-0998.12635 PMID:
27860289
28. Kaloshian I, Teixeira M. Advances in plant–nematode interactions with emphasis on the notorious nem-
atode genus Meloidogyne. Phytopathology. 2019; 109(12):1988–96. https://doi.org/10.1094/PHYTO-
05-19-0163-IA PMID: 31613704
29. Hussey RS, Janssen GJW. Root-knot nematode: Meloidogyne species. In: Starr JI, Cook R, Bridge J,
editors. Plant Resistance to Parasitic Nematodes. Wallingford, UK: CAB International; 2002. p. 43–70.
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 17 / 20
30. Oostenbrink M. Major characteristics of the relation between nematodes and plants. Wageningen:
Veenman. Report no. 66–4 46 p., 1966.
31. Inglis PW, Pappas MdCR, Resende LV, Grattapaglia D. Fast and inexpensive protocols for consistent
extraction of high quality DNA and RNA from challenging plant and fungal samples for high-throughput
SNP genotyping and sequencing applications. PLosOne. 2018; 13(10):e0206085. https://doi.org/10.
1371/journal.pone.0206085 PMID: 30335843
32. Shah TS, Liu JZ, Floyd JAB, Morris JA, Wirth N, Barrett JC, et al. optiCall: a robust genotype-calling
algorithm for rare, low-frequency and common variants. Bioinformatics. 2012; 28(12):1598–603. Epub
2012/04/12. https://doi.org/10.1093/bioinformatics/bts180 PMID: 22500001.
33. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MAR, Bender D, et al. PLINK: a tool set for
whole-genome association and population-based linkage analyses. Am J Hum Genet. 2007; 81
(3):559–75. Epub 2007/07/25. https://doi.org/10.1086/519795 PMID: 17701901.
34. Bradbury PJ, Zhang Z, Kroon DE, Casstevens TM, Ramdoss Y, Buckler ES. TASSEL: software for
association mapping of complex traits in diverse samples. Bioinformatics. 2007; 23(19):2633–5. https://
doi.org/10.1093/bioinformatics/btm308 PMID: 17586829
35. Chin C-S, Peluso P, Sedlazeck FJ, Nattestad M, Concepcion GT, Clum A, et al. Phased diploid genome
assembly with single-molecule real-time sequencing. Nature Methods. 2016; 13(12):1050–4. https://
doi.org/10.1038/nmeth.4035 PMID: 27749838
36. Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, et al. Phytozome: a comparative
platform for green plant genomics. Nucleic Acids Research. 2012; 40(D1):D1178–D86. https://doi.org/
10.1093/nar/gkr944 PMID: 22110026
37. Armstrong J, Hickey G, Diekhans M, Fiddes IT, Novak AM, Deran A, et al. Progressive Cactus is a mul-
tiple-genome aligner for the thousand-genome era. Nature. 2020; 587(7833):246–51. https://doi.org/10.
1038/s41586-020-2871-y PMID: 33177663
38. Stanke M, Diekhans M, Baertsch R, Haussler D. Using native and syntenicallymapped cDNA align-
ments to improve de novo gene finding. Bioinformatics. 2008; 24(5):637–44. https://doi.org/10.1093/
bioinformatics/btn013 PMID: 18218656
39. Waterhouse RM, Seppey M, Simão FA, Manni M, Ioannidis P, Klioutchnikov G, et al. BUSCO Applica-
tions from Quality Assessments to Gene Prediction and Phylogenomics. Molecular Biology and Evolu-
tion. 2018; 35(3):543–8. https://doi.org/10.1093/molbev/msx319 PMID: 29220515
40. Seppey M, Manni M, Zdobnov EM. BUSCO: Assessing Genome Assembly and Annotation Complete-
ness. In: M. K, editor. Gene Prediction Methods in Molecular Biology. 1962. New York: Humana; 2019.
p. 227–45.
41. Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies.
Bioinformatics 2014; 30(9):1312–3. https://doi.org/10.1093/bioinformatics/btu033 PMID: 24451623
42. Hickey G, Paten B, Earl D, Zerbino D, Haussler D. HAL: a hierarchical format for storing and analyzing
multiple genome alignments. Bioinformatics. 2013; 29(10):1341–2. https://doi.org/10.1093/
bioinformatics/btt128 PMID: 23505295
43. Kolmogorov M, Armstrong J, Raney BJ, Streeter I, Dunn M, Yang F, et al. Chromosome assembly of
large and complex genomes using multiple references. Genome Research. 2018; 28(11):1720–32.
https://doi.org/10.1101/gr.236273.118 PMID: 30341161
44. Navarro Gonzalez J, Zweig AS, Speir ML, Schmelter D, Rosenbloom Kate R, Raney BJ, et al. The
UCSC Genome Browser database: 2021 update. Nucleic Acids Research. 2021; 49(D1):D1046–D57.
https://doi.org/10.1093/nar/gkaa1070 PMID: 33221922
45. Fiddes IT, Armstrong J, Diekhans M, Nachtweide S, Kronenberg ZN, Underwood JG, et al. Compara-
tive Annotation Toolkit (CAT)—simultaneous clade and personal genome annotation. Genome
Research. 2018; 28(7):1029–38. https://doi.org/10.1101/gr.233460.117 PMID: 29884752
46. Cingolani P, Platts A, Wang LL, Coon M, Nguyen T, Wang L, et al. A program for annotating and predict-
ing the effects of single nucleotide polymorphisms, SnpEff. Fly. 2012; 6(2):80–92. https://doi.org/10.
4161/fly.19695 PMID: 22728672
47. Costa SR, Santos CAF, da Cunha e Castro JM. Inheritance of resistance to Meloidogyne enterolobii in
Psidium guajava x P. guineense hybrid. European Journal of Plant Pathology. 2017; 148(2):405–11.
https://doi.org/10.1007/s10658-016-1098-0
48. Scheben A, Batley J, Edwards D. Genotyping-by-sequencing approaches to characterize crop
genomes: choosing the right tool for the right application. Plant Biotechnology Journal. 2017; 15
(2):149–61. https://doi.org/10.1111/pbi.12645 PMID: 27696619
49. Darrier B, Russell J, Milner SG, Hedley PE, Shaw PD, Macaulay M, et al. A Comparison of Mainstream
Genotyping Platforms for the Evaluation and Use of Barley Genetic Resources. Frontiers in Plant Sci-
ence. 2019; 10(544). https://doi.org/10.3389/fpls.2019.00544 PMID: 31105733
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 18 / 20
50. Decker JE, Pires JC, Conant GC, McKay SD, Heaton MP, Chen K, et al. Resolving the evolution of
extant and extinct ruminants with high-throughput phylogenomics. Proceedings of the National Acad-
emy of Sciences. 2009; 106(44):18644. https://doi.org/10.1073/pnas.0904691106 PMID: 19846765
51. Miller JM, Kijas JW, Heaton MP, McEwan JC, Coltman DW. Consistent divergence times and allele
sharing measured from cross-species application of SNP chips developed for three domestic species.
Molecular Ecology Resources. 2012; 12(6):1145–50. ISI:000309739700019. https://doi.org/10.1111/
1755-0998.12017 PMID: 22994965
52. Kimura M, Ota T. The average number of generations until extinction of an individual mutant gene in a
finite population. Genetics. 1969; 63(3):701–9. https://doi.org/10.1093/genetics/63.3.701 PMID:
5399256.
53. Thornhill AH, Ho SYW, Ku¨lheim C, Crisp MD. Interpreting the modern distribution of Myrtaceae using a
dated molecular phylogeny. Molecular Phylogenetics and Evolution. 2015; 93:29–43. https://doi.org/10.
1016/j.ympev.2015.07.007 PMID: 26211451
54. Butler JB, Freeman JS, Vaillancourt RE, Potts BM, Glen M, Lee DJ, et al. Evidence for different QTL
underlying the immune and hypersensitive responses of Eucalyptus globulus to the rust pathogen Puc-
cinia psidii. Tree Genetics & Genomes. 2016; 12(3):1–13. https://doi.org/10.1007/s11295-016-0987-x
55. Freeman JS, Potts BM, Vaillancourt RE. Few Mendelian genes underlie the quantitative response of a
forest tree, Eucalyptus globulus, to a natural fungal epidemic. Genetics. 2008; 178(1):563–71.
ISI:000252742200044. https://doi.org/10.1534/genetics.107.081414 PMID: 18202395
56. Junghans DT, Alfenas AC, Brommonschenkel SH, Oda S, Mello EJ, Grattapaglia D. Resistance to rust
(Puccinia psidii Winter) in Eucalyptus: mode of inheritance and mapping of a major gene with RAPD
markers. Theor Appl Genet. 2003; 108(1):175–80. https://doi.org/10.1007/s00122-003-1415-9 PMID:
14504745.
57. Mamani EMC, Bueno NW, Faria DA, Guimaraes LMS, Lau D, Alfenas AC, et al. Positioning of the
major locus for Puccinia psidii rust resistance (Ppr1) on the Eucalyptus reference map and its validation
across unrelated pedigrees. Tree Genetics & Genomes. 2010; 6(6):953–62. https://doi.org/10.1007/
s11295-010-0304-z
58. Resende RT, Resende MDV, Silva FF, Azevedo CF, Takahashi EK, Silva-Junior OB, et al. Regional
heritability mapping and genome-wide association identify loci for complex growth, wood and disease
resistance traits in Eucalyptus. New Phytologist. 2017; 213(3):1287–300. https://doi.org/10.1111/nph.
14266 PMID: 28079935
59. Rosado CCG, da Silva Guimarães LM, Faria DA, de Resende MDV, Cruz CD, Grattapaglia D, et al.
QTL mapping for resistance to Ceratocystis wilt in Eucalyptus. Tree Genetics & Genomes. 2016; 12
(4):1–10. https://doi.org/10.1007/s11295-016-1029-4
60. Christie N, Tobias PA, Naidoo S, Kulheim C. The Eucalyptus grandis NBS-LRR Gene Family: Physical
Clustering and Expression Hotspots. Frontiers in Plant Science. 2016; 6:1238. Artn 1238 https://doi.
org/10.3389/fpls.2015.01238 PMID: 26793216
61. Van Bel M, Diels T, Vancaester E, Kreft L, Botzki A, Van de Peer Y, et al. PLAZA 4.0: an integrative
resource for functional, evolutionary and comparative plant genomics. Nucleic Acids Research. 2018;
46(D1):D1190–D6. https://doi.org/10.1093/nar/gkx1002 PMID: 29069403
62. Potuschak T, Lechner E, Parmentier Y, Yanagisawa S, Grava S, Koncz C, et al. EIN3-Dependent Reg-
ulation of Plant Ethylene Hormone Signaling by Two Arabidopsis F Box Proteins: EBF1 and EBF2. Cell.
2003; 115(6):679–89. https://doi.org/10.1016/S0092-8674(03)00968-1
63. Hershko A, Ciechanover A. The Ubiquitin system. Annual Review of Biochemistry. 1998; 67(1):425–79.
https://doi.org/10.1146/annurev.biochem.67.1.425 PMID: 9759494
64. Salazar-Iribe A, Zu
´ñiga-Sa
´nchez E, Mejı
´a EZ, Gamboa-deBuen A. Cell Wall Localization of Two
DUF642 Proteins, BIIDXI and TEEBE, during Meloidogyne incognita Early Inoculation. Plant Pathol J.
2017; 33(6):614–8. https://doi.org/10.5423/PPJ.NT.05.2017.0101 PMID: 29238286
65. Maurer-Stroh S, Dickens NJ, Hughes-Davies L, Kouzarides T, Eisenhaber F, Ponting CP. The Tudor
domain ‘Royal Family’: Tudor, plant Agenet, Chromo, PWWP and MBT domains. Trends in Biochemical
Sciences. 2003; 28(2):69–74. https://doi.org/10.1016/S0968-0004(03)00004-5 PMID: 12575993
66. Brasil JN, Cabral LM, Eloy NB, Primo LMF, Barroso-Neto IL, Grangeiro LPP, et al. AIP1 is a novel
Agenet/Tudor domain protein from Arabidopsis that interacts with regulators of DNA replication, tran-
scription and chromatin remodeling. BMC Plant Biology. 2015; 15(1):270. https://doi.org/10.1186/
s12870-015-0641-z PMID: 26538092
67. Chandler JW. The Hormonal Regulation of Flower Development. Journal of Plant Growth Regulation.
2011; 30(2):242–54. https://doi.org/10.1007/s00344-010-9180-x
68. Almeida EJ, Santos JM, Martins ABG. Influência do parasitismo pelo nematoide de galhas nos nı
´veis
de nutrientes em folhas e na fenologia de goiabeira ’Paluma’. Bragantia. 2011; 70:876–81.
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 19 / 20
69. Hurchanik D, Schmitt D.P., Hue NV, Sipes BS. Plant Nutrient Partitioning in Coffee Infected with Meloi-
dogyne konaensis. The Journal of Nematology. 2004; 36(1):76–84. PMID: 19262790
70. Nasr TA, Ibrahim IKA, El-Azab EM, Hassan MWA. Effect of root-knot nematodes on the mineral, amino
acid and carbohydrate concentrations of almond and peach rootstocks. Nematologica. 1980; 26
(2):133–8. https://doi.org/10.1163/187529280X00017
71. Li C, Xu J, Li J, Li Q, Yang H. Involvement of Arabidopsis Histone Acetyltransferase HAC Family Genes
in the Ethylene Signaling Pathway. Plant and Cell Physiology. 2014; 55(2):426–35. https://doi.org/10.
1093/pcp/pct180 PMID: 24287137
72. Gu W, Wang X, Zhai C, Xie X, Zhou T. Selection on Synonymous Sites for Increased Accessibility
around miRNA Binding Sites in Plants. Molecular Biology and Evolution. 2012; 29(10):3037–44. https://
doi.org/10.1093/molbev/mss109 PMID: 22490819
73. Iwamoto M, Tagiri A. MicroRNA-targeted transcription factor gene RDD1 promotes nutrient ion uptake
and accumulation in rice. The Plant Journal. 2016; 85(4):466–77. https://doi.org/10.1111/tpj.13117
PMID: 26729506
74. Tang J, Chu C. MicroRNAs in crop improvement: fine-tuners for complex traits. Nature Plants. 2017; 3
(7):17077. https://doi.org/10.1038/nplants.2017.77 PMID: 28665396
75. Vidal EA, Araus V, Lu C, Parry G, Green PJ, Coruzzi GM, et al. Nitrate-responsive miR393/AFB3 regu-
latory module controls root system architecture in Arabidopsis thaliana. Proceedings of the National
Academy of Sciences. 2010; 107(9):4477. https://doi.org/10.1073/pnas.0909571107 PMID: 20142497
PLOS ONE
SNPs associated to Meloidogyne enterolobii resistance in guava
PLOS ONE | https://doi.org/10.1371/journal.pone.0273959 November 2, 2022 20 / 20
