Access to this full-text is provided by Frontiers.
Content available from Frontiers in Veterinary Science
This content is subject to copyright.
ORIGINAL RESEARCH
published: 05 July 2022
doi: 10.3389/fvets.2022.928375
Frontiers in Veterinary Science | www.frontiersin.org 1July 2022 | Volume 9 | Article 928375
Edited by:
Ran Di,
Institute of Animal Sciences
(CAAS), China
Reviewed by:
Yongfu La,
Lanzhou Institute of Husbandry and
Pharmaceutical Sciences
(CAAS), China
João Gouveia,
Universidade Federal do Vale do São
Francisco, Brazil
*Correspondence:
Xiaoxue Zhang
zhangxx@gsau.edu.cn
Specialty section:
This article was submitted to
Livestock Genomics,
a section of the journal
Frontiers in Veterinary Science
Received: 25 April 2022
Accepted: 14 June 2022
Published: 05 July 2022
Citation:
Cui P, Wang W, Zhang D, Li C,
Huang Y, Ma Z, Wang X, Zhao L,
Zhang Y, Yang X, Xu D, Cheng J, Li X,
Zeng X, Zhao Y, Li W, Wang J, Lin C,
Zhou B, Liu J, Zhai R and Zhang X
(2022) Identification of TRAPPC9 and
BAIAP2 Gene Polymorphisms and
Their Association With Fat
Deposition-Related Traits in Hu
Sheep. Front. Vet. Sci. 9:928375.
doi: 10.3389/fvets.2022.928375
Identification of TRAPPC9 and
BAIAP2 Gene Polymorphisms and
Their Association With Fat
Deposition-Related Traits in Hu
Sheep
Panpan Cui 1, Weimin Wang 1,2, Deyin Zhang 2, Chong Li 1, Yongliang Huang 1, Zongwu Ma 1,
Xiaojuan Wang 1, Liming Zhao 1, Yukun Zhang 1, Xiaobin Yang 1, Dan Xu 1, Jiangbo Cheng 1,
Xiaolong Li 1, Xiwen Zeng 1, Yuan Zhao1, Wenxin Li 1, Jianghui Wang 1, Changchun Lin 1,
Bubo Zhou 1, Jia Liu 1, Rui Zhai 1and Xiaoxue Zhang 1
*
1College of Animal Science and Technology, Gansu Agricultural University, Lanzhou, China, 2The State Key Laboratory of
Grassland Agro-Ecosystems, College of Pastoral Agriculture Science and Technology, Lanzhou University, Lanzhou, China
Fat deposition is an important economic trait that is closely related to feed efficiency
and carcass performance in livestock. In this study, the fat deposition-related traits of
1,293 Hu sheep were measured and descriptive statistical analysis was conducted.
The results showed that the coefficient of variation of all fat deposition-related traits
was higher than 24%. In addition, single nucleotide polymorphisms and the expression
characteristics of TRAPPC9 (encoding trafficking protein particle complex subunit
9) and BAIAP2 (encoding brain-specific Angiogenesis inhibitor 1-associated protein
2) genes in Hu sheep were detected using PCR amplification, Sanger sequencing,
KASPar genotyping, and quantitative real-time reverse transcription PCR (qRT-PCR). The
associations between SNPs and fat deposition-related traits were also analyzed. Two
intronic mutations, TRAPPC9 g.57654 A >G and BAIAP2 g.46061 C >T, were identified
in Hu sheep. The result of association analysis showed that TRAPPC9 g.57654 A >G
and BAIAP2 g.46061 C >T were both significantly associated with the weight of tail
fat, tail fat relative weight (body weight), and tail fat relative weight (carcass) (P<0.05).
Comprehensive effects analysis showed that there were significant differences between
the combined genotypes and tail fat and perirenal fat deposition. Moreover, qRT-PCR
analysis showed that TRAPPC9 and BAIAP2 are widely expressed, and their expression
levels were significantly higher in the small-tail group compared with those in the big-tail
group (P<0.01). These results provided important candidate molecular markers that
could be used in strategies to reduce tail fat deposition in Hu sheep.
Keywords: Hu sheep, TRAPPC9,BAIAP2, fat deposition related traits, qRT-PCR
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
INTRODUCTION
Hu sheep are one of the important livestock breeds in Taihu
Lake Basin region of China. They have the advantages of high
reproductive performance (long estrus period, average litter
size 2.06), fast growth and development performance, strong
environmental adaptability, and good lactation performance (1,
2). Nowadays, sheep can be classified into five types on the basis
of their tail size: short fat-tailed sheep, long fat-tailed sheep, short
thin-tailed sheep, long thin-tailed sheep, and fat-rumped sheep
(3). The important fat-tailed breed of sheep was first recorded
5,000 years ago (4). Hu sheep belong to short fat-tailed sheep
(3). Adipose tissue plays a vital role in maintaining the balance
of homeostatic metabolic processes in domestic animals. And
it is found in various parts of the sheep body, including the
perirenal, mesentery, and tail. Tail fat is the most typical type of
deposited fat (5). During severe conditions, such as food scarcity
resulting from migration, drought, and winter, tail fat can provide
energy (6). Fat has added value to humans as it can provide high-
energy food during droughts and famines (4). Currently, with
the improvement of people’s living standards and diet structure,
consumers are paying increased attention to their own health
and meat quality. However, for fat-tailed sheep, most of the fat
is deposited in the tail, leading to the reduction of fat deposition
in other parts of the body, which affects meat quality (7). In
modern mutton sheep production systems, tail fat deposition
requires higher energy costs. In addition, tail fat accounts for
20% of the carcass weight, which greatly reduces the economic
value of the carcass and increases the feeding cost (8). Thus,
reducing tail fat deposition has become a research hotspot in
sheep genetic improvement.
NIK- and IKKβ-binding protein (NIBP), also known as
trafficking protein particle complex 9 (TRAPPC9), is a nuclear
factor kappa B (NF-κB) signaling pathway regulating factor that
has been detected in human nerve cells. It has become clear that
the TRAPP complex might exist in different forms depending
on its specific functions (9). In addition, the NF-κB signaling
pathway is the key mediator of cell proliferation, apoptosis,
and physiological and pathological events in tumorigenesis (10).
Wang et al., conducted genome-wide association studies on
Chinese Holstein cows, and the results supported the presence
of significant single nucleotide polymorphisms (SNPs), mainly
located in Bos taurus autosome (BTA) 14 of Chinese Holstein
cows, revealing a new candidate gene, TRAPPC9, gene related
to cow mastitis resistance (11). Another study showed that
microcephaly and obesity are common features of TRAPPC9-
deficient patients (12/23 cases) and summarized this phenotype
in a TRAPPC9-deficient mouse model (12). Briollais et al.
showed that the mean effect of exclusive breastfeeding (EBF) was
associated with a 0.06 reduction in the M value of the TRAPPC9
CpG locus in the first 2 years of life, which resulted in a 0.20
kg/m2reduction in body mass index (BMI) (13). In a study by
Liang et al., deleting TRAPPC9 in mice resulted in the weight
of mice increasing significantly, and it was concluded that the
loss of TRAPPC9 function led to the weight gain (14). Liu et al.
showed that TRAPPC9 is related to body shape traits in pigs,
in which it participates in the regulation of bone growth and
development and nutrient absorption, and is associated with
obesity (15). Insulin receptor substrate p53 (IRSp53), also known
as brain-specific angiogenesis inhibitor 1-associated protein 2
(BAIAP2), is a multi-domain adapter protein originally identified
as a tyrosine protein phosphorylated by the insulin receptor and
insulin-like growth factor 1 (IGF-1) receptor (16). Lakshman et
al. found that BAIAP2 was significantly associated with weight
loss in participants with chronic obstructive pulmonary disease
(COPD) (17). Al-Dokhi showed that adults tend to gain weight
as they get older, caused by fat deposits (18). In addition, Lee
and Shin reported that TRAPPC9 and BAIAP2 were related
to fat accumulation of pigs using a genome-wide association
study (GWAS) (19). However, to the best of our knowledge,
there have been no reports on the association of polymorphisms
in TRAPPC9 and BAIAP2 with fat deposition related-traits in
Hu sheep.
Therefore, in the present study, we analyzed the relationship
between the single SNPs of TRAPPC9 and BAIAP2 and fat
deposition-related traits in Hu sheep. In addition, the expression
levels of TRAPPC9 and BAIAP2 mRNAs in ten different tissues
of Hu sheep and tail adipose tissue of small-tail and big-tail
Hu sheep were also investigated. This study provided valuable
molecular markers for Hu sheep breeding.
MATERIALS AND METHODS
Experimental Sheep and Extraction of DNA
A total of 1,293 Male Hu sheep were purchased from Jinchang
Zhongtian Sheep Industry Co., Ltd., Gansu Zhongsheng Huamei
Sheep Industry Development Co., Ltd., Gansu Sanyang Jinyuan
Animal Husbandry Co., Ltd., Shandong Runlin Sheep Industry
Co., Ltd., and Wuwei Pukang Sheep Industry Co., Ltd. Lambs
were immunized according to standard procedures before
weaning at 56 days of age. All weaned lambs were raised at
Minqin Defu Agriculture Co., Ltd. (Gansu, China). The lamb
acclimation period was 14 days, the pre-experiment period
was 10 days, and the experimental period was 100 days. The
feeding conditions were consistent, including housing, feeding,
and drinking water. Hu sheep were fed with pellet feed purchased
from Gansu Sanyang Jinyuan Animal Husbandry Co., Ltd. All
experimental animals were weighed and slaughtered at 180 days.
After slaughter, the weight of tail fat, mesenteric fat, and perirenal
fat were measured, and collected, and then stored at −80◦C for
subsequent RNA extraction. DNA was extracted from blood of
1,293 adult sheep (6 months old) using an EASYPURE Blood
Genomic DNA Kit (Transgen Biotech, Beijing, China). DNA was
stored in elution buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8.0)
at −20◦C.
SNP Identification and Genotyping
PCR primers were designed according to the gene sequences
to conduct PCR amplification of TRAPPC9 (NC_040260.1
Chromosome 9 Reference Oar_rambouillet_v1.0 Primary
Assembly) and BAIAP2 (NC_040262.1 Chromosome 11
Reference Oar_rambouillet_v1.0 Primary Assembly) sequences
Frontiers in Veterinary Science | www.frontiersin.org 2July 2022 | Volume 9 | Article 928375
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
(Table 1). Using mixed DNA (n =20), the PCR products were
sequenced using Sanger sequencing to determine the SNPs of
TRAPPC9 and BAIAP2. The PCR reaction (35 µL) included
17.5 µL of 2 ×Easy Taq PCR Super Mix (Transgen), 1.12 µL
of each primer (forward and reverse), 1.4 µL of dNTPs, and 14
µL ddH2O. The thermal cycling procedure for the TRAPPC9
gene included 5 min at 94◦C; followed by 30 s at 94◦C, 30 s at
54◦C, and 30 s at 72◦C for 35 cycles; with a final extension for
5 min at 72◦C. The thermal cycling procedure for the BAIAP2
gene included 5 min at 94◦C; 30 s at 94◦C, 30 s at 60◦C, and
30 s at 72◦C for 35 cycles; with a final extension for 5 min at
72◦C. According to previous studies, genotyping was performed
using competitive allele-specific fluorescence resonance energy
transfer (FRET)-based PCR (KASPar) assays (LGC Genomics,
Hoddesdon, UK) (20). The primers used for genotyping are
shown in Table 2. In this experiment, the TRAPPC9 and
BAIAP2 genes of 1,162 and 1,046 individuals, respectively, were
successfully genotyped, and 970 individuals were successfully
genotyped for both genes.
Expression Features of TRAPPC9 and
BAIAP2 Using Quantitative Real-Time
Reverse Transcription PCR
The total RNA of each tissue was extracted using Transzol
(Transgen) and reverse transcribed into cDNA using an
Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate
Biotechnology Co., Ltd, Hunan, China) following the
manufacturer’s protocols. Six 180-day-old Hu sheep were
randomly selected to analyze the expression levels of TRAPPC9
and BAIAP2 mRNA in ten tissues (heart, liver, spleen, lung,
kidney, rumen, duodenum, muscle, lymph, and tail fat, n=
4 for each tissue). In addition, the mRNA expression levels of
TRAPPC9 and BAIAP2 in the tail adipose tissue of six small-tail
and six big-tail Hu sheep were detected. We assessed the tail
fat deposition traits of the sheep, which are shown in Table 3.
The mRNA sequences of sheep TRAPPC9 (XM_042254050.1
Chromosome 9 Reference Oar_rambouillet_v1.0 Primary
Assembly) and BAIAP2 (XM_024450535.2 Chromosome 11
Reference Oar_rambouillet_v1.0 Primary Assembly), were
used as templates. Specific primer pairs used for detecting
TRAPPC9 and BAIAP2 expression were designed using Oligo 7.0
software, which the expected band sizes are 197 bp and 152 bp,
respectively. β-actin (GenBank Accession no. NM_001009784.3)
as reference gene (Table 1). The quantitative real-time PCR
(qPCR) step of the qRT-PCR protocol was carried out at 94◦C
for 3 min; followed by 40 cycles of 15 s at 94◦C, the optimum
annealing temperature for 15 s, and 72◦C for 20 s; with a final
extension at 72◦C for 5 min. The 2−11CT method was used to
analyze the data (21).
Statistical Analysis
The association analysis between genotypes and the fat
deposition-related traits was performed using a general linear
model program, which was defined as:
Yijk =µ+Gi+Fj+εijk
Yimjkn =µ+Gi+Gm+Fj+Cn+εimjkn
TABLE 1 | Primer pairs for the TRAPPC9 and BAIAP2 genes used for qRT-PCR and PCR amplification.
Gene name Primer name Primer sequence (5′-3′) GenBank accession number Size Tm (◦C)
TRAPPC9 TRAPPC9-SNP-F AGCACATACCCCTTTCGTGA NC_056062 988 bp 54◦C
TRAPPC9-SNP-R TGGCACACATTTAAACTAGGGA
BAIAP2 BAIAP2-SNP-F GCGTCCCGGTTTACACTGCT NC_040262 604 bp 60◦C
BAIAP2-SNP-R AGGAACACCTGCTGGACACA
β-actin β-actin-F TCCGTGACATCAAGGAGAAGC NM_001009784.3 267 bp 60◦C
β-actin-R CCGTGTTGGCGTAGAGGT
TRAPPC9 TRAPPC9-expression-F GCGGCCAACAGACATCGACCA XM_042254050.1 197 bp 54◦C
TRAPPC9-expression-R AACTCAATCACCCCGGCGTTC
BAIAP2 BAIAP2-expression-F ACCCGCAGAAATACTCGGACA XM_024450535.2 152 bp 60◦C
BAIAP2-expression-R GGCGCACTGCTTTTCCACCA
TABLE 2 | KASPar genotyping primers.
Gene Primer name Primer sequence (5′-3′)
TRAPPC9 Primer_AlleleX GAAGGTGACCAAGTTCATGCTGTATATATGTTTTATTTACAAAAATGAGAGCG
Primer_AlleleY GAAGGTCGGAGTCAACGGATTATGTATATATGTTTTATTTACAAAAATGAGAGCA
Primer_Common GTGCACGCAGCAAGCTGCAGAAA
BAIAP2 Primer_AlleleX GAAGGTGACCAAGTTCATGCTCAGAGTGAGCGGAGGCCCTT
Primer_AlleleY GAAGGTCGGAGTCAACGGATTGAGTGAGCGGAGGCCCTC
Primer_Common ACAGCAACCTGGCACTAGACCG
Frontiers in Veterinary Science | www.frontiersin.org 3July 2022 | Volume 9 | Article 928375
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
TABLE 3 | Performance of the sheep used in qRT-PCR.
Small-tail group Big-tail group P-value
Traits 6 6
The weight of tail fat 0.572 ±0.138 1.917 ±0.138 <0.01
The relative weight of tail fat (body weight) 0.018 ±0.002 0.036 ±0.002 <0.01
The relative weight of tail fat (carcass weight) 0.034 ±0.003 0.065 ±0.003 <0.01
Vales for the phenotypic data are shown as the mean ±standard error (SE). P-value as calculated using a t-test.
TABLE 4 | Descriptive statistics of fat traits.
Items Min Max Mean SD CV (%)
The weight of tail fat 0.31 3.23 1.50 0.01 30%
The relative weight of tail fat (carcass weight) 0.01 0.07 0.03 0.00 26%
The relative weight of tail fat (body weight) 0.02 0.15 0.06 0.00 25%
The weight of perirenal fat 0.07 2.12 0.63 0.01 47%
The relative weight of perirenal fat (carcass weight) 0.00 0.07 0.02 0.00 42%
The relative weight of perirenal fat (body weight) 0.00 0.04 0.01 0.00 42%
The weight of mesenteric fat 0.15 3.14 1.08 0.01 38%
The relative weight of mesenteric fat (carcass weight) 0.01 0.11 0.04 0.00 33%
The relative weight of mesenteric fat (body weight) 0.00 0.06 0.02 0.00 33%
Where, Yijk and Yimjkn are the phenotypic observation value of
the tail fat deposition traits, µis the mean, Giand Gmis the
effect of the ith and mth genotypes, Fjrepresents the farm effect
(j=1, 2. . . . . . 5), Cnrefers to the effect of combination, and εijk
and εimjkn are the residuals corresponding to the observed trait
values. A P-value <0.05 or a P-value <0.01 were regarded as
statistically significant and highly significant, respectively. The
genotypic frequency and allele frequency were calculated. SPSS
v.23 software was used for all statistical analyses (IBM Corp.,
Armonk, NY, USA).
RESULTS
Descriptive Statistics of Fat Deposition
Related Traits
In the present study, the fat deposition-related traits of all lambs
(n=1,293) were measured after slaughter at 180 days of age,
and the descriptive statistics for the phenotypes of all the traits
are shown in Table 4. The coefficient of variation for all traits
was great than 24%, among which the variation coefficient of tail
fat weight, perirenal fat weight, and mesenteric fat weight were
30.28, 47.43, and 38.34%, respectively. These results suggested
the fat deposition traits have marked phenotypic variation in the
experimental population.
SNP Scanning of Sheep TRAPPC9 and
BAIAP2 Genes
The 988 bp fragment of TRAPPC9 and the 604 bp fragment
of BAIAP2 were amplified using the primers shown in Table 2
(Figure 1). The amplified PCR products were sequenced by
Tsingke Ltd. (Xi’an, China). A new mutation was found in
FIGURE 1 | PCR amplification of the target fragments of the ovine TRAPPC9
(A) and BAIAP2 (B) genes. M: DL2000 DNA Marker; 1–10: PCR products.
TRAPPC9, located in intron 10 (g.57654 A >G), and a new
mutation was also found in BAIAP2, located in intron 6
(g.46061 C >T, Figure 2).
Genotyping, and Genotype and Allele
Frequency Analysis
KASPar analysis was used to genotype the two SNPs, and three
genotypes of the two genes were determined: AA, AG, and
Frontiers in Veterinary Science | www.frontiersin.org 4July 2022 | Volume 9 | Article 928375
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
FIGURE 2 | Image of the sequencing peaks of sheep TRAPPC9 (A) and BAIAP2 (B) loci.
FIGURE 3 | KASPar-based single nucleotide polymorphism (SNP) genotyping of sheep TRAPPC9 g.57654 A >G(A) and BAIAP2 g.460 C >T(B).
GG (TRAPPC9) and CC, CT, and TT (BAIAP2) (Figure 3).
The genetic parameters of the SNPs recognized in Hu sheep at
TRAPPC9 g.57654 A >G and BAIAP2 g.46061 C >T loci were
calculated (Table 5). For the TRAPPC9 g.57654 A >G locus, the
genotype frequencies were 0.45, 0.44, and 0.11, respectively. The
results of allele frequency analysis showed that the frequency
of the A allele was 0.67, which accounted for the highest
proportion in the population. For the BAIAP2 g.46061 C >
T locus, the genotype frequencies were 0.58, 0.29, and 0.13,
respectively. The results of allele frequency analysis showed that
the frequency of the C allele was 0.73, which accounted for
the highest proportion in the population. The polymorphism
information content (PIC), effective allele number (Ne), expected
homozygosity (Ho), expected heterozygosity (He), and the P-
value of the Hardy-Weinberg equilibrium (PHWE) of TRAPPC9
were 0.34, 1.79, 0.56, 0.44, and 0.84, respectively, and the PIC, Ne,
Ho, He, and PHWE of BAIAP2 were 0.31, 1.64, 0.61, 0.39, and 0,
respectively (Table 5).
Association Analysis Between TRAPPC9
and BAIAP2 Genes and Fat Deposition
Traits in Hu Sheep
The association analysis showed that the TRAPPC9 g.57654 A
>G gene polymorphism correlated significantly with tail fat
deposition traits (P<0.05). The tail fat weight, relative tail fat
weight (body weight), and relative tail fat weight (carcass) of
the GG genotype were significantly lower than those of the AA
genotype (P<0.05). Therefore, GG was a significant genotype
associated with tail fat deposition in Hu sheep. The BAIAP2
g.46061 C >T gene polymorphism also correlated significantly
Frontiers in Veterinary Science | www.frontiersin.org 5July 2022 | Volume 9 | Article 928375
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
TABLE 5 | The genotype frequency, allele frequency, and genetic diversity of the TRAPPC9 and BAIAP2 SNP sites.
Loci Genotype Genotype frequency Allele Allele frequency Ne Ho He PIC PHWE
TRAPPC9 g.57654A >G AA (527) 0.45 A 0.67 1.79 0.56 0.44 0.34 0.84
AG (509) 0.44
GG (126) 0.11 G 0.33
BAIAP2 g.46061A >G CC (610) 0.58 C 0.73 1.64 0.61 0.39 0.31 0.00
CT (299) 0.29
TT (137) 0.13 T 0.27
Expected heterozygosity (He), expected homozygosity (Ho), effective allele number (Ne), polymorphism information content (PIC), and the P-value of the Hardy-Weinberg
equilibrium (PHWE).
TABLE 6 | Analysis of the associations of sheep TRAPPC9 g.57654 A >G and BAIAP2 g.46061 C >T SNPs.
TRAPPC9 g.57654 A >GBAIAP2 g.46061 C >T
Items AA AG GG CC CT TT
No. 527 509 126 610 299 137
The weight of tail fat 1.546 ±0.02a1.484 ±0.02ab 1.413 ±0.04b1.503 ±0.018ab 1.45 ±0.026b1.57 ±0.038a
The relative weight of tail fat (carcass weight) 0.059 ±0.001a0.058 ±0.001ab 0.056 ±0.001b0.032 ±0.00ab 0.031 ±0.00b0.033 ±0.001a
The relative weight of tail fat (body weight) 0.032 ±0.00a0.031 ±0.00ab 0.03 ±0.001b0.058 ±0.001ab 0.057 ±0.001b0.061 ±0.001a
The weight of perirenal fat 0.638 ±0.013 0.623 ±0.013 0.619 ±0.027 0.627 ±0.012 0.609 ±0.017 0.646 ±0.025
The relative weight of perirenal fat (carcass weight) 0.024 ±0.00 0.024 ±0.00 0.024 ±0.001 0.024 ±0.00 0.023 ±0.001 0.025 ±0.001
The relative weight of perirenal fat (body weight) 0.013 ±0.00 0.013 ±0.00 0.013 ±0.00 0.013 ±0.00 0.013 ±0.00 0.014 ±0.00
The weight of mesenteric fat 1.106 ±0.018 1.066 ±0.018 1.052 ±0.037 1.09 ±0.017 1.057 ±0.024 1.093 ±0.036
The relative weight of mesenteric fat (carcass weight) 0.042 ±0.001 0.042 ±0.001 0.041 ±0.001 0.042 ±0.001 0.041 ±0.001 0.042 ±0.001
The relative weight of mesenteric fat (body weight) 0.023 ±0.00 0.022 ±0.00 0.022 ±0.001 0.023 ±0.00 0.022 ±0.00 0.023 ±0.001
SNP, single nucleotide polymorphism.
Values for the phenotypic data are shown as the mean ±standard error. Different superscript lowercase letters against values in the same column indicate significant differences (P <
0.05) or extremely significant differences (P <0.01).
with tail fat deposition traits (P<0.05). The tail fat weight,
relative tail fat weight (body weight), and relative tail fat weight
(carcass) of the CT genotype were significantly lower than
those of the TT genotype (P<0.05). However, no significant
association was observed between the genes and perirenal fat
weight and mesenteric fat weight (P>0.05) (Table 6).
Association Analysis of the Combination
Genotypes of the TRAPPC9 and BAIAP2
Genes With the Tail Fat Deposition Traits of
the Hu Sheep
The comprehensive effects of TRAPPC9 g.57654 A >G and
BAIAP2 g.46061 C >T on tail fat deposition traits were
analyzed (Table 7). The results showed that tail fat weight, tail
fat relative weight (body weight), and tail fat relative weight
(carcass) of the GGTRAPPC9/CTBAIAP2, AGTRAPPC9/CCBAIAP2,
GGTRAPPC9/CCBAIAP2, and AATRAPPC9/CCBAIAP2genotype
were significantly lower than those of the AATRAPPC9/TTBAIAP2,
and AATRAPPC9/CTBAIAP2combined genotypes (P<0.05).
The perirenal fat weight, perirenal fat relative weight (body
weight), and perirenal fat relative weight (carcass) of the
GGTRAPPC9/CTBAIAP2genotype were significantly lower than
those of the AATRAPPC9/TTBAIAP2, AATRAPPC9/CTBAIAP2,
AGTRAPPC9/TTBAIAP2, and GGTRAPPC9/CCBAIAP2combined
genotypes (P<0.05). The mesenteric fat weight of the
AGTRAPPC9/CTBAIAP2genotype was significantly lower
than that of the AATRAPPC9/CTBAIAP2genotype (P<
0.05), but not significantly different compared with other
genotypes, and there was no significant difference between
the mesenteric fat relative weight (body weight) and the
mesenteric fat relative weight (carcass) among the genotypes
(P>0.05).
Expression Profile Analysis
The expression levels of TRAPPC9 and BAIAP2 in the tail
fat, lymph, muscle, duodenum, rumen, kidney, lung, spleen,
liver, and heart were detected using qRT-PCR. The results
showed that TRAPPC9 and BAIAP2 were expressed in these
ten tissues. Moreover, the expression levels of TRAPPC9 in
the tail fat and rumen were significantly higher than those
in the other tissues (P<0.05), and the expression levels
of BAIAP2 in the heart, liver, kidney, muscle, and tail fat
were significantly higher than those in the other tissues
(P<0.05; Figure 4).
Frontiers in Veterinary Science | www.frontiersin.org 6July 2022 | Volume 9 | Article 928375
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
TABLE 7 | Analysis of the associations of combined genotypes at the TRAPPC9 and BAIAP2 loci and sheep tail fat deposition traits.
Items AATRAPPC9/ AATRAPPC9/ AGTRAPPC9/ AGTRAPPC9/ AATRAPPC9/ GGTRAPPC9/ GGTRAPPC9/ AGTRAPPC9/ GGTRAPPC9/
TTBAIAP2CTBAIAP2TTBAIAP2CTBAIAP2CCBAIAP2CCBAIAP2TTBAIAP2CCBAIAP2CTBAIAP2
No. 68 129 52 111 250 56 6 249 49
The weight of tail
fat
1.602 ±0.054a1.561 ±0.028a1.522 ±0.062ab 1.477 ±0.042abc 1.458 ±0.039bc 1.454 ±0.059bc 1.451 ±0.182bc 1.439 ±0.028bc 1.332 ±0.064c
The relative weight
of tail fat (body
weight)
0.033 ±0.001a0.033 ±0.001a0.032 ±0.001ab 0.032 ±0.001ab 0.03 ±0.001b0.03 ±0.001b0.033 ±0.003ab 0.031 ±0.001b0.028 ±0.001b
The relative weight
of tail fat (carcass
weight)
0.061 ±0.002a0.06 ±0.001a0.06 ±0.002ab 0.058 ±0.001ab 0.057 ±0.001bc 0.056 ±0.002bc 0.061 ±0.006a0.057 ±0.001bc 0.053 ±0.002c
The weight of
perirenal fat
0.656 ±0.035a0.639 ±0.019a0.658 ±0.041a0.601 ±0.028ab 0.623 ±0.026ab 0.664 ±0.039a0.655 ±0.119a0.601 ±0.019ab 0.542 ±0.042b
The relative weight
of perirenal fat
(body weight)
0.014 ±0.001a0.013 ±0a0.014 ±0.001a0.013 ±0.001ab 0.013 ±0ab 0.014 ±0.001a0.015 ±0.002ab 0.013 ±0ab 0.011 ±0.001b
The relative weight
of perirenal fat
(carcass weight)
0.025 ±0.001a0.024 ±0.001a0.026 ±0.001a0.023 ±0.001ab 0.023 ±0.001ab 0.025 ±0.001a0.027 ±0.004ab 0.024 ±0.001ab 0.021 ±0.001b
The weight of
mesenteric fat
1.133 ±0.05ab 1.117 ±0.026a1.035 ±0.057ab 1.018 ±0.039b1.063 ±0.036ab 1.118 ±0.055ab 0.957 ±0.169ab 1.053 ±0.026ab 1±0.059ab
The relative weight
of mesenteric fat
(body weight)
0.024 ±0.001 0.023 ±0.00 0.022 ±0.001 0.022 ±0.001 0.022 ±0.001 0.023 ±0.001 0.022 ±0.003 0.022 ±0.00 0.021 ±0.001
The relative weight
of mesenteric fat
(carcass weight)
0.043 ±0.002 0.043 ±0.001 0.041 ±0.002 0.04 ±0.001 0.041 ±0.001 0.043 ±0.002 0.04 ±0.006 0.042 ±0.001 0.039 ±0.002
Different superscript lowercase letters against values in the same column indicate significant differences (P <0.05) or extremely significant differences (P <0.01) (Tukey test).
Frontiers in Veterinary Science | www.frontiersin.org 7July 2022 | Volume 9 | Article 928375
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
FIGURE 4 | TRAPPC9 mRNA expression profile in sheep tissues (A).BAIAP2 mRNA expression profile in sheep tissues (B). Different lowercase letters indicate a
significant difference (P<0.05).
FIGURE 5 | The relative TRAPPC9 and BAIAP2 mRNA expression levels
between the small-tail and big-tail groups. Asterisks indicate a significant
differences between the small- and big-tail groups (P<0.05), double asterisks
indicate a very significant differences between the small-tail and big-tail groups
(P<0.01).
Expression of TRAPPC9 and BAIAP2
Genes in Extreme Tail Fat Tissue Types
The mRNA expression levels of TRAPPC9 and BAIAP2
between small-tailed sheep and big-tailed sheep were
analyzed quantitatively using qRT-PCR. The results
showed that the expression levels of TRAPPC9 and
BAIAP2 in the small-tailed group were significantly
higher than those in the big-tailed group (P<0.01;
Figure 5).
DISCUSSION
Fat tails in sheep are perceived to have developed following
domestication and are a valuable energy reserve for the animals
during migration and winter (4,22). However, fat tails might
affect reproduction and fattening, thereby increasing the cost of
raising sheep and reducing their economic value (23,24). Fat
deposition in sheep tails is the result of a complex mechanism.
Previous studies have conducted several investigations into the
inheritance of fat tails (25); nevertheless, the mechanisms of
the genes affecting fat deposition in fat tail sheep remain
unknown. TRAPPC9 is a subunit of the highly conserved
protein complex called the transport protein particle (TRAPP), a
guanine nucleotide exchange factor for rab proteins that operates
in secretory, endocytic, and autophagic pathways (26). Over
half of the patients with TRAPPC9 mutations are reported
to present different degrees of obesity (27). Hnoonual et al.
(12) found that the deletion of the TRAPPC9 gene leads
to obesity. BAIAP2, which is located on 17q25 and encodes
brain-specific angiogenesis inhibitor 1-associated protein 2
(BAIAP2), has been suggested to be involved in cerebral
asymmetry (28). In a study by Lakshman et al. (17), the
BAIAP2 gene was significantly associated with weight change in
patients with chronic obstructive pulmonary disease (COPD).
TRAPPC9 and BAIAP2 were implicated in fat accumulation
Frontiers in Veterinary Science | www.frontiersin.org 8July 2022 | Volume 9 | Article 928375
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
by a GWAS (19). In this study, Two intronic mutations were
detected in the TRAPPC9 and BAIAP2 genes, respectively.
Recent studies suggest intronic mutations can change protein
levels or protein conformation by altering regulatory splice
sites, mRNA stability, miRNA binding sites, or translation
efficiency (29–33). To further investigate the effect of these
two intronic mutations on sheep phenotype, we analyzed the
potential association between genotype and fat deposition. The
results showed that TRAPPC9 g.57654 A >G and BAIAP2
g.46061 C >T were both associated significantly with tail
fat deposition.
We detected that TRAPPC9 and BAIAP2 were expressed
in all ten tissues of Hu sheep tested. Zhang et al. showed
that TRAPPC9 was highly expressed in muscles and kidneys
of human tissues; showed low expression in the heart, brain,
and placenta; and was weakly expressed in the thymus and
spleen (34). In Abbott et al.’s study, the tissue distribution of
BAIAP2 mRNA was determined by northern blotting, appearing
mainly in the heart, brain, spleen, lung, liver, kidney, and
testis (35). Our results are consistent with those of previous
studies. TRAPPC9 was significantly expressed in the rumen
and tail fat (P<0.05). However, studies on the TRAPPC9
gene in the rumen are rarely reported. This gene may be
related to the growth and development of the rumen, but the
specific mechanism still needs further study. Usman et al. found
through research that mouse TRAPPC9 gene deficiency affects
the proliferation and differentiation ability of adipose stem cells
(ASCs) (36). Our qRT-PCR results also confirmed this view.
Therefore, we speculate that TRAPPC9 has the same function
in sheep.
The expression of BAIAP2 in the liver was significantly higher
than that in other tissues (P<0.05). Previous studies have found
that the BAIAP2 is significantly expressed in the liver (37–39).
The liver plays a pivotal role in regulating the metabolism of fatty
acids (FA) and their neutral storage form, triglycerides (TGs)
(40,41). A study identified that interactions between adipose
tissue and the liver might play a role in the development of
non-alcoholic fatty liver disease (42). Therefore, we speculated
that BAIAP2 might affect tail fat deposition by regulating
FA synthesis.
To verify the potential roles of TRAPPC9 and BAIAP2 in
ovine tail fat deposition, we analyzed the mRNA expression
levels of TRAPPC9 and BAIAP2 between small-tail and big-tail
sheep. The results showed that the expression levels of TRAPPC9
and BAIAP2 in the small-tailed group were significantly higher
than those in the large-tailed group (P<0.01). Therefore,
we speculated the polymorphic loci in TRAPPC9 and BAIAP2
might represent important genetic markers in studies designed
to reduce tail fat deposition in Hu sheep, and also provide
clues for further search for causal mutations of tail fat
deposition. However, the regulatory mechanism of TRAPPC9
and BAIAP2 on tail fat deposition in Hu sheep require
further study.
CONCLUSIONS
In the present study, two novel SNPs in the TRAPPC9 and
BAIAP2 genes were identified. Association analysis indicated
that the two SNPs were significantly related to tail fat weight-
related traits of Hu sheep. In addition, the two genes were
expressed widely in ten tissues of Hu sheep, and the expression
levels of TRAPPC9 and BAIAP2 in the small-tail group were
significantly higher than those in the big-tail group. Thus, we
speculated that the polymorphic loci in TRAPPC9 and BAIAP2
might be used as genetic markers of tail fat deposition in
Hu sheep.
DATA AVAILABILITY STATEMENT
The datasets presented in this study can be found in online
repositories. The names of the repository/repositories
and accession number(s) can be found in the
article/Supplementary Material.
ETHICS STATEMENT
All experiments in this study were authorized and
approved by the Animal Welfare and Ethics Committee
of Gansu Agricultural University, and carried out in
accordance with the regulations of the Standing Committee
of the People’s Congress of Gansu Province. License
No. 2012-2-159.
AUTHOR CONTRIBUTIONS
WW, XZh, and PC were involved in the design and design
of the experiment. CLi, LZ, DX, JC, YZhan, XL, XZe, YZhao,
WL, JW, RZ, CLin, JL, and BZ collected the experimental
samples. DZ, YH, ZM, XW, XY, and PC conducted the data
analysis. PC wrote the paper. XZh revised the manuscript.
All authors contributed to the article and approved the
submitted version.
FUNDING
This work was supported by the National Key
Research and Development Program of China (No.
2021YFD1300901), the National Natural Science
Foundation of China (31960653), and the Key Research
and Development Project of Gansu Province, China
(20YF3NA012).
SUPPLEMENTARY MATERIAL
The Supplementary Material for this article can be found
online at: https://www.frontiersin.org/articles/10.3389/fvets.
2022.928375/full#supplementary-material
Frontiers in Veterinary Science | www.frontiersin.org 9July 2022 | Volume 9 | Article 928375
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
REFERENCES
1. Feng X, Li F, Wang F, Zhang G, Pang J, Ren C, et al. Genome-wide differential
expression profiling of mrnas and lncrnas associated with prolificacy in Hu
sheep. Bioscience reports. (2018) 38: BSR20171350. doi: 10.1042/BSR20171350
2. H EE, Ma L, Xie X, Ma J, Ma X, Yue C, et al. Genetic polymorphism association
analysis of SNPs on the species conservation genes of tan sheep and Hu
sheep. Trop Anim Health Prod. (2020) 52:915–26. doi: 10.1007/s11250-019-0
2063-1
3. Wang J, Zhang X, Wang X, Li F, Zhang D, Li X, et al. Polymorphism and
expression of the HMGA1 gene and association with tail fat deposition in Hu
sheep. Anim Biotechnol. (2021) 1–9. doi: 10.1080/10495398.2021.1998093
4. Moradi MH, Nejati-Javaremi A, Moradi-Shahrbabak M, Dodds KG, McEwan
JC. Genomic scan of selective sweeps in thin and fat tail sheep breeds for
identifying of candidate regions associated with fat deposition. BMC Genet.
(2012) 13:10. doi: 10.1186/1471-2156-13-10
5. He X, Wu R, Yun Y, Qin X, Chen L, Han Y, et al. Transcriptome analysis of
messenger RNA and long noncoding RNA related to different developmental
stages of tail adipose tissues of sunite sheep. Food Sci Nutr. (2021) 9:5722–
34. doi: 10.1002/fsn3.2537
6. Ben Sassi-Zaidy Y, Maretto F, Charfi-Cheikhrouha F, Mohamed-
Brahmi A, Cassandro M. Contribution of microsatellites markers in
the clarification of the origin, genetic risk factors, and implications for
conservation of tunisian native sheep breeds. Genet Mol Res. (2016)
15:15017059. doi: 10.4238/gmr.15017059
7. Zhu C, Li N, Cheng H, Ma Y. Genome wide association study for the
identification of genes associated with tail fat deposition in Chinese sheep
breeds. Biol Open. (2021) 10:bio054932. doi: 10.1242/bio.054932
8. Bakhtiarizadeh MR, Alamouti AA. RNA-seq based genetic variant discovery
provides new insights into controlling fat deposition in the tail of sheep. Sci
Rep. (2020) 10:13525. doi: 10.1038/s41598-020-70527-8
9. Zong M, Wu XG, Chan CW, Choi MY, Chan HC,Tanner JA, et al. The adaptor
function of TRAPPC2 in mammalian trapps explains TRAPPC2-associated
SEDT and TRAPPC9-associated congenital intellectual disability. PLoS ONE.
(2011) 6:e23350. doi: 10.1371/journal.pone.0023350
10. Fu ZH, Liu SQ, Qin MB, Huang JA, Xu CY, Wu WH, et al. NIK- and IKK?-
binding protein contributes to gastric cancer chemoresistance by promoting
epithelial-mesenchymal transition through the NF-?b signaling pathway.
Oncol Rep. (2018) 39:2721–30. doi: 10.3892/or.2018.6348
11. Wang X, Ma P, Liu J, Zhang Q, Zhang Y, Ding X, et al. Genome-wide
association study in Chinese holstein cows reveal two candidate genes for
somatic cell score as an indicator for mastitis susceptibility. BMC Genet.
(2015) 16:111. doi: 10.1186/s12863-015-0263-3
12. Hnoonual A, Graidist P, Kritsaneepaiboon S, Limprasert P. Novel
compound heterozygous mutations in the trappc9 gene in two
siblings with autism and intellectual disability. Front Genet. (2019)
10:61. doi: 10.3389/fgene.2019.00061
13. Briollais L, Rustand D, Allard C, Wu Y, Xu J, Rajan SG, et al. DNA methylation
mediates the association between breastfeeding and early-life growth
trajectories. Clin Epigenet. (2021) 13:231. doi: 10.1186/s13148-021-01209-z
14. Liang ZS, Cimino I, Yalcin B, Raghupathy N, Vancollie VE, Ibarra-Soria X, et
al. TRAPPC9 deficiency causes parent-of-origin dependent microcephaly and
obesity. PLoS Genet. (2020) 16:e1008916. doi: 10.1371/journal.pgen.1008916
15. Liu H, Song H, Jiang Y, Jiang Y, Zhang F, Liu Y, et al. A single-step
genome wide association study on body size traits using imputation-
based whole-genome sequence data in yorkshire pigs. Front Genet. (2021)
12:629049. doi: 10.3389/fgene.2021.629049
16. Yeh TC, Ogawa W, Danielsen AG, Roth RA. Characterization and cloning of
a 58/53-KDA substrate of the insulin receptor tyrosine kinase. J Biol Chem.
(1996) 271:2921–8. doi: 10.1074/jbc.271.6.2921
17. Lakshman Kumar P, Wilson AC, Rocco A, Cho MH, Wan E, Hobbs
BD, et al. Genetic variation in genes regulating skeletal muscle
regeneration and tissue remodelling associated with weight loss in chronic
obstructive pulmonary disease. J Cachexia Sarcopenia Muscle. (2021)
12:1803–17. doi: 10.1002/jcsm.12782
18. Al-Dokhi L. Association of the new index of sarcopenic obesity with physical
fitness in healthy Saudi men and women. Eur Rev Med Pharmacol Sci.
(2015) 19:328–33.
19. Lee YS, Shin D. Genome-wide association studies associated with backfat
thickness in landrace and yorkshire pigs. Genomics Inform. (2018) 16:59–
64. doi: 10.5808/GI.2018.16.3.59
20. Smith SM, Maughan PJ. SNP genotyping using kaspar assays. Methods Mol
Biol. (2015) 1245:243–56. doi: 10.1007/978-1-4939-1966-6_18
21. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. (2001)
25:402–8. doi: 10.1006/meth.2001.1262
22. Ermias E, Yami A, Rege J. Fat deposition in tropical sheep as adaptive
attribute to periodic feed fluctuation. Journal of Animal Breeding Genet. (2002)
119:235–46. doi: 10.1046/j.1439-0388.2002.00344.x
23. Kilminster TF, Greeff JC. A note on the reproductive performance of damara,
dorper and merino sheep under optimum management and nutrition for
Merino Ewes in the Eastern Wheatbelt of Western Australia. Trop Anim
Health Prod. (2011) 43:1459–64. doi: 10.1007/s11250-011-9871-8
24. Frisch RE. Body fat, menarche, fitness and fertility. Hum Reprod. (1987)
2:521–33. doi: 10.1093/oxfordjournals.humrep.a136582
25. Kashan N, Azar G, Afzalzadeh A, Salehi A. Growth performance and carcass
quality of fattening lambs from fat-tailed and tailed sheep breeds. Small
Ruminant Res. (2005) 60:267–71. doi: 10.1016/j.smallrumres.2005.01.001
26. Barrowman J, Bhandari D, Reinisch K, Ferro-Novick S. Trapp complexes in
membrane traffic: convergence through a common rab. Nat Rev Mol Cell Biol.
(2010) 11:759–63. doi: 10.1038/nrm2999
27. Radenkovic S, Martinelli D, Zhang Y, Preston GJ, Maiorana A, Terracciano
A, et al. TRAPPC9-CDG: a novel congenital disorder of glycosylation with
dysmorphic features and intellectual disability. Genet Med. (2022) 24:894–
904. doi: 10.1016/j.gim.2021.12.012
28. Sun T, Patoine C, Abu-Khalil A, Visvader J, Sum E, Cherry TJ, et al. Early
asymmetry of gene transcription in embryonic human left and right cerebral
cortex. Science. (2005) 308:1794–8. doi: 10.1126/science.1110324
29. Sharma Y, Miladi M, Dukare S, Boulay K, Caudron-Herger M, Groß M, et
al. A pan-cancer analysis of synonymous mutations. Nat Commun. (2019)
10:2569. doi: 10.1038/s41467-019-10489-2
30. Gupta SK, Carmi S, Waldman Ben-Asher H, Tkacz ID,
Naboishchikov I, Michaeli S. Basal splicing factors regulate the
stability of mature mRNAs in trypanosomes. J Biol Chem. (2013)
288:4991–5006. doi: 10.1074/jbc.M112.416578
31. Gingeras TR. Origin of phenotypes: genes and transcripts. Genome Res. (2007)
17:682–90. doi: 10.1101/gr.6525007
32. Reis EM, Louro R, Nakaya HI, Verjovski-Almeida S. As antisense RNA gets
intronic. Omics. (2005) 9:2–12. doi: 10.1089/omi.2005.9.2
33. Chorev M, Carmel L. The function of introns. Front Genet. (2012)
3:55. doi: 10.3389/fgene.2012.00055
34. Zhang Y, Bitner D, Pontes Filho AA, Li F, Liu S, Wang H, et al. Expression and
function of NIK- and IKK2-binding protein (NIBP) in mouse enteric nervous
system. Neurogastroenterol Motility. (2014) 26:77–97. doi: 10.1111/nmo.12234
35. Abbott MA, Wells DG, Fallon JR. The insulin receptor tyrosine kinase
substrate P58/53 and the insulin receptor are components of CNS synapses.
J Neurosci. (1999) 19:7300–8. doi: 10.1523/JNEUROSCI.19-17-07300.1999
36. Usman M, Li Y, Ke Y, Chhetri G, Islam MA, Wang Z, et al. TRAPPC9
deficiency impairs the plasticity of stem cells. Int J Mol Sci. (2022)
23:4900. doi: 10.3390/ijms23094900
37. Yang Y, Ge H, Li DQ, Xu AX. E2F1-induced lncRNA BAIAP2-
AS1 overexpression contributes to the malignant progression of
hepatocellular carcinoma via miR-361-3p/SOX4 axis. Dis Markers. (2021)
2021:6256369. doi: 10.1155/2021/6256369
38. Solís-Fernández G, Montero-Calle A, Martínez-Useros J, López-Janeiro
Á, de Los Ríos V, Sanz R, et al. Spatial proteomic analysis of isogenic
metastatic colorectal cancer cells reveals key dysregulated proteins
associated with lymph node, liver, and lung metastasis. Cells. (2022)
11:447. doi: 10.3390/cells11030447
39. Chen Q, Jia A, Snyder SA, Gong Z, Lam SH. Glucocorticoid activity detected
by in vivo zebrafish assay and in vitro glucocorticoid receptor bioassay
at environmental relevant concentrations. Chemosphere. (2016) 144:1162–
9. doi: 10.1016/j.chemosphere.2015.09.089
40. Seebacher F, Zeigerer A, Kory N, Krahmer N. hepatic lipid droplet
homeostasis and fatty liver disease. Semin Cell Dev Biol. (2020) 108:72–
81. doi: 10.1016/j.semcdb.2020.04.011
Frontiers in Veterinary Science | www.frontiersin.org 10 July 2022 | Volume 9 | Article 928375
Cui et al. TRAPPC9/BAIAP2 and Sheep Fat Deposition
41. Alves-Bezerra M, Cohen DE. Triglyceride metabolism in the liver. Compr
Physiol. (2017) 8:1–8. doi: 10.1002/cphy.c170012
42. Merli M, Lattanzi B, Aprile F. Sarcopenic obesity in fatty
liver. Curr Opin Clin Nutr Metabolic Care. (2019) 22:185–
90. doi: 10.1097/MCO.0000000000000558
Conflict of Interest: The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be construed as a
potential conflict of interest.
Publisher’s Note: All claims expressed in this article are solely those of the authors
and do not necessarily represent those of their affiliated organizations, or those of
the publisher, the editors and the reviewers. Any product that may be evaluated in
this article, or claim that may be made by its manufacturer, is not guaranteed or
endorsed by the publisher.
Copyright © 2022 Cui, Wang, Zhang, Li, Huang, Ma, Wang, Zhao, Zhang, Yang,
Xu, Cheng, Li, Zeng, Zhao, Li, Wang, Lin, Zhou, Liu, Zhai and Zhang. This is an
open-access article distributed under the terms of the Creative Commons Attribution
License (CC BY). The use, distribution or reproduction in other forums is permitted,
provided the original author(s) and the copyright owner(s) are credited and that the
original publication in this journal is cited, in accordance with accepted academic
practice. No use, distribution or reproduction is permitted which does not comply
with these terms.
Frontiers in Veterinary Science | www.frontiersin.org 11 July 2022 | Volume 9 | Article 928375
Available via license: CC BY
Content may be subject to copyright.
