Content uploaded by Abdulrahman Itopa Suleiman
Author content
All content in this area was uploaded by Abdulrahman Itopa Suleiman on Jun 27, 2022
Content may be subject to copyright.
_____________________________________________________________________________________________________
*Corresponding author: E-mail: itopa2020@gmail.com;
Asian Journal of Biotechnology and Genetic Engineering
4(4): 1-13, 2021; Article no.AJBGE.75165
Spores and Extracts of Entomopathogenic Fungal
Isolate (Paecilomyces formosus) as Potential
Biolarvicide of Anopheles Mosquitoes
Abdulrahman Itopa Suleiman1*, Abba Nasidi2, Rufai Nasir2,
Jwan’an L. Emmanuel2, Nasir Sirajo Sadi2, Mustapha Omenesa Idris3
and Abdullahi Abdulkadir Imam2
1Department of Biochemistry, Kogi State University, Anyigba, Nigeria.
2Department of Biochemistry, Bayero University, Kano, Nigeria.
3Department of Chemistry, Kogi State University, Anyigba, Nigeria.
Authors’ contributions
This work was carried out in collaboration among all authors. Authors AIS and NSS designed the
study, carried out the investigation and prepared the original draft. Authors MOI and RN carried out
analysis of the data. Authors JLE and AN managed the literature searches and prepare the
manuscript. Author AAI wrote the protocol, supervised and review the manuscript.
All authors review the manuscript, read and approved the final manuscript.
Article Information
Editor(s):
(1) Dr. Tsygankova Victoria Anatolyivna, Institute of Bioorganic Chemistry and Petrochemistry of National Academy of Sciences
of Ukraine, Ukraine.
Reviewers:
(1) Dinesh Rai, Dr. Rajendra Prasad Central Agricultural University, India.
(2) Gustavo Bich, National University of Misiones, Argentina.
(3) Leandris Argentel Martínez, Instituto Tecnológico del Valle del Yaqui, México.
Complete Peer review History: https://www.sdiarticle4.com/review-history/75165
Received 02 August 2021
Accepted 11 October 2021
Published 16 October 2021
ABSTRACT
Introduction: Paecilomyces formosus is a geographically widespread entomopathogenic fungus
that produces infectious conidia against Anopheles mosquito larvae, which curtail the uprising
resistance of mosquitoes against synthetic insecticides. These mosquitoes are known vectors of
human and animal pathogens, millions of people are killed by mosquito-borne diseases every year
such as malaria, dengue, chikungunya, Zuka, yellow fever, encephalitis and filariasis.
Aim: This study investigated the spores and extract sourced from entomopathogenic (Paecilomyces
formosus) fungal isolates as potential biolarvicide of Anopheles mosquitoes.
Methods: The conidia and extract bioassays were conducted according to WHO-2005 protocol with
Original Research Article
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
2
slight modification. The most active extract ethylacetate was characterized using Gas
Chromatography-Mass Spectroscopy.
Results: From the conidia bioassay, The LC50 mortality of the larvae was found to be 1.4×104
conidia ml-1 at 24 hrs 6.1×105 conidia ml-1 at 48hrs 8.8×104 conidia/ml at 72 hrs. Solvents used for
the extract bioassay includes; Diethyl-ether, Chloroform and Ethyl-acetate of which, Ethyl-acetate
extract is found to be most active (LC50s; 101.5 μg/ml, 735.6 μg/ml, 769.0 μg/ml after 48-hours post
exposure time.
Gas Chromatography-Mass Spectroscopic analysis of ethyl-acetate extract showed 6 major
compounds (R.T) 3, 4-Altrosan (9.14), I, 6-anhydro-β-glucopyranose (9.30), Pentanoic acid (10.97),
methylpropandioic acid (9.69), Cyclobutanol (10.97), and Diethylpropylmalonate (15.63).
Conclusion: These results indicated that Paecilomyces formosus spores and extracted secondary
bioactive metabolites could serve as promising lead organism for the development of potential novel
and effective insecticidal compounds.
Keywords: Entomopathogenic fungi; paecilomyces formosus; Anopheles mosquito; biolarvicide; gas
chromatography-mass spectroscopy.
1. INTRODUCTION
Mosquitoes are known vectors of human and
animal pathogens. Millions of people are killed by
mosquito-borne diseases annually such as
malaria, dengue, chikungunya, Zuka, yellow
fever, encephalitis and filariasis [1]. Vector
control sanitation, habitat disruption and personal
protection from mosquito bites are the most
adopted measures employed to control and
protect people from infection of these diseases
[2]. Over the past few decades, many countries
organized official programs of mosquito vector
control. Currently, synthetic chemical insecticides
- adults or larva have been the mainstay and are
the most widely used for malaria vectors control.
Mosquito larvae are the attractive targets for
these insecticides because mosquitoes breed in
water and thus, it is easy to deal with them in this
habitat [3]. The indiscriminate use of chemical
insecticides to target adult mosquitoes causes
problems such as mosquito resistance,
environmental polution and health risk to humans
and non-target organisms [3]. To reduce these
problems, there is an urgent need to develop
alternatives to conventional chemical
insecticides, which are safe, effective,
biodegradable and highly selective [3]. There has
been an increasing awareness in the use
biological control agents as alternative to
chemical control of mosquitoes. Among the
eminent biological control agents are
entomopathogenic microorganisms such as fungi
and bacteria [4]. Fungal bio control agents are
the most essential among all the
entomopathogenic microorganisms due to easy
delivery, chances to improve formulation, a vast
number of pathogenic strains known, easy
engineering techniques and its ability to control
both sap sucking pests, such as mosquito and
aphids as well as pest with chewing mouth parts
[4]. They include several phylogenetical
morphological and ecologically diverse fungal
species which evolve to exploit insects with their
main route of entry being through the insect’s
integument, by ingestion or via wounds or
trachea [5]. Most entomopathogenic fungi can be
grown on artificial media; being natural mortality
agents which are environmentally safe, there is a
worldwide interest in the use and manipulation of
entomopathogenic fungi for biological control of
insects and other arthropod pests [6]. They
display a higher degree of effectiveness in
infecting their host, acting as regulators for
numerous harmful insects including both
domestic and forest insects [6]. In general,
mosquitoes have shown susceptibility towards
entomopathogenic fungi and their extracts. They
have low toxicity to non-target organisms and
using entomopathogenic fungi as larvicides may
be a promising lead for biological control of
mosquitoes due to their selective toxicity and
ready decomposability in the ecosystem [7,8].
Also, unlike the dangers which are associated
with the process of production of synthetic
insecticides, the process for the manufacture of
microbial products is safe and less toxic. Spores
and extracts of different entomopathogenic fungi,
notably Paecilomyces formosus, Meterhizium
anisopliae, Beaveria bassiana, Aspegillus niger,
Aspergillus flavus, Lagenidium giganteum,
among others have been reported to exhibit
promising larvicidal activity against mosquito
larvae [9-12] in view of this, current research
focuses on evaluating larvicidal efficacy of
spores and extracts of Paecilomyces formosus
on Anopheles mosquito.
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
3
2. MATERIALS AND METHODS
Fungal growth medias and selective proteins
such as Potato dextrose agar, Czapek’sdox agar/
broth, Cetyl-trimthyl ammonium bromide
(CTAB), Chloramphenicol, synthetic chemical
larvicides/ insecticides such as Malathion
(781.25 mg/L), Temephos (156.25 mg/L) as well
as chemicals used for fungal identification
procedures such as Tween-20, Lacto-phenol
cotton blue were supplied by the department of
biochemistry, Bayero University, Kano. DNA
extraction kit and PCR reagents were purchased
from Sigma-Aldrich Inc., USA while laboratory
apparatus and machineries used in this research
were obtained from Biochemistry department
laboratories and Microbiology department
laboratory complex, Bayero University, Kano,
Nigeria.
2.1 Soil Sample Collection
Soil sample about (200 g) was collected from
insect hibernation site including fields
characterized by soil with a lot of leaf litters that
typically cover the ground and grasses,
shrubs and shades of trees at a depth of
0-20 cm using trowel after removing litter or
weeds and placed in appropriately labelled
plastic bags within Bayero University Kano
premises (11.9836oN 8.4753oE). Before use,
samples were thoroughly mixed and passed
through 0.4 mm mesh sieve for breaking of soil
lumps [13].
2.2 Isolation and Identification of
Paecilomyces formosus
The fungus was isolated from soil using soil
suspension procedures [14]. Soil suspension
was prepared by weighing 0.1g of soil into 10mL
0.05% Tween-20. 100μL of the soil suspension
was inoculated into a perti-dishes of solidified
Czapek’s media (3g NaNO3, 0.5g MgSO4.7H2O,
1g K2HPO4, 0.5g KCl and FeSO4.7H2O),
supplemented with 0.6 g/L of CTAB and 0.1 g/L
of streptomycin. The plates were incubated at
room temperature in the dark for 3-5days. Micro
and macro morphological characteristics of the
isolate was used for identification of fungal genus
[15,16], while molecular characteristic of the ITS-
region of the fungal genome amplified using
TW81 (5’GTTCCGTAGGTGAACCTGC) and
AB28 (5’ATATGCTTAAGTTCAGCGGGT)
primers was used for specie identification [17,
18,19].
2.3 Formulation of Conidial Suspension
Fungal conidiosphore was harvested from 10
days old culture in 0.05% Tween-20 (used as
negative control), its concentration was
determined using hemocytometer, after which,
four concentrations (6.6×104, 6.6×105, 6.6×106,
6.6×107conidia/ml) were formulated by serial
dilution [20, 21].
2.4 Extract Production
Extract production was carried out following the
method of Ragavendran and Natarajan [22].
Isolate of Paecilomyces formosus was cultured in
conical flasks containing 150 mL of sterile
Czapek’s dox broth medium. The flasks were
incubated in a rotary shaker at 28ᵒC and 130rpm
for 7days. The mycelium was filtered through
cheese cloth and washed several times with
sterile water. 100 ml of each solvent (Chloroform,
Diethyl-ether and Ethyl-acetate) was measured
into a conical flasks and 5g of the harvested
mycelium was transferred into each flask. The
flasks were further incubated in a rotary shaker
at 28ᵒC and 130 rpm for 7 days. The mycelium
was then filtered to collect the crude extract. The
extract was transferred into a round bottomed
flask, concentrated using rotary evaporator at
45ᵒC and finally air dried at room temperature.
100 mg of the dried extract was dissolved into
100ml of DMSO to give a final concentration of
1mg/ml.
2.5 Extract Bioassay
The bioassay was carried out according to the
protocol of WHO [21] with slight modification.
Different concentration of the extracts (of each
solvent) ranging from 300 to 1200 μg/ml were
prepared and tested against 15 healthy fourth
instars larvae of Anopheles mosquito. Each
experiment was conducted in triplicates and
DMSO was used as a negative control, while
Temephos and Malathion were used as positive
controls. The number of dead larvae was
counted after 24 h and 48 h, while the
percentage mortality was reported as average of
the three replicates.
2.6 Mosquito Larvae Collection,
Identification and Maintenance
Mosquito larvae collected from stagnant water
from Auyo Local Government Area of Jigawa
State were brought and maintained in the
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
4
insectaria laboratory at a temperature of 27,
relative humidity of about 70% and a photoperiod
of 12L: 12D h. Anopheles larvae were identified
using morphological and behavioural
characteristics as described by Gilles and
Coetzee (1987). Fourth instars of Anopheles
larva were transferred into separate containers
and are maintained according to WHO-2005
protocol [21].
2.7 Bioassay
Bioassay was conducted according to WHO-
2005 protocol with slight modification.
2.7.1 Conidial bioassay
A set of 5 disposable cups each containing 15
fourth instars larvae was prepared. 4 cups were
treated with one concentration of conidial
suspension prepared as stated above, while the
remaining cup was treated with 0.05% Tween-20
as negative control. The whole experimental set-
up was prepared in triplicate and the result was
reported as average of the three replicates [23].
2.7.2 Extract bioassay
Another set of 8 disposable cups was prepared
containing 15 fourth instars larvae each, among
which, 4 were treated with one of the four
concentrations (300, 600, 900 and 1200 μg/ml)
of the extracted metabolites, while the remaining
three were used as controls; 2 positive controls
treated with Temephos- 156.25μg/ml and
Malathion- 781.25 μg/ml respectively, and the
last cup was treated with DMSO as negative
control. The whole experimental set-up was also
prepared in triplicate and the result was reported
as average of the three replicates [21, 23, 24,
25].
2.8 Gas Chromatography Mass
Spectroscopy (GC-MS)
Dried ethyl-acetate extract was dissolved in n-
hexane and then filtered through a 0.2 μm
syringe filter before ingestion into the GC-MS
column. The analysis was conducted with DB-
5MS column (30 m×0.25 mm I.D., 0.25 μm film
thickness). The oven temperature was
programmed at 60°C for initial temperature for 2
min, which then rises at a rate of 10°Cmin-1 to
300°C and finally held isothermally at 300°C for
6min, to complete a total run time of 34min.
Helium was used as carrier gas at 1 mlmin-1 flow
rate, and the relative abundance of compounds
that consists of the extract was expressed as
percentage of peak area. Bioactive compounds
were identified by comparing their mass spectra
and retention indices with those of NIST mass
spectral library and literature values [59].
2.9 Statistical Analysis
The data generated were analyzed using IBM
SPSS Statistics version 20. The Average
percentage mortality was determined using One-
way ANOVA and Probit analysis was conducted
to determine the lethal concentrations (LC50) of
fungal conidiophores and bioactive extracts.
3. RESULTS AND DISCUSSION
Entomopathogens are microorganisms capable
of infecting and invading live insects at various
developmental stages (larvae, pupae and adult)
and ultimately killing their host through feeding
on their body nutrients and secreting biochemical
toxins. This brings about reduction in the
population of pest and vector to a level that does
not cause economic or health impact [26].
Bacterial and fungal entomopathogens are
widely employed as bio-control agents of
mosquito worldwide, where fungi are most
preferred because they are relatively easier to
deliver. These entomopathogens also have
higher chances of improving formulations, vast
number of pathogenic strains, and wider range of
host and are easily subjected to molecular
transgenesis [27]. Paecilomyces species is a
geographically widespread group of many
entomopathogens that can infect different orders
of insects in all stages of development and can
be frequently isolated from soil [28].
Paecilomyces formosus is a thermophilic,
filamentous and saprophyic fungus that is
characterized by high level of sporulation [29]. A
thermophilic fungus is one that has a minimum
temperature of growth at or above 20℃ and a
maximum temperature for growth at or above
50℃ [30]. Like most entomopathogenic fungi,
Paecilomyces formosus infects its host by
breaching the cuticle. Various metabolites allow
the pathogen to physically penetrate the host as
well as inhibit its regulatory system [31]. The
drug resistance and increasing insecticidal
resistance have stimulated the use of alternative
larvicides. The European Union (EU) has
withdrawn many pesticides due to the risk they
pose to humans and the environment [32].
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
5
In recent years, interest on mosquito-killing fungi
is reviving, mainly due to continuous and
increasing levels of insecticide resistance and
increasing global risk of mosquito-borne
diseases. Historically, both environmental and
biological controls of mosquitoes were
exclusively aimed at larval stages and as such
have been successful in a variety of geographical
and ecological settings within the class of
Dueteromycetes, especially Ascomycetes that
have entomopathogenic fungi such as
Metarhizium anisopliae, Beauveria bassiana and
Paecilomyces formosus species [33]. The basic
mechanism of pathogenesis behind was
entrance through the external integument.
Besides, infection through digestive tract was
also possible [34]. Conidia attach to the cuticle,
germinate and penetrate the cuticle. Once in the
hemocoel, the mycelium grows and spreads
throughout the host, forming hyphae and
producing blastospores. Humidity is a key factor
for high and rapid killing of insects by
entomopathogenic fungi, and further
development on cadavers [35-37].
Identification of the fungal isolate was based
predominantly upon the morphology of the
conidia and conidiophores. Fig. 1 shows the
macroscopic characteristics of the fungal isolate.
Colonies were rounded; central bulged, dense,
floccose and thick with orderly margins and
radiating ring. The colony colour was white, later
changing to dark green for young culture; while
the mature culture gives an ash colour.
Fungal isolate is characterized by verticillate
clusters of conidiophores bearing divergent
whorls of phialides with a cylindrical or inflated
base tapering to distinctly narrowed neck as
shown in Fig. 2. The conidia are typically hyaline,
one-celled, and smooth walled, and produced in
basipetal chains [38-40]. DNA of fungal isolates
amplified by ITS1&4 primers specifically for
paecilomyces formosus isolates shows a similar
result with that of ITS1-5.8S and ITS2 region that
was amplified, hence the PCR product were
found to be 534bp, 560bp and 569bp which is in
line with result of paecilomyces lilacinus,
paecilomyces nostocoides, and paecilomyces
variotii as shown in Fig. 3. Neverthelessn
Paecilomyces lilacinus can grow at 37°C and is
usually considered as a biological control agent
for root-knot nematodes [41,42,43].
(A) (B)
Fig. 1. (A) Five days old (B) Two weeks old mono-cultured plates of fungal isolate
Fig. 2. Micro Slide Image of the Fungal Isolate viewed under X100 magnification
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
6
Fig. 3. PCR product of the isolate on 1.5% agarose gel electrophoresis. The fungal isolate
produced a product of about 570bps-600bps. L is the ladder (hyperladder1kb) from 200bps-
6000bps, lane 1 and 2 are the analyzed DNA of the isolate
Based on their morphological characteristics,
mosquito larvae have the absence of breathing
tube (siphon) which is unique characteristics of
Anopheles. They breathe through a cluster of
small abdominal plates and possess palmate
hairs. Mosquito larvae are observed to lie flat just
below the water surface when not diving or
swimming [25]. However, a review of studies has
elucidated the larvicidal activity of fungi and
revealed that they could successfully infect and
kill larvae of a wide range of mosquito genus with
varying rates of mortality [6]. Furthermore, a
research conducted in East Africa to determine
the pathogenicity of entomopathogenic fungi
against several strains of adult Anopheles
gambiae revealed a high infection rates ranging
from 46 to 88% with Metarhizium anisopliae
being the most pathogenic strain [14]. In recent
years, there is a considerable amount of
attention focusing on identifying potential
mosquitocidal fungus from natural sources for
effective control of mosquitoes as a key measure
to curtailing the vector borne diseases in human
[15]. A study was also conducted in Asia
researching the larvicidal potential of Lagenidium
giganteum, a water weed, leading to its efficacies
in killing the tested vectors with appreciable
safety to non-target organisms and good
biological stability [15]. According to a large-scale
field trial conducted in the United States,
mycelium extract of Lagenidium giganteum
caused 40-90% infection rates in Culextarsalis
and Anopheles freeborn sentinel larvae [16]. The
potentials of many fungi have been established
for mosquito control, nevertheless, only a few
have received commercial attention and are
marketed for use in vector control programmes
globally [16].
In this study, the conidia from the
entomopathogenic fungus (Paecilomyces
formosus) exhibited larvicidal activity, these
Paecilomyces formosus was isolated from soil
using soil suspension and selective media, four
different concentration of conidial suspension;
6.6×107, 6.6×106, 6.6×105 and 6.6×104 conidia
ml-1 were tested, and the results show that;
mortality increases with increase in conidial
concentration and exposure time. The lowest
mean percentage mortality (44%) was recorded
at 6.6×104 conidia/ml and the highest mean
percentage mortality (98%) was recorded at
6.6×107 conidia/ml at 72-hours post exposure.
The lethal concentration of conidial suspension
causing 50% and 90% mortality of the larvae
was found to be 1.4×104 and 2.2×1012 conidia
ml-1 at 24-hours; 6.1×105 and 4.6×108 conidia/ml
at 48-hours; 8.8×104 and 1.2×107 conidia/ml at
72-hours as shown below.
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
7
Table 1. Larvicidal efficiency of Paecilomyces formosus conidial suspension against
Anopheles mosquitoes
Exposure
Time
Concentration
(conidia ml-1)
Percentage
Mortality
(%)
Probit
equation
Lethal
Concentration
(LC50) (conidia/ml)
P
value
𝓧𝟐
Chi
Square
24 Hrs
6.6×107
47±3.8
6.6×106
33±3.8
y = 0.5x –
3.0
1.4×108
0.004
0.005
6.6×105
25±2.2
6.6×104
16±5.9
48 Hrs
6.6×107
82±2.2
6.6×106
67±7.7
y = 0.5x –
2.75
6.1×105
0.002
0.001
6.6×105
51±4.4
6.6×104
33±6.7
72 Hrs
6.6×107
98±2.2
6.6×106
80±7.7
y = 0.5x –
2.50
8.8×104
0.001
0.001
6.6×105
78±2.2
6.6×104
44±8.0
3.1 Positive Control Group (Treated with
1 ml 0.05% Tween-20 and Distilled
Water) Records no Mortality
This study produced results which corroborate
the findings of Sani et al. [23] reporting the
mortality percentage of Paecilomyces spp
against culex mosquito larvae to be up to 80%
after 96 h post treatment. Thomas et al. [38] also
in his findings reported the mortality percentage
of Aspergillus fumigatus against culex mosquito
reaching up to 96% after 72 h post treatment.
Gayathri et al. [54] reported the pathogenicity of
Paecilomyces fumosoroseus against Culex
quinquefasciatus with 97.73% mortality on 8th day
after treatment with (108 conidia ml-1) which is
similar to this research with mortality reaching
98% at concentration of 6.6×107 conidia/ml after
72 h exposure time. In this study, mortality in the
control was recorded zero percentage,
pathogenicity varied according to concentration
of conidial suspension and period of exposure.
For the four concentrations of the conidial
suspension isolate tested (Table 2). These
findings further support the idea of Al-Hussaini
and Hergian [44] and Benserradj and Mihoubi
[45] who reveal that larval mortality percent and
LC50 of C. quinquefasciatus increased as
exposure periods increased. The results from
extract bioassay of chloroform, diethyl ether and
ethyl acetate revealed that the extracts of P.
formosus were pathogenic to 4th instars larvae of
Anopheles mosquitoes with four different
concentrations of the extracts tested; 300, 600,
900, and 1200 μg/ml. The results also show
increased mortality with increased extract
concentration. The LC50 were found to be 735.6
μg/ml for chloroform extract, 769.0 μg/ml for
diethyl-ether extract and 101.5 μg/ml for ethyl-
acetate extract as presented in Table 2.
3.2 Negative Control Group (Treated with
DimethylSulfoxide) Records no
Mortality. Positive Control Group 1
and 2 Treated with Standard Chemical
Larvicides Temephos (176.25 μg/ml)
and Malathion (781.25 μg/ml)
Respectively) Recorded 100%
Mortality
The findings of this study produced results
similar to the reports on comparative study on
larvicidal efficacy of mycelium; ethyl-acetate and
methanolic extract of A. Terreus against
Anopheles stephensi, Culex quinquefasciatus,
and Aedes aegypti larvae [46] and Beauveria
bassiana against Aedes aegypti larvae [47], also
shows higher larvicidal activity of ethyl-acetate
extracts.
Ethyl-acetate extract; having recorded the least
LC50 based on this result, ethyl-acetate extract is
considered the most pathogenic and considered
a better solvent for extraction of P. formosus-
mycelium extract for control of Anopheles
mosquito larvae. In the same vein,
Vivekanandhan et al. [48] reported on larvicidal
toxicity of ethyl-acetate mycelium extract of
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
8
Beauveria bassiana-28 grown in potato dextrose
broth (PDB), reported lower LC50 which is in
tandem with the result of this research. The
concentration of the most pathogenic extract;
ethyl acetate was further compared to standard
chemical insecticide, Temephos and Malathion.
The result, as presented in (Fig. 4) shows that
the chemical insecticides are more toxic to the
larvae than the extract, at 156.25 μg/ml
Temephos and Malathion causes 100% mortality
after 48hrs post exposure time, while the extract
causes 80% mortality at 1200 μg/ml.
This shows that Temephos and Malathion are
20% more efficient, thus corroborate with a study
on the evaluation of synergistic effect of
Aspergillus flavus on Temephos, reported similar
scenario. The fungal extract was reported to
have LC50 of 13.61, 14.37, and 10.02 ppm after
24, 48 and 72 hrs, respectively while that of
Temephos were 0.0060, 0.0055 and 0.0042 ppm
after 24, 48 and 72 hrs respectively [49].
Bioactive compounds identified by GC-MS
analysis of Paecilomyces formosus ethylacetate
extract, 9 peaks were detected in the GC-MS
chromatograms. However, 6 out of these
compounds have been reported to exhibit certain
biological activity. Most of the compounds
identified are carbohydrates; 1, 6-anhydro-β-D-
Glucopyranose, 3,4-Altrosan, organic acids;
pentanoic acid, diethylpropylmalonate,
propylpropandioic acid and cyclobutanol among
others as shown in Table 3.
Table 2. Larvicidal efficiency of Paecilomyces formosus extracts against Anopheles
mosquitoes
Solvent
Concentration
(μg/ml)
Percentage
Mortality
(%)
Probit equation
LC50
(μg /ml)
P value
𝓧2
Chloroform
24_Hours
300
27±0.01
600
33±7.70
y = 7.143x –
5.11
2135.5
0.04
0.001
900
33±8.84
1200
47±3.84
48_Hours
300
40±3.87
600
40±7.68
y = 2.1429x –
5.8
735.6
0. 018
0.001
900
47±3.84
1200
67±3.84
Ethylacetate
24_Hours
300
33±0.01
y = 1.7857x –
4.7857
778.9
0.001
0.003
600
40±3.86
900
47±3.84
1200
67±3.83
48Hrs
300
67±3.84
600
60±2.83
y = 1.0x – 2.20
101.5
0.004
0.002
900
73±3.83
1200
80±2.40
Diethyl ether
24 _ Hours
48 _ Hours
300
600
900
1200
300
600
900
1200
20±1.24
27±2.31
31±2.21
40±6.70
36±2.23
47±3.84
51±2.20
57±2.23
y = 1.1429x –
3.2429
y = 1.4286x –
4.4286
2605
769. 0
0.002
0.002
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
9
Fig. 4. Comparison between ethyl acetate extract and standard chemical larvicides
Table 3. Major bioactive compounds of Paecilomyces formosus ethylacetate extract identified
by GC-MS
S/
N
R. Time
(Mins)
Molecular
Weight
(g/mol)
Compound
Structure
Biological
activity
Reference
1
9.14
162
3,4- Altrosan
Bacteriostatic,
Fungicide.
[50]
2
9.30
162
1,6-Anhydro-β-
D-
Glucopyranose
Antioxidant
activity
[51]
3
9.50
146
Propyl-
Propanedioic
acid
Insecticidal,
Antimicrobial
[55]
4
9.69
202
Diethylpropyl
malonate
Antiplasmodial,
pesticide.
[29]
5
10.97
102
Pentanoic acid
Insecticidal,
Antimicrobial.
[49]
6
15.63
72
Cyclobutanol
Antimicrobial
[58]
3, 4-Altrosan a component of ethylacetate extract
of P. formosus has been reported to exhibit
biologically and pharmacologically important
activities such as bacteriostatic, fungicide [50,
51]. Fatty acids generally have been reported to
have larvicidal potential. Pentanoic acid,
diethylpropylmalonate and methylpropandioic
acid found on the ethylacetate extract of P.
formosus have several biological activities such
as hepatoprotective, antimicrobial, antiplasmodic
and insecticidal effects. The mechanism of action
of some of these metabolites may be as a result
of them accumulating naturally in the spinal fluid
during sleep deprivation and induce sleep in
animals [52,53], the compounds are presumed
to execute their biological activity through
interaction with multiple neuro transmitter system
[54,55] Senthil-Kumar et al. [56] have reported
0
20
40
60
80
100
120
24 48
Percentage Mortality
Time (hours)
Ethyl acetate extract Temphos Malathion
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
10
the larvicidal and insecticidal activity
of Phomopsis spp because of the presence of
dodecanoic acid in Phomopsis spp, has better
insecticidal property. 9,12-Octadecanoic acid has
been widely reported as an important component
of ethyl-acetate-mycelium extracted metabolites
of Beauveria bassiana, exhibiting larvicidal
activity against a wide range of insect larvae
including mosquito (Vivekanandhan et al. [48],
Ragavendran, [57,9]. Senthilkumar et al. [56]
reported that ethyl acetate mycelium extract of
Beauveria bassiana showed the presence of
prominent functional groups which may be
involved in the mosquitocidal activity.
4. CONCLUSION
Spores and extracts of Paecilomyces formosus
have promising larvicidal activity against
Anopheles mosquito larvae, the vector of
Plasmodium parasite that causes malaria which
is widely distributed in the Northern guinea
savannah vegetation of Nigeria. GC-MS
characterization of ethyl-acetate extract showed
6 major compounds and the effect of some of
these compounds might to be responsible for the
observed larvicidal activity of the extract.
ETHICAL APPROVAL
As per international standard or university
standard ethical approval has been collected and
preserved by the authors.
ACKNOWLEDGEMENTS
I am indebted to Prof. A. A. Imam of Bayero
University, Kano Nigeria, for his mentorship
towards the success of this research work and
also his role in reviewing the research work. My
sincere gratitude also goes to Abba Nasidi, Rufai
Nasir (Biochemistry Department) and Mahe
(Molecular biology lab) for their great support in
carrying out the research.
COMPETING INTERESTS
Authors have declared that no competing
interests exist.
REFERENCES
1. Odalo J, Omolo M, Malebo H, Angira J,
Njeru P, Ndiege I. Repellance of essential
oil of some plants from Kenya Coast
against Anopheles gambiae. Acta Tropica.
2005;2(95):210-18.
2. World Health Organization (WHO). Global
Programme to eliminate lymphatic
filariasis; 2013.
Available:www.who.int
3. Arivoli S, Ravindran JK, Tennyson S.
Larvicidal Efficacy of plant extracts against
the malaria vector Anopheles stephensis
Liston (Diptera Culicidae). World Journal of
Medical Scence. 2012;7:77-80.
4. Bhan S, Shrankhla, Mohan L, Srivasstava
CN. Larvicidal toxicity of Temephos and
entomopathogenic fungus, Aspergillus
flavus and their synergistic activity against
malaria vector, Anopheles stephensi.
Journal of Entomology and Zoology
Studies. 2013;1(6):55-60.
5. Watarabe T. Pictorial Atlas of soil and seed
fungi morphologies of cultured fungi.
2010;295-296.
6. Scolte EJ, Knols BGJ, Samson RA,
Takken W. Entomopathogenic fungi for
Mosquito control: A review. Journal Insect
Science. 2004;4:19.
7. Augustyniuk-Kram A, Kram KJ, Lo JA.
Entomopathogenic Fungi as an Important
Natural Regulator of Insect Outbreaks in
Forests (Review). Forest ecosystem- more
than Just Trees. 2012;265-94.
Available:www.intechopen.com
8. Soni N, Soam P. Effect of Chrysosporium
keratinoplulum metabolites against Culex
quinquefasciantus after chromatographic
purification. Parasitol Research. 2010;107:
1329-1336.
9. Bukhari T, Willem T. Development of
Metarhizium anisopliae and Beauveria
bassiana formulations for control of malaria
Mosquito larvae. Parasites and Vectors.
2011;4(1):23.
10. Freed S, Feng-Liang J, Naeem M, Shun-
Xiang R, Hussian M. Toxicity of Proteins
Secreted by Entomopathogenic Fungi
against Plutella xylostella (Lepidoptera :
Plutellidae). International Journal of
Agriculture and Biology. 2012;14:291–295.
11. Sani I, Yusuf U, Umar KM. Larvicidal
Efficacy of Entomopathogenic Fungus,
Metarhizium anisopliae against Culex
quinquefasciatus Say (Diptera: Culicidae).
Annals of Experimental Biology. 2016;
4(4):17-21.
12. Mazid S, Rajkhowa RC, Kalita JC.
Pathogenicity of Aspergillus niger and
Aspergillus flavus on red spider mite
(Oligonychus coffeae Nietner), a serious
pest of tea. Journal of Entomology and
Zoology Studies. 2015;3(3):11-13.
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
11
13. Abdullah SK, Mustapha RA, Assaf LH.
Isolation of selective entomopathogenic
and opportunistic fungi from soil in Duhok
province, Kurdistan region of Iraq by
different selective isolation media. Journal
of Biology, Agriculture and Healthcare.
2015;5(4):73–80
14. Posadas JB, Comerio RM, Mini JI,
Nussenbanum AL, Lecuona RE. A novel
dodine- free selective medium based on
the use of cetyltrimethylamonium
bromide(CTAB )to isolate Beuaveria
bassiana, Metarhizium anisoplaie
sensulato and Paecilomyceslilacinus soil.
Mycologia. 2012;104(4):974-980.
15. Richards HA. Entomopathogenic fungal
identification, Nevada. USA. 2005;5-32.
16. Watarabe T. Pictorial atlas of soil and seed
fungi pictorial atlas of soil and seed fungi
morphologies of cultured fungi. 2010;12:
295-296.
17. Livak KJ. Organisation and Mapping of
sequence on the Drosophila Melanogaster
X and Y chromosomes that is transcribed
during spermamatogenis. Genetics
Journal. 1984;107:611-634.
18. Driver F, Milner RJ, Trueman JWH. A
taxonomic revision of Metarhizium based
on a phylogenetic analysis of rDNA
sequence data. Journal of Mycology
Research. 2000;104:143-150.
19. White TJ, Bruns TD, Lee SB, Taylor JW.
Analysis of phylogenetic relationships by
amplification and direct sequencing of
ribosomal genes. In: Innis M. A. PCR
protocols. Academic Press, New York.
1990;315-322.
20. Dong T, Zhang B, Jiang Y, Hu Q. Isolation
and Classification of Fungal White fly
Entomopathogens from Soils of Qinghai-
Tibet Plateau and Gansu Corridor
China. Journal PLOS ONE. 2016;11(5):
e0156087.
21. World Health Organization. Guidelines for
laboratoty and field testing mosquito
larvicides; 2005.
Available:http://www.who.int/iris/bitstream/
10665/69101/1/WHO CDS WHOPES
GCDPP 13.pdf
22. Ragavendran C, Nawal KD, Natarajan D.
Beauveria bassiana (Clavicipitaceae):
a potent fungal agent for controlling
mosquito vectors of Anopheles stephensi,
Culex quinquefasciatus and Aedes
egypti (Diptera: Culicidae). Royal Society
of Chemistry Advances. 2017;7:3838-
4350.
23. Sani I, Yusuf U, Kim U. Larvicidal Efficacy
of Entomopathogenic Fungus, Metarhizium
anisopliae against Culex quinquefasciatus.
Annals of Experimental Biology. 2016;
4(4):17–21.
24. Gillies MT, Coetzee M. A supplement to
the Anophellinae of Africa south of the
sahara Publication of the South African.
Institute for Medical Research. 1987;
55:140-143.
25. Mohammed GJ, Kadhim MJ, Hussein HM.
Characterization of Bioactive Chemical
Compounds from Aspergillus terreus and
Evaluation of Antibacterial and Antifungal
Activity, International Journal of
Pharmacognosy and Phytochemical
Research. 2016;8(6):889-905.
26. Araújo JPM, Hughes DP. Diversity of
entomopathogens Fungi : Which groups
conquered the insect body ? Advances in
Genetics. 2016;94:1–39.
27. Houbraken J, Verweij PE, Rijs AJ, Borman
AM, Samson RA. Identification of
Paecilomyces variotii in clinical samples
and settings. Journal of Clinical
Microbiology. 2010;48:2754-6137.
28. Gumus T, Demirci AS, Sagdic O, Arici M.
Inhibition of heat resistant molds:
Aspergillus fumigatus and Paecilomyces
variotii by some plant essential oils.
Journal of Food Science and
Biotechnology. 2010;19:1241–1244.
29. Anastasiadis IA, Giannakou IO, Prophetou-
Athanasiadou DA, Gowen SR. The
combined effect of the application of a
biocontrol agent Paecilomyces lilacinus,
with various practices for the control of
root-knot nematodes. Journal of Crop
Protection. 2008;27:352–361.
30. Hussein HM, Skokova HO, Půža V, Zemek
R. Laboratory Evaluation of Isaria
fumosorosea CCM 8367 and Steinernema
feltiae Ustinov against Immature Stages of
the Colorado PotatoBeetle. PLOS ONE
Journal. 2016;11(3):14-20.
31. Samson RA. Paecilomyces and some
allied hyphomycetes. Studies in Mycology.
1974;6:1-119.
32. Samson RA, Yilmaz N, Houbraken J,
Spierenburg H, Seifert KA, Peterson SW,
Varga J, Frisvad JC. Phylogeny and
nomenclature of the genus Talaromyces
and taxa accommodated in Penicillium
subgenus Biverticillium. Studies in
Mycology. 2011;70:159-83.
33. Samson RA, Houbraken J, Varga J,
Frisvad JC. Polyphasic taxonomy of the
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
12
heat resistant ascomycete genus
Byssochlamys and its Paecilomyces
anamorphs. Persoonia Journal. 2009;22:
14-27.
34. Carpenter S, Mellor PS, Torr SJ. Control
techniques for Culicoides biting midges
and their application in the UK and
northwestern Palaearctic. Journal of
Medical Veterinary Entomology. 2008;22:
175-87.
35. Scholte EJ, Ng'habi K, Kihonda J, Takken
W, Paaijmans K, Abdulla S, Killeen GF,
Knols BGJ. An entomopathogenic fungus
for control of adult African malaria
mosquitoes. Science. 2014;308:1641–
1642.
36. Inglis D, Enkerli G, Goettel M. Laboratory
techniques used for entomopathogenic
fungi. Hypocreals. Manual of Technique
in Invertebrate Pathology. 2012;4:189-
253.
37. El Damir M. Variation in germination,
virulence and conidial production of single
spore isolates of entomopathogenic fungi
in response to environmental
heterogeneity. Journal of Biological
Science. 2006;6:305–315.
38. Thomas D, Rai V, Updhyay P, Mehra M,
Rana A, Pandey K. Potential of
entomopathogenic fungi as biopesticides.
Department of Plant Pathology, College of
Agriculture, G. B. Pant University of
Agriculture & Technology, Pantnagar
(Uttarakhand), India. Indian Journal of
Sciences Research and Technology. 2016;
2(5):7-13.
39. Samson RA, Houbraken J, Varga J,
Frisvad JC. Polyphasic taxonomy of the
heat resistant ascomycete genus
Byssochlamys and its Paecilomyces
anamorphs. Persoonia Journal. 2009;22:
14-27.
40. Samson RA, Yilmaz N, Houbraken J,
Spierenburg H, Seifert KA, Peterson SW,
Varga J, Frisvad JC. Phylogeny and
nomenclature of the genus Talaromyces
and taxa accommodated in Penicillium
subgenus Biverticillium. Studies in
Mycology. 2011;70:159-83.
41. Kiewnick S, Sikora RA. Biological control
of the root-knot nematode Meloidogyne
incognita by Paecilomyces lilacinus strain
251. Journal of Biological Control. 2006;
38:179–187.
42. Ciecko SC, Scher R. Invasive fungal
rhinitis caused by Paecilomyces lilacinus
infection: Report of a case and a novel
treatment. Ear Nose Throat Journal. 2010;
89:594–595.
43. Dong Q, Wang H, Xing X, Ji S.
Identification and characterization of a
special species of Paecilomyces. Annals of
Microbiology. 2012;62:1587-92.
44. Al-Hussaini M, Hergian A. The Larvicidal
effect of four fungal aflatoxinsagainst fourth
instar larvae of the mosquito Culex
quinquefasciatus (Culicidae: Diptera)
Journal of Kerbala University. 2014;12(4):
79-88.
45. Benserradj O, Mihoubi I Larvicidal activity
of entomopathogenic fungi Metarhizium
anisopliae against mosquito larvae in
Algeria. International Journal of current
Microbiology and Applied Science.
2014;3(1):54-62.
46. Ragavendran CN, Natarajan D. Beauveria
bassiana (Clavicipitaceae): a potent
fungal agent for controlling mosquito
vectors of Anopheles stephensi, Culex
quinquefasciatus and Aedes aegypti
(Diptera: Culicidae), Royal Society of
Chemistry Advances. 2015;7:3838-3851.
47. Daniel RS, Michael ES. Insecticide Basics
for Pest Management Professionals,
University of Florida. Bulletin. 2015;1352.
Available:www.extension,uga.edu/publicati
ons.
48. Vivekanandhan P, Kavitha S, Karthi S,
Nathan SS, Shivakumar MS. Toxicity of
Beauveria bassiana-28 Mycelial Extracts
on Larvae of Culex quinquefasciatus
Mosquito (Diptera: Culicidae). International
Journal Environmental Research and
Public Health. 2018;15:388-4.
49. Alves SB, Alves LFA, Lopes RB, Pereira
RM, Vieira SA. Potential of some
Metarhizium anisopliae isolates for control
of Culex quinque fasciatus (Diptera:
Culicidae). Journal of Applied Entomology.
2002;126:504-509.
50. Jadhav V, Kalase V, Patil P. GC-MS
analysis of bioactive compounds in
methanolic extract of Holigarna grahamii
(wight) Kurz. International Journal of
Health and Medicine. 2014;2(4):35–39.
51. Kumar G, Loganathan L, Kokathi VBR.
Antimicrobial activity of latex of Calotropis
Gigantea against pathogenic
microorganisms- an in-vitro study.
Pharmacologyonline. 2010;3:155-163.
52. Fedorova I, Hashimoto A, Robert AF,
Michael P, Hedrick LT. Behavioral
evidence for the interaction of oleamide
with multiple neurotransmitter systems.
Suleiman et al.; AJBGE, 4(4): 1-13, 2021; Article no.AJBGE.75165
13
Journal of Pharmacology and Experimental
Therapeutic. 2001;299(1):332-342.
53. Anastasiadis S, Vladimir VP, Lumir OH,
Valery MD. Cyclobutane Containing
Alkaloids: Origin, Synthesis, and Biological
Activities. The Open Medicinal Chemistry
Journal. 2008;2:26-37.
54. Gayathri G, Balasurbramaninan C,
Vinayagamorthi B, Kubendran T. Larvicidal
Potential of Beauveria bassiana (Balsamo)
vuillemin and Paecilomyces fumosoroseus
(wize). Browan and simith on culex
quinguefasiafus (say). Journal of
Biopesticide. 2010;3(1):147-151.
55. Pandey P, Sahu SS, Gunasekaran K,
Vijayakumar T. Triple insecticide
resistance in Anopheles culicifacies: a
practical impediment for malaria control
in Odisha State, India. Indian Journal
of Medical Research. 2015;142(1):59–
63.
56. Senthilkumar G, Madhanraj P,
Panneerselvam S. A studies on the
compounds and its antifungalpotentiality of
fungi isolated from paddy field soils of
Jenbagapuram Village, Thanjavur District,
and South India. Asian Journal of
Pharmaceutical Research. 2011;1:19–21.
57. Ragavendran CN, Natarajan D. Beauveria
bassiana (Clavicipitaceae): a potent fungal
agent for controlling mosquito vectors of
Anopheles stephensi, Culex
quinquefasciatus and Aedes aegypti
(Diptera: Culicidae), Royal Society of
Chemistry Advances. 2015;7:3838-3851.
58. Jihadi MG, Jawad M, Hussein H.
Characterization of bioactive chemical
compounds from Aspergillus terreus and
evaluation of antibacterial and antifungal
activity. International Journal of
Pharmacognosy and Phytochemical
Research. 2016;8:889-905.
_________________________________________________________________________________
© 2021 Suleiman et al.; This is an Open Access article distributed under the terms of the Creative Commons Attribution License
(http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium,
provided the original work is properly cited.
Peer-review history:
The peer review history for this paper can be accessed here:
https://www.sdiarticle4.com/review-history/75165
