Available via license: CC BY 4.0
Content may be subject to copyright.
Citation: Wang, W.; Yan, M.; Aarabi,
G.; Peters, U.; Freytag, M.; Gosau, M.;
Smeets, R.; Beikler, T. Cultivation of
Cryopreserved Human Dental Pulp
Stem Cells—A New Approach to
Maintaining Dental Pulp Tissue. Int.
J. Mol. Sci. 2022,23, 11485. https://
doi.org/10.3390/ijms231911485
Academic Editor: Takayoshi Yamaza
Received: 2 August 2022
Accepted: 26 September 2022
Published: 29 September 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
International Journal of
Molecular Sciences
Article
Cultivation of Cryopreserved Human Dental Pulp Stem
Cells—A New Approach to Maintaining Dental Pulp Tissue
Wang Wang 1,*,† , Ming Yan 2,† , Ghazal Aarabi 1, Ulrike Peters 1, Marcus Freytag 2, Martin Gosau 2,
Ralf Smeets 2,3 and Thomas Beikler 1
1Department of Periodontics, Preventive and Restorative Dentistry, University Medical Center
Hamburg-Eppendorf, 20246 Hamburg, Germany
2Department of Oral and Maxillofacial Surgery, University Medical Center Hamburg-Eppendorf,
20246 Hamburg, Germany
3Department of Oral and Maxillofacial Surgery, Division of Regenerative Orofacial Medicine,
University Medical Center Hamburg-Eppendorf, 20246 Hamburg, Germany
*Correspondence: w.wang.ext@uke.de
† These authors contributed equally to this work.
Abstract:
Human dental pulp stem cells (hDPSCs) are multipotent mesenchymal stem cells (MSCs)
that are capable of self-renewal with multilineage differentiation potential. After being cryopreserved,
hDPSCs were reported to maintain a high level of proliferation and multi-differentiation abilities. In
order to optimize cryopreservation techniques, decrease storage requirements and lower contamina-
tion risks, the feasibility of new whole-tooth cryopreservation and its effects on hDPSCs were tested.
The survival rates, morphology, proliferation rates, cell activity, surface antigens and differentiation
abilities of hDPSCs isolated from fresh teeth were compared with those of one-month cryopreserved
teeth in 5% and 10% DMSO. The data of the present study indicated that the new cryopreservation
approach did not reduce the capabilities or stemness of hDPSCs, with the exception that it extended
the first appearance time of hDPSCs in the teeth that were cryopreserved in 10% DMSO, and reduced
their recovery rate. With the novel strategy of freezing, the hDPSCs still expressed the typical sur-
face markers of MSCs and maintained excellent proliferation capacity. Three consecutive weeks of
osteogenic and adipogenic induction also showed that the expression of the key genes in hDPSCs,
including lipoprotein lipase (LPL), peroxisome proliferator-activated receptor-
γ
(PPAR-
γ
), alkaline
phosphatase (ALP), runt-related transcription factor 2 (RUNX2), type I collagen (COL I) and osteo-
calcin (OSC) was not affected, indicating that their differentiation abilities remained intact, which
are crucial parameters for hDPSCs as cell-therapy candidates. These results demonstrated that the
new cryopreservation method is low-cost and effective for the good preservation of hDPSCs without
compromising cell performance, and can provide ideas and evidence for the future application of
stem-cell therapies and the establishment of dental banks.
Keywords:
human dental pulp stem cells; methodology; dimethyl sulfoxide; cryopreservation;
cellular differentiation; teeth
1. Introduction
In recent years, as research on stem-cell therapy and tissue engineering has intensified,
the preservation and application of mesenchymal stem cells (MSCs) has become a hot
research topic. MSCs are adult stem cells with self-renewal, a high proliferating ability and
multi-differentiation potential, and they have a wide range of applications in the fields of
stem-cell biology, vascular tissue engineering, and other areas of regenerative medicine [
1
].
Among them, human dental pulp stem cells (hDPSCs) are regarded as a reliable source
due to their excellent self-renewal, proliferation capacity, and multipotent differentiation
ability [
2
]. hDPSCs were first identified by Gronthos in the year 2000 [
3
]. They express
the specific surface biomarkers of mesenchymal stem-cell antigens such as STRO-1, CD29,
Int. J. Mol. Sci. 2022,23, 11485. https://doi.org/10.3390/ijms231911485 https://www.mdpi.com/journal/ijms
Int. J. Mol. Sci. 2022,23, 11485 2 of 18
CD44, CD59, CD73 and CD90, while CD19, CD24, CD34 and CD45 are not expressed [
4
,
5
].
It is reported that hDPSCs can be differentiated into various cell types
in vitro
, including
adipocytes, chondrocytes, neurons, myocytes, and the most important for bone recon-
struction in maxillofacial surgeries, osteoblasts [
6
–
10
]. Moreover, hDPSCs have a high
differentiation potential in odontogenic lineages, and compared with bone marrow cells,
a stronger ability to differentiate and proliferate [
11
,
12
].
Govindasamy et al.
found that
hDPSCs can even be differentiated into islet-like cell aggregates [
13
]. Dasari et al. found
that DPSCs might be an appropriate source for therapeutic uses in neurological pathologies
such as spinal cord injuries [
14
]. The repair and rebuilding of neuronal tissue [
15
–
18
],
osseous tissue [
19
], hepatic tissue [
16
], muscle tissue [
20
] as well as salivary glands [
21
] are
among the possible medicinal applications depending on DPSCs. Another significant bene-
fit of hDPSCs is their easy accessibility: dental pulp cells can be conveniently isolated from
extracted teeth, which might frequently be regarded as biological trash [22]. According to
statistics, pulp tissue from interrupted third molars was most frequently used as a source
of DPSCs [
23
]. In transplantation medicine, employing autologous cells can protect the
regenerated tissue of donors from being rejected by the immune system by establishing
histocompatibility banks [
24
]. Hence, if hDPSCs can be preserved in cell banks throughout
therapy when their donors are both young and healthy, then there will be a stable supply
of stem cells with excellent biological activities if their donors require them for regenerative
therapies in the future.
The conventional cryopreservation process of dental pulp mesenchymal cells includes
tooth disinfection, pulp extraction, cell isolation, cell proliferation, and cryopreserva-
tion [
25
]. However, dental clinics are not usually equipped with a research laboratory
that ensures the sterile handling and storage of freshly extracted teeth. Before the hDPSC
isolation, it is advantageous if the entire tooth is frozen and dental pulp is kept in an
aseptic environment, namely pulp cavities, so that the possibility of sample contamination
is minimized. Furthermore, in most cases it is a logistical and thus time-consuming effort
to transport the extracted teeth immediately following extraction to a laboratory that is
able to establish primary cell cultures.
So, we propose the immediate cryopreservation of whole teeth at
−
80
◦
C following
extraction. Compared with the conventional cryopreservation procedure, this strategy can
notably reduce the costs of cryopreservation—because the cell isolation step is omitted
before clinical application—and storage in liquid nitrogen is unnecessary. Such limited
processing might be more suitable for storing samples that do not have any imminent
intentions for growth or usage. In addition, the majority of the cryopreservation methods
can only be carried out in laboratories. However, the hDPSCs can only remain active
in vitro
for up to five days after teeth extraction [
26
]. The extra time needed to transport
the tissue can cause damage to the cells and thus reduce the quality of the hDPSCs. To
overcome this difficulty, the application of this novel method may extend the feasible
period of hDPSCs in the event that samples cannot be handled in time. Therefore, the
present study aimed to develop and evaluate a procedure that simplifies the storage of
freshly extracted teeth intended to be used for hDPSCs. Dental pulp cells can be freshly
preserved when they are most active, which may be more beneficial to the future use of
these cells than long-term transportation.
2. Results
2.1. Analysis of Results
2.1.1. The Impact of the Novel Cryopreservation Method on Cell Multiplication
and Expansion
Dental pulp cells were inspected under a microscope every day to observe the cell
morphology. The healthy cells resembled triangular or spindle shapes, with dark cytoplasm
and a distinct nucleus. After the assessment of the morphology of the DPSCs by two trained
examiners, Cohen’s kappa coefficients of the T1 and T2 groups were
κ
= 88.9% and 83.3%,
respectively, indicating almost perfect inter-observer agreement on the consistency of the
Int. J. Mol. Sci. 2022,23, 11485 3 of 18
cellular morphology compared with the C group (Figure 1A). The dental pulp cells in the
T2 frozen group took the longest time (16.830
±
1.472 days) until the cells were initially
observed to grow and attach. A significantly longer outgrowth time of the DPSCs in T1
group (14.670
±
1.506 days) was observed compared to the C group (9.170
±
1.472 days)
(* p< 0.01) (Figure 1B).
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 3 of 18
2. Results
2.1. Analysis of Results
2.1.1. The Impact of the Novel Cryopreservation Method on Cell Multiplication and
Expansion
Dental pulp cells were inspected under a microscope every day to observe the cell
morphology. The healthy cells resembled triangular or spindle shapes, with dark cyto-
plasm and a distinct nucleus. After the assessment of the morphology of the DPSCs by
two trained examiners, Cohen’s kappa coefficients of the T1 and T2 groups were κ = 88.9%
and 83.3%, respectively, indicating almost perfect inter-observer agreement on the con-
sistency of the cellular morphology compared with the C group (Figure 1A). The dental
pulp cells in the T2 frozen group took the longest time (16.830 ± 1.472 days) until the cells
were initially observed to grow and attach. A significantly longer outgrowth time of the
DPSCs in T1 group (14.670 ± 1.506 days) was observed compared to the C group (9.170 ±
1.472 days) (* p < 0.01) (Figure 1B).
(A)
(B)
Figure 1. Morphology of dental pulp cells in different preservation strategy groups. (A) Morphology
of dental pulp tissue and cells at the primary and the third generation. Ⅰ–Ⅲ: C group—Primary cells
emerged from tissue blocks (×40; ×100) and the cells from the third generation after passage (×100).
Ⅳ–Ⅵ: T1 group—Primary cells emerged from tissue blocks (×40; ×100) and the cells from the third
generation after passage (×100). Ⅵ–Ⅸ: T2 group—Primary cells emerged from tissue blocks (×40;
×100) and the cells from the third generation after passage (×100). (B) The first appearance time of
dental pulp cells in different groups: The first appearance time of dental pulp cells in the frozen
groups was significantly longer than in the C group, and the first appearance time in the T2 frozen
group was significantly longer than that in T1 group. The cryopreservation approach led to a longer
period for cells to grow out of the tissue blocks. * p < 0.05, **** p < 0.0001.
2.1.2. Effects of New Cryopreservation Strategy on the Primary Cell Yield
A significantly larger number of DPSCs was collected in the C group ((9.725 ± 1.601)
× 105) compared with the other two groups. The number of primary dental pulp cells har-
vested in T1 ((6.333 ± 1.341) × 105) and T2 ((6.658 ± 1.229) × 105) frozen group was smaller
compared with the C group (* p < 0.05) (Figure 2).
Figure 1.
Morphology of dental pulp cells in different preservation strategy groups. (
A
) Morphology
of dental pulp tissue and cells at the primary and the third generation. I–III: C group—Primary
cells emerged from tissue blocks (
×
40;
×
100) and the cells from the third generation after passage
(
×
100). IV–VI: T1 group—Primary cells emerged from tissue blocks (
×
40;
×
100) and the cells from
the third generation after passage (
×
100). VI–IX: T2 group—Primary cells emerged from tissue blocks
(
×40; ×100
) and the cells from the third generation after passage (
×
100). (
B
) The first appearance
time of dental pulp cells in different groups: The first appearance time of dental pulp cells in the
frozen groups was significantly longer than in the C group, and the first appearance time in the T2
frozen group was significantly longer than that in T1 group. The cryopreservation approach led to a
longer period for cells to grow out of the tissue blocks. * p< 0.05, **** p< 0.0001.
2.1.2. Effects of New Cryopreservation Strategy on the Primary Cell Yield
A significantly larger number of DPSCs was collected in the C group ((
9.725 ±1.601) ×105
)
compared with the other two groups. The number of primary dental pulp cells harvested
in T1 ((6.333
±
1.341)
×
10
5
) and T2 ((6.658
±
1.229)
×
10
5
) frozen group was smaller
compared with the C group (* p< 0.05) (Figure 2).
2.1.3. Identification of Specific Stem-Cell Markers
CD34, CD45, CD73, CD90 and CD105 were detected through flow cytometry in the
three groups: CD73, CD90 and CD105 were abundantly expressed, while CD34 and CD45
were not strongly expressed. (Figure 3).
2.1.4. Effects of New Cryopreservation Strategy on the Cell Survival Rate after Trypan Blue
and Live–Dead Staining
There was no significant difference in the cell survival rate among the three groups
(p> 0.05) (Figure 4B,C).
Int. J. Mol. Sci. 2022,23, 11485 4 of 18
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 4 of 18
Figure 2. Effects of new cryopreservation strategy on the primary cell yield. The new cryopreserva-
tion strategy dramatically decreased the number of harvested primary cells compared with the C
group (** p < 0.01).
2.1.3. Identification of Specific Stem-Cell Markers
CD34, CD45, CD73, CD90 and CD105 were detected through flow cytometry in the
three groups: CD73, CD90 and CD105 were abundantly expressed, while CD34 and CD45
were not strongly expressed. (Figure 3).
Figure 2.
Effects of new cryopreservation strategy on the primary cell yield. The new cryopreserva-
tion strategy dramatically decreased the number of harvested primary cells compared with the C
group (** p< 0.01).
Figure 3.
Identification of MSCs by flow cytometry in each group. I–V: C group; VI–X: T1 group;
XI–XV: T2 group. The expression of CD73, CD90 and CD105 was positive; otherwise, CD45 and CD34
expression was negative in the three groups.
Int. J. Mol. Sci. 2022,23, 11485 5 of 18
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 5 of 18
Figure 3. Identification of MSCs by flow cytometry in each group. Ⅰ–Ⅴ: C group; Ⅵ–Ⅹ: T1 group;
Ⅺ–XV: T2 group. The expression of CD73, CD90 and CD105 was positive; otherwise, CD45 and
CD34 expression was negative in the three groups.
2.1.4. Effects of New Cryopreservation Strategy on the Cell Survival Rate after Trypan
Blue and Live–Dead Staining
There was no significant difference in the cell survival rate among the three groups
(p > 0.05) (Figure 4B,C).
(A)
(B)
(C)
Figure 4. Effects of new cryopreservation strategy on the cell survival rate. (A) Live–dead staining
results of dental pulp cells. Ⅰ: C group (×40); Ⅱ: T1 group (×40); Ⅲ: T2 group (×40); Ⅳ: C group (×100);
Ⅴ: T1 group (×100); Ⅵ: T2 group (×100). (B) The survival rate of live–dead staining in each group.
(C) The survival rate of Trypan Blue staining in each group.
2.1.5. Effects of New Cryopreservation Strategy on the Primary Cell Proliferation
There was no significant difference in the cell proliferation ability, including cell col-
ony-forming efficiency as well as the growth curve among the three groups (p > 0.05) (Fig-
ure 5B,C).
Figure 4.
Effects of new cryopreservation strategy on the cell survival rate. (
A
) Live–dead staining
results of dental pulp cells. I: C group (
×
40); II: T1 group (
×
40); III: T2 group (
×
40); IV: C group
(×100); V: T1 group (×100); VI: T2 group (×100). (B) The survival rate of live–dead staining in each
group. (C) The survival rate of Trypan Blue staining in each group.
2.1.5. Effects of New Cryopreservation Strategy on the Primary Cell Proliferation
There was no significant difference in the cell proliferation ability, including cell colony-
forming efficiency as well as the growth curve among the three
groups (p> 0.05) (Figure 5B,C)
.
2.1.6. Effects of New Cryopreservation Strategy on the Differentiation Potential of Dental
Pulp Cells
The cells from the third generation were stained after osteogenic and adipogenic induc-
tion for three weeks following the respective protocols (Figure 6A) and the corresponding
absorbance was detected by a spectrophotometer at different wavelengths. The results
illustrated that there was no difference among the three groups in terms of the ability of
osteogenic and adipogenic differentiation (p> 0.05) (Figure 6B,C).
2.1.7. Representative Gene Expression Profile of LPL, PPARG, ALP, RUNX2, COL I and
OSC in Each Group
The relative expressions of two adipogenic and four osteogenic genes were not sig-
nificantly different at the same time point among the three groups (p> 0.05). However,
the relative expression of osteogenic genes changed with the time of osteogenic induction.
(Figure 7A–C).
Int. J. Mol. Sci. 2022,23, 11485 6 of 18
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 6 of 18
(A)
(B)
(C)
Figure 5. Proliferation ability of primary dental pulp cells in each group. (A) Giemsa staining results
of dental pulp cells. Ⅰ: C group; Ⅱ: T1 group; Ⅲ: T2 group. (B) Colony-forming efficiency. (C) Cell
growth curve (MTS assay).
2.1.6. Effects of New Cryopreservation Strategy on the Differentiation Potential of Dental
Pulp Cells
The cells from the third generation were stained after osteogenic and adipogenic in-
duction for three weeks following the respective protocols (Figure 6A) and the corre-
sponding absorbance was detected by a spectrophotometer at different wavelengths. The
results illustrated that there was no difference among the three groups in terms of the
ability of osteogenic and adipogenic differentiation (p > 0.05) (Figure 6B,C).
Figure 5.
Proliferation ability of primary dental pulp cells in each group. (
A
) Giemsa staining results
of dental pulp cells. I: C group; II: T1 group; III: T2 group. (
B
) Colony-forming efficiency. (
C
) Cell
growth curve (MTS assay).
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 7 of 18
(A)
(B)
(C)
Figure 6. Differentiation potential of dental pulp cells. (A) Osteogenic and adipogenic differentia-
tion results of dental pulp cells. Ⅰ–Ⅵ: Osteogenic differentiation results. Ⅰ: C group (×40); Ⅱ: C group
(×100); Ⅲ: T1 group (×40); Ⅳ: T1 group (×100); Ⅴ: T2 group (×40); Ⅵ: T2 group (×100). Ⅶ–Ⅻ: Adi-
pogenic differentiation results. Ⅶ: C group (×40); Ⅷ: C group (×100); Ⅸ: T1 group (×40); Ⅹ: T1
group (×100); Ⅺ: T2 group (×40); Ⅻ: T2 group (×100). (B) The absorbance value at 450 nm of dis-
solved solution after Alizarin Red S staining in the three groups. (C) The absorbance value at 540
nm of dissolved solution after Oil Red O staining in the three groups.
2.1.7. Representative Gene Expression Profile of LPL, PPARG, ALP, RUNX2, COL I and
OSC in Each Group
The relative expressions of two adipogenic and four osteogenic genes were not sig-
nificantly different at the same time point among the three groups (p > 0.05). However,
the relative expression of osteogenic genes changed with the time of osteogenic induction.
(Figure 7A–C).
(A)
(B)
Figure 6.
Differentiation potential of dental pulp cells. (
A
) Osteogenic and adipogenic differentiation
results of dental pulp cells. I–VI: Osteogenic differentiation results. I: C group (
×
40); II: C group (
×
100);
Int. J. Mol. Sci. 2022,23, 11485 7 of 18
III: T1 group (
×
40); IV: T1 group (
×
100); V: T2 group (
×
40); VI: T2 group (
×
100). VII–XII: Adipogenic
differentiation results. VII: C group (
×
40); VIII: C group (
×
100); IX: T1 group (
×
40); X: T1 group
(
×
100); XI: T2 group (
×
40); XII: T2 group (
×
100). (
B
) The absorbance value at 450 nm of dissolved
solution after Alizarin Red S staining in the three groups. (
C
) The absorbance value at 540 nm of
dissolved solution after Oil Red O staining in the three groups.
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 7 of 18
(A)
(B)
(C)
Figure 6. Differentiation potential of dental pulp cells. (A) Osteogenic and adipogenic differentia-
tion results of dental pulp cells. Ⅰ–Ⅵ: Osteogenic differentiation results. Ⅰ: C group (×40); Ⅱ: C group
(×100); Ⅲ: T1 group (×40); Ⅳ: T1 group (×100); Ⅴ: T2 group (×40); Ⅵ: T2 group (×100). Ⅶ–Ⅻ: Adi-
pogenic differentiation results. Ⅶ: C group (×40); Ⅷ: C group (×100); Ⅸ: T1 group (×40); Ⅹ: T1
group (×100); Ⅺ: T2 group (×40); Ⅻ: T2 group (×100). (B) The absorbance value at 450 nm of dis-
solved solution after Alizarin Red S staining in the three groups. (C) The absorbance value at 540
nm of dissolved solution after Oil Red O staining in the three groups.
2.1.7. Representative Gene Expression Profile of LPL, PPARG, ALP, RUNX2, COL I and
OSC in Each Group
The relative expressions of two adipogenic and four osteogenic genes were not sig-
nificantly different at the same time point among the three groups (p > 0.05). However,
the relative expression of osteogenic genes changed with the time of osteogenic induction.
(Figure 7A–C).
(A)
(B)
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 8 of 18
(C)
Figure 7. Representative gene expression profile in different groups. (A) Gel electrophoresis results.
Ⅰ: RNA electrophoresis of three groups. 1: C group; 2: T1 group; 3: T2 group. Ⅱ: Electrophoresis
results of osteogenic expression and reference genes in each group. 1: C group; 2: T1 group; 3: T2
group; 4: Negative control group. Ⅲ: Electrophoresis results of adipogenic expression and reference
genes in each group. 1: C group; 2: T1 group; 3: T2 group; 4: Negative control group. (B) Quantitative
real-time PCR results of adipogenic genes. (C) Quantitative real-time PCR results of osteogenic
genes.
2.1.8. ALP Assay Test to Identify the Osteogenic Activity of hDPSCs
There was no significant difference in the ALP activity among the three groups at the
same time point. As the duration of osteogenic induction increased, ALP activity gradu-
ally decreased (p > 0.05, Figure 8).
Figure 8. ALP assay results of dental pulp cells in each group.
3. Discussion
In this study, we devised a more accessible novel cryopreservation approach using
varying concentrations of DMSO to preserve the third molars, which can be a source of
hDPSCs for the donor. To evaluate the effect of the new cryopreservation strategy, 18 third
molars were extracted and cell lineages were separated, then the difference between the
frozen and unfrozen teeth was examined. It was demonstrated that the T1 and T2 DMSO
frozen groups showed significantly longer times for the outgrowth of cells than the fresh
dental pulp tissue, indicating that a higher dose of DMSO will extend the growth time of
primary cells. Last but not least, the total number of primary cells yielded in the T1 and
the T2 frozen groups was considerably lower than in the C group. After the first passage,
however, the cryopreservation at −80 °C for one month showed no influence on the
Figure 7.
Representative gene expression profile in different groups. (
A
) Gel electrophoresis results.
I: RNA
electrophoresis of three groups. 1: C group; 2: T1 group; 3: T2 group. II: Electrophoresis results
of osteogenic expression and reference genes in each group.
1: C group
;
2: T1 group
;
3: T2 group;
4: Negative
control group. III: Electrophoresis results of adipogenic expression and reference genes
in each group. 1: C group; 2: T1 group; 3: T2 group; 4: Negative control group. (
B
) Quantitative
real-time PCR results of adipogenic genes. (
C
) Quantitative real-time PCR results of osteogenic genes.
2.1.8. ALP Assay Test to Identify the Osteogenic Activity of hDPSCs
There was no significant difference in the ALP activity among the three groups at the
same time point. As the duration of osteogenic induction increased, ALP activity gradually
decreased (p> 0.05, Figure 8).
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 8 of 18
(C)
Figure 7. Representative gene expression profile in different groups. (A) Gel electrophoresis results.
Ⅰ: RNA electrophoresis of three groups. 1: C group; 2: T1 group; 3: T2 group. Ⅱ: Electrophoresis
results of osteogenic expression and reference genes in each group. 1: C group; 2: T1 group; 3: T2
group; 4: Negative control group. Ⅲ: Electrophoresis results of adipogenic expression and reference
genes in each group. 1: C group; 2: T1 group; 3: T2 group; 4: Negative control group. (B) Quantitative
real-time PCR results of adipogenic genes. (C) Quantitative real-time PCR results of osteogenic
genes.
2.1.8. ALP Assay Test to Identify the Osteogenic Activity of hDPSCs
There was no significant difference in the ALP activity among the three groups at the
same time point. As the duration of osteogenic induction increased, ALP activity gradu-
ally decreased (p > 0.05, Figure 8).
Figure 8. ALP assay results of dental pulp cells in each group.
3. Discussion
In this study, we devised a more accessible novel cryopreservation approach using
varying concentrations of DMSO to preserve the third molars, which can be a source of
hDPSCs for the donor. To evaluate the effect of the new cryopreservation strategy, 18 third
molars were extracted and cell lineages were separated, then the difference between the
frozen and unfrozen teeth was examined. It was demonstrated that the T1 and T2 DMSO
frozen groups showed significantly longer times for the outgrowth of cells than the fresh
dental pulp tissue, indicating that a higher dose of DMSO will extend the growth time of
primary cells. Last but not least, the total number of primary cells yielded in the T1 and
the T2 frozen groups was considerably lower than in the C group. After the first passage,
however, the cryopreservation at −80 °C for one month showed no influence on the
Figure 8. ALP assay results of dental pulp cells in each group.
Int. J. Mol. Sci. 2022,23, 11485 8 of 18
3. Discussion
In this study, we devised a more accessible novel cryopreservation approach using
varying concentrations of DMSO to preserve the third molars, which can be a source of
hDPSCs for the donor. To evaluate the effect of the new cryopreservation strategy, 18 third
molars were extracted and cell lineages were separated, then the difference between the
frozen and unfrozen teeth was examined. It was demonstrated that the T1 and T2 DMSO
frozen groups showed significantly longer times for the outgrowth of cells than the fresh
dental pulp tissue, indicating that a higher dose of DMSO will extend the growth time
of primary cells. Last but not least, the total number of primary cells yielded in the T1
and the T2 frozen groups was considerably lower than in the C group. After the first
passage, however, the cryopreservation at
−
80
◦
C for one month showed no influence
on the morphology of the dental pulp cells, including their cell size, cytoplasmic density
and nucleus. The data of colony-forming efficiency, cell survival rate and the MTS test
illustrated that the new cryopreservation method had no impact on dental pulp cell activity.
In accordance with the International Cell Therapy Society’s (ISCT) guidelines, we identified
the surface antigens of the hDPSCs cultured from the teeth that were frozen using novel
cryopreservation techniques and discovered that CD45 and CD34 expression was negative
in the three groups, while CD73, CD90 and CD105 expression was positive, which is similar
to a previous study [
5
]. Since these cells’ surface antigens biologically match those of MSCs,
cryopreservation techniques would not have a negative impact on the stemness of dental
pulp cells. In addition, we noticed that the ability of dental pulp cells to differentiate into
adipogenic and osteogenic tissues in cryopreservation groups was not significantly affected
according to the detection of calcium and lipid deposits after 21 days of differentiation
induction, and the relevant mRNAs—especially relevant osteogenic genes including ALP,
RUNX2, COL I and OSC—were not observed to be downregulated at the same time point
(day 7, day 14 and day 21). The ALP assay results among the three groups showed no
significant difference, but the relative expression of osteogenic genes changed with the time
of osteogenic induction, demonstrating that dental pulp cells in the DMSO frozen groups
retained their differentiation capacity after the passage.
The present study by our group showed that the new cryopreservation strategy
inevitably reduced the harvest of primary pulp cells and increased their initial appearance
time, which may be due to the cryopreservation approach reducing the contact between
the pulp tissue and the cryoprotectants that ensure the integrity of the teeth, resulting
in an insufficient number of cells being protected. Furthermore, being one of the most
widely used cryoprotectants, DMSO concentrations below 10% can be mildly hazardous,
despite its ability to decelerate the ice-crystal-formation rate in cells and preserve the
structural and functional integrity of cells after unfreezing [
22
,
27
]. The passaged pulp
cells’ growth proliferation and differentiating capacities, on the other hand, were not
considerably harmed by freezing. This might be due to a month-long freezing period not
being too lengthy; therefore, cell damage was not obvious. In addition, the dental tissue
of the donors selected by this experiment had a high cell volatility, allowing the cells to
withstand physical and chemical stimulation.
There is a significant demand for bone-regeneration therapy in individuals over
40 years
of age due to dental implant treatment, tumor surgery, trauma, and periodontitis-
induced alveolar bone loss [
28
]. In this regard, hDPSCs are considered a promising source
of cells for regenerative medicine and tissue engineering [
29
]. However, research has shown
that the quantity of MSCs and their ability of self-renewal are reduced as age increases [
30
].
The proliferation and differentiation ability of MSCs also decreases with age due to telomere
shortening [
31
], DNA damage and epigenetic changes in transcriptional regulation [
32
,
33
].
In addition, increased secondary dentinogenesis and root-canal mineralization in older
individuals resulted in the significant shrinkage of pulp tissue, which further increased the
difficulty of collecting hDPSCs [
34
]. Therefore, preserving patients’ hDPSCs in advance at
a young age is one of the keys to ensuring their stem-cell function (including proliferation
and differentiation ability). With the preservation method used in our experiment, we
Int. J. Mol. Sci. 2022,23, 11485 9 of 18
can cryopreserve and store as many hDPSCs with the best stemness and the highest
proliferative capacity as possible.
A previous study by our lab has shown that dental pulp tissue can be cryopreserved
in a 5% and a 10% DMSO culture media at
−
196
◦
C for one month, with no significant
difference in the proliferation, cell growth, and differentiation capacity of hDPSCs between
the frozen and unfrozen groups [
35
]. This conclusion serves as a useful guide for the
large-scale and long-term preservation of dental pulp tissue. However, there is still a
risk of tissue contamination due to the constrained settings, primarily the lack of a sterile
atmosphere in the operation blocks of clinics and hospitals. Moreover, most dental offices
lack liquid nitrogen cryopreservation chambers at
−
196
◦
C to preserve tissue and cells.
Our new approach supports evidence from prior studies, which noted that hDPSCs stored
at
−
80
◦
C in 10% DMSO for 1–5 years still retained very high capabilities [
36
,
37
]. This
is also partly consistent with a study showing that hDPSCs can be preserved at
−
85
◦
C
for six months without a loss of function [
38
]. Ginani F et al. also discovered that after
six-month storage at
−
80
◦
C, cells from human exfoliated deciduous teeth could retain
similar properties in terms of the cell viability and proliferation rate in 10% DMSO for up
to six months [
39
], suggesting that the method of the cryopreservation of whole teeth may
still be suitable for the preservation of deciduous teeth.
The ability of stem cells to multi-differentiate is a prerequisite for their therapeutic use.
Because of their ability to develop into endoderm, mesoderm, and ectoderm lineages, den-
tal mesenchymal stem cells are considered an ideal source of stem cells in cell engineering
and tissue regeneration. Yanasse et al. mixed hDPSCs with platelet-rich plasma (PRP) to
form a stem-cell scaffold and found a significant improvement in articular cartilage repair
in a rabbit model [
40
]; Wang et al. injected the cultured secretome or vehicle (DMEM) of
hDPSCs into a mouse model of amyotrophic lateral sclerosis (ALS) and found a significant
increase in the number of days of survival after the onset of the disease and in the total life
span of the mice [
41
]; Li et al. cultured and intravenously transplanted hepatocyte growth
factor (HGF)-transformed hDPSCs into a rat model of ulcerative colitis (UC) and found that
HGF–DPSCs could inhibit inflammatory responses by transdifferentiating into intestinal
stem cell (ISC)-like cells, promoting ISC-like cell proliferation, inhibiting inflammatory re-
sponses and reducing oxidative stress injury [
42
]; Hata et al. injected hDPSCs into diabetic
polyneuropathic nude mice after culture and found that they significantly improved de-
layed nerve-conduction velocity, reduced blood flow and increased the sensory perception
threshold [
43
]. Apart from that, hDPSCs have a significant advantage over other stem-cell
sources in terms of accessibility. Third molars are the most common source of teeth for use
in stem-cell cryopreservation compared to other teeth. It was reported by Carter et al. that
the prevalence of wisdom teeth ranges from 18–68%, with 41% of those being diagnosed as
mesioangular impaction [
44
], which were frequently suggested for prophylactic extraction
by dentists. In this study, the teeth selected were incompletely erupted, impacted third
molars, which do not affect the oral chewing function when extracted. Impacted third
molars can cause swelling and ulceration of the surrounding gingival area, root damage to
the second molars, decay of the second molars, and gingival and skeletal disease around
the second molars. Impacted third molars are also related to pathological changes such as
pericoronitis, root resorption, periodontal disease, caries, and the development of cysts or
tumors [
45
]. In the long term, the retention of impacted wisdom teeth may enhance the
risk of pathology in the surrounding structures, and their removal at later ages may result
in more frequent and serious complications [
46
]. Therefore, the preventive extraction of
asymptomatic healthy wisdom teeth, whether impacted or fully erupted, has long been
regarded as appropriate care [
47
,
48
]. In addition to impacted third molars, the second
common source of hDPSCs is premolars [
23
], especially those extracted during orthodontic
treatment for severe crowding and Class II malocclusions. The age of these patients is
usually around 10 to 16 years [
49
]. Multiple teeth are the third most common source of
hDPSCs [
23
]. Therefore, from a biological point of view, any other healthy tooth, including
the above three categories, may be used as a source of hDPSCs. Additionally, the premolars
Int. J. Mol. Sci. 2022,23, 11485 10 of 18
extracted during orthodontic treatment are another frequent source of dental pulp cells [
23
].
Rather than being regarded as biological waste, viable dental pulp cells could be a depend-
able and universal source of stem cells that can be broadly applied to organ reconstruction
and tissue regeneration if the teeth can be preserved appropriately following extraction
surgeries. Amongst the conventional cryopreservation processes, the most critical step can
be the extraction of the dental pulp, in which an improper technique can easily lead to
dental tissue contamination. Moreover, as storage time rises, the amount of pulp stem cells
that can be separated from removed teeth decreases [
50
]. Studies have shown that dental
pulp stem cells can remain active
in vitro
for up to one night or 12 h [
51
]. To put it another
way, in a sterile operating environment, this is the shortest possible exposure time
in vitro
.
Our study has proved that whole-tooth cryopreservation at
−
80
◦
C is achievable, which
would boost the success rate of obtaining healthy dental pulp stem cells while minimizing
the risk of contamination during operation after tooth extraction and maintaining the
phenotype of primary cells. Furthermore, through this method, we were able to lower the
requirements as well as the expense of hDPSC preservation, which creates better conditions
for the establishment of dental stem-cell banks and future clinical applications.
However, due to the limited time and samples, additional research into the longest
period of cryopreservation of complete teeth is problematic. If we figure out this problem,
then the whole-tooth cryopreservation schedule would be more flexible, ensuring that they
are therapeutically deployed at the optimal period for cell function. Our future research
may be conducted on this topic to provide a deeper understanding of the preservation
of hDPSCs.
4. Materials and Methods
4.1. Collection of Samples
Teeth extraction and cryopreservation: Between November 2019 and June 2020,
18 impacted
third molars of healthy teenagers aged 15–19 years old were gathered in
the Department of Oral and Maxillofacial Surgery of University Medical Center Hamburg-
Eppendorf. The experimental protocol was authorized by the institutional review board
of the medical chamber of Hamburg (IRB-vote # REC 1712/5/2008). The patients and
their guardians completed the informed permission forms prior to surgeries and were
taught to gargle with 1% H
2
O
2
solution for 3 min. Furthermore, the standard sterilization
procedures were followed during the whole process of operations. The extracted third
molars were then removed and immediately placed in DMEM (Cat. NO. 41965-049, Gibco,
Loughborough, UK) with 10% FBS (Cat. NO. 10500-064, Gibco, Paisley, UK) and peni-
cillin (100 U/mL)/streptomycin (Cat. NO. 15140-148, Gibco, Paisley, UK) at 4
◦
C. Teeth
were then soaked in 4
◦
C DPBS (Cat. NO. 14190-094, Gibco, Paisley, UK) solution (con-
taining
3×105U/mL
penicillin/streptomycin) for 30–60 min followed by experiments
within 2–4 h (Figure 9). The whole progress of this experiments is depicted in a flow
diagram (Figure 10).
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 11 of 18
operating environment, this is the shortest possible exposure time in vitro. Our study has
proved that whole-tooth cryopreservation at −80 °C is achievable, which would boost the
success rate of obtaining healthy dental pulp stem cells while minimizing the risk of con-
tamination during operation after tooth extraction and maintaining the phenotype of pri-
mary cells. Furthermore, through this method, we were able to lower the requirements as
well as the expense of hDPSC preservation, which creates better conditions for the estab-
lishment of dental stem-cell banks and future clinical applications.
However, due to the limited time and samples, additional research into the longest
period of cryopreservation of complete teeth is problematic. If we figure out this problem,
then the whole-tooth cryopreservation schedule would be more flexible, ensuring that
they are therapeutically deployed at the optimal period for cell function. Our future re-
search may be conducted on this topic to provide a deeper understanding of the preser-
vation of hDPSCs.
4. Materials and Methods
4.1. Collection of Samples
Teeth extraction and cryopreservation: Between November 2019 and June 2020, 18
impacted third molars of healthy teenagers aged 15–19 years old were gathered in the
Department of Oral and Maxillofacial Surgery of University Medical Center Hamburg-
Eppendorf. The experimental protocol was authorized by the institutional review board
of the medical chamber of Hamburg (IRB-vote # REC 1712/5/2008). The patients and their
guardians completed the informed permission forms prior to surgeries and were taught
to gargle with 1% H2O2 solution for 3 min. Furthermore, the standard sterilization proce-
dures were followed during the whole process of operations. The extracted third molars
were then removed and immediately placed in DMEM (Cat. NO. 41965-049, Gibco,
Loughborough, UK) with 10% FBS (Cat. NO. 10500-064, Gibco, Paisley, UK) and penicillin
(100 U/mL)/streptomycin (Cat. NO. 15140-148, Gibco, Paisley, UK) at 4 °C. Teeth were
then soaked in 4 °C DPBS (Cat. NO. 14190-094, Gibco, Paisley, UK) solution (containing 3
× 105 U/mL penicillin/streptomycin) for 30–60 min followed by experiments within 2–4 h
(Figure 9). The whole progress of this experiments is depicted in a flow diagram (Figure
10).
Figure 9. The procedure of teeth treatment in T1 and T2 frozen groups: 1/3 of the apical was removed
and stored in the freezing medium containing DMSO.
Figure 9.
The procedure of teeth treatment in T1 and T2 frozen groups: 1/3 of the apical was removed
and stored in the freezing medium containing DMSO.
Int. J. Mol. Sci. 2022,23, 11485 11 of 18
Int. J. Mol. Sci. 2022, 23, x FOR PEER REVIEW 12 of 18
Figure 10. Flow diagram for teeth processing. DPSCs in six teeth were immediately cultured for
cellular characterization experiments. After a month of cryopreservation, others were cultivated and
examined.
4.2. Cryopreservation
The third molars were then allocated into 3 groups at random: a control group (C), a
5% DMSO group (T1), and a 10% DMSO group (T2). For the T1 and T2 groups, the corre-
sponding concentration of DMSO (Cat. NO. 2308.0100, Geyer GmbH, Germany) medium
was used to immerse the teeth. Previously, sterilized high-speed turbine drills were used
to remove a section of the root from 1/3 of the apical in order for the DMSO cell-cryopres-
ervation solution to have greater contact with the pulp tissue (Figure 8). After being stored
in the refrigerator at 4 °C for 30 min and −20 °C for 1 h, the teeth in the T1 and T2 groups
were then preserved in the −80 °C refrigerator for 1 month. The teeth in the C group, on
the other hand, were split open using a sterilized high-speed turbine drill to expose the
pulp. Thereafter, the intra-dental pulp tissues were cut into 0.5 mm3 tissue blocks and
placed in cell culture plates.
4.3. Culture of hDPSCs
Figure 10.
Flow diagram for teeth processing. DPSCs in six teeth were immediately cultured for
cellular characterization experiments. After a month of cryopreservation, others were cultivated
and examined.
4.2. Cryopreservation
The third molars were then allocated into 3 groups at random: a control group (C),
a 5% DMSO group (T1), and a 10% DMSO group (T2). For the T1 and T2 groups, the
corresponding concentration of DMSO (Cat. NO. 2308.0100, Geyer GmbH, Germany)
medium was used to immerse the teeth. Previously, sterilized high-speed turbine drills
were used to remove a section of the root from 1/3 of the apical in order for the DMSO
cell-cryopreservation solution to have greater contact with the pulp tissue (Figure 8). After
being stored in the refrigerator at 4
◦
C for 30 min and
−
20
◦
C for 1 h, the teeth in the T1
and T2 groups were then preserved in the
−
80
◦
C refrigerator for 1 month. The teeth in
the C group, on the other hand, were split open using a sterilized high-speed turbine drill
to expose the pulp. Thereafter, the intra-dental pulp tissues were cut into 0.5 mm
3
tissue
blocks and placed in cell culture plates.
Int. J. Mol. Sci. 2022,23, 11485 12 of 18
4.3. Culture of hDPSCs
Tissues of each group were dispersed in 24-well plates. Each tissue block was po-
sitioned in its own well and dipped in 600 uL DMEM culture medium (with 10% FBS
and
100 U/mL
penicillin/streptomycin) after it affixed to the bottom. The plates with
tissue blocks were then incubated at 37
◦
C in 5% CO
2
incubators. Every day, an inverted
microscope was used to evaluate cell adhesion and cultivation conditions. When con-
fluency of colonies reached the optimal level, the cells were isolated with 0.05% Trypsin
(
Cat. NO. 25300-054
, Gibco, Paisley, UK) and counted with cell-counting boards. The cells
were passaged when a density of roughly 8 ×103/cm2was reached.
4.4. Assessment of Primary Cellular Morphology and Recording of Primary Cell Growth Time
Two trained and calibrated experimenters examined the pulp tissue daily with an
inverted microscope, assessed the morphology of the primary cells and recorded the time
from tissue block implantation to cell adhesion and expansion for each group. When the
cells reached 80–90% confluency, the primary cells were digested and passaged.
4.5. Cell Yield Computation
After the primary cells reached 80–90% confluency, they were digested using 0.05%
trypsin for 3 min. The trypsinization process was halted with an equivalent volume of
DMEM culture medium as soon as the cellular morphology was observed to be spherical
and floating. Afterward, the hDPSCs were transferred into 50 mL tubes and centrifuged
at 1000 rpm for 10 min at room temperature. The supernatant was discarded and the
cells were suspended again in DMEM culture medium. The number of cells was calcu-
lated with cell-counting plates. Primary cell quantity = Total cell number/4
×
dilution
factor ×104 ×volume of cell suspension
4.6. Flow Cytometry
Dental pulp cells were collected for flow cytometry. Specific PE-conjugated antibodies
including CD34 (Cat. NO. 343505, Biolegend, San Diego, CA, USA), CD45 (
Cat. NO. 304007
,
Biolegend, San Diego, CA, USA), CD73 (Cat. NO. 344003, Biolegend, San Diego, CA, USA),
CD90 (Cat. NO. 328109, Biolegend, San Diego, CA, USA) and CD105 (Cat. NO. 323205,
Biolegend, San Diego, CA, USA) were chosen to test the cells following the protocol from the
manufacturer. Each tube containing 2
×
10
5
cells received 100
µ
L of dye liquid containing
1:1000 live/dead dye and 1:100 antibody, which was then incubated for 20 min at room
temperature. After being washed with PBS, cells were detected with BD LSRFortessa cell
analyzer (Becton Dickinson Bioscience, Becton, USA) and BD FACSDiva software V6.1.3
(Becton Dickinson Bioscience, USA). Data were further analyzed with FlowJo software
V10.0.7 (Treestar Inc., Ashland, OR, USA).
4.7. Colony-Forming Efficiency
A total of 1
×
10
3
cells of each group from the first generation were seeded on
10 cm
-diameter culture dishes. The culture medium was changed every 3 days. The
medium was removed two weeks later, and the cellular colonies were fixed in pure
methanol for
10–15 min
, rinsed three times with DPBS, and stained with Giemsa Solu-
tion (Cat. NO. 48900, Sigma-Aldrich, Schaffhausen, Switzerland) for 10 min. The colonies
of dental pulp cells with a number greater than 50 were recorded as being available. Three
parallel dishes were set for 1 sample. Colony-forming efficiency = number of available
colonies/number of seeded cells ×100%
4.8. Cell Survival Rate
Trypan Blue staining: Cells from the first generation in the three groups were stained
with 0.4% Trypan Blue (Cat. NO. 15250-061, Gibco, Paisley, UK) for 2 min and then observed
using the inverted microscope. Within 500 dental pulp cells, the number of unstained living
Int. J. Mol. Sci. 2022,23, 11485 13 of 18
cells was recorded and the cell survival rates were computed. Cell survival rate of Trypan
Blue = number of unstained living cells/500 ×100%
Live–dead staining: Cells from the first generation of each group were seeded on
TCC (tissue culture coverslips, Cat. NO. 83.1840.002, Sarstedt, Nümbrecht, Germany) at
a density of 8
×
10
4
/mL in 12-well plates, corresponding to 8
×
10
4
cells per well, and
were incubated at 37
◦
C in 5% CO
2
incubators for 4 h. Next, 60
µ
L of propidium iodide (PI)
(50
µ
g/mL in PBS) and 500
µ
L fluorescein diacetate (FDA) working solution (20
µ
g/mL)
were added to each well. After 3 min of incubation at room temperature and rinsing with
DPBS, samples were observed with a fluorescence microscope (Nikon ECLIPSE Ti-S/L100,
Düsseldorf, Germany). The number of live cells, which were stained in green, were counted.
The cell survival rate was calculated. Cell survival rate of live–dead staining = number of
green-stained cells/number of total cells ×100%
4.9. Proliferation Testing with MTS Assay
Cells from the third generation were seeded in 96-well plates at a density of
2×104/mL
,
equating to 2
×
10
3
cells per well, and were incubated at 37
◦
C in 5% CO2 incubators.
The proliferation of cells was measured with the MTS assay (Cat. NO. G1111, Promega,
Madison, USA) for 8 continuous days in total. Cells from 3 wells of each sample in every
group were subjected to MTS colorimetric analysis. Next, 20
µ
L of MTS reagent was added
to each well and the absorbance was detected after 3 h of incubation using a microplate
reader (Thermo Fisher Scientific, Waltham, MA, USA) at the wavelength of 490 nm.
4.10. Differentiation Potential Assessment
Adipogenic differentiation: Cells from the third generation were cultured at a density
of 2
×
10
4
/mL, corresponding to 4
×
10
4
per well in 6-well plates. EVE Automatic Cell
Counter (NanoEntek, Seoul, Korea) was used to calculate the concentration of the cell
suspension in each group 3 times. Then, the cell suspension was plated at the same volume
into 6-well plates after normalizing the concentration of cells in each group to ensure that the
number of cells added to each well and the volume of culture medium were the same. The
cells were grown in adipogenesis-induction medium (DMEM containing 10% FCS,
5µg/mL
insulin, 0.5 mmol/L 3-isobutyl-1-methylxanthine, and 10
µ
mol/L dexamethasone) for
3 weeks
after reaching 60–70 percent confluency, and the medium in the wells was replaced
every 3 days. On the 22nd day, the cells were fixed with paraformaldehyde (PFA; Electron
Microscopy Sciences, Fort Washington, PA, USA) for 20 min and rinsed 3 times with DPBS.
The stimulated cells were then stained with 0.5% Oil Red O solution (Cat. NO. O1391-
250ML, Sigma-Aldrich, St. Louis, MS, USA) for 10–15 min. After staining, cells were
rinsed 3 times with DPBS and the stained lipid droplets in the cytoplasm were seen and
photographed using an inverted microscope.
Adipogenic differentiation quantitative analysis: To eliminate the remaining staining
solution, stained cells in plates were washed three times with DPBS. Thereafter, 1 mL
isopropanol (Cat. NO. 34965-1L, Honeywell, North Carolina, Charlotte, US) was added to
each well to dissolve the lipid droplets, and the plates were gently shaken until the solution
was equally colored. Then, the solution was transferred into 96-well plates at 100
µ
L well
and detected using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA) at a
wavelength of 540 nm. Three parallel groups were set for 1 sample.
Osteogenic differentiation: Cells from the third generation were cultured at a density
of 2
×
10
4
/mL, corresponding to 4
×
10
4
per well in 6-well plates. EVE Automatic Cell
Counterwas used to calculate the concentration of cell suspension in each group 3 times.
Then, the cell suspension was plated at the same volume into 6-well plates after normalizing
the concentration of cells in each group to ensure that the number of cells added in each
well and the volume of culture medium were the same. After attaining 60–70 percent
confluency, the cells were cultured for 3 weeks in osteogenic-induction medium (DMEM
with 10% FCS, 10 mmol/L glycerophosphate, 5 mmol/mL ascorbic acid, and 1 mol/L
dexamethasone). The medium was changed every 3 days. On the 22nd day, the cells were
Int. J. Mol. Sci. 2022,23, 11485 14 of 18
fixed with paraformaldehyde for 20 min and washed 3 times with DPBS. The stimulated
cells were then stained for 10–15 min with 0.1% Alizarin red S (Cat. NO. GT6383, Glentham,
Germany) solution. After staining, cells were rinsed 3 times with DPBS and the inverted
microscope was used to observe and take pictures of the stained calcium nodules.
Osteogenic differentiation quantitative analysis: To remove leftover staining solution,
stained cells in plates were washed three times with DPBS. Following that, 750
µ
L of 10%
acetic acid (Cat. NO. 2289.1000, Geyer GmbH, Stuttgart, Germany) was transferred into
each well and the plates were gently shaken to completely dissolve the stained calcium
nodules. To neutralize the acetic acid, an equivalent amount (750
µ
L) of 10% ammonium
hydroxide was applied. The solution was transferred into 96-well plates at 100
µ
L/well
and detected using a microplate reader at a wavelength of 405 nm. Three parallel groups
were set for 1 sample.
4.11. Osteogenic Activity with ALP Assay
Following the ALP assay kit instructions (ab83369 Alkaline Phosphatase Assay Kit,
Cambridge, UK), 80
µ
L of the supernatant of each group after osteogenic induction was
added to 96-well plates for the ALP assay. Then, 20
µ
L of stop solution was added to the
sample background control wells to terminate ALP activity in these samples. The samples
were mixed well by pipetting up and down. Next, 50
µ
L of 5 mM pNPP solution was
added to each well containing the sample and background sample controls. Then, 10
µ
L of
ALP enzyme solution was added to each pNPP standard well. Plates were incubated at
25
◦
C for 60 min while protected from light. The reaction was ceased in sample wells and
standard wells by adding 20
µ
L of stop solution. The output at OD 405 nm was measured
on a microplate reader. The ALP activities of each group were detected at day 7, day 14
and day 21, respectively.
4.12. Gene Expression Detection
TRIzol reagent (Cat. NO. 15596026, Ambion, Austin, TX, USA) was used to extract
total RNA from differentiated dental pulp cells, which was subsequently quantified using
a spectrophotometer (Cat. NO. 51119700DP, Thermo Fisher, Singapore) and 1 percent
agarose gel electrophoresis. The isolated total RNA was reverse transcribed to cDNA
for the reverse-transcription PCR as well as real-time quantitative PCR analysis using
GoScriptTM RT reagent Kit (Cat. NO. A5001, Promega, Madison, WI, USA) and Luna
®
Universal One-Step RT-qPCR Kit (Cat. NO. E3005, New England biolabs INC, Ipswich, MA,
USA) according to the manufacturer’s protocol. Primers were designed on Primerbank.
Lipoprotein lipase (LPL) and peroxisome proliferator-activated receptor-
γ
(PPAR-
γ
) were
selected as adipogenic-specific genes; otherwise, alkaline phosphatase (ALP), runt-related
transcription factor 2 (RUNX2), type I collagen (COL I) and osteocalcin (OSC) were selected
as osteogenic genes and their expressions were detected at day 7, day 14 and day 21.
GAPDH was selected as the reference housekeeping gene of each sample. The relative
quantity of mRNAs was calculated with the 2
−∆∆Ct
method after normalization. Table 1
shows the primer sequences as well as the length of the products.
Table 1. Primer sequences of adipogenic- and osteogenic-induced gene expression.
Primer Direction Sequence Length of Products (bp)
LPL Forward ACAAGAGAGAACCAGACTCCAA 76
Reverse GCGGACACTGGGTAATGCT
PPAR-γForward GGGATCAGCTCCGTGGATCT 186
Reverse TGCACTTTGGTACTCTTGAAGTT
ALP Forward ACTGGTACTCAGACAACGAGAT 97
Reverse ACGTCAATGTCCCTGATGTTATG
Int. J. Mol. Sci. 2022,23, 11485 15 of 18
Table 1. Cont.
Primer Direction Sequence Length of Products (bp)
RUNX 2 Forward TGGTTACTGTCATGGCGGGTA 97
Reverse TCTCAGATCGTTGAACCTTGCTA
Type I collagen Forward GGACACAATGGATTGCAAGG 441
Reverse AACCACTGCTCCACTCTGG
Osteocalcin Forward GGCGCTACCTGTATCAATGG 110
Reverse GTGGTCAGCCAACTCGTCA
GAPDH Forward GAGTCAACGGATTTGGTCGT 185
Reverse GACAAGCTTCCCGTTCTCAG
4.13. Statistical Analysis
Variance in the mean values across the three groups was analyzed using a student t-
test. Statistical significance was defined as a p-value of less than 0.05. For statistical analysis,
SPSS 25.0 software (SPSS Inc., Chicago, IL, USA) and Graphpad Prism V9.0 (GraphPad
Software, San Diego, CA, USA) was utilized.
5. Conclusions
Our research aimed to examine the effect of cryopreserving whole teeth with 5% and
10% DMSO on hDPSCs. The results of our study indicated that the new strategy of sample
freezing and unfreezing had a negative effect on the initial culture stage of dental pulp cells,
which prolonged the growth and culture time of dental pulp cells. However, the results
of the cell experiments on the third generation showed that the biological activity of the
experimental dental pulp stem cells was almost not affected. The hDPSCs maintained a high
proliferation and differentiation ability. The new strategy, on the other hand, effectively
reduced the exposure time of the samples to aseptic conditions, which can reduce the
chance of infection. More importantly, the new cryopreserved method effectively lowers
the tissue-preservation requirements, so that the common dental practice can preserve the
samples in time, too. This maximizes the freshness of the pulp tissue and the biological
activities of the dental pulp stem cells. Although the small sample size did not allow us to
further investigate the maximum duration of the cryopreservation of whole teeth, our study
shows the feasibility of the new cryopreservation method, which can provide a theoretical
basis for the establishment of a dental stem-cell bank and create better conditions for future
stem-cell therapy.
Author Contributions:
Conceptualization, W.W. and M.Y.; methodology, T.B.; software, G.A.; valida-
tion, U.P.; formal analysis, M.F.; investigation, R.S.; resources, M.G.; data curation, W.W.; writing—
original draft preparation, W.W. and M.Y.; writing—review and editing, W.W. and M.Y.; supervision,
T.B.; project administration, T.B.; funding acquisition, M.Y. and R.S. All authors have read and agreed
to the published version of the manuscript.
Funding:
This research was funded by Merit Scholarship for International Students, grant number
No.7238065.
Institutional Review Board Statement:
Administrative permissions were acquired by our team to
access the data used in our research. The study protocol was approved by the Hamburg University
ethics committee that approved the study. No: REC 1712/5/2008.
Informed Consent Statement:
Informed consent was obtained from all subjects involved in the
study. All teeth were coded with number and all personal identification of the patients were removed.
All parent or guardian of participants provided written informed consent for using their teeth which
otherwise would have been discarded as waste.
Data Availability Statement:
The data presented in this study are available on request from the
corresponding author.
Int. J. Mol. Sci. 2022,23, 11485 16 of 18
Acknowledgments:
The authors thank the Lan Kluwe of Laboratory for Neurology, Department of
Oral and Maxillofacial Surgery, University Medical Center Hamburg for skillful technical assistance.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Hoang, D.M.; Pham, P.T.; Bach, T.Q.; Ngo, A.T.L.; Nguyen, Q.T.; Phan, T.T.K.; Nguyen, G.H.; Le, P.T.T.; Hoang, V.T.;
Forsyth, N.R.; et al. Stem cell-based therapy for human diseases. Signal Transduct. Target. Ther. 2022,7, 272. [CrossRef]
2.
Gronthos, S.; Brahim, J.; Li, W.; Fisher, L.W.; Cherman, N.; Boyde, A.; DenBesten, P.; Robey, P.G.; Shi, S. Stem Cell Properties of
Human Dental Pulp Stem Cells. J. Dent. Res. 2002,81, 531–535. [CrossRef]
3.
Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal human dental pulp stem cells (DPSCs)
in vitro
and
in vivo
.
Proc. Natl. Acad. Sci. USA 2000,97, 13625–13630. [CrossRef]
4.
Huang, G.T.-J.; Gronthos, S.; Shi, S. Mesenchymal Stem Cells Derived from Dental Tissues vs. Those from Other Sources: Their
Biology and Role in Regenerative Medicine. J. Dent. Res. 2009,88, 792–806. [CrossRef]
5.
La Noce, M.; Stellavato, A.; Vassallo, V.; Cammarota, M.; Laino, L.; Desiderio, V.; Del Vecchio, V.; Nicoletti, G.F.; Tirino, V.;
Papaccio, G.; et al. Hyaluronan-Based Gel Promotes Human Dental Pulp Stem Cells Bone Differentiation by Activating YAP/TAZ
Pathway. Cells 2021,10, 2899. [CrossRef]
6.
Kawashima, N.; Noda, S.; Yamamoto, M.; Okiji, T. Properties of Dental Pulp–derived Mesenchymal Stem Cells and the Effects of
Culture Conditions. J. Endod. 2017,43, S31–S34. [CrossRef]
7.
Jo, Y.-Y.; Lee, H.-J.; Kook, S.-Y.; Choung, H.-W.; Park, J.-Y.; Chung, J.-H.; Choung, Y.-H.; Kim, E.-S.; Yang, H.-C.; Choung, P.-H.
Isolation and Characterization of Postnatal Stem Cells from Human Dental Tissues. Tissue Eng. 2007,13, 767–773. [CrossRef]
8.
Wei, X.; Ling, J.; Wu, L.; Liu, L.; Xiao, Y. Expression of Mineralization Markers in Dental Pulp Cells. J. Endod.
2007
,33, 703–708.
[CrossRef]
9.
Chang, C.-C.; Chang, K.-C.; Tsai, S.-J.; Chang, H.-H.; Lin, C.-P. Neurogenic differentiation of dental pulp stem cells to neuron-like
cells in dopaminergic and motor neuronal inductive media. J. Formos. Med. Assoc. 2014,113, 956–965. [CrossRef]
10.
Huang, G.T.-J.; Shagramanova, K.; Chan, S.W. Formation of Odontoblast-Like Cells from Cultured Human Dental Pulp Cells on
Dentin In Vitro. J. Endod. 2006,32, 1066–1073. [CrossRef]
11.
Tatullo, M.; Marrelli, M.; Shakesheff, K.M.; White, L.J. Dental pulp stem cells: Function, isolation and applications in regenerative
medicine. J. Tissue Eng. Regen. Med. 2015,9, 1205–1216. [CrossRef]
12.
Karaöz, E.; Demircan, P.C.; Sa˘glam, Ö.; Aksoy, A.; Kaymaz, F.; Duruksu, G. Human dental pulp stem cells demonstrate better
neural and epithelial stem cell properties than bone marrow-derived mesenchymal stem cells. Histochem. Cell Biol.
2011
,
136, 455–473. [CrossRef]
13.
Govindasamy, V.; Ronald, V.S.; Abdullah, A.N.; Nathan, K.G.; Aziz, Z.A.C.A.; Abdullah, M.; Musa, S.; Kasim, N.H.A.;
Bhonde, R.R.
Differentiation of Dental Pulp Stem Cells into Islet-like Aggregates. J. Dent. Res. 2011,90, 646–652. [CrossRef]
14.
Dasari, V.R.; Veeravalli, K.K.; Dinh, D.H. Mesenchymal stem cells in the treatment of spinal cord injuries: A review. World J. Stem
Cells 2014,6, 120–133. [CrossRef]
15.
Király, M.; Porcsalmy, B.; Pataki, A.; Kádár, K.; Jelitai, M.; Molnár, B.; Hermann, P.; Gera, I.; Grimm, W.-D.; Ganss, B.; et al.
Simultaneous PKC and cAMP activation induces differentiation of human dental pulp stem cells into functionally active neurons.
Neurochem. Int. 2009,55, 323–332. [CrossRef]
16.
Ikeda, E.; Yagi, K.; Kojima, M.; Yagyuu, T.; Ohshima, A.; Sobajima, S.; Tadokoro, M.; Katsube, Y.; Isoda, K.; Kondoh, M.; et al.
Multipotent cells from the human third molar: Feasibility of cell-based therapy for liver disease. Differentiation
2008
,76, 495–505.
[CrossRef]
17.
Taghipour, Z.; Karbalaie, K.; Kiani, A.; Niapour, A.; Bahramian, H.; Nasr-Esfahani, M.H.; Baharvand, H. Transplantation of
Undifferentiated and Induced Human Exfoliated Deciduous Teeth-Derived Stem Cells Promote Functional Recovery of Rat
Spinal Cord Contusion Injury Model. Stem Cells Dev. 2012,21, 1794–1802. [CrossRef]
18.
Sakai, K.; Yamamoto, A.; Matsubara, K.; Nakamura, S.; Naruse, M.; Yamagata, M.; Sakamoto, K.; Tauchi, R.; Wakao, N.;
Imagama, S.; et al.
Human dental pulp-derived stem cells promote locomotor recovery after complete transection of the rat spinal
cord by multiple neuro-regenerative mechanisms. J. Clin. Investig. 2012,122, 80–90. [CrossRef]
19.
D’Aquino, R.; De Rosa, A.; Laino, G.; Caruso, F.; Guida, L.; Rullo, R.; Checchi, V.; Laino, L.; Tirino, V.; Papaccio, G. Human dental
pulp stem cells: From biology to clinical applications. J. Exp. Zoöl. Part B Mol. Dev. Evol. 2008,312B, 408–415. [CrossRef]
20.
Kerkis, I.; Ambrosio, C.E.; Kerkis, A.; Martins, D.S.; Zucconi, E.; Fonseca, S.A.S.; Cabral, R.M.; Maranduba, C.M.C.; Gaiad, T.P.;
Morini, A.C.; et al. Early transplantation of human immature dental pulp stem cells from baby teeth to golden retriever muscular
dystrophy (GRMD) dogs: Local or systemic? J. Transl. Med. 2008,6, 35. [CrossRef]
21.
Yamamura, Y.; Yamada, H.; Sakurai, T.; Ide, F.; Inoue, H.; Muramatsu, T.; Mishima, K.; Hamada, Y.; Saito, I. Treatment of salivary
gland hypofunction by transplantation with dental pulp cells. Arch. Oral Biol. 2013,58, 935–942. [CrossRef] [PubMed]
22.
Pilbauerova, N.; Schmidt, J.; Soukup, T.; Ivancakova, R.K.; Suchanek, J. The Effects of Cryogenic Storage on Human Dental Pulp
Stem Cells. Int. J. Mol. Sci. 2021,22, 4432. [CrossRef]
Int. J. Mol. Sci. 2022,23, 11485 17 of 18
23.
Ferrúa, C.P.; Centeno, E.G.Z.; da Rosa, L.C.; Amaral, C.C.D.; Severo, R.F.; Sarkis-Onofre, R.; Nascimento, G.G.; Cordenonzi, G.;
Bast, R.K.; Demarco, F.F.; et al. How has dental pulp stem cells isolation been conducted? A scoping review. Braz. Oral Res.
2017
,
31, e87. [CrossRef]
24.
Collart-Dutilleul, P.-Y.; Chaubron, F.; De Vos, J.; Cuisinier, F.J. Allogenic banking of dental pulp stem cells for innovative
therapeutics. World J. Stem Cells 2015,7, 1010–1021.
25.
Hilkens, P.; Driesen, R.B.; Wolfs, E.; Gervois, P.; Vangansewinkel, T.; Ratajczak, J.; Dillen, Y.; Bronckaers, A.; Lambrichts, I.
Cryopreservation and Banking of Dental Stem Cells. Biobanking Cryopreserv. Stem Cells 2016,951, 199–235.
26.
Perry, B.C.; Zhou, D.; Wu, X.; Yang, F.-C.; Byers, M.A.; Chu, T.-M.G.; Hockema, J.J.; Woods, E.J.; Goebel, W.S. Collection,
cryopreservation, and characterization of human dental pulp-derived mesenchymal stem cells for banking and clinical use. Tissue
Eng. Part C Methods 2008,14, 149–156. [CrossRef]
27.
Zambelli, A.; Poggi, G.; Da Prada, G.; Pedrazzoli, P.; Cuomo, A.; Miotti, D.; Perotti, C.; Preti, P.; Della Cuna, G.R. Clinical toxicity
of cryopreserved circulating progenitor cells infusion. Anticancer Res. 1999,18, 4705–4708.
28. Sato, M.; Kawase-Koga, Y.; Yamakawa, D.; Fujii, Y.; Chikazu, D. Bone Regeneration Potential of Human Dental Pulp Stem Cells
Derived from Elderly Patients and Osteo-Induced by a Helioxanthin Derivative. Int. J. Mol. Sci. 2020,21, 7731. [CrossRef]
29.
Graziano, A.; Papaccio, G.; Laino, G.; Graziano, A. Dental pulp stem cells: A promising tool for bone regeneration. Stem Cell Rev.
2008,4, 21–26. [CrossRef]
30. Liu, L.; Rando, T.A. Manifestations and mechanisms of stem cell aging. J. Cell Biol. 2011,193, 257–266. [CrossRef]
31.
Alt, E.U.; Senst, C.; Murthy, S.N.; Slakey, D.P.; Dupin, C.L.; Chaffin, A.E.; Kadowitz, P.J.; Izadpanah, R. Aging alters tissue resident
mesenchymal stem cell properties. Stem Cell Res. 2012,8, 215–225. [PubMed]
32.
Wu, W.; Niklason, L.; Steinbacher, D.M. The Effect of Age on Human Adipose-Derived Stem Cells. Plast. Reconstr. Surg.
2013
,
131, 27–37.
33. Smith, J.A.; Daniel, R. Stem cells and aging: A chicken-or-the-egg issue? Aging Dis. 2012,3, 260–268.
34.
Murray, P.E.; Stanley, H.R.; Matthews, J.B.; Sloan, A.J.; Smith, A.J. Age-related odontometric changes of human teeth. Oral Surg.
Oral Med. Oral Pathol. Oral Radiol. Endodontology 2002,93, 474–482. [CrossRef] [PubMed]
35.
Yan, M.; Nada, O.A.; Kluwe, L.; Gosau, M.; Smeets, R.; Friedrich, R.E. Expansion of Human Dental Pulp Cells In Vitro Under
Different Cryopreservation Conditions. Vivo 2020,34, 2363–2370. [CrossRef] [PubMed]
36.
Raik, S.; Kumar, A.; Rattan, V.; Seth, S.; Kaur, A.; Charyya, S.B. Assessment of Post-thaw Quality of Dental Mesenchymal Stromal
Cells After Long-Term Cryopreservation by Uncontrolled Freezing. Appl. Biochem. Biotechnol. 2019,191, 728–743.
37.
Kumar, A.; Bhattacharyya, S.; Rattan, V. Effect of uncontrolled freezing on biological characteristics of human dental pulp stem
cells. Cell Tissue Bank. 2015,16, 513–522. [CrossRef]
38.
Woods, E.J.; Perry, B.C.; Hockema, J.J.; Larson, L.; Zhou, D.; Goebel, W.S. Optimized cryopreservation method for human dental
pulp-derived stem cells and their tissues of origin for banking and clinical use. Cryobiology 2009,59, 150–157. [CrossRef]
39.
Ginani, F.; Soares, D.M.; Rabêlo, L.M.; Rocha, H.A.O.; De Souza, L.B.; Barboza, C.A.G. Effect of a cryopreservation protocol on the
proliferation of stem cells from human exfoliated deciduous teeth. Acta Odontol. Scand. 2016,74, 598–604.
40.
Yanasse, R.H.; Marques, L.; Fukasawa, J.T.; Segato, R.; Kinoshita, A.; Matsumoto, M.A.; Felisbino, S.L.; Solano, B.; dos Santos, R.R.
Xenotransplantation of human dental pulp stem cells in platelet-rich plasma for the treatment of full-thickness articular cartilage
defects in a rabbit model. Exp. Ther. Med. 2019,17, 4344–4356. [CrossRef]
41.
Wang, J.; Zuzzio, K.; Walker, C.L. Systemic Dental Pulp Stem Cell Secretome Therapy in a Mouse Model of Amyotrophic Lateral
Sclerosis. Brain Sci. 2019,9, 165. [CrossRef] [PubMed]
42.
Li, N.; Zhang, Y.; Nepal, N.; Li, G.; Yang, N.; Chen, H.; Lin, Q.; Ji, X.; Zhang, S.; Jin, S. Dental pulp stem cells overexpressing
hepatocyte growth factor facilitate the repair of DSS-induced ulcerative colitis. Stem Cell Res. Ther.
2021
,12, 30. [CrossRef]
[PubMed]
43.
Hata, M.; Omi, M.; Kobayashi, Y.; Nakamura, N.; Miyabe, M.; Ito, M.; Ohno, T.; Imanishi, Y.; Himeno, T.; Kamiya, H.; et al.
Sustainable Effects of Human Dental Pulp Stem Cell Transplantation on Diabetic Polyneuropathy in Streptozotocine-Induced
Type 1 Diabetes Model Mice. Cells 2021,10, 2473. [CrossRef] [PubMed]
44.
Carter, K.; Worthington, S. Predictors of Third Molar Impaction: A Systematic Review and Meta-analysis. J. Dent. Res.
2016
,
95, 267–276. [CrossRef]
45.
Ghaeminia, H.; Perry, J.; Nienhuijs, M.E.L.; Toedtling, V.; Tummers, M.; Hoppenreijs, T.J.M.; van der Sanden, W.J.M.; Mettes, T.G.
Surgical removal versus retention for the management of asymptomatic disease-free impacted wisdom teeth. Cochrane Database
Syst. Rev. 2016,2016, CD003879. [CrossRef]
46.
McArdle, L.W.; Renton, T. The effects of NICE guidelines on the management of third molar teeth. Br. Dent. J.
2012
,213, E8.
[CrossRef]
47. Brokaw, W.C. The third molar question: When and why should we recommend removal? Va. Dent. J. 1991,68, 18–21.
48. Tate, T.E. Impactions: Observe or treat? W. V. Dent. J. 1994,68, 19–23.
49.
Omar, Z.; Short, L.; Banting, D.W.; Saltaji, H. Profile changes following extraction orthodontic treatment: A comparison of first
versus second premolar extraction. Int. Orthod. 2018,16, 91–104. [CrossRef]
Int. J. Mol. Sci. 2022,23, 11485 18 of 18
50.
Eubanks, E.J.; Tarle, S.A.; Kaigler, D. Tooth Storage, Dental Pulp Stem Cell Isolation, and Clinical Scale Expansion without Animal
Serum. J. Endod. 2014,40, 652–657. [CrossRef]
51.
Huynh, N.C.-N.; Le, S.H.; Doan, V.N.; Ngo, L.T.Q.; Tran, H.L.B. Simplified conditions for storing and cryopreservation of dental
pulp stem cells. Arch. Oral Biol. 2017,84, 74–81. [CrossRef] [PubMed]
