Determination of Inherent Antibiotic Drug Resistance and Pathogenic Potential of Different E. coli Phylotypes from Diarrheic Calves in Arid and Semiarid Regions of India

Abstract

India has a large population of dairy animals, and calf diarrhea is a major concern in the dairy sector. Escherichia coli have varying degrees of virulence; however, this study aimed to understand the association of different phylotypes with calf diarrhea and elucidate their inherent virulence potential as well as their antimicrobial drug resistance potential. In the current study, the phylogenetic analysis showed that the majority of the isolates (19/35; 54.28%) belonged to phylotype B1, followed by A (9/35; 20%), E (4/35; 11.42%), C (2/35; 5.71%), and F (2/35; 5.71%).On the basis of virulence genes, isolates were classified into ETEC (25.71%), STEC (48.57%) and non-ETEC/STEC (25.71%). PhylotypesB1 and F predominated in virulence potential, followed by phylotypesC and E. Both isolates of phylotype F were found to be STEC pathotypes. PhylotypesF and B1 were found to carry antimicrobial resistance genes against all four classes of antimicrobials, while phylotype E carried antimicrobial drug resistance genes for three classes, and phylotypes C and A showed the least number of resistance genes. In conclusion, isolates belonging to phylotypes B1 and F were of high pathogenic potential due to the carriage of a higher number of virulence and antibiotic resistance genes.

Full text

Page 1/15
Determination of Inherent Antibiotic Drug
Resistance and Pathogenic Potential of Different E.
coli Phylotypes from Diarrheic Calves in Arid and
Semiarid Regions of India
Sudesh Kumar (  sudeshdedar@gmail.com )
College of Veterinary and Animal Science Bikaner https://orcid.org/0000-0002-9230-0937
Suvidhi Choudhary
RAJUVAS: Rajasthan University of Veterinary and Animal Sciences
Ram Kumar
RAJUVAS: Rajasthan University of Veterinary and Animal Sciences
Kritika Dhial
RAJUVAS: Rajasthan University of Veterinary and Animal Sciences
Taruna Bhati
RAJUVAS: Rajasthan University of Veterinary and Animal Sciences
Ramesh Kumar Dedar
NRCE: National Research Centre on Equines
Research Article
Keywords: Escherichia coli, Phylotypes, Pathotypes, Calf diarrhea, Antimicrobial resistance
Posted Date: October 5th, 2022
DOI: https://doi.org/10.21203/rs.3.rs-2058974/v1
License:   This work is licensed under a Creative Commons Attribution 4.0 International License. 
Read Full License

Page 2/15
Abstract
India has a large population of dairy animals, and calf diarrhea is a major concern in the dairy sector.
Escherichia coli
have varying degrees of virulence; however, this study aimed to understand the
association of different phylotypes with calf diarrhea and elucidate their inherent virulence potential as
well as their antimicrobial drug resistance potential. In the current study, the phylogenetic analysis
showed that the majority of the isolates (19/35; 54.28%) belonged to phylotype B1, followed by A (9/35;
20%), E (4/35; 11.42%), C (2/35; 5.71%), and F (2/35; 5.71%).On the basis of virulence genes, isolates
were classied into ETEC (25.71%), STEC (48.57%) and non-ETEC/STEC (25.71%). PhylotypesB1 and F
predominated in virulence potential, followed by phylotypesC and E. Both isolates of phylotype F were
found to be STEC pathotypes. PhylotypesF and B1 were found to carry antimicrobial resistance genes
against all four classes of antimicrobials, while phylotype E carried antimicrobial drug resistance genes
for three classes, and phylotypes C and A showed the least number of resistance genes. In conclusion,
isolates belonging to phylotypes B1 and F were of high pathogenic potential due to the carriage of a
higher number of virulence and antibiotic resistance genes.
Introduction
Calf diarrhea is a multifactorial disease triggered by several infectious and noninfectious factors causing
economic losses (Radostits et al., 2007). In India, neonatal calf mortality in the rst month of life
accounted for 80–85% of the total mortality (Singh et al., 2009), with an incidence of 16.03%, which
differs signicantly with herd size (P < 0.001) (Patbandha et al., 2017).
Escherichia coli
is one of the most
important causative agents of diarrhea in newborn calves (Nguyen et al., 2011).
Escherichia coli
is a
gram-negative, rod-shaped, agellated, nonsporulating and facultative anaerobic bacterium of the family
Enterobacteriaceae
. There are six pathotypes of diarrheagenic
E. coli
[viz. enteropathogenic
E. coli
(EPEC),
enterotoxigenic
E. coli
(ETEC), enterohemorrhagic
E. coli
(EHEC)/Shiga toxin-producing
E. coli
(STEC),
enteroinvasive
E. coli
(EIEC), enteroaggregative
E. coli
(EAEC), and diffusively adherent
E. coli
(DAEC)
(Kaper et al., 2004)], and there are seven phylotypes [via. (A, B1, B2, C, D, E, F]. Furthermore, 186 somatic
(O), 55 agellar (H) and 80 capsular (K) antigens of
E. coli
have been identied, and there are over 160
serological types of
E. coli.
Among pathotypes, ETEC and STEC cause serious illness and mortality in
calves. The identication of pathogenic serotypes/pathotypes is a laborious procedure and requires a
high degree of technical support. In contrast, the phylotyping of
E. coli
is a rapid and cost-effective
method. Currently, very few reports are available that provide insight into the association of phylotypes
with calf diarrhea, as seen in the case of
E. coli
serotypes and pathotypes. However, some reports have
suggested that out of seven phylotypes, B2 and D (causing extraintestinal infections) have not been
isolated from calf diarrhea to date. Likewise, the inherent drug resistance and pathogenic potential of
different
E. coli
phylotypes are unknown. Hence, this study was designed to understand the association
of different phylotypes with calf diarrhea and to elucidate their inherited antimicrobial drug resistance
and virulence potential.

Page 3/15
Materials And Methods
In this study, 35
E. coli
isolates were selected for the phylotyping study. All these isolates were isolated
from diarrheic calves below one month of age and conrmed by culture, biochemical and 16S rRNA
species-specic-based ribotyping (Kumar et al., 2022).
Phylotyping of E. coli isolates by Quadruplex PCR:
Quadruplex PCR for phylogenetic group identication of
E. coli
was performed as per the method
described by Clermont et al. (2013). The primer pairs used for the PCR are given in Table 1.

Table 1
Details of the primers used for the phylo-typing of E. coli isolates
PCR reaction Primer ID Target gene Sequence (5’---- 3’) Amplicon size
(bp)
Quadruplex chuA.1b
chuA
ATGGTACCGGACGAACCAAC 288
chuA.2 TGCCGCCAGTACCAAAGACA
yjaA.1b
yjaA
CAAACGTGAAGTGTCAGGAG 211
yjaA.2b AATGCGTTCCTCAACCTGTG
TspE4C2.1b
TspE4.C2
CACTATTCGTAAGGTCATCC 152
TspE4C2.2b AGTTTATCGCTGCGGGTCGC
AceK.f
arpA
AACGCTATTCGCCAGCTTGC 400
ArpA1.r TCTCCCCATACCGTACGCTA
Group E ArpAgpE.f
arpA
GATTCCATCTTGTCAAAATATGCC 301
ArpAgpE.r GAAAAGAAAAAGAATTCCCAAGAG
Group C trpAgpC.1
trpA
AGTTTTATGCCCAGTGCGAG 219
trpAgpC.2 TCTGCGCCGGTCACGCCC
Internal control trpBA.f
trpA
CGGCGATAAAGACATCTTCAC 489
trpBA.r GCAACGCGGCCTGGCGGAAG
The PCR was carried out in a nal reaction volume of 25 µl using 0.2 ml thin walled sterile and nuclease-
free PCR tubes (Microcentrifuge tubes, Labware). Puried
E. coli
isolates were grown in Luria Bertani
broth and the next day DNA was extracted by PCI conventional methods. The amounts of primer used are
20 pmol, except for
Ace
K.f (40 pmol),
Arp
A1.r (40 pmol),
trp
BA.f (12 pmol) and
trp
BA.r (12 pmol). In E-
and C-specic PCR reactions, the primers
trp
BA.f and
trp
BA.r are added to provide an internal control. PCR

Page 4/15
reaction was performed in a volume of 25 µl containing 12.5 µl of green mater mix, 1 µl (20 pmol) of each
primer, 3 µl of template DNA and nuclease-free water up to 25 µl. Optimum cyclic conditions for
Quadruplex, group C and group E PCR reactions are given in the following Table 2.

Table 2
Steps and cyclic conditions for Quadruplex PCR and group C, group E determination PCR
PCR reaction Initial
denaturation
(°C/min)
Denaturation
(°C/sec)
Annealing
(°C/sec)
Extension
(°C/sec)
Final
extension
(°C/min)
No of
cycles
Quadruplex 94/4 94/5 59/20 72/60 72/5 30
Group C 94/4 94/5 59/20 72/60 72/5 30
Group E 94/4 94/5 57/20 72/60 72/5 30
PCR was performed in a Veriti 96 well Thermal cycler (Applied Bio System, USA) with a heated lid
following the steps and cycle conditions as provided in the given in Table 2. The PCR product was
analyzed by agarose gel electrophoresis to examine the amplicon sizes and the phylogenetic group to
which an isolate belonged was done as per the method of Clermont et al. (2013).


Page 5/15
Table 3
Quadruplex genotypes and steps required for assigning E. coli isolates to different phylogroup
Quadruplex genotype Phylo-
group Next step
arpA
(400bp)
chuA
(288bp)
yjaA
(211bp)
TspE4.C2
(152bp)
+ - - - A -
+ - - + B1 -
- + - - F -
- + + - B2 -
- + + + B2 -
- + - + B2 -
+ - + - A / C Screen using C-specic primers. If C +
then C, else A
+ + - - D / E Screen using E-specic primers. If E +
then E, else D
+ + - + D / E Screen using E-specic primers. If E +
then E, else D
+ + + - E / clade I Screen using E-specic primers. If E- then
clade I
- - + - clade I / II -
-(476)c- - clade
III/IV/V -
- - - + Unknown -
- - + + Unknown -
+ - + + Unknown -
+ + + + Unknown -
- - - - Unknown -
(476)c = Amplicon size 476 bp
Determination of pathotypes:
The PCR method was used for amplication of virulence genes for determination of ETEC (
F49, K99, STa,
STb, LT
) and STEC/EHEC (
hly
A,
stx1
,
stx2
) isolates using a specic primer sequence as described by
Fagan et al. 1999 (
hly
A), Kim
et al.
2002 (
stx2
), Blanco et al. 2004 (
stx1
), Vu-Khac et al. 2007 (
STb
) and
Nguyen et al. 2011 (
F49, K99, STa, LT
).

Page 6/15
Determination of antimicrobial susceptibility and detection
of antibiotic resistance genes:
Antibiotic susceptibility testing was performed as per the disc diffusion method (Bauer et al., 1966) on
Muller-Hinton agar (MHA) against sulfadiazine (300 mcg), penicillin-G (10 IU), ampicillin (10 mcg),
streptomycin (10 mcg), gentamicin (10 mcg), tetracycline (30 mcg) and oxytetracycline (30 mcg). The
inhibition zone around each disc was measured in millimeters, and the results were interpreted according
to CLSI guidelines (CLSI, 2020).
Molecular typing of antibiotic resistance genes in
E. coli
isolates was done by PCR using specic primer
sequences as described by Sengelov et al. 2003 (
tet
(A),
tet
(B)), Boerlin et al. 2005 (
aad
A,
sul
-2) and Kozak
et al. 2009 (
BlaTEM
,
strA
).
Results
Phylotyping of E. coli isolates:
In the present study, all 35
E. coli
isolates from diarrheic calves were subjected to Quadruplex PCR as
described by Clermont et al. (2013). The majority of the isolates (19/35; 54.28%) belonged to phylotype
B1, followed by A (9/35; 20%), E (4/35; 11.42%), C (2/35; 5.71%), and F (2/35; 5.71%) (Table4 & Figs.1a-
b). One isolate was assigned as “unknown” because this isolate was positive for only one
TspE4.C2
but
was screened by 16S rRNA ribotyping, conrming the detection of
E. coli.
According to Clermont et al.
(2013), MLST should be performed to classify such strains.
Escherichia coli
strains belonging to
phylotypes B2, D and Clade I were not detected in the present study.

Page 7/15
Table 4
Phylogenetic analysis of E. coli isolates from calf diarrhea
S.
No. Quadruplex genotype C or E
PCR Number of
strains Phylo-
group Prevalence of
Phylo-groups (%)
ArpA
(400
bp)
chuA
(288
bp)
yjaA
(211
bp)
TspE4.C2
(152 bp)
1. + - - -  6 A 07
(20%)
2. + - + - C −1
3. + - - +  19 B1 19
(54.28%)
4. + - + - C +2 C 2(5.71%)
5. + + - - E +1 E 4(11.42%)
6. + + + - E +3
7. - + - -  2 F 2(5.71%)
8. - - - +  1 Unknown 1(2.85%)
Pathogenic potential of phylotypes:
Each phylotype was evaluated for the presence of virulence genes by PCR, with prevalence recorded as
the
hlyA
(31.42%) gene followed by the
stx2
(20%),
STb
(17.14%),
stx1
(14.28%),
F41
(8.57%),
LT
(2.85%)
and
STa
(2.85%) genes (Fig.2). On the basis of these virulence genes, isolates were classied into ETEC
(25.71%), STEC (48.57%) and non-ETEC/STEC (25.71%).
Furthermore, the 10 isolates from phylotypes B1 had proles similar to STEC pathotypes, while ve
isolates were similar to ETEC, and four isolates belonged to non-ETEC or STEC strains. Out of seven
isolates of phylotype A, only one isolate was classied as ETEC, two as STEC and four isolates as non-
ETEC/STEC. Phylotype C strains showed pathogenic potential equal to 50% in both ETEC and STEC. The
two isolates of pathotypes ETEC and one isolate of pathotypes STEC were identied as phylotype E. Both
isolates of phylotype F were found to be STEC pathotypes (Table5).
Antibiotic drug resistance in phylotypes:
Each phylotype was evaluated for antimicrobial drug resistance against four commonly used
antimicrobial classes. The majority of the isolates carried the
BlaTEM
(82.85%) gene, followed by
strA
(31.42%),
Sul
-2 (22.85%),
tet
(B) (17.14%),
tet
(A) (8.57%) and
aad
A (2.85%) (Fig.3). Phylotypes F and B1
were found to carry antimicrobial resistance genes against all four classes of antimicrobials, while
phylotype E carried antimicrobial drug resistance genes for three classes, and phylotypes C and A showed
the least number of resistance genes (only 2 classes). On phenotypic testing, we observed similar results

Page 8/15
of resistance for sulfadiazine (
Sul-
2), penicillin G, ampicillin (
Bla
TEM), streptomycin (
str
A), gentamicin
(
aad
A), tetracycline and oxytetracycline (
tet
(A),
tet
(B)) which corresponds with genotypic proling. Only F
phylotypes carried the
aad
A gene and were observed to be resistant to all aminoglycoside (gentamicin)
antibiotics, while other groups were sensitive to gentamicin. The phylotypes possessing the
str
A gene
showed resistance against streptomycin but not against gentamicin.
Table 5
Determination of inherent antibiotic drug resistance and pathogenic potential of different E. coli
phylotypes
Phylogenetic
group
ETEC STEC Non ETEC or STEC
No. of
Isolates Antibiotic
Resistance
gene
No. of
Isolates Antibiotic
Resistance gene No. of
Isolates Antibiotic
Resistance
gene
A1/7
(14.28%)
Bla
TEM,
str
A2/7
(28.57%)
Bla
TEM 4/7
(57.14%)
Bla
TEM,
str
A,
B1 5/19
(26.31%)
Bla
TEM,
str
A10/19
(52.63%)
Sul
-2,
Bla
TEM,
str
A,
tet
(A),
tet
(B) 4/19
(21.05%)
Bla
TEM,
str
A,
C1/2
(50%)
Bla
TEM 1/2
(50%)
Bla
TEM,
tet
(B)  
E2/4
(50%)
Bla
TEM,
tet
(B),
Sul
-2 1/4
(25%) BlaTEM,
tet
(B) 1/4
(25%)
Sul-
2,
Bla
TEM,
tet
(A)
F  2/2
(100%)
Sul-
2,
Bla
TEM,
str
A,
tet
(A),
tet
(B),
aad
A
 
Unknown   1/1
Bla
TEM  
Discussion
In this study, the isolates mainly belonged to phylogenetic groups A and B1. Similar to these ndings,
Ghanbarpour and Oswald (2009) reported that 48.38% of
E. coli
isolates from septicemic calves in Iran
belonged to B1, 29.03% belonged to phylotype A. Coura
et al
. (2016) performed phylogenetic analysis of
the
E. coli
strains isolated from calves in Brazil with the Clermont method and showed that 6.25% isolates
belonged to phylotype A, 67.85% belonged to phylotype B1, 0.6% belonged to phylotype B2, 1.49%
belonged to phylotype C, 16.96% belonged to phylotype E, and 0.9% belonged to phylotype F. Phylotype D
was not identied, and 5.95% of the strains were assigned as unknown. Coura et al. (2019) showed that
58.95% of the
E. coli
strains isolated from buffalo calves belonged to phylotype B1, followed by E
(9.70%), B2 (5.90%), C (5.90%), D (5.22%), A (2.24%), and F (1.50%), and 14 strains were assigned as
“unknown”.

Page 9/15
In contrast, Naderi et al. (2016) reported
E. coli
strains belonging to phylogenetic groups A and B1 with
frequencies of 65.8% and 30.6%, respectively, from diarrheic calves. Barzan
et al.
(2017) observed that
55% of
E. coli
isolates from diarrheic calves belonged to phylotype A and no one belonged to phylotype
B1, which is in contrast to the present ndings.
Our study observed high pathogenic potential in phylotypes B1, C, E, and F. Pathotype ETEC strains
belonged to phylotypes C and F followed by B1 and A, while the STEC strains were predominant in
phylotypes F, B1, and C followed by E and A. In the current study, similar to the B1 and A phylotypes,
phylotyped groups C and F comprised highly pathogenic strains of
E. coli
, but they were less frequently
associated with calf diarrhea.
In a report, phylotype B1 was the most virulent phylotype, but phylotypes A and D were the predominant
groups in non-virulent isolates (Valat et al., 2012). It was suggested that phylotypes A and B1 are more
common in animals than in humans and that phylotype B1 is predominant in herbivores (Carlos et al.,
2010). The majority of
E. coli
isolates that cause bovine mastitis were reported to belong to phylotypes A
and B1 (Liu et al., 2014; Keane, 2016). In our study,
E. coli
isolates of phylogenetic groups B2 and D were
not reported in diarrheic calves. This nding agrees with the hypothesis that virulent extraintestinal
E. coli
(ExPEC) strains are clustered mostly in phylotypes B2 and D (Clermont et al., 2000; Escobar-Paramo et al.,
2004). A report of
E. coli
strains isolated from human septicaemia belonged mainly to phylotypes B2 and
D (Curova et al., 2014). This study suggested that phylotype B1 is dominant in diarrheic calves, but
phylotypes C, E, and F had high virulent properties.
In the present study,
E. coli
isolates belonging to different phylotypes were identied in diarrheic calves,
but no isolates were found to belong to phylotypes B2 and D. This can be due to the difference in
secretions of the digestive system in diarrheic calves, which can prevent the conditions for instability of
E.
coli
isolates. It is dicult to explain, but environmental and ecological conditions, geographic variation,
host species and health status play an important role in
E. coli
phylotype distribution.
In the present study, phylotype B1 and F strains were observed to harbor the highest inherent antibiotic
resistance property for four types of antibiotic classes.
The Bla
TEM gene was found in all reported
phylotypes that correlated with phenotypic resistance to ampicillin by the disk diffusion method. A
previous study on farm animals reported that B2 group strains are less prone to be resistant to antibiotics
than non-B2 strains. This link between strain phylogeny and antibiotic resistance could explain why, in
farm animals subjected to high antibiotic pressure, A and B1 strains are selected and B2 strains are
counter selected (Escobar-Paramo et al. 2006). This was supported by the ndings of Staji et al. (2017),
who reported that strains of phylotypes B1 and D had the highest and lowest antimicrobial resistance,
respectively.
Conclusions
The present study reported a high prevalence of
E. coli
isolates from diarrheic neonatal calves. The
majority of the isolates belonged to the B1 phylotype. A high recovery of STEC and ETEC strains with a

Page 10/15
higher presence of virulence and antibiotic resistance genes in isolates from the B1 phylotype was
signicant in understanding the pathogenic potential of
E. coli
isolates from this study area.
Declarations
Acknowledgments
The authors are thankful to the Department of Veterinary Microbiology and Biotechnology for providing
the necessary research facilities and support for this study.
Ethics approval
This study was conducted following approval by the research committee and Institutional Animal Ethics
Committee (Reg. No.-2044/GO/Re/SL/18/CPCSEA), Rajasthan University of Veterinary and Animal
Sciences, under permission number CVAS/IAEC/2021-22/108.
Authors’ contributions
This work was carried out in collaboration among all authors. Author S.K. designed the study, wrote the
protocol, conducted the experiments and wrote the rst draft of the manuscript. The authors S.C., R.K.,
K.D. and R.K.D. managed the analyses of the study and contributed to conducting the experiments.
Author T.B. supervised all the authors for conducting this research, guided the methodology and analysis
of the study and reviewed the original draft. All authors read and approved the nal manuscript.
Funding information
Rajasthan University of Veterinary and Animal Sciences, Bikaner, provided the necessary funds, research
facilities and support for this study.
Disclaimer
The views and opinions expressed in this article are those of the authors and do not necessarily reect
the ocial policy or position of any aliated agency of the authors.
Conict of Interest
The authors declare that they have no conict of interest.
Data availability
The raw data are available at Rajasthan University of Veterinary and Animal Sciences, Bikaner as part of
the M.V.Sc. thesis.
References

Page 11/15
1. Bauer, A.W., Kirby, W.M., Sherris, J.C. and Turck, M. 1966. Antibiotic susceptibility testing by a
standardized single disk method, American journal of clinical pathology, 45(4), 493.
2. Blanco, M., Blanco, J. E., Mora, A., Dahbi, G., Alonso, M. P., Gonzalez, E. A., and Blanco, J., 2004.
Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing
Escherichia coli
isolates from cattle in Spain and identication of a new intimin variant gene (eae-ξ), Journal of
clinical microbiology, 42(2), 645–651.
3. Boerlin, P., Travis, R., Gyles, C. L., Reid-Smith, R., Lim, N. J. H., Nicholson, V. and Archambault, M.,
2005. Antimicrobial resistance and virulence genes of
Escherichia coli
isolates from swine in Ontario,
Applied and environmental microbiology, 71(11), 6753–6761.
4. Carlos, C., Pires, M. M., Stoppe, N. C., Hachich, E. M., Sato, M. I., Gomes, T. A. and Ottoboni, L. M.,
2010.
Escherichia coli
phylogenetic group determination and its application in the identication of
the major animal source of fecal contamination, BMC microbiology, 10(1), 1–10.
5. Clermont, O., Bonacorsi, S. and Bingen, E., 2000. Rapid and simple determination of
Escherichia coli
phylogenetic group, Applied and environmental microbiology, 66(10), 4555–4558.
. Clermont, O., Christenson, J.K., Denamur, E. and Gordon, D.M., 2013. The Clermont
Escherichia coli
phylo-typing method revisited: improvement of specicity and detection of new phylo-groups,
Environmental Microbiology Reports, 5(1), 58–65.
7. CLSI, 2020. Performance Standards for Antimicrobial Susceptibility Testing; 30th ed. CLSI
supplement M100. Wayne, PA: Clinical Laboratory Standard Institute.
. Coura, F. M., de Araujo Diniz, S., Mussi, J. M. S., Silva, M. X., Lage, A. P. and Heinemann, M. B., 2017.
Characterization of virulence factors and phylogenetic group determination of
Escherichia coli
isolated from diarrheic and non-diarrheic calves from Brazil, Folia microbiologica, 62(2), 139–144.
9. Coura, F. M., Diniz, S. D. A., Silva, M. X., Oliveira, C. H. S. D., Mussi, J. M. S., Oliveira, C. S. F. D. and
Heinemann, M. B., 2019. Virulence factors and phylotyping of
Escherichia coli
isolated from non-
diarrheic and diarrheic water buffalo calves, Ciencia Rural, 49.
10. Curova, K., Kme A., M., Vargová, R., Lovayova, V. and Siegfried, L., 2014. Toxins of extraintestinal
Escherichia coli
isolated from blood culture, Clinical Microbiology: Open Access, 3(5), 171.
11. Escobar-Paramo, P., Clermont, O., Blanc-Potard, A. B., Bui, H., Le Bouguenec, C. and Denamur, E., 2004.
A specic genetic background is required for acquisition and expression of virulence factors in
Escherichia coli
, Molecular biology and evolution, 21(6), 1085–1094.
12. Escobar-Paramo, P., Le Menac’h, A., Le Gall, T., Amorin, C., Gouriou, S., Picard, B. and Denamur, E.,
2006. Identication of forces shaping the commensal
Escherichia coli
genetic structure by
comparing animal and human isolates, Environmental microbiology, 8(11), 1975–1984.
13. Fagan, P. K., Hornitzky, M. A., Bettelheim, K. A. and Djordjevic, S. P., 1999. Detection of Shiga-like toxin
(stx1 andstx2), intimin (eaeA), and enterohemorrhagic
Escherichia coli
(EHEC) hemolysin (EHEC
hlyA) genes in animal feces by multiplex PCR, Applied and Environmental Microbiology, 65(2), 868–
872.

Page 12/15
14. Ghanbarpour, R. and Oswald, E., 2009. Characteristics and virulence genes of
Escherichia coli
isolated from septicemic calves in southeast of Iran, Tropical animal health and production, 41(7),
1091–1099.
15. Kaper, J. B., Nataro, J. P. and Mobley, H. L., 2004. Pathogenic
Escherichia coli
. Nature reviews
microbiology, 2(2), 123–140.
1. Keane, O. M., 2016. Genetic diversity, the virulence gene prole and antimicrobial resistance of
clinical mastitis-associated
Escherichia coli
, Research in microbiology, 167(8), 678–684.
17. Kim, I. W., Kang, M. H., Kwon, S. H., Cho, S. H., Yoo, B. S., Han, S. H., and Yoon, B. S., 2010). Rapid
detection of virulence stx2 gene of Enterohemorrhagic
Escherichia coli
using two-step ultra-rapid
real-time PCR, Biotechnology letters, 32(5), 681–688.
1. Kozak, G. K., Boerlin, P., Janecko, N., Reid-Smith, R. J. and Jardine, C., 2009. Antimicrobial resistance
in
Escherichia coli
isolates from swine and wild small mammals in the proximity of swine farms and
in natural environments in Ontario, Canada, Applied and environmental microbiology, 75(3), 559–
566.
19. Kumar S., Suvidhi, Dhial K., Milind M. and Bhati T., 2022. Occurrence of
E. coli
and associated risk
factors in neonatal calf diarrhea from Bikaner, The Pharma Innovation Journal, 11(6S), 1030–1033.
http://dx.doi.org/10.13140/RG.2.2.23006.10563
20. Liu, Y., Liu, G., Liu, W., Liu, Y., Ali, T., Chen, W. and Han, B., 2014. Phylogenetic group, virulence factors
and antimicrobial resistance of Escherichia coli associated with bovine mastitis, Research in
microbiology, 165(4), 273–277.
21. Naderi, Z.,Ghanbarpour, R. and Sami, M., 2016. Antimicrobial resistance characteristics and
phylogenetic groups of
Escherichia coli
isolated from diarrheic calves in southeast of Iran,
International Journal of Enteric Pathogens, 4(4), 1–7.
22. Nguyen, T. D., Vo, T. T. and Vu-Khac, H., 2011. Virulence factors in
Escherichia coli
isolated from
calves with diarrhea in Vietnam, Journal of veterinary science, 12(2), 159–164.
23. Patbandha, T. K., Garg, D. D., Maharana, B. R., Chavda, M. R., Pathak, R., and Gamit, V. V., 2017.
Factors Associated with Calf Mortality under Field Condition in Saurashtra Region of Gujarat, India,
International Journal of Current Microbiology and Applied Science, 6(7), 4184–4192.
24. Radostits, O. M., Gay, C. C., Hinchcliff, K. W. and Constable, P. D., 2007. Diseases associated with
bacteria-IV, Veterinary Medicine, 10th ed. Saunders Elsevier, Edinburgh, 1007–1017.
25. Sengelov, G., Agerso, Y., Halling-Sørensen, B., Baloda, S. B., Andersen, J. S. and Jensen, L. B., 2003.
Bacterial antibiotic resistance levels in Danish farml and as a result of treatment with pig manure
slurry, Environment international, 28(7), 587–595.
2. Singh, D. D., Kumar, M., Choudhary, P. K. and Singh, H. N., 2009. Neonatal calf mortality–an overview,
Intas Polivet, 10(2), 165–169.
27. Staji H, Badagliacca P, Salehi TZ, Lopes F, Iorio M, Tonelli A, Masson L., 2017. Pathotyping of
diarrhoeagenic cattle Escherichia coli strains isolated in the Province of Tehran, Iran, Vet Ital 53,
345–356.

Page 13/15
2. Valat, C., Auvray, F., Forest, K., Métayer, V., Gay, E., Peytavin de Garam, C. and Haenni, M., 2012.
Phylogenetic grouping and virulence potential of extended-spectrum-β -lactamase-producing
Escherichia coli
strains in cattle, Applied and environmental microbiology, 78(13), 4677–4682.
29. Vu-Khac, H., Holoda, E., Pilipcinec, E., Blanco, M., Blanco, J. E., Dahbi, G. and Blanco, J., 2007.
Serotypes, virulence genes, intimin types and PFGE proles of
Escherichia coli
isolated from piglets
with diarrhoea in Slovaki, The Veterinary Journal, 174(1), 176–187.
Figures
Figure 1
See image above for gure legend.

Page 14/15
Figure 2
See image above for gure legend.

Page 15/15
Figure 3
See image above for gure legend.