Content uploaded by Merve Kahraman Yiğit
Author content
All content in this area was uploaded by Merve Kahraman Yiğit on Mar 04, 2022
Content may be subject to copyright.
Available via license: CC BY-NC-ND
Content may be subject to copyright.
123
M. G. Halıcı*, M. Kahraman
Erciyes University, Kayseri, 38039, Turkey
* Corresponding author: mghalici@gmail.com
DNA barcoding and morphological observations
of three lichenized fungal species from James Ross Island
(Antarctic Peninsula)
Abstract. Antarctica seems to many people to be a very remote, isolated, and mysterious place at the end of the world, and its
name is hardly mentioned in normal life and conversation. However, considering that it plays a key role in the rapidly warming
global climate system and its contribution to the continuing sea-level rise, its importance today is increasing day by day and it
can be seen that it is of vital importance for humanity. There is increasing interest in the distribution of terrestrial organisms in
Antarctica because of the potential use of biodiversity as a predictor or indicator of climate change. Lichenized fungi cover large
areas of Antarctica that are not covered by ice and form precursor organisms that thrive in harsh environments. They are the
largest contributors to biomass and diversity. The characteristic features of these organisms can be counted as developing certain
protective mechanisms, adapting to temperature and radiation, and surviving even when the amount of water in their body is
minimized. On the other hand, lichenized fungi are the most dominant components of Antarctic terrestrial vegetation, and their
adaptation to extreme conditions; growth forms, reproduction, adaptation to environmental conditions can also be explained
through mechanisms. Because of the lichens, dominant organisms of Antarctica, studying lichen biodiversity is very important.
Although around 500 species of lichens were reported from Antarctica, the lichen biodiversity of the continent is far from being
fully known; as in the last 5 years of our studies on Antarctic lichens, we and other scientists reported a significant number of
undescribed or unreported species. So the lichen biodiversity of Antarctica is not fully known as there are still many undescribed
or unreported species on the continent. In this paper, we deal with three lichenized fungal species: Arthonia glebosa Tuck.,
Lecanora atromarginata (H. Magn.) Hertel & Rambold and Lecidea tessellata Flörke which are common in James Ross Island,
using nrITS, mtSSU, and RPB1 sequences. The lichen samples are studied by morphological and anatomical characters. In
addition, to determine the phylogenetic positions of the species, we provide nrITS and mtSSU of these 3 species from Antarctica
and additionally RPB1 sequences of Lecidea tessellata.
Keywords: Antarctica, biodiversity, Arthonia glebosa, Lecanora atromarginata, Lecidea tessellata
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Halıcı, M. G., & Kahraman, M. (2021). DNA barcoding
and morphological observations of three lichenized fungal species
from James Ross Island (Antarctic Peninsula).
Ukrainian Antarctic Journal, 1, 123—148.
https://doi.org/10.33275/1727-7485.1.2021.671
1 Introduction
The first collections of lichens from Antarctica were
made in the early 1800’s. Until the First World War,
several national expeditions made significant collec-
tions of lichens. Because of the harsh environment
and relative inaccesibility, and also the low species
diversity compared with other parts of the world,
professional lichenologists were not attracted by
Antarctica. The lichen samples were mostly collected
by non-specialists such as ecologists or geologists
(Øvstedal & Lewis-Smith, 2001).
The terrestrial vegetation of Antarctica is domi-
nated by lichens and mosses which are poikilohydric
cryptogams. Today around 500 species of lichens are
known from Antarctica, most of them from Antarctic
Peninsula, and the number of species decreases grad-
ually towards the continental parts of Antarctica (Øv-
124
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
s tedal & Lewis-Smith, 2011; Sancho et al., 2019).
Un fortunately, today the lichen biodiversity of
Antarctica is far from completely and truly known.
Especially the publications of Caroll William Dodge
between 1938–1973 in which 350 new taxa and 150
new combinations were made from Antarctic collec-
tions are discussed harshly and only 39 of these
species are currently in use; most of the others were
reduced to synonymy (Hertel, 1988; Castello & Nimis,
1995; Fryday, 2011).
Recently, molecular methods are being used more in
determining the lichen biodiversity of the Antarctic
(Lee et al., 2008; Halıcı et al., 2017; 2018; 2020; 2021).
It is important to determine the lichen biodiversity of
Antarctica truly, as the organisms can be excellent bio-
monitors of climate change and Antarctica is a natural
laboratory for these studies (Sancho et al., 2019). In this
study, 3 lichenized fungal species (7 samples) which
have a wide distribution in James Ross Island located in
the northeast of Antarctica (Fig. 1) are studied by mor-
phological, anatomical and molecular methods.
2 Materials and methods
The collecting expedition was realized in James Ross
Island in the austral summer of 2017 (January-March).
Lichen samples were collected from 0–100 m alti-
tude (the sites are listed in Appendix 1) by spatula on
soil or by chisel and hammer on rock. They were
wrapped in toilet paper and put in paper bags. When
brought to the Mendel Polar Station, they were left to
dry for three days in a room with air flow. The studied
samples are stored in the lichen section of ERCH
(Erciyes University Herbarium, Turkey).
Morphological examinations were all carried out
under a stereo microscope (Leica EZ24). Sections
were taken directly under the stereomicroscope by
hand and anatomical characters were examined under a
light microscope (Leica DM2500). Ascospores were
measured in water. In addition, chemical reagents for
spot tests were used to identify the species.
2.1 Lichen sampling
Two specimens of Arthonia glebosa Tuck.; three spec-
imens of Lecanora atromarginata (H. Magn.) Hertel
& Rambold and six specimens of Lecidea tesselata
Flörke. were used for analysis (Appendix 1). We used
three gene regions (nrITS, mtSSU, RPB1). For Ar-
thonia glebosa the nrITS region was analyzed for both
specimens and the mtSSU region only for one. For
Lecanora atromarginata the nrITS region was ana-
Figure 1. A map showing the James Ross Island in the Antarctic Peninsula
125
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
lyzed for one specimen and the mtSSU region for two
specimens. For Lecidea tessellata nrITS region was ana-
lyzed for all six specimens, the mtSSU region for four
specimens and RPB1 region for three specimens.
2.2 DNA isolation, PCR and sequencing
DNeasy Plant Mini Kit (Catalog No: 69104) pro-
duced by Qiagen company was used in the DNA iso-
lation. The protocol given in the kit was followed.
Amplification of all gene regions (nrITS, mtSSU,
RPB1) from the isolated DNA was performed under
appropriate PCR conditions. PCR reaction mixture
applied for gene regions 5 μl of 200 ng DNA, 5μl of
10X reaction buffer, 5 μl of 25mM MgCl2, 5 μl of 25μ
dNTPs, 4 μl of 10 μM forward primer, 4 μl of 10 μM
reverse primer, 0.5 U of Taq DNA polymerase. PCR
reaction was performed by adding 21.5 μl PCR water
to complement the total volume to 50 μl for all gene
regions (nrITS, mtSSU and RPB1). PCR amplifica-
tions of nrITS were performed using fungal-specific
primers nrITS4 (TCCTCCGCTTATTGATATGC,
White et al., 1990) and nrITS1-F (CTTGGTCATT-
TAGAGGAAGTAA, Gardes & Bruns, 1993). PCR
am plifications of mtSSU were performed using fun-
gal-specific primers (mrSSU1-F AGCAGTGAG-
GAATATTGGTC ; mrSSU3-R ATGTGGCACGTC
TATAGCCC, Zoller et al., 1999) and PCR amplifi-
cations of RPB1 were performed using fungal-specif-
ic primers RPB1-aFasc (ADTGYCCYGGYCATT-
TYGGT, Hofstetter et al., 2007) and RPB1-cR (CCC
GCATNTCRTTRTCCATRTA, Matheny et al., 2002).
PCR amplifications were carried out in a thermal cy-
cler (Blue Rey-Biotech) equipped with a heated lid, in
the following conditions for ITS: an initial heating step
for 5 min. at 95 °C; 6 cycles with 1:30 min. at 94 °C,
1:30 min. at 55 °C, and 2 min. at 72 °C; and 33 cycles
with 1 min. at 94 °C, 1 min. at 52 °C, and 2 min. at 72 °C.
A final extension step of 8 min. at 72 °C was added, after
which the samples were kept at 4 °C; for mtSSU and
RPB1: an initial heating step for 5 min. at 94 °C; 35
cyc les with 1 min. at 94 °C, 1 min. at 58 °C, and 1 min.
at 72 °C. A final extension step of 10 min. at 72 °C was
added, after which the samples were kept at 4 °C.
After the PCR, amplificated samples were loaded
on a 1% agarose gel with ethidium bromide dye add-
Figure 2. Maximum Likelihood (ML) analysis inferred from nrITS region sequences of the genus Arthonia
126
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
Figure 3. Maximum Likelihood (ML) analysis inferred from
mtSSU region sequences of the genus Arthonia
127
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Figure 4. Maximum Likelihood (ML) analysis inferred from nrITS region sequences of the genus Lecanora
0.02
128
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
ed (5mg/ml) for electrophoretic separation. The
DNA bands were detected under UV light at 100 watt
after 60 minutes.
2.3 Sequence alignment and phylogenetic analysis
The sequencing was performed by ABI 3730 XL se-
quencer (applied Biosystem). Possible reading errors
were corrected with the Cluster X function of MEGA
6.0 program and the sequences of the species obtained
from the research area and the sequences of the genes
downloaded from the GenBank (Appendix 2) were
analyzed with Mega 6.0 program. The dendrograms
were obtained with ML method and Tamura 3-pa-
rameter model. Pairwise deletion was applied to gaps
in data, and the reliability of the inferred tree was test-
ed by 1000 bootstrap replications for control.
3 Results
3.1 Phylogeny
3.1.1 Arthonia glebosa Tuck.
The nrITS alignment comprised 15 accessions with a
length of 520 bp (Appendix 2). Opegrapha multipunc-
ta MN687935 was used for the outgroup. According
to nrITS analyses, both specimens (indicated with
circles in Fig. 2), formed a clade with Arthonia didy-
ma and Arthonia apatetica. There is no data in Gen-
Bank for A. glebosa. Two Antarctic specimens of
A. glebosa studied here clearly belong to another clade
than other Arthonia specimens (Fig. 2).
The mtSSU alignment comprised 57 accessions (Ap-
pendix 2) with a length of 818 bp. Reichlingia zwack-
hii (Sandst.) Frisch & G. Thor KF707652 was used as
the outgroup. The Antarctic specimen of A. glebosa
clearly belongs to another clade than the other Artho-
nia specimens (Fig. 3).
3.1.2 Lecanora atromarginata (H. Magn.)
Hertel & Rambold.
The nrITS alignment comprised 46 accessions with a
length of 600 bp, and Umbilicaria antarctica AY603128
was used for the outgroup. The mtSSU alignment
comprised 81 accessions with a length of 630 bp and
Figure 5. Maximum Likelihood (ML) analysis inferred from
mtSSU region sequences of the genus Lecanora
DQ986807.1 Lecanora poly tropa
MN023037.1 Lecanora fusc obrunnea
DQ787356.1 Lecanora sulphurea
DQ787346.1 Lecanora intric ata
DQ787344.1 Lecanora perpruinos a
MN508274.1 Lecanora s chofieldii
DQ986898.1 Lecanora cont ractula
MN508273.1 Lecanora lept acina
MH520111.1 Lecanora s olaris
MH520114.1 Lecanora s omervellii
MH520114.1 Lecanora s omervellii
DQ787348.1 Lecanora polyt ropa
MN192153.1 Lecanora pac hyphylla
MK693685.1 Lec anora pseudistera
HQ660556.1 Lecanora murali s
DQ972976.1 Lecanora achari ana
MN192156.1 Lecanora c hondroderma
KT453824.1 Lecanora novomexic ana
DQ912273.1 Lecanora hyboc arpa
JR 0.230
JR 0.270
JQ782697.1 Lecanora subi mmersa
JQ782685.1 Lecanora lepros a
JQ782692.1 Lecanora queensl andica
MK778538.1 Lec anora leptyrodes
MK778533.1 Lec anora carpinea
MK693683.1 Lec anora carpinea
MK541649.1 Lec anora excludens
KY502443.1 Lec anora intumescens
KP224472.1 Lec anora anakeestiicola
KT453820.1 Lecanora formosa
KY502440.1 Lec anora thysanophora
JQ782667.1 Lecanora caesi orubella
KY502433.1 Lec anora farinaria
MK778542.1 Lec anora pulicaris
JQ782702.1 Lecanora vainioi
DQ787360.1 Lecanora glabrat a
KY502459.1 Lec anora allophana
KY502458.1 Lec anora impudens
DQ787362.1 Lecanora campes tris
JQ782699.1 Lecanora tropic a
KT453821.1 Lecanora horiza
MK693684.1 Lec anora argopholis
MN508326.1 Lecanora alas kensis
MH700565.1 Lecanora c aperatica
MH700566.1 Lecanora c aperatica
KY502449.1 Lec anora substerilis
JQ782676.1 Lecanora gangaleoides
JQ782668.1 Lecanora cal ifornica
JQ782686.1 Lecanora paci fica
KY502452.1 Lec anora expersa
KY502426.1 Lec anora cenisia
KY502422.1 Lec anora chlarotera
EF105418.1 Lecanora param erae
EF105417.1 Lecanora hy bocarpa
KY502430.1 Lec anora albella
JQ782687.1 Lecanora phaeocardi a
KP224465.1 Lec anora cinereofusca
KP224461.1 Lec anora saxigena
JQ782674.1 Lecanora flavopallida
KR094858.1 Lecanora lay ana
KR094857.1 Lecanora lay ana
MN879871.1 Lecanora baek dudaeganensis
JQ900617.1 Lecanora orientoa fricana
KY502429.1 Lec anora alboflavida
MH481360.1 Lecanora darli ngiae
JQ782669.1 Lecanora elat inoides
KR055656.1 Lecidea hogani i
JQ782680.1 Lecanora helva
KJ152466.1 Lecanora s ymmicta
KJ766421.1 Lecanora s ymmicta
KJ766420.1 Lecanora s trobilina
JQ900616.1 Lecanora keny ana
JQ782703.1 Lecanora wils onii
KT962184.1 Lecanora ecorti cata
KY502445.1 Lec anora variolascens
JQ782696.1 Lecanora subim mergens
JQ782684.1 Lecanora leproplac a
AY603139.1 Umbilic aria antarctica
98
65
99
52
99
66
99
84
81
94
44
94
99
19
85
25
70
89
70
70
49
74
11
44
42
67
63
56
43
28
12
13
6
47
83
2
21
44
2
86
0
17
49
42
78
20
21
27
3
17
18
35
0
13
7
4
0
1
0.1
129
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Figure 6. Maximum Likelihood (ML) analysis inferred from nrITS
region sequences of the genus Lecidea
130
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
Umbilicaria antarctica AY603139 was used as out-
group (Appendix 2). According to nrITS and mtSSU
analyses of L. atromarginata specimens in Fig. 3
and Fig. 4 (triangle), formed a separate clade.
There are no data of L. atromarginata in GenBank,
but three specimens of this species clearly belong
to another clade from the other Lecanora speci-
mens (Figs. 4, 5).
3.1.3 Lecidea tessellata Flörke.
The nrITS alignment comprised 55 accessions with a
length of 575 bp, mtSSU alignment comprised 65 ac-
cessions with a length of 610 bp and the RPB1 align-
ment comprised 40 accessions with a length of 755 bp
(Appendix 2). Rhizoplaca parilis MN764276, KT453859
and KU935393 were used for the outgroups respec-
tively.
According to nrITS, mtSSU and RPB1 analyses of
L. tessellata specimens in Fig. 6, Fig. 7 and Fig. 8 with
square, matched with L. tessellata specimens depo-
sited in GenBank. So clearly all these specimens be-
long to L. tessellata (Figs. 6, 7 and 8).
3.2 Morphology and Anatomy
3.2.1 Arthonia glebosa Tuck.
Morphology and Anatomy: Thallus squamulose, brown,
almost areolate or subeffigurate. Apotechium lecideine,
black, usually aggregated, swollen, arcuated, convex,
margin excluded, 0.1–0.35 mm (Fig. 9a). Epihy me-
ni um brown or blackish brown, 10–15 μm, N-, K-.
Hymenium hyaline, sometimes with a brownish tinge
and with oil droplets, 30–55 μm. Hypothecium hya-
line or brown, 25–140 μm. Ascus 8-spored, 50 × 20 μm.
Ascospores hyaline, elipsoid to subglobose, usually
one septate, when septate, asymmetric, sometimes no
septum present in young ascospores, (8–)10–12.5–
15(–16) × 4–5 μm (n = 15), ascospore length/width
ratio (1.6–)2.14–2.62–3.1(–3.5) μm (n = 15) (Fig. 9b).
Paraphyses simple, unbranched, 3 μm. Algae green,
chlorococcoid, more or less globose, ~15 μm diam.
Thallus K-, C-, KI-, Pd-. Medulla K+ yellow and
KI+ blue. Pycnidium not observed.
Examined species: JR 0.154, JR 0.252 (see Ap-
pendix 1).
Figure 7. Maximum Likelihood (ML) analysis inferred from
mtSSU region sequences of the genus Lecidea
0.01
131
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Figure 8. Maximum Likelihood (ML) analysis inferred from RPB1 region sequences of the genus Lecidea
0.05
132
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
Ecology and Distribution: It occurs on soil (Free-
bury, 2014), on humus (DeBolt & McCune, 1993)
and it is very common in dry or cold open habitats
(McCune, 1997).
Arthonia glebosa is considered as rare on a global
scale (Baldursson et al., 2003). It has been reported
from Mongolia (Biazrov & Zhurbenko, 2004), Saska-
tchewan (Freebury, 2014), Arctic Iceland, Greenland
(Kristinsson et al., 2010), USA, Russia (Zhurbenko,
2009), Ecuador (Sklenář et al., 2010), Tibet (Ober-
mayer, 2004), Canada (Williston, 2000), China (Bili-
chenko, 2021) and South Orkney and James Ross
Islands in Antarctic Peninsula (Øvstedal & Lewis-
Smith, 2001). World-wide distribution of Arthonia
glebosa is indicated by red circle in Figure 12.
3.2.2 Lecanora atromarginata
(H. Magn.) Hertel & Rambold.
Morphology and Anatomy: Thallus crustose, continous
or dispersed as unregular patches, up to 2 cm. Thallus
chalky white or dirty white, rimose-areolate. Prothal-
lus present around the thallus and margins of the
areoles, black. Apothecium present, lecideine, round-
ish to angular, black, epruinose, immersed or subses-
sile, 0.2–0.55 mm (Fig. 10a). Margin present at the
Figure 9. Arthonia glebosa Tuck., (a) — thallus and apothecia; (b) — ascospores
Figure 10. Lecanora atromarginata (H. Magn.) Hertel & Rambold, (a) — thallus and apothecia; (b) — ascus and ascospores
(a) (b)
(a) (b)
133
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
young ones, very thick, black, excluded at the old ones.
Epihymenium greenish black, 20–60 μm, N-. Hyme-
nium hyaline, 40–100 μm. Hypothecium mostly hya-
line, sometimes brownish hyaline, 20–40 μm. Ascus
8-spored, 38 × 17 μm. Ascospores simple, hyaline,
eli psoid with oil droplets, 8–10.5 × (3–)–4.5–6 μm
(n = 20), l/w ratio (1.33–)1.67–2.06–2.45(–2.67) μm
(Fig. 10b). Paraphyses simple, unbranched, tips
clavate or almost capitate, 2–4 μm. Algae green,
chlorococcoid. Thallus and medulla K+ yellow, C+
yellow or C-, medulla I-. Pycnidium not observed.
Examined species: JR 0.008, JR 0.230, JR 0.270
(Appendix 1).
Ecology and Distribution: Lecanora atromarginata
occurs on inland rocks at high altitudes in shaded
sites. It is usually accompanied by Rhizocarpon gemi-
natum, Staurothele gelida, Usnea sphacelata, Lecidea
tesselata, Rhizocarpon disporum and Rusavskia ele-
gans (Śliwa & Olech, 2002; Øvstedal & Lewis-Smith,
2001; Hansen, 2009). On James Ross Island it is
usually found with Lecidea tessellata which is de-
tai led below.
Lecanora atromarginata has a bipolar distribution
and is found in portions of arctic Asia, Europe, Scan-
dinavia, Arctic (Greenland, Svalbard, Canada) and
Antarctica, where it occurs on calcareous, siliceous
and other base-rich rock at high elevations (Kristins-
son et al., 2010; Brinker, 2020). World-wide distribu-
tion of Lecanora atromarginata is indicated by purple
triangle in Figure 12.
3.2.3 Lecidea tessellata Flörke.
Morphology and Anatomy: Thallus crustose, well de-
veloped, rimose-areolate, sometimes almost subef-
Figure 11. Lecidea tessellata Flörke., (a) — thallus with apothecia (the areolate thallus in the upper left belongs to Lecanora
atromarginata which was detailed above); (b) — ascus and ascospores
Figure 12. World-wide distribution of examined species (red
circles: Arthonia glebosa Tuck.; blue squares: Lecidea tessellata
Flörke; purple triangles: Lecanora atromarginata (H. Magn.)
Hertel & Rambold.)
(a) (b)
134
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
figurate, greyish white, dirty white or ash-grey, centers
of the areoles are blackish, sometimes between are -
o les there are rusty colored patches (Fig. 11a). Areo les
contiguous, flat or weakly convex, regular or irregular.
Prothallus sometimes present, black, very thin. Apothe-
cium black, sessile or almost immersed, aggregated
or dispersed, adnate or appressed, plane, weakly pru-
inose, roundish or angular, lecideine, (0.2–)0.25–0.4–
0.55(–0.7) mm (n = 40). Apothecium margin promi-
nent, black, concolorous with the disc, smooth or
fissured especially at mature ones, pruinose or not.
Epi hymenium dark brown or black, 30–100 μm, N+
red, K-. Hymenium hyaline or blue-greenish hyaline,
sometimes it has bluish tinge, 55–80 μm. Hypothe-
cium brown or brownish hyaline, 30–110 μm. Asci
8-spored, 34–80 × 8–20 μm. Ascospores hyaline,
simple, ellipsoid, almost oblong, (7–)8–8.5–9(–
10.5) × (3–)–4.5–(–5.5) μm (n = 40) and ascospore
length/width ratio (1.4–)1.66–2.12–2.57(–3) μm (n =
= 40) (Fig. 11b). Paraphyses simple, thin, unbranched,
sometimes septate, tips are slightly enlarged 3–5 μm.
Pycnidium not observed. Thallus and medulla K- or
K+ pale yellow, KI-, I-, C- or C+ yellow, Pd-.
Ecology and Distribution: Lecidea tessellata occurs
on both calcareous and siliceous rocks (Hansen,
2017) as well as on sandstone (Lendemer, 2010); on
basalt (Hansen, 2017) or on granite rocks (Knudsen
& Kramer, 2007).
L. tesselata is a bipolar species. It has been report-
ed from America (Mayrhofer et al., 2016), Iran (Mo-
ni ri & Sipman, 2011), Turkey (Halici et al., 2007),
Mongolia (Huneck et al., 1984), Armenia (Haruty-
unyan et al., 2011), Russia (Tarasova et al., 2015),
Greenland (Hansen, 2017), Morocco (Egea & Rowe,
1988), Pakistan (Aptroot & Iqbal, 2010), New Zea-
land (de Lange et al., 2018), India (Upreti et al.,
2006), Europe and the Antarctic (Øvstedal & Lewis-
Smith, 2004). World-wide distribution of Lecidea
tessellata is indicated by blue square in Figure 12.
4 Discussion
The lichens are the most dominant organisms of Antarc-
tic terrestrial vegetation and important to understand
the terrestrial biota of Antarctic which is under the
effect of global warming. Although around 500 species
of lichens were reported from Antarctica, the lichen
biodiversity of the continent is far from being fully
known; as in the last 5 years of our studies on Antarctic
lichens, we and other scientists reported significant
number of undescribed or unreported species (Halıcı
et al., 2017; 2018; 2020; 2021; Cao et al., 2018; Park et
al., 2018; Halıcı & Bartak, 2019; Sancho et al., 2020).
In our opinion, if more lichens are examined with
molecular techniques, the lichen biota of Antarctic
will be known more detailed.
These 3 species detailed here were previously re-
ported from James Ross Island (Øvstedal & Lewis-
Smith, 2001; 2004) but they were never DNA-barcod-
ed. According to our molecular studies (Figs. 1–7),
the reports of these species are correct. All the speci-
mens collected by us share the similar descriptions
provided by Øvstedal and Lewis-Smith (2001; 2004).
It is important to know the accurate checklist of
lichens in Antarctica as they can perfectly be used in
biomonitoring the climate change in Antarctica
(Sancho et al., 2019). As the molecular methods
are used in determining the lichen biodiversity of
Antarctica, we will have a more accurate checklist of
the continent.
Author contributions. MGH — collected the sam-
ples from Antarctica; MGH, MK — has same con-
trubition to other parts of study and discussed the
results and contributed to the final manuscript.
Acknowledgments. Merve Kahraman thanks Erci-
yes University for their financial support to do the
field work in James Ross Island, Antarctica and in-
frastructure and facilities of J. G. Mendel Station
provided during the Czech Antarctic expedition,
Jan-Feb 2017.
Funding. This study was financially supported by
TÜBİTAK 118Z587 coded project.
Conflicts of Interest. The authors declare no con-
flict of interest.
References
Aptroot, A., & Iqbal, S. H. (2010). Annotated checklist of the
lichens of Pakistan, with reports of new records. Herzogia,
25(2), 211–229. https://doi.org/10.13158/heia.25.2.2010.211
135
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Baldursson, S., Torfason, H., & Kristinsson, H. (2003).
Natural conditions and the conservation value of natural phe-
nomena north of the glacier Vatnajökull - a Summary. Icelandic
Ministry for the Environment, Reykjavík, Iceland.
Biazrov, L. G., & Zhurbenko, M. P. (2004). New and rare
lichen species from Khangai Upland (Mongolia). Botaniches-
kii zhurnal, 89(4), 663–667. (in Russian)
Bilichenko, I. N. (2021). Landscape diversity of the Pre-
olkhon region. IOP Conference Series: Earth and Environmen-
tal Science, 629, 012080. https://doi.org/10.1088/1755-1315
/629/1/012080
Brinker, S. R. (2020). Contributions to the Ontario flora of
lichens and allied fungi, with emphasis on the Great Lakes
Basin. Opuscula Philolichenum, 19, 58–157.
Cao, S., Zhang, F., Zheng, H., Liu, C., Peng, F., & Zhou,
Q. (2018). Coccomyxa antarctica sp. nov. from the Antarctic
lichen Usnea aurantiacoatra. PhytoKeys, 98, 107–115.
https://doi.org/10.3897/phytokeys.98.25360
Castello, M., & Nimis, P. L. (1995). A critical revision of
Antarctic lichens described by C.W. Dodge. Bibliotheca Li-
chenologica, 57, 71–92.
de Lange, P., Blanchon, D., Knight, A., Elix, J., Lucking, R.,
Frogley, K., Harris, A., Cooper, J., & Rolfe, J. R. (2018). Con-
servation status of New Zealand indigenous lichens and licheni-
colous fungi, 2018. Wellington: Department of Conservation.
DeBolt, A., & McCune, B. (1993). Lichens of Glacier Na-
tional Park, Montana. The Bryologist, 96(2), 192–204.
https://doi.org/10.2307/3243801
Egea, J. M., & Rowe, J. G. (1988). Lichenological excur-
sion in North Africa. I. Silicicolous lichens from Morocco.
Collectanea Botanica, 17(1), 27–45. https://doi.org/10.3989/
collectbot.1988.v17.153
Freebury, C. E. (2014). Lichens and lichenicolous fungi of
Grasslands National Park (Saskatchewan, Canada). Opuscula
Philolichenum, 13, 102–121.
Fryday, A. M. (2011). How should we deal with the Antarc-
tic and Subantarctic taxa published by Carroll William Dodge?
Opuscula Philolichenum, 9, 89–98.
Gardes, M., & Bruns, T. D. (1993). ITS primers with en-
hanced specificity for basidiomycetes — application for the
identification of mycorrhizae and rusts. Molecular Ecology, 2,
113–118. https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
Halıcı, M. G., & Barták, M. (2019). Sphaerellothecium
reticulatum (Zopf) Etayo, a new lichenicolous fungus for
Antarctica. Czech Polar Reports, 9(1), 13–19. https://doi.org/
10. 5817/CPR2019-1-2
Halıcı, M. G., Aksoy, A. & Kocakaya, M. (2007). Some
lichens from Gaziantep, Kahramanmaraş, Kırşehir and Yoz-
gat Provinces. Turkish Journal of Botany, 31, 161–170.
Halıcı, M. G., Bartak, M., & Güllü, M. (2018). Identifica-
tion of some lichenised fungi from James Ross Island (Antarc-
tic Peninsula) using nrITS markers. New Zealand Journal of
Botany, 56(3), 276–290. https://doi.org/10.1080/0028825X.2
018.1478861
Halıcı, M. G., Güllü, M., & Barták, M. (2017). First record
of a common endolithic lichenized fungus species Catenarina
desolata Søchting, Søgaard & Elvebakk. from James Ross Is-
land (Antarctic Peninsula). Czech Polar Reports, 7(1), 11–17.
https://doi.org/10.5817/CPR2017-1-2
Halıcı, M. G., Kahraman, M., Kistenich, S., & Timdal, E.
(2021). Toniniopsis bartakii — A new species of lichenised fun-
gus from James Ross Island (Antarctic Peninsula). Turkish
Journal of Botany, 45, 216–223. https://doi.org/10.3906/bot-
2101-24
Halıcı, M. G., Osmanoğlu, O. M., & Kahraman, M. (2020).
A new record of lichenized fungus species for Antarctica:
Peltigera castanea Goward, Goffinet & Miądl. Czech Polar Re-
ports, 10(1), 50–58. https://doi.org/10.5817/CPR2020-1-5
Hansen, E. S. (2009). A contribution to the lichen flora of
Iceland. Folia Cryptogamica Estonica, 46, 45–54.
Hansen, E. S. (2017). Contribution to the lichen flora of
North East Greenland. V. Zackenberg and Clavering Ø area.
Botanica Lithuanica, 23(1), 43–50. https://doi.org/10.1515/
botlit-2017-0004
Harutyunyan, S., Wiesmair, B., & Mayrhofer, H. (2011).
Catalogue of the lichenized fungi in Armenia. Herzogia, 24(2),
265–296. https://doi.org/10.13158/heia.24.2.2011.265
Hertel, H. (1988). 1.1 Problems in Monographing Antarc-
tic Crustose Lichens. Polarforschung, 58(2/3), 65–76.
Hofstetter, V., Miadlikowska, J., Kauff, F., & Lutzoni, F.
(2007). Phylogenetic comparison of protein-coding versus ri-
bosomal RNA-coding sequence data: A case study of the Le-
canoromycetes (Ascomycota). Molecular Phylogenetics and
Evolution, 44(1), 412–426. https://doi.org/10.1016/j.ympev.
2006.10.016
Huneck, S., Poelt, J., Ahti, T., Vitikainen, O., & Cogt, U.
(1984). Zur Verbreitung und Chemie von Flechten der Mon-
golischen Volksrepublik. Exploration into the Biological Re-
sources of Mongolia, 4, 51–62.
Knudsen, K., & Kramer, K. A. (2007). The lichen flora of
the San Jacinto Mountains: San Jacinto Wilderness Area, San
Bernardino National Forest, Riverside County, California,
USA. Evansia, 24(2), 42–47. https://doi.org/10.1639/0747-
9859-24.2.42
Kristinsson, H., Zhurbenko, M., & Hansen, E. S. (2010).
Panarctic Checklist of Lichens and Lichenicolous Fungi.
(Technical Report No. 20), CAFF International Secretariat.
https://oaarchive.arctic-council.org/bitstream/handle/11374/
1046/ACSAO-DK03_12_Lichen_Report_July_2010_Low_
res.pdf?sequence=1&isAllowed=y
Lee, J. S., Lee, H. K., Hur, J.-S., Andreev, M., & Hong, S.
G. (2008). Diversity of the lichenized fungi in King George
Island, Antarctica, revealed by phylogenetic analysis of partial
large subunit rDNA sequences. Journal of Microbiology and
Biotechnology, 18(6), 1016–1023.
Lendemer, J. C. (2010). Contributions to the lichen
flora of Pennsylvania—further new and interesting reports of
136
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
lichens and lichenicolous fungi. Evansia, 27(2), 47–64.
https://doi.org/10.1639/0747-9859-27.2.47
Matheny, P. B., Liu, Y. J., Ammirati, J. F., & Hall, B. D.
(2002). Using RPB1 sequences to improve phylogenetic infer-
ence among mushrooms (Inocybe, Agaricales). American
Jo urnal of Botany, 89(4), 688–698. https://doi.org/10.3732/
ajb. 89.4.688
Mayrhofer, H., Czeh, D., Kobald, E.-M., & Bilovitz, P.-O.
(2016). Catalogue of the lichenized and lichenicolous fungi of
Kosovo. Herzogia, 29(2), 529–554. https://doi.org/10.13158/
heia.29.2.2016.529
McCune, B. (1997). Key to the lichen genera of the Pacific
Northwest. Oregon University Press.
Moniri, M. H., & Sipman, H. J. M. (2011). Lichens from
three mountain sites in Khorasan provinces, Iran, including
four species new to Iran. Cryptogamie, Mycologie, 32(2), 145–
150. https://doi.org/10.7872/crym.v32.iss2.2011.145
Obermayer, W. (2004). Additions to the lichen flora of the
Tibetan region. Bibliotheca Lichenologica, 88, 479–526.
Øvstedal, D., & Lewis-Smith, R. (2001). Lichens of Antarctica
and South Georgia: A guide to their identification and ecology.
Cambridge University Press.
Øvstedal, D. O., & Lewis-Smith, R. I. (2004). Additions
and corrections to the lichens of Antarctica and South Geor-
gia. Cryptogamie, Mycologie, 25(4), 323–331.
Øvstedal D. O., & Lewis-Smith, R. I. (2011). Four addi-
tional lichens from the Antarctic and South Georgia, includ-
ing a new Leciophysma species. Folia Cryptogamica Estonica,
48, 65–68. Retrieved May 28, 2021, from https://ojs.utlib.ee/
index.php/FCE/article/view/13634
Park, C. H., Hong, S. G., & Elvebakk, A. (2018). Psoroma
antarcticum, a new lichen species from Antarctica and neigh-
bouring areas. Polar Biology, 41, 1083–1090. https://doi.
org/10.1007/s00300-018-2265-x
Sancho, L. G., Pintado, A., & Green, T. G. A. (2019).
An tarctic studies show lichens to be excellent biomonitors of
climate change. Diversity, 11(3), 42. https://doi.org/10.3390/
d11030042
Sancho, L., de los Ríos, A., Pintado, A., Colesie, C., Rag-
gio, J., Ascaso, C., & Green, A. (2020). Himantormia lugubris,
an Antarctic endemic on the edge of the lichen symbiosis.
Symbiosis, 82(1), 49–58. https://doi.org/10.1007/s13199-020-
00723-7
Sklenář, P., Kovář, P., Palice, Z., Stančík, D., & Soldán, Z.
(2010). Primary succession of high-altitude Andean vegeta-
tion on lahars of Volcán Cotopaxi, Ecuador. Phytocoenolo-
gia, 40(1), 15–28. https://doi.org/10.1127/0340-269X/2010/
0040-0442
Śliwa, L., & Olech, M. (2002). Notes on species of Leca-
nora (lichenized Ascomycotina) from the Antarctic. Polish
Po lar Research, 23(2), 117–133.
Tarasova, V., Sonina, A., Androsova, V., & Stepanchikova, I.
(2015). The lichens of forest rocky communities of mountain
Olovgora (Arkhangelsk Region, Northwest Russia). Folia Cryp-
togamica Estonica, 52, 51–62. https://doi.org/10.12697/fce.
2015.52.07
Upreti, D. K., Nayaka, S., & Andreev, M. P. (2006). Notes
on some species of the lichen genus Lecidea from India. My-
cotaxon, 95, 323–330.
White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). 38 —
Amplification and direct sequencing of fungal ribosomal RNA
genes for phylogenics. In M. A. Innis, D. H. Gelfand, J. J.
Sninsky, & T. J. White (Eds.), PCR Protocols: A Guide to
Methods and Applications (pp. 315–322). Academic Press.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Williston, P. (2000). Floristics and distribution patterns of
lichens and bryophytes in microbiotic crusts of British Colum-
bia’s ponderosa pine forests. In L. M. Darling (Ed.), Proceed-
ings of a Conference on the Biology and Management of
Species and Habitats at Risk, (Vol. 2, pp. 769–774), Univer-
sity of British Columbia.
Zhurbenko, M. P. (2009). Lichenicolous fungi and lichens
from the Holarctic. Part II. Opuscula Philolichenum, 7, 121–186.
Zoller, S., Scheidegger, C., & Sperisen, C. (1999). PCR
pri mers for the amplification of mitochondrial small subunit
ri bo somal DNA of lichen-forming ascomycetes. The Liche-
no lo gist, 31(5), 511–516. https://doi.org/10.1017/S0024282
999000663.
Received: 31 May 2021
Accepted: 9 July 2021
137
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
М. Г. Халісі*, М. Кахраман
Університет Ерджіес, м. Кайсері, 38039, Туреччина
* Автор для кореспонденції: mghalici@gmail.com
ДНК-штрих-кодування та морфологічні спостереження за трьома
ліхенізованими видами грибів з острова Джеймс Росс (Антарктичний півострів)
Реферат. Антарктика багатьом видається дуже віддаленим, ізольованим, загадковим місцем в кінці світу, яке не
згадують у звичайних розмовах. Однак враховуючи її ключову роль у глобальній кліматичній системі, що швидко
нагрівається, і вклад у підйом рівня моря, що досі триває, важливість цього регіону зростає з дня на день. Зростає й
інтерес у розподілі наземних організмів, що її населяють, адже використовуючи знання про біорізноманіття, можна
передбачити або відслідкувати кліматичні зміни. Ліхенізовані гриби у складі піонерних угруповань покривають
великі, вільні від льоду, області Антарктиди, і добре себе почувають у суворих умовах. Їм належить найбільша частка
біомаси та різноманіття. Ліхенізовані гриби володіють властивістю виробляти певні захисні механізми, адаптуватися
до температури й випромінювання, виживати навіть за мінімальної гідратації. З іншого боку, вони — найбільша група
організмів-домінантів антарктичної рослинності, і їх адаптації до екстремальних умов — життєві форми, розмноження,
адаптація — теж можна пояснити цими механізмами. Внаслідок того, що лишайники, організми-домінанти Антарктиди,
вивчення їх біорізноманіття дуже важливе. Попри те, що з даного регіону відомо близько 500 видів, вважається, що
різноманіття лишайників тут відоме далеко не сповна. За останні п’ять років і ми, й інші автори відзначали багато
видів, раніше невідомих у регіоні або взагалі неописаних. У цій роботі, з використанням послідовностей nrITS, mtSSU
та RPB1, розбирається три ліхенізовані види грибів: Arthonia glebosa, Tuck. , Lecanora atromarginata (H. Magn.) Hertel &
Rambold та Lecidea tessellata Flörke, звичайні на острові Джемс Росс. У зразках лишайників вивчали морфологічні та
анатомічні показники. Додатково, для визначення філогенетичного положення, наводяться послідовності nrITS
та mtSSU цих трьох видів з Антарктиди та RPB1 — для Lecidea tessellata.
Ключові слова: Антарктика, біорізноманіття, Arthonia glebosa, Lecanora atromarginata, Lecidea tessellata
138
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
Appendix 1. The sites where lichens were collected
JR 0.154 Arthonia glebosa Tuck. Antarctica, Antarctic Peninsula, James Ross Island, Vega Island, 63°50′0″
S, 57°25′0″ W, on soil, alt. 5 m, Leg. M. G. Halıcı
JR 0.252 Arthonia glebosa Tuck. Antarctica, Antarctic Peninsula, James Ross Island, Solorina Valley,
63°52′39.0″ S, 57°46′51.6″ W, alt. 2 m., on soil, Leg. M. G. Halıcı
JR 0.008 Lecanora atromarginata (H.
Magn.) Hertel & Rambold
Antarctica, Antarctic Peninsula, James Ross Island, SE Tip of Johnson
Mesa, 63°49′46.2″ S, 57°54′21.6″ W, alt. 292 m., on rock, Leg.
M. G. Halıcı
JR 0.230, JR 0.270 Lecanora atromarginata (H.
Magn.) Hertel & Rambold
Antarctica, Antarctic Peninsula, James Ross Island, Solorina Valley,
63°52′39.0″ S, 57°46′51.6″ W, alt. 2 m., on soil, Leg. M. G. Halıcı
JR 0.001 Lecidea tessellata Flörke. Antarctica, Antarctic Peninsula, James Ross Island, "Dirty Valley"
63°48′38.1″ S, 57°51′36″ W, alt. 92 m., on rock, Leg. M. G. Halıcı
JR 0.007, JR 0.109 Lecidea tessellata Flörke. Antarctica, Antarctic Peninsula, James Ross Island, "Lachmann Lake",
63°48′36″ S, 57°48′29″ W, alt. 36 m., on rock, Leg. M. G. Halıcı
JR 0.176, JR 0.260,
JR 0.269
Lecidea tessellata Flörke. Antarctica, Antarctic Peninsula, James Ross Island, Solorina Valley,
63°52′39.0″ S, 57°46′51.6″ W, alt. 2 m., on soil, Leg. M. G. Halıcı
139
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Appendix 2. mtSSU, nrITS and RPB1 sequences used in the analyses; newly produced ones are in bold
Arthonia
Species GenBank
Number (nrITS) Country Year
JR 0.154 MZ502374 Antarctica, James Ross Island 2021
JR 0.252 MZ502376 Antarctica, James Ross Island 2021
Arthonia apatetica MG773662 the Carpathians 2018
Arthonia cinnabarina f. cuspidans MN734112 Norway 2020
Arthonia cinnabarina f. cuspidans MN734111 Norway 2020
Arthonia cinnabarina f. cuspidans MN734114 Norway 2020
Arthonia cinnabarina f. cuspidans MN734113 Norway 2020
Arthonia didyma MK812348 Norway 2019
Arthonia phaeobaea MK812215 Norway 2019
Arthonia sardoa AF138813 - 1999
Arthonia susa MH887470 USA 2018
Arthonia toensbergii MH177774 Norway 2018
Arthonia toensbergii MH177773 Norway 2018
Arthonia toensbergii MH177772 Norway 2018
Opegrapha multipuncta MN687935 United Kingdom 2018
Species GenBank Number
(mtSSU) Country Year
JR 0.154 MZ502372 Antarctica, James Ross Island 2021
Arthonia punctiformis KJ850975 Japan 2014
Arthonia apatetica MG773672 Carpathians 2020
Arthonia apatetica KJ850993 Sweden 2014
Arthonia apatetica KJ850994 Sweden 2014
Arthonia apotheciorum KJ850970 Sweden 2014
Arthonia biatoricola KJ850990 Japan 2014
Arthonia caesia FJ469671 Zambia 2014
Arthonia calcarea EU704064 France 2014
Arthonia calcarea KJ850974 Sweden 2014
Arthonia calcarea EU704065 France 2014
Arthonia cinnabarina f. cuspidans MN733979 Norway 2020
Arthonia cinnabarina f. cuspidans MN733978 United Kingdom 2020
Arthonia dispersa AY350750 — 2005
Arthonia dispersa AY571383 — 2005
Arthonia eos KJ850987 Japan 2014
Arthonia graphidicola KJ850981 Sweden 2014
Arthonia graphidicola KJ850980 Japan 2014
Arthonia ilicina KJ850982 USA 2014
140
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
Continuation of Appendix 2
Species GenBank Number
(mtSSU) Country Year
Arthonia incarnata KY983976 Japan 2017
Arthonia incarnata KY983975 Japan 2017
Arthonia lapidicola KJ850997 Sweden 2014
Arthonia lobariellae MH177776 Norway 2018
Arthonia mediella KJ851015 Sweden 2014
Arthonia mediella KJ851014 Sweden 2014
Arthonia molendoi MH177777 Norway 2018
Arthonia molendoi KJ851000 Sweden 2014
Arthonia neglectula KJ850989 Sweden 2014
Arthonia parietinaria MH177778 Norway 2018
Arthonia peltigerina KJ850998 Sweden 2014
Arthonia phaeophysciae MN955428 Japan 2020
Arthonia physcidiicola KF707646 Uganda 2014
Arthonia picea MG201837 Japan 2018
Arthonia picea MG201836 Japan 2018
Arthonia pinastri MN842780 Italy 2020
Arthonia radiata EU704048 Belgium 2009
Arthonia radiata KJ850969 Sweden 2014
Arthonia radiata KJ850968 Sweden 2014
Arthonia ruana MG495137 South Korea 2017
Arthonia ruana GU327683 Germany 2009
Arthonia rubrocincta GU327684 USA 2009
Arthonia sanguinaria MG201838 Japam 2017
Arthonia sp. KJ851019 Sweden 2014
Arthonia sp. MG495138 South Korea 2017
Arthonia sp. KJ851025 Uganda 2014
Arthonia sp. EU704049 Rwanda 2009
Arthonia sp. EU704050 Florida 2009
Arthonia sp. MH177775 Norway 2018
Arthonia subfuscicola KJ850972 Sweden 2014
Arthonia subfuscicola KJ850971 Sweden 2014
Arthonia thoriana MG207687 England 2018
Arthonia thoriana MG207686 England 2018
Arthonia toensbergii MH177776 Norway 2018
Arthonia toensbergii MH177775 Norway 2018
Arthonia stereocaulina KJ850999 Sweden 2014
Reichlingia zwackhii KF707652 Sweden 2014
141
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Continuation of Appendix 2
Lecanora
Species GenBank Number
(nrITS) Country Year
JR 0.008 MZ502324 Antarctica, James Ross Island 2021
Lecanora albescens JQ993719 Belgium 2012
Lecanora albescens JQ993720 Estonia 2012
Lecanora albescens JQ993727 Poland 2012
Lecanora andrewii JQ993722 Estonia 2012
Lecanora chlorophaodes AY398704 Sweden 2003
Lecanora compallens MG076965 Netherlands 2017
Lecanora compallens KY586037 Italy 2017
Lecanora crenulata JQ993725 Poland 2012
Lecanora dispersa JQ993734 Hungary 2012
Lecanora dispersa JQ993733 — 2012
Lecanora dispersa JQ993732 — 2012
Lecanora epibryon AY541251 Austria 2004
Lecanora epibryon KP314307 Svalbard 2014
Lecanora flotowiana AF070034 — 1998
Lecanora fuscobrunnea JN873872
Lecanora fuscobrunnea GU170840
Lecanora hagenii JQ993743 Estonia 2012
Lecanora hagenii JQ993755 Slovakia 2012
Lecanora intricata KY266975 Antarctica, Victoria Land 2012
Lecanora intricata KY266891 Norway 2014
Lecanora perpruinosa AF070025 — 1998
Lecanora polytropa KP314461 Svalbard 2014
Lecanora polytropa KP314458 Svalbard 2014
Lecanora pringlei KF024740 USA 2013
Lecanora pringlei KF024739 USA 2013
Lecanora pruinosa JQ993740 Poland 2012
Lecanora pruinosa AF070018 — 1998
Lecanora reuteri AF070026 — 1998
Lecanora reuteri JQ993741 Poland 2012
Lecanora rupicola DQ451670 Spain 2007
Lecanora rupicola DQ451669 Spain 2007
Lecanora semipallida JQ993757 Hungary 2012
Lecanora semipallida JQ993743 Estonia 2012
Lecanora semipallida JQ993755 Slovakia 2012
Lecanora solaris MH512983 Russia 2019
142
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
Lecanora solaris MH512984 Russia 2019
Lecanora strobilina MG973236 Spain 2018
Lecanora strobilina MG973237 Spain 2018
Lecanora strobilinoides MG973239 Spain 2018
Lecanora strobilinoides MG973238 Spain 2018
Umbilicaria antarctica AY603128 Antarctica, Lagoon Island 2004
Species GenBank Number
(mtSSU) Country Year
JR 0.230 MZ502369 Antarctica, James Ross Island 2021
JR 0.270 MZ502367 Antarctica, James Ross Island 2021
Lecanora achariana DQ972976 — 2006
Lecanora alaskensis MN508326 USA 2020
Lecanora albella KY502430 Austria 2017
Lecanora alboflavida KY502429 United Kingdom 2017
Lecanora allophana KY502459 Albania 2017
Lecanora anakeestiicola KP224472 USA 2015
Lecanora argopholis MK693684 Ukraine 2019
Lecanora baekdudaeganensis MN879871 Korea 2020
Lecanora caesiorubella JQ782667 Australia 2012
Lecanora californica JQ782668 USA 2012
Lecanora campestris DQ787362 Sweden 2007
Lecanora caperatica MH700565 USA 2018
Lecanora caperatica MH700566 USA 2018
Lecanora carpinea MK778533 Russia 2019
Lecanora carpinea MK693683 Ukraine 2019
Lecanora cenisia KY502426 Romania 2017
Lecanora chlarotera KY502422 Czech Republic 2017
Lecanora chondroderma MN192156 China 2019
Lecanora cinereofusca KP224465 USA 2014
Lecanora darlingiae MH481360 USA 2019
Lecanora ecorticata KT962184 United Kingdom 2015
Lecanora elatinoides JQ782669 Australia 2012
Lecanora excludens MK541649 Norway 2019
Lecanora exspersa KY502452 Slovakia 2017
Lecanora farinaria KY502433 Norway 2017
Lecanora flavopallida JQ782674 Australia 2012
Lecanora formosa KT453820 China 2015
Continuation of Appendix 2
Species GenBank Number
(nrITS) Country Year
143
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Lecanora fuscobrunnea MN023037 Antarctica, Victoria Land 2019
Lecanora gangaleoides JQ782676 USA 2012
Lecanora glabrata DQ787360 Sweden 2007
Lecanora helva JQ782680 Thailand 2012
Lecanora horiza KT453821 Spain 2015
Lecanora hybocarpa DQ912273 — 2006
Lecanora hybocarpa EF105417 Spain 2007
Lecanora impudens KY502458 Czech Republic 2017
Lecanora intricata DQ787346 Austria 2007
Lecanora intumescens KY502443 Ukraine 2017
Lecanora kenyana JQ900616 Kenya 2012
Lecanora layana KR094858 USA 2015
Lecanora layana KR094857 USA 2015
Lecanora leproplaca JQ782684 Fiji 2012
Lecanora leprosa JQ782685 Thailand 2012
Lecanora leptacina MN508273 USA 2019
Lecanora leptyrodes MK778538 Russia 2019
Lecanora muralis HQ660556 Germany 2010
Lecanora novomexicana KT453824 USA 2015
Lecanora orientoafricana JQ900617 Kenya 2012
Lecanora pachyphylla MN192153 China 2019
Lecanora pacifica JQ782686 USA 2012
Lecanora paramerae EF105418 Spain 2007
Lecanora perpruinosa DQ787344 Austria 2007
Lecanora phaeocardia JQ782687 Thailand 2012
Lecanora polytropa DQ986807 — 2006
Lecanora polytropa DQ787348 Austria 2007
Lecanora pseudistera MK693685 China 2019
Lecanora pulicaris MK778542 Russia 2019
Lecanora queenslandica JQ782692 Australia 2012
Lecanora saxigena KP224461 USA 2014
Lecanora schofieldii MN508274 USA 2020
Lecanora solaris MH520111 Russia 2019
Lecanora somervellii MH520114 Russia 2019
Lecanora strobilina KJ766420 — 2006
Lecanora subimmergens JQ782696 Thailand 2012
Lecanora subimmersa JQ782697
Lecanora substerilis KY502449 Australia 2012
Continuation of Appendix 2
Species GenBank Number
(mtSSU) Country Year
144
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
Lecanora sulphurea DQ797356 Ukraine 2017
Lecanora symmicta KJ152466 Germany 2014
Lecanora symmicta KJ766421 — 2006
Lecanora thysanophora KY502440 Czech Republic 2014
Lecanora tropica JQ782699 Thailand 2012
Lecanora vainioi JQ782702 Thailand 2012
Lecanora variolascens KY502445 Austria 2017
Lecanora wilsonii JQ782703 Australia 2012
Umbilicaria antarctica AY603139 Antarctica, Lagoon Island 2004
Lecidea
Species GenBank Number
(nrITS) Country Year
JR 0.001 MZ502279 Antarctica, James Ross Island 2021
JR 0.007 MZ502322 Antarctica, James Ross Island 2021
JR 0.109 MZ502373 Antarctica, James Ross Island 2021
JR 0.176 MZ502371 Antarctica, James Ross Island 2021
JR 0.260 MZ502375 Antarctica, James Ross Island 2021
JR 0.269 MZ502377 Antarctica, James Ross Island 2021
Lecidea aglaea JN009719 Sweden 2011
Lecidea aglaea KR303636 — 2015
Lecidea albohyalina KF650950 Sweden 2014
Lecidea andersonii MK970673 Antarctica, Victoria Land 2019
Lecidea andersonii MK620084 Antarctica, Dronning Maud Land 2019
Lecidea atrobrunnea MK620265 Svalbard 2019
Lecidea atrobrunnea MK620240 Argentina 2019
Lecidea auriculata MK620246 Argentina 2019
Lecidea cancriformis MK620205 Argentina 2019
Lecidea confluens EU263921 Austria 2010
Lecidea fuscoatra HQ650707 — 2011
Lecidea fuscoatra HQ650662 — 2011
Lecidea fuscoatrina MK591838 China 2019
Lecidea kalbii MK620199 Argentina 2019
Lecidea lapicida HQ650665 — 2011
Lecidea leprarioides HQ650666 — 2011
Lecidea leucothallina MG968261
Lecidea lithophila MK620247 Norway 2019
Lecidea lithophila MK620090 Austria 2019
Continuation of Appendix 2
Species GenBank Number
(mtSSU) Country Year
145
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Lecidea medusula MK620251 Austria 2019
Lecidea medusula MK620270 Norway 2019
Lecidea nylanderi HQ650667 — 2011
Lecidea obluridata GU074423 Austria 2009
Lecidea perlatolica MK595453 China 2019
Lecidea plana EU259904 Sweden 2007
Lecidea polypycnidophora EU257682 Antarctica, Victoria Land 2007
Lecidea polypycnidophora EU257681 Antarctica, Victoria Land 2007
Lecidea polytrichina HQ650668 — 2011
Lecidea promiscens MK620212 Argentina 2019
Lecidea protabacina KY800506 USA 2017
Lecidea pullata HQ650669 — 2011
Lecidea roseotincta HQ650670 — 2011
Lecidea rubrocastanea EF495166 USA 2017
Lecidea silacea MK620077 Canada 2019
Lecidea silacea MK620629 Canada 2019
Lecidea silacea MK620249 Austria 2019
Lecidea sp. MK620097 Antarctica, Victoria Land 2019
Lecidea sphaerella KF650952 Czech Republic 2014
Lecidea sphaerella AM292702 — 2007
Lecidea swartzioidea MK620260 Austria 2019
Lecidea tessellata MH794139 China 2017
Lecidea tessellata MH794140 China 2017
Lecidea uniformis KY800508 USA 2017
Lecidea uniformis KY800507 USA 2017
Lecidea uniformis NR158514 USA 2017
Lecidea violascens KY800510 USA 2017
Rhizoplaca parilis MN764276 — 2020
Species GenBank Number
(mtSSU) Country Year
JR 0.001 MZ502302 Antarctica, James Ross Island 2021
JR 0.007 MZ502323 Antarctica, James Ross Island 2021
JR 0.109 MZ502324 Antarctica, James Ross Island 2021
JR 0.260 MZ502375 Antarctica, James Ross Island 2021
Lecidea andersonii GU074470 Antarctica, Dronning Maud Land 2010
Lecidea andersonii GU074469 Antarctica, Dronning Maud Land 2010
Lecidea atrobrunnea MK684659 Argentina 2019
Continuation of Appendix 2
Species GenBank Number
(nrITS) Country Year
146
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
Lecidea atrobrunnea MK591146 China 2019
Lecidea atrobrunnea GU074510 Greenland 2010
Lecidea atrobrunnea GU074509 Antarctica, South Shetland Islands 2010
Lecidea atrobrunnea HQ660560 Canada 2011
Lecidea auriculata HQ660561 USA 2011
Lecidea auriculata GU074500 Sweden 2010
Lecidea berengeriana HQ660562 Sweden 2011
Lecidea cancriformis GU074488 Antarctica, Ross Dependency 2010
Lecidea cancriformis GU074487 Antarctica, Ross Dependency 2010
Lecidea cancriformis MN023046 Antarctica, Victoria Land 2019
Lecidea cancriformis GU074489 Antarctica, Ross Dependency 2010
Lecidea albohyalina KF662399 Czech Republic 2014
Lecidea confluens GU074492 Austria 2010
Lecidea diapensiae HQ660564 Sweden 2011
Lecidea floridensis HQ660565 USA 2011
Lecidea fuscoatra HQ660566 Sweden 2011
Lecidea fuscoatra DQ912275 Austria 2006
Lecidea fuscoatra GU074490 Sweden 2010
Lecidea fuscoatra var. grisella HQ660567 Austria 2011
Lecidea haematites EU075529 Brazil 2008
Lecidea hoganii KR055656 USA 2015
Lecidea hypopta FJ644537 USA 2009
Lecidea laboriosa GU074503 USA 2010
Lecidea laboriosa DQ986882 — 2006
Lecidea lapicida MK684635 Argentina 2020
Lecidea lapicida HQ660570 Canada 2011
Lecidea lapicida var. lapicida GU074493 Austria 2010
Lecidea lapicida var. pantherina GU074494 Austria 2010
Lecidea leprarioides HQ660571 Norway 2011
Lecidea lithophila MK684743 Austria 2019
Lecidea medusula MK684707 Argentina 2019
Lecidea nylanderi HQ660572 USA 2011
Lecidea obluridata GU074495 Austria 2010
Lecidea plana GU074498 Sweden 2010
Lecidea plana GU074497 Sweden 2010
Lecidea plana KF683103 USA 2014
Lecidea polypycnidophora GU074474 Antarctica, Mac Robertson Island 2010
Lecidea polypycnidophora GU074473 Antarctica, Victoria Land 2010
Continuation of Appendix 2
Species GenBank Number
(mtSSU) Country Year
147
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Український антарктичний журнал, 2021, № 1, https://doi.org/10.33275/1727-7485.1.2021.671
Lecidea polytrichina HQ660573 Sweden 2011
Lecidea pullata HQ660574 Norway 2011
Lecidea roseotincta HQ660575 Norway 2011
Lecidea roseotincta KY123745 USA 2016
Lecidea sanguineoatra AY762094 Norway 2008
Lecidea silacea GU074496 Austria 2010
Lecidea silacea AY756402 Sweden 2008
Lecidea silacea DQ986878 — 2006
Lecidea sphaerella KF662400 Czech Republic 2014
Lecidea tessellata HQ660576 USA 2011
Lecidea tessellata GU074491 Austria 2010
Lecidea tessellata MK684698 Argentina 2019
Lecidea tessellata MK684668 Argentina 2019
Lecidea tessellata MK684667 Argentina 2019
Lecidea tessellata KR055661 USA 2015
Lecidea turgidula AY567788 Sweden 2005
Lecidea turgidula KJ766424 — 2014
Lecidea sphaerella AM292749 Slovakia 2007
Rhizoplaca parilis KT453859 USA 2015
Species GenBank Number
(RPB1) Country Year
JR 0.001 MZ515495 (submitted
to GenBank) Antarctica, James Ross Island 2021
JR 0.007 MZ515496 (submitted
to GenBank) Antarctica, James Ross Island 2021
JR 0.109 MZ515497 (submitted
to GenBank) Antarctica, James Ross Island 2021
Lecidea andersonii MN023060 Antarctica, Victoria Land 2019
Lecidea andersonii MK684915 Svalbard 2019
Lecidea atrobrunnea subsp. saxosa MK684918 USA 2019
Lecidea atrobrunnea subsp. stictica MK684908 Austria 2019
Lecidea auriculata MK685036 Argentina 2019
Lecidea auriculata MK685025 Argentina 2019
Lecidea auriculata MK685012 Argentina 2019
Lecidea auriculata MK684989 Argentina 2019
Lecidea cancriformis MN023058 Antarctica, Victoria Land 2019
Lecidea cancriformis MK684914 Antarctica, Victoria Land 2019
Lecidea cancriformis MN023057 Antarctica, Victoria Land 2019
Lecidea cancriformis MN023056 Antarctica, Victoria Land 2019
Lecidea cancriformis MN023059 Antarctica, Victoria Land 2019
Continuation of Appendix 2
Species GenBank Number
(mtSSU) Country Year
148
M. G. Halıcı, M. Kahraman: DNA barcoding and morphological observations of three lichenized fungal species from James Ross Island
ISSN 1727-7485. Ukrainian Antarctic Journal, 1, 2021, https://doi.org/10.33275/1727-7485.1.2021.671
Lecidea fuscoatra AY756408 Sweden 2019
Lecidea fuscoatra MK684909 Austria 2019
Lecidea fuscoatra var. grisella KF683115 Scotland 2014
Lecidea fuscoatrina MK684919 USA 2019
Lecidea kalbii MK684992 Argentina 2019
Lecidea kalbii MK684994 Argentina 2019
Lecidea laboriosa DQ986821 — 2006
Lecidea laboriosa MK684890 USA 2019
Lecidea lapicida var. lapicida MK684910 Austria 2019
Lecidea lithophila MK685037 Austria 2019
Lecidea medusula MK684946 Argentina 2019
Lecidea medusula MK684923 Argentina 2019
Lecidea plana MK684895 Sweden 2019
Lecidea plana KF683116 USA 2013
Lecidea plana MK684896 Sweden 2019
Lecidea polypycnidophora MN023061 Antarctica, Victoria Land 2019
Lecidea polypycnidophora MK684897 Antarctica, Mac Robertson Land 2019
Lecidea promiscens MK685015 Argentina 2019
Lecidea silacea DQ986820 — 2006
Lecidea silacea AY756409 — 2006
Lecidea tessellata MK684996 Argentina 2019
Lecidea tessellata MK684971 Argentina 2019
Lecidea tessellata MK684970 Argentina 2019
Lecidea tessellata MK684894 Austria 2019
Rhizoplaca parilis KU935393 USA 2016
End of Appendix 2
Species GenBank Number
(RPB1) Country Year
