Available via license: CC BY 4.0
Content may be subject to copyright.
Page 1/16
Interrelationship among substrate utilization,
metabolic productions, and housekeeping-related
gene expression levels in Mortierella alpina CBS
754.68
hamid reza samadlouie ( hsamadlouie@yahoo.com )
Shahrood University of Technology
Shahrokh Gharanjik
Shahrood University of Technology
Abdolah Vatandost
Shahrood University of Technology
Side Maryam Ghasemi Tarvigi
Shahrood University of Technology
Research Article
Keywords: Mortierella alpine, lipid, magnesium oxide nanoparticles, RTqPCR, gene expression, housekeeping
genes
Posted Date: October 20th, 2022
DOI: https://doi.org/10.21203/rs.3.rs-2175105/v1
License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read
Full License
Page 2/16
Abstract
Mortierella alpina
has been well-known for producing a substantial amount of lipid with considerable amounts
of long poly unsaturated fatty acid. A combination of excess carbon with nitrogen-limited substrates
supplemented with magnesium oxide nanoparticles (MgONPs) were used to assay their effects on lipid and
dry weight biomass of
Mortierella alpina
CBS 754.68 productions and subsequently, the expressions of 10
possible candidate housekeeping genes during the fermentation time. The results indicated that proteins were
completely used up over the early stage of the fermentation and, as a result, DWB steadily declined at the end
of the fermentation time, while in medium with MgONPs,
Mortierella alpina
stayed at the growth phase during
the fermentation time. GeNorm and BestKeeper software were used to analyze statistically the data of Reverse
transcription polymerase chain reaction (RTqPCR) of 10 possible candidate housekeeping genes. Ultimately,
actin was rated as a best housekeeping gene candidate when
Mortierella alpina
experienced both growth and
death phases, on the other hand dihydropteridine reductase and 28s were realized as suitable ones when
Mortierella alpina stayed in a growth phase.
1. Introduction
Such is the high lipid synthesis with a considerable quantity of arachidonic acid that Mortierella genus have
become the most famous oleaginous species.(Samadlouie et al. 2014) Manipulation of the physical and
chemical conditions of the media is fast becoming a key instrument in industrial microbiology led for
stimulating secondary metabolites synthesis by microorganisms (Papanikolaou and Aggelis 2003; Yang and
Hu 2019). Of all inuential factors used, the key substrates of the fermentation media, carbon and nitrogen, are
the most indispensable factors, stimulating fungi growth and subsequently secondary metabolite productions
(Liu et al. 2012; Hao et al. 2014; Ye et al. 2015). In case of oleaginous fungi, especially
Mortierella alpine
, the
carbon to nitrogen ratio along with mineral supplementations exerts a great inuence on lipid production
(Samadlouie et al. 2018). In general, lipogenesis in
Mortierella alpina
is commenced by a surplus of glucose
along with the nitrogen deciency (Wynn and Ratledge 2000), More importantly, the over-expression of the
genes involved in
Mortierella alpina
lipid production is an effective approach to induce high amount of the
lipids.(Hao et al. 2015; Shi et al. 2018) Importantly, key substrate levels affect the gene expressions involved in
lipid and PUFA productions.(Takeno et al. 2005; Kikukawa et al. 2018) More to the point, gene expression
proling under various physical and chemical conditions denitely leads to recognition of the bottle neck
genes, in metabolic pathway (Chen et al. 2016). Of various analytical methods, qRT-PCR has been worldwide
applied as a pioneer in evaluation of the expression proles of genes. But, intra- and inter-kinetic RT-PCR
variations have posed diculties for precise analysis of relative gene expressions.(Song et al. 2019) With this
in mind, the most stable genes, namely housekeeping genes, compensated such variations (Guénin et al. 2009;
Ju et al. 2018; Qu et al. 2019). Notably, ribosomal (18S rRNA and 28S rRNA), actin, glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) and elongation factor (eEF1, eEF2, eEF-Tu, eIF-1A) genes have been
postulated to be stably expressed in the different phase of a fungus life cycle. As a result, these genes have
been considered the houskeeping genes in fungi.(Fang and Bidochka 2006; Nailis et al. 2006; Li et al. 2012;
Zampieri et al. 2014) However, there have been several reports declared that some of these stable genes,
ACT
,
translation elongation factors and
GAPDH
, were unstable under the given conditions.(Yan and Liou 2006; Teste
et al. 2009) Thereby, it appears to be critical to identify a set of reference genes in individual species. Above all,
a thorough examination of stable housekeeping genes for
Mortierella alpine
has not yet been carried out.
Page 3/16
Therefore, different substrates were used to evaluate the stability of 10 potential reference genes and
simultaneously analyze DWB and lipid productions. The BestKeeper and geNorm were served to analyze the
expression stability of the selected genes.
2. Materials And Methods
2.1 Fermentation
Mortierella alpina
CBS 754.68 was purchased from Centraalbureau Schimmelcultures (CBS, the Netherlands).
The strain was incubated in medium containing 30 g/l glucose and 7 g/l yeast extract as seed culture. The
10% (v/v) of the seed culture was added to fermentation medium then incubated in shack asks at 21°C, pH 6
for ve days. To induce oleaginous potential, nitrogen limited-media (10g/l yeast extract) with relatively high
glucose content (70g/l) were designed.(Samadlouie et al. 2012) MgONPs was also used to assess its effect on
Mortierella alpina
CBS 754.68 metabolisms. MgONPs was attained from US Research Nanomaterials Inc.,
which had 99% purity and an average size of 20 nm with polyhedral morphology.
2.2 Determination of substrates consumption and metabolic
productions
The biomass and fermentation broth were separated by vacuum ltration via Whatman No. 4 lter paper. No.1
Whatman paper was served to collect biomass washed with water twice, then freeze-dried to evaluate dry
weight biomass (DWB) and lipid content according to the method of (Jang et al. 2005). Fermentation broth
was used for the analysis of residual reducing sugar and nitrogen content. Reducing sugar concentration was
assayed by using dinitrosalicylic (DNS) colorimetric method.(Miller 1959) The Lowry’s method was used to
determined nitrogen concentration.(Lowry et al. 1951)
2.3 RNA isolation and purication
Mortierella alpine
biomass which was freeze-dried and then ground to a ne powder in liquid nitrogen was
served to extract total RNA on day 3, 4 and 5 according to the protocol of Bio Basic kit (EZ-10 Spin Column
Total RNA Miniprep Super Kit), The kit is of a membrane embedded spin column for tying up to 10 µg of RNA.
All impurities e.g. Nucleotides and proteins do not bind to the EZ-10 Column. UV spectrophotometer (Nano
DROP) quantied the extracted RNA. For insurances of the high purity and protein content of the extracted
RNA, the ratio of A260/280 was measured between 2.0-2.1. The integrity of RNA was veried by using 1.5%
agarose gel electrophoresis. the high-quality puried RNA was used to create a complementary strand of cDNA
2.4 cDNA synthesis
According to the Takara cDNA synthesis kit’s protocol, the high-quality puried RNA was used to synthesize
cDNA. The integrity of CDNA was determined by loading the prepared CDNA on a 1.5 per cent gel. NanoDrop
2000 was applied to assess the quantity and quality of CDNA. a negative control containing no cDNA, but total
extracted RNA was also used to assess whether the extracted RNA was cleaned from residual genomic DNA or
not.
2.5 Quantitative real-time RT-PCR
Page 4/16
The
Mortierella alpine
transcriptome data were used to design primer for 10 candidate genes. The target genes
sequences were obtained from NCBI site (Table1).
The primers used in this research were designed by Gene Runner Design software and all designed primers
which met the criteria sent to Takapouzist Company (www.takapouzist.com) for construction. Such criteria
were as follows: primer lengths of 20–22 bp, GC contents of 45–55%, melting temperature (Tm) in a range of
55–60°C and amplicon lengths of 60–150 bp (table − 2). All primers were also checked for primer dimmers,
hairpin and stem loop. Following that, Primer Blast program was run at NCBI to verify the expected unique DNA
amplication with the primers.
The qPCR was performed in a StepOnePlus Real-Time PCR (96-well). Takara Bio SYBR Green Master Mix was
used to carry out the RT-qPCR reactions. As regards the instruction of Takara kit, quality and quantity of cDNA
was determined using NanoDrop 2000. RT-qPCR conditions were: 95˚C for 10 min, followed by 40 cycles of
95˚C/15 s, annealing (regards the optimum temperature)/30 s, and 95˚C/30. At the end of the process, 60 ˚C/1
min was applied for nal extension. At the end of the multiple copies of the target genes, a melting curve for
each primer pair were performed by increasing the temperature, 0.5˚C every 5 s, which was from 60˚C to 95˚C.
2.6 Statistical data analysis
GeNorm software (http://medgen.ugent.be/~jvdesomp/genorm) and gene expression stability (M) was used
to carry out the analysis of the Ct values obtained from RT-qPCR.(Vandesompele et al. 2002) Bestkeeper
program was also applied to validate the data and then, the bestkeeper index determined the best reference
gene (s).(Pfa 2001) Data were introduced as mean values with standard deviation (± SD) from triplicate
experiments. SPSS 16.0 (SPSS Inc., Chicago, IL, USA) software was served to analyze the data.
3. Result And Discussion
3.1 Investigation of biomass production during the
fermentation time
Mortierella alpina CBS 754.68
as a commercial source of arachidonic acid is able to accumulate high level of
lipid. To be more specic, the nitrogen-limited medium triggers lipogenesis in
Mortierella alpina
, while
inhabiting cell growth (Ratledge 1994). Among various key macro elements required for cellular biomass,
mineral elements are found to have a number of biological roles. Notably, Magnesium (Mg2+) as a cofactor of
different enzymes stimulates a net rise in biomass accumulation.(Sissi and Palumbo 2009) On the other hand,
many researchers maintain that MgONPs had been found to have antimicrobial effects.(Nguyen et al. 2018)
Besides these outstanding capability of nanoparticle, such agents are able to enhance the microbiological
reaction rates.(Shan et al. 2005) Considering that, the initial examination indicated that 0.05 g/l MgONPs was
able to stimulate
Mortierella alpina CBS 754.68
metabolites. On the other hand, the trend was reversed with
increasing concentrations of MgONPs (data not shown). Thereby, A 0.05 g/l MgONPs was used in the medium
containing glucose and yeast extract. Lipid production, glucose consumption and biomass accumulation were
monitored simultaneously during fermentation.
Page 5/16
To medium without MgONPs, DWB experienced a continual rise over the 4 days. (gure-1). DWB hit the peak of
just under 1.6 g/l at day 4. After uptrends for the four consecutive days, DWB in day 5 marked a drop in
content. It was expected that fungi entered the death phase at that time. To medium with MgONPs (DWBn),
over the fermentation time, DWB continued to see a rise. In comparison with the aforementioned medium, the
biomass production was lower, while the cells stood in the growth phase during the whole of the fermentation
time
3.2 Glucose and protein consumption during the fermentation
time
Two key substrates were monitored during the fermentation time. The results indicated that protein content
was used up completely over the rst day. As a consequence, the excess content of carbon sources was
assimilated to produce high quantity of lipid. Various carbon sources like rice bran, wheat bran, potato waste,
molasses, potato starch, rice straw were utilized to stimulate lipid production.(Jang et al. 2005; Samadlouie et
al. 2018) More to the point, The uptake of glucose by oleaginous microorganism is far easier than that of the
other carbon sources. Glucose was claimed to be by far the best substrate for growth and lipid production by
oleaginous fungi (Hao et al. 2015). As regards the medium without MgONPs, the rate of glucose consumption
between 3th and 4th day were the highest while the trend was slower for the rest of fermentation time. To
medium with MgONPs, the rate of glucose consumption varied signicantly over the ve days of fermentation.
At the rst three days, the trend was slower than that of the next one day of fermentation. To be more precise,
the rate of glucose consumption was the highest Between 3 and 4 day. By contrast, the trend was on the
decline during the last one day of fermentation (gure-2).
3.3 Lipid production during the fermentation time
As can be seen in Fig.3, the medium without MgONPs,
Mortierella alpina
was experienced a continual rise in
lipid content during the fermentation time. The trend was the least between 3th and 4th day. Notably, lipid
accumulation considerably promoted once glucose came to the least amount of it. It is postulated that the
absorbed glucose might have been converted into lipid. This result was in agreement with (Hwang et al. 2005)
which reported that a considerable amount of lipid was obtained even when the glucose content dipped as low
as 10 g /l. The result indicated that the increasing rate of lipid production varied during the fermentation in
medium containing MgONPs. The highest amount of lipid was accumulated between 3th and 4th of
fermentation (gure-3). There were a direct correspondence between lipid production and biomass
accumulation in medium supplemented with MgONPs. (Figs.1 and 3). Lipid and biomass accumulation
sharply increased simultaneously as the considerable quantity of glucose was consumed. However, it has
been normally expected that the lipid production is triggered as
Mortierella alpine
CBS 756.4 enters in
stationary phase. Importantly, Ratledge et al 1994 put forwarded the theory that lipid is concomitantly
accumulated with the reduction of protein and nucleic acids biosynthetic.(Ratledge 1994) Growth-coupled lipid
synthesis has been observed in some species of
Mortierella alpine
such as
Mortierella alpina
LPM 301(Eroshin
et al. 2002) and some oleaginous yeast like
Cryptococcus terricolus
(Pedersen 1961), and
Debaryomyces
globosu.
(Dedyukhina et al. 1994)
3.4 Gene expression during the death and growth phases in
medium without MgONPs
Page 6/16
Mortierella alpine
is a potential source of lipid with the high content of arachidonic acid (Samadlouie et al.
2018). During the growth phase, lipid mainly comprises the structural fatty acid like oleic acid,(Zhu et al. 2006;
Gray et al. 2007) Having said that, when
Mortierella alpine
enters the stationary and death phase, the
appreciable proportion of saturated fatty acids are mainly converted to long poly unsaturated fatty acids as
response to nutritional stresses. To be more precise, the aging of
Mortierella alpine
plays a vital role in
arachidonic acid accumulation.(Ji et al. 2014) Thereby, to that end, the expressions of genes involved in lipid
and arachidonic acid at the death and growth phases seems to be important. Some genes selected for use
with
mortierela alpina
were served as references in other fungal species, including 28s,(Chen et al. 2016) actin,
glyceraldehyde-3‐phosphate dehydrogenase,(Hacquard et al. 2013) cytochrome b5 reductase (Nailis et al.
2006) and histone H3.2 and H4.2 genes.(Tao et al. 2016) As mentioned before the determination of the stable
housekeeping genes have not yet been carried out in
Mortierella alpine
.
Present results indicated that the candidate genes in growth phase, by comparison, had the higher expression
rates (data not shown). It could be stated that the reduction in microorganism basal metabolic rate during the
death phase caused a fall in the gene expression rate. Boutte and Crosson reported that the exhaustion of key
substrates in medium triggered down regulation of some rRNA synthesis.(Boutte and Crosson 2011) On the
other hand, housekeeping genes must have the least variation in expression at the both growth and death
phases.
As can be seen in Table − 3, glycerol-3-pHospHate dehydrogenase and NADH-red genes had the lowest
standard deviations with appropriate CV indexs. On the other hand, the Best Keeper indexes were low so that
glycerol-3-pHospHate dehydrogenase and NADH-red genes did not regarded as suitable housekeeping genes.
The next candidate gene was dihydrofolate reductase with a high standard deviation of 0.47. This gene also
had a low CV index that could be regarded as a good candidate for a high-stability housekeeping gene, except
for bestkeeper index, so this gene was also eliminated. The translational elongation factor 1 alpHa and
putative 60S ribosomal genes had the suitable P values, M values and Best keeper indexs, while CV was out of
the standard range. The lowest quantity of M (0.149) and P values (0.001) with the highest keeper indexes
(0.99) were typically indicated that the stable candidates for housekeeping gene could be actin. Various
research done on fungi introduced actin as a best housekeeping gen.(Samadlouie et al. 2014) (Tan et al. 2017)
As a result, actin would be a suitable housekeeping gene characteristic if cells experienced the growth and
death phase during the cultivation time.
3.5 Determination the stable housekeeping genes in medium
containing MgONPs
As can be seen in table 4 the translation elongation factor 1 alpHa and actin genes had a low standard
deviation and CV indexes with suitable M factors, while p values were insignicant so these genes were
excluded. The low Bestkeeper indexes for glycerol-3-pHospHate dehydrogenase, dihydrofolate reductase
genes, NADH-red, putative 60S ribosomal and shock protein 10 caused these genes to be overlooked.
dihydropteridine reductase and 28s genes with appropriate Bestkeeper index, standard deviation as well as the
low CV and M factor below 1.5 genes were selected as a stable candidate genes.
In this step of fermentation it seemed these two genes were suitable to introduce as best housekeeping genes.
Luo et al., 2019 reported that 28s could be considered a stable gen to normalize the data of Lentinula edodes
Page 7/16
gene expressions(Luo et al. 2019) Zhou et al., 2012 also reported 28s gene under given condition, namely
nutritional and stress condition, was selected as the most stable gene.(Zhou et al. 2012)
4. Conclusion
The biomass and lipid production of
Mortierella alpina CBS 754.68
under two different conditions, in the
presence and absence of MgONPs., were analyzed, displayed the effect of the MgONPs on lipid and biomass
accumulation. The balance between metabolism and substrates has been found to be critical for the ecient
lipid production in
Mortierella alpina
under nitrogen limitation conditions. Notably, the presence of MgONPs
exerted a positive inuence on the regulation of the balance, resulting in increased lipid production under
nitrogen starvation. As regards the two conditions of the submerge fermentation; 10 potential reference genes
were also assayed to recognize their stability during the 5 day fermentation period. Statistic analysis indicated
that when cell entered the death phase, actin was of the most stable expression. On the other hand, 28s and
dihydropteridine reductase were identied as the appropriate reference genes when
Mortierella alpina
stayed in
growth phase. All in all, the ideal reference genes under various experimental conditions have been proposed
for correct interpretation of qPCR results in
Mortierella alpina CBS 754.68
.
Declarations
Ethical Approval
Not applicable
Consent to Participate
Not applicable
Consent to Publish
Not applicable
Authors Contributions
All authors contributed to the study conception and design. Material preparation, data collection and analysis
were performed by [hamid reza samadlouie], [Shahrokh Gharanjik], [Abdolah Vatandost] and [Side Maryam
Ghasemi Tarvigi]. The rst draft of the manuscript was written by [hamid reza samadlouie] and all authors
commented on previous versions of the manuscript. All authors read and approved the nal manuscript.
Funding
Partial nancial support was received from shahrood university of technology
Competing Interests
The authors have no conicts of interest to declare that are relevant to the content of this article
Availability of data and materials
Page 8/16
The original data and materials used to support the ndings of this study are included within the article.
References
1. Boutte CC, Crosson S (2011) The complex logic of stringent response regulation in Caulobacter
crescentus: starvation signalling in an oligotrophic environment. Mol Microbiol 80:695–714
2. Chen C, Xie T, Ye S et al (2016) Selection of reference genes for expression analysis in the
entomophthoralean fungus Pandora neoaphidis. brazilian J Microbiol 47:259–265
3. Dedyukhina EG, Kamzolova SV, Eroshin VK (1994) Study of lipid synthesis and biomass composition of a
constitutive lipid producer Debaryomyces globosus under conditions of continuous cultivation.
Microbiology 63:567–571
4. Eroshin VK, Dedyukhina EG, Satroutdinov AD, Chistyakova TI (2002) Growth-coupled lipid synthesis in
Mortierella alpina LPM 301, a producer of arachidonic acid. Microbiology 71:169–172
5. Fang W, Bidochka MJ (2006) Expression of genes involved in germination, conidiogenesis and
pathogenesis in Metarhizium anisopliae using quantitative real-time RT-PCR. Mycol Res 110:1165–1171
. Gray J, Groeschler S, Le TGZ (2007) Membrane structure. SWF)Davidson Coll Retrieved 1–11
7. Guénin S, Mauriat M, Pelloux J et al (2009) Normalization of qRT-PCR data: the necessity of adopting a
systematic, experimental conditions-specic, validation of references. J Exp Bot 60:487–493
. Hacquard S, Kracher B, Maekawa T et al (2013) Mosaic genome structure of the barley powdery mildew
pathogen and conservation of transcriptional programs in divergent hosts. Proc Natl Acad Sci
110:E2219–E2228
9. Hao G, Chen H, Gu Z et al (2015) Metabolic engineering of Mortierella alpina for arachidonic acid
production with glycerol as carbon source. Microb Cell Fact 14:205
10. Hao G, Chen H, Wang L et al (2014) Role of malic enzyme during fatty acid synthesis in the oleaginous
fungus Mortierella alpina. Appl Environ Microbiol 80:2672–2678
11. Hwang B-H, Kim J-W, Park C-Y et al (2005) High-level production of arachidonic acid by fed-batch culture
of Mortierella alpina using NH 4 OH as a nitrogen source and pH control. Biotechnol Lett 27:731–735
12. Jang H-D, Lin Y-Y, Yang S-S (2005) Effect of culture media and conditions on polyunsaturated fatty acids
production by Mortierella alpina. Bioresour Technol 96:1633–1644
13. Ji X-J, Ren L-J, Nie Z-K et al (2014) Fungal arachidonic acid-rich oil: research, development and
industrialization. Crit Rev Biotechnol 34:197–214
14. Ju W, Smith AO, Sun T et al (2018) Validation of Housekeeping Genes as Reference for Reverse-
Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells
15. Kikukawa H, Sakuradani E, Ando A et al (2018) Arachidonic acid production by the oleaginous fungus
Mortierella alpina 1S-4: a review. J Adv Res 11:15–22
1. Li QQ, Skinner J, Bennett JE (2012) Evaluation of reference genes for real-time quantitative PCR studies in
Candida glabrata following azole treatment. BMC Mol Biol 13:1–13
17. Liu X, Ji X, Zhang H et al (2012) Development of a dened medium for arachidonic acid production by
Mortierella alpina using a visualization method. Appl Biochem Biotechnol 168:1516–1527
Page 9/16
1. Lowry OH, Rosebrough NJ, Farr AL et al (1951) Protein measurement with the Folin phenol reagent. J Biol
Chem 193:265–275
19. Luo Y, Wang G, Wang C et al (2019) Selection and validation of reference genes for qRT-PCR in Lentinula
edodes under different experimental conditions. Genes (Basel) 10:647
20. Miller GL (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem
31:426–428
21. Nailis H, Coenye T, Van Nieuwerburgh F et al (2006) Development and evaluation of different
normalization strategies for gene expression studies in Candida albicans biolms by real-time PCR. BMC
Mol Biol 7:25
22. Nguyen N-YT, Grelling N, Wetteland CL et al (2018) Antimicrobial activities and mechanisms of
magnesium oxide nanoparticles (nMgO) against pathogenic bacteria, yeasts, and biolms. Sci Rep 8:1–
23
23. Papanikolaou S, Aggelis G (2003) Modeling lipid accumulation and degradation in Yarrowia lipolytica
cultivated on industrial fats. Curr Microbiol 46:398–402
24. Pedersen TA (1961) Lipid formation in Cryptococcus terricolus 1. Nitrogen nutrition and lipid formation.
Acta Chem Scand 15:651–662
25. Pfa MW (2001) A new mathematical model for relative quantication in real-time RT–PCR. Nucleic Acids
Res 29:e45–e45
2. Qu R, Miao Y, Cui Y et al (2019) Selection of reference genes for the quantitative real-time PCR
normalization of gene expression in Isatis indigotica fortune. BMC Mol Biol 20:9
27. Ratledge C (1994) Yeasts, moulds, algae and bacteria as sources of lipids. Technological advances in
improved and alternative sources of lipids. Springer, pp 235–291
2. Samadlouie H-R, Hamidi-Esfahani Z, Alavi S-M, Varastegani B (2014) Expression analysis for genes
involved in arachidonic acid biosynthesis in Mortierella alpina CBS 754.68. Brazilian J Microbiol 45:439–
445
29. Samadlouie H-R, Hamidi-Esfahani Z, Soltani-Najafabadi S-MAM et al (2012) Statistical approach to
optimization of fermentative production of oil and arachidonic acid from Mortierella alpine CBS 754.68.
Afr J Microbiol Res 6:1559–1567
30. Samadlouie HR, Nurmohamadi S, Moradpoor F, Gharanjik S (2018) Effect of low-cost substrate on the
fatty acid proles of Mortierella alpina CBS 754.68 and Wickerhamomyces siamensis SAKSG. Biotechnol
Biotechnol Equip 32:1228–1235
31. Shan G, Xing J, Zhang H, Liu H (2005) Biodesulfurization of dibenzothiophene by microbial cells coated
with magnetite nanoparticles. Appl Environ Microbiol 71:4497–4502
32. Shi N, Mao W, He X et al (2018) Co-expression of exo-inulinase and endo-inulinase genes in the oleaginous
yeast Yarrowia lipolytica for ecient single cell oil production from inulin. Appl Biochem Biotechnol
185:334–346
33. Sissi C, Palumbo M (2009) Effects of magnesium and related divalent metal ions in topoisomerase
structure and function. Nucleic Acids Res 37:702–711
Page 10/16
34. Song Y, Wang Y, Guo D, Jing L (2019) Selection of reference genes for quantitative real-time PCR
normalization in the plant pathogen Puccinia helianthi Schw. BMC Plant Biol 19:20
35. Takeno S, Sakuradani E, Murata S et al (2005) Molecular evidence that the rate-limiting step for the
biosynthesis of arachidonic acid in Mortierella alpina is at the level of an elongase. Lipids 40:25–30
3. Tan L, Zhuo R, Li S et al (2017) Differential expression of desaturase genes and changes in fatty acid
composition of Mortierella sp. AGED in response to environmental factors. J Sci Food Agric 97:1876–
1884
37. Tao Y, Van Peer AF, Huang Q et al (2016) Identication of novel and robust internal control genes from
Volvariella volvacea that are suitable for RT-qPCR in lamentous fungi. Sci Rep 6:29236
3. Teste M-A, Duquenne M, François JM, Parrou J-L (2009) Validation of reference genes for quantitative
expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Mol Biol 10:99
39. Vandesompele J, De Preter K, Pattyn F et al (2002) Accurate normalization of real-time quantitative RT-
PCR data by geometric averaging of multiple internal control genes. Genome Biol 3:research0034–
research0031
40. Wynn JP, Ratledge C (2000) Evidence that the rate-limiting step for the biosynthesis of arachidonic acid in
Mortierella alpina is at the level of the 18: 3 to 20: 3 elongase. Microbiology 146:2325–2331
41. Yan H-Z, Liou R-F (2006) Selection of internal control genes for real-time quantitative RT-PCR assays in the
oomycete plant pathogen Phytophthora parasitica. Fungal Genet Biol 43:430–438
42. Yang Y, Hu B (2019) Investigation on the cultivation conditions of a newly isolated fusarium fungal strain
for enhanced lipid production. Appl Biochem Biotechnol 187:1220–1237
43. Ye C, Xu N, Chen H et al (2015) Reconstruction and analysis of a genome-scale metabolic model of the
oleaginous fungus Mortierella alpina. BMC Syst Biol 9:1
44. Zampieri D, Nora LC, Basso V et al (2014) Validation of reference genes in Penicillium echinulatum to
enable gene expression study using real-time quantitative RT-PCR. Curr Genet 60:231–236
45. Zhou Y-H, Zhang Y-J, Luo Z-B et al (2012) Selection of optimal reference genes for expression analysis in
the entomopathogenic fungus Beauveria bassiana during development, under changing nutrient
conditions, and after exposure to abiotic stresses. Appl Microbiol Biotechnol 93:679–685
4. Zhu M, Yu L-J, Li W et al (2006) Optimization of arachidonic acid production by fed-batch culture of
Mortierella alpina based on dynamic analysis. Enzyme Microb Technol 38:735–740
Tables
Table.1 Selected housekeeping gene for expression analysis
Page 11/16
Gene name Gene symbol Accession number
28Sribosomal RNA 28 s KC018438.1
actin actin AB490771.1
putativeheat shock protein 10 PHSP10 AJ249748.1
dihydrofolate reductase mRNA DFR KU987834.1
putative60Sribosomal proteinL27A,exons1–3 P60S-L27A AJ249749.1
glycerol-3-phosphate dehydrogenase type 1 G3PD KT344118.1
dihydropteridine reductase DPR JQ281475.1
translationelongation factor1 alpha gene TEF1a EU736263.1
NADH-cytochromeb5 reductase NADH-CB5R AB020035.1
histone H3.2 and H4.2 genes H3.2 and H4.2 AJ249813.1
Table.2 The primer sequences and amplication eciency of candidate reference genes
Gene
symbol
Forward primer(5′~ 3′) Reverse primer(5′~ 3′) Tm
(°C)
PCR
eciency
(100%)
Amplicon
size (bp)
DPR TCCTGTTACCCTTGACACG CAGCTTGCCGGATGTAAC 60 1.98 139
G3PD CATTATCCGCCTTGGTCTC CCAGTCGTGACATGGGC 60.5 1.95 162
P60S-
L27A TCGGTAAGGTCGGTATGC GTGTTCTTGGCAGCGTTC 59 2.02 124
DFR CCATTCCTGCAAAGT TCC GCCACCATCGGGTTATT 57 1.94 106
TEF1a1 TGGTTGTCACCTTCGCC ACGGAGACGTTCTTGACG 60 2.00 124
PHSP10 GGAAGCGTTGTTAAGGTTG CTTGGCAAGGATCTCGG 60 2.13 66
ACTIN CTAACCGCGAGAAGATGAC GAACAGTGTGGGTGACAC 60 1.90 98
28S CCATGCGCGTAATGAAAG ACCATCTTTCGGGTCCC 60 2.02 100
TEF1a2 CGGTGGTATCGGAACAGTTC TCTCGACGGACTTGACTTCA 60 1.99 113
NADH-
CB5R GCT GCC GAC ATC AAG GTC CTTCGAGACGGCATTGACC 60 1.94 109
H3.2
and
H4.2
GCGT ATC TCC GGC CTC AT GCTT GGC GTG CTC AGT G 60 2.01 101
Page 12/16
Table.3 Statistics results by Best Keeper and geNorm software for ten selected genes based on Ct values in
medium without MgONPs.
DFR Phsp1010 DPR G3PD P60S-
L27A
NADH-
CB5R
H3.2
and
H4.2
TEF1a1 actin 28s
min
[CP] 30.19 27.43 29.00 31.90 16.24 23 11.99 23 17.9 4.36
max
[CP] 32.00 32.60 33.81 33.10 20.60 27.89 29.78 33 21.7 12
std
dev [±
CP]
0.47 1.96 2.11 0.43 1.82 1.68 6.16 2.59 1.73 3.42
CV [%
CP] 1.52 6.52 6.68 1.33 10.01 6.74 30.3 8.9 8.71 89.40
coeff.
of
corr. [r]
-0.37 0.958 0.99 -0.541 0.986 0.325 0.918 0.72 0.99 0.997
p-
value 0.463 0.003 0.001 0.267 0.001 0.393 0.001 0.029 0.001 0.001
M
value 0.218 0.153 0.152 0.216 0.157 0.285 0.473 0.276 0.149 0.607
Table.4 Statistics results by Best Keeper and geNorm software for ten selected genes based on Ct values in in
medium with MgONPs.
Page 13/16
DFR Phsp1010 DPR G3PD P60S-
L27A
NADH-
CB5R
H3.2
and
H4.2
TEF1a1 actin 28s
min
[CP] 26.40 23.64 32.61 29.28 21 17.5 18 14.6 30.41 18.61
max
[CP] 28.63 27.29 36 31.95 24 25.1 24 26.8 32.00 22.26
std
dev [±
CP]
0.62 1.09 0.97 0.81 0.88 2.43 2.22 5.03 0.42 1.08
CV [%
CP] 2.25 4.23 2.87 2.64 3.94 11.23 10.27 26.65 1.36 5.29
coeff.
of corr.
[r]
0.69 0.692 0.962 0.412 0.895 -0.412 0.889 0.729 0.177 0.963
p-
value 0.039 0.039 0.001 0.269 0.001 0.269 0.001 0.026 0.646 0.001
M
value 0.08 0.079 0.06 0.078 0.07 0.394 0.262 0.419 0.063 0.086
Figures
Page 14/16
Figure 1
Percentage of DWB (medium without MgONPs) and DWBn (medium with MgONPs) over the ve day
fermentation
Page 15/16
Figure 2
reduced sugar (medium without MgONPs) and reduced sugar N (medium with MgONPs) over the ve day
fermentation
Page 16/16
Figure 3
percentage of Lipid (medium without MgONPs) and lipid N (medium with MgONPs) accumulation in DWB over
the ve day fermentation
