Access to this full-text is provided by Pensoft Publishers.
Content available from Mycokeys
This content is subject to copyright. Terms and conditions apply.
Examination of the generic concept and species
boundaries of the genus Erioscyphella
(Lachnaceae, Helotiales, Ascomycota)
with the proposal of new species and new
combinations based on the Japanese materials
Yukito Tochihara1,2, Tsuyoshi Hosoya2
1Department of Biological Sciences, Graduate School of Science, e University of Tokyo, Hongo 7-3-1, Bun-
kyo-ku, Tokyo 113-0033, Japan 2Department of Botany, National Museum of Nature and Science, 4-1-1
Amakubo, Tsukuba, Ibaraki 305-0005, Japan
Corresponding author: Yukito Tochihara (tochi@kahaku.go.jp)
Academic editor: Cecile Gueidan|Received 17 August 2021|Accepted 10 January 2022|Published 8 February 2022
Citation: Tochihara Y, Hosoya T (2022) Examination of the generic concept and species boundaries of the genus
Erioscyphella (Lachnaceae, Helotiales, Ascomycota) with the proposal of new species and new combinations based on
the Japanese materials. MycoKeys 87: 1–52. https://doi.org/10.3897/mycokeys.87.73082
Abstract
e genus Erioscyphella Kirschst., which was morphologically confused with Lachnum, was herein exam-
ined. Based on molecular phylogenetic analyses using a combined dataset of ITS, LSU, mtSSU, and RPB2
and morphological examinations, Erioscyphella was distinguished from Lachnum and redened by longer
ascospores and the presence of apical amorphous materials and/or resinous materials equipped on hairs.
Species boundaries recognized by morphology/ecology and phylogenetic analyses were cross-checked us-
ing species delimitation analyses based on DNA barcode sequences downloaded from UNITE, resulting
in that species’ taxonomic problems being uncovered. Six new species (E. boninensis, E. insulae, E. otanii,
E. papillaris, E. paralushanensis, and E. sasibrevispora) and two new combinations (E. hainanensis and
E. sinensis) were proposed.
Keywords
ITS, morphology, phylogeny, species delimitation, species hypothesis, taxonomy, UNITE
MycoKeys 87: 1–52 (2022)
doi: 10.3897/mycokeys.87.73082
https://mycokeys.pensoft.net
Copyright Yukito Tochihara & Tsuyoshi Hosoya. This is an open access ar ticle distributed under the terms of the Creative Commons Attribution License
(CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
RESEARCH ARTICLE
A peer-reviewed open-access journal
Launched to accelerate biodiversity research
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
2
Introduction
e genus Erioscyphella Kirschst belongs to the family Lachnaceae Raitv. (Helotiales,
Ascomycota) and includes 11 species: E. abnormis (Mont.) Baral, Šandová & B. Perić
[lectotype of Erioscyphella (Haines and Dumont 1984); as ‘E. longispora (P. Karst.)
Kirschst.’ in the original description (Kirschstein 1938)], E. alba Ekanayaka & K.D.
Hyde, E. aseptata Ekanayaka & K.D. Hyde, E. bambusina (Bres.) Kirschst., E. brasil-
iensis (Mont.) Baral, Šandová & B. Perić, E. curvispora B. Perić & Baral, E. euterpes
(S.A. Cantrell & J.H. Haines) Guatim., R.W. Barreto & Crous, E. fusiformis (Ekanay-
aka & K.D. Hyde) Ekanayaka & K.D. Hyde, E. lunata (W.Y. Zhuang & Spooner) B.
Perić & Baral, E. lushanensis (W.Y. Zhuang & Zheng Wang) Guatim., R.W. Barreto &
Crous, and E. sclerotii (A.L. Sm.) Baral, Šandová & B. Perić. (Index Fungorum 2021).
Erioscyphella has been suggested as a monophyletic group by molecular phyloge-
netic analyses by Cantrell and Hanlin (1997), Hosoya et al. (2010), Perić and Baral
(2014), and Guatimosim et al. (2016). However, the morphological delimitation
of the genus is currently ill-dened. In the original description (Kirschstein 1938),
Erioscyphella was misleadingly dened based on features that are not taxonomical-
ly informative, such as liform, colored, and pigmented ascospores and lanceolate
paraphyses (Korf 1978; Perić and Baral 2014). After that, in the genus Lachnum
Retz. [type genus of Lachnaceae], species of so-called ‘long-spored Lachnum’, which
were characterized by longer ascospores and the occurrence in tropical areas, were
suggested as members of Erioscyphella (Haines and Dumont 1984) and have been
transferred into Erioscyphella based on molecular phylogenetic analyses by Perić and
Baral (2014) and Guatimosim et al. (2016). However, in fact, as morphology of
Erioscyphella, including ‘long-spored Lachnum’, is consecutive with that of the genus
Lachnum especially regarding the ascospore length and shape of ectal excipular cells
(Haines and Dumont 1984), the morphological delimitation of Erioscyphella has
not been suciently discussed. Since much more potential species are thought to be
included in Erioscyphella, its morphological concept must be discussed and updated
based on a wider size of taxon sampling.
In the present study, the authors aimed to: a) clarify the generic boundaries of
Erioscyphella using molecular and morphological/ecological data, and b) propose new
species or new combinations based on more objectively dened species boundaries. To
reach our rst goal, we used specimens from the herbarium of the National Museum
of Nature and Science (TNS) (Tsukuba, Japan) as most of them were accompanied
by culture and/or DNA extracts. In TNS, only three identied species of Erioscyphella
were recognized (E. abnormis, E. brasiliensis, and E. sclerotii); however, we presumed
that many unidentied species of Erioscyphella were housed therein. To reach our sec-
ond goal, for species recognition, we tested DNA barcoding using the internal tran-
scribed spacer region of nuclear ribosomal DNA (ITS), widely accepted as fungal DNA
barcode (Begerow et al. 2010; Schoch et al. 2012; Hosoya 2021). ITS-based species
boundaries were explored based on multiple methods, and the results were compared
to species boundaries based on morphology, ecology, and phylogenetic relationships.
Generic concept and species boundaries of the genus Erioscyphella 3
Materials and methods
Taxon sampling
In TNS, specimens labeled as Erioscyphella were initially searched, and closely related
specimens to Erioscyphella were searched based on the sequence similarities of ITS.
Selected specimens were tentatively identied based on morphology following Dennis
(1954), Haines (1980), Haines and Dumont (1984), Spooner (1987), and Perić and
Baral (2014).
Morphological observation, DNA extraction, and sequencing
Micromorphology was examined using cotton blue (CB) dissolved in lactic acid (LA)
(CB/LA; 0.5 g CB and 99.5 mL LA) as a mounting uid. To check the ascal apex io-
dine reaction, Melzer’s reagent (MLZ; 0.5 g I2, 1.5 g KI, 20 g chloral hydrate, and 20
g water) was initially used without KOH pretreatment, and Lugol’s iodine (IKI; 1 g I2
and 1 g KI, and 100 mL H2O) and MLZ with 3% KOH pretreatment were used when
necessary. World Geodetic System 84 was used for the geographic coordinates. URLs
herein shown were accessed on April 15, 2021, except for GBIF website accessed on
Feb 10, 2020.
DNA was extracted from cultivated isolates in 2% malt extract broth (MEB) using
the modied cetyltrimethylammonium bromide (CTAB) method (Hosaka and Castel-
lano 2008; Tochihara and Hosoya 2019). When isolates are not available, DNA was
extracted directly from a crushed apothecium using DNA extraction buer following
Tochihara and Hosoya (2019). e isolates from which DNA extracted were deposited
in the NITE National Biological Resource Center (NBRC) (Kisarazu, Japan), except
for isolates with restriction on transition by Japanese laws and those unavailable be-
cause of contracts with private companies.
Polymerase chain reaction (PCR) was used to amplify the following regions: ITS
(= ITS1-5.8S-ITS2), the partial large subunit nuclear ribosomal RNA gene (LSU), the
partial mitochondrial small subunit (mtSSU), and section ‘6–7’ of the second larg-
est subunit of the nuclear RNA polymerase II gene (RPB2). Primer pairs for PCR
reactions of ITS, LSU and mtSSU were ITS1F (5’–CTTGGTCATTTAGAGGAAG-
TAA–3’) (Gardes and Bruns 1993) or ITS1 (5’–TCCGTAGGTGAACCTCGGG–3’)
(White et al. 1990) and ITS4 (5’–TCCTCCGCTTATTGATATGC–3’) (White et
al. 1990), LR0R (5’–ACCCGCTGAACTTAAGC–3’) and LR5 (5’–TCCTGAGG-
GAAACTTCG–3’) (Vilgalys and Hester 1990), and mrSSU1 (5’–AGCAGTGAG-
GAATATTGGTC–3’) and mrSSU3R (5’–ATGTGGCACGTCTATAGCCC–3’)
(Zoller et al. 1999) respectively. e PCR program consisted of an initial denaturation
at 95 °C for 3 min, followed by 30 cycles of 94 °C for 35 s, 51 °C for 30 s, and 72 °C
for 1 min, and a nal extension at 72 °C for 10 min. When appropriate PCR products
were not obtained, a modied PCR program was applied rst, and then alternative
primer pairs were tested. For RPB2, an alternative forward primer fRPB2-5F (5’–GAY-
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
4
GAYMGWGATCAYTTYGG–3’) (Liu et al. 1999) or RPB2-P6Fa (5’–TGGGGRYTK
GTBTGYCCKGCHGA–3’) (Hansen et al. 2005) and a reverse primer bRPB2-7.1R2
(5’–CCCATNGCYTGYTTVCCCATDGC–3’) (modied from bRPB2-7.1R) (Ma-
theny 2005; Matheny et al. 2007; Gelardi et al. 2015) were used.
Sequencing was conducted on an ABI PRISM 3500xL Genetic Analyzer (Applied
Biosystems; ermo Fisher Scientic, Waltham, MA, USA) with a BigDye Terminator
3.1 Cycle Sequencing Kit (Applied Biosystems). e obtained sequences were assem-
bled using ATGC 7 (Genetyx, Tokyo, Japan). Assembled sequences were deposited
in the International Nucleotide Sequence Database Collaboration (INSDC) via the
DNA Data Bank of Japan (DDBJ), and acquired INSDC accession numbers. Assem-
bled ITS sequences were also deposited in the UNITE database (https://unite.ut.ee/)
via the PlutoF workbench (https://plutof.ut.ee/) (Abarenkov et al. 2010) and acquired
UNITE accession numbers.
Phylogenetic analyses
e specimens obtained from TNS were included in the phylogenetic analyses as
candidate members of Erioscyphella (‘‡’ in Table 1). From other genera of the family
Lachnaceae, four species of Lachnum, two species of Albotricha, Brunnipila, Capitotri-
cha, Dasyscyphella, Incrucipulum, and Lachnellula, and one species of Neodasyscypha
and Proliferodiscus were used (‘†’ in Table 1). Among the eight genera, seven of them
(except Proliferodiscus) included type species. ree species of Helotiales were selected
as outgroups following Tochihara and Hosoya (2019) (Table 1).
A concatenated dataset of ITS, LSU, mtSSU, and RPB2 was used in the phy-
logenetic analyses. Each region was aligned separately using MAFFT 7 (Katoh and
Standley 2013). e Q-INS-i option was used for ITS, LSU, and mtSSU to accom-
modate the secondary structures of RNA, and the G-INS-1 option was used for RPB2
to assume global alignment using the entire region. e aligned sequences were edited
manually using BioEdit 7.0.5.2 (Hall 1999).
Phylogenetic conicts among gene partitions were checked before the phylogenet-
ic analyses using the concatenated matrix. Maximum likelihood (ML) trees with 1,000
bootstrap replications (Felsenstein 1985) using the ITS, LSU, mtSSU, and RPB2 data-
sets separately were constructed using MEGA X (Kumar et al. 2018) with the GTR+G
model; branches with bootstrap values > 70% were compared among trees. For mtSSU
and RPB2, specimens containing missing data were excluded from the analyses.
e concatenated dataset was analyzed using ML, maximum parsimony (MP),
and Bayesian inference (BI). For the ML and BI analyses, substitution models were
estimated for each partition (ITS, LSU, mtSSU, and each codon position of RPB2)
based on Akaike’s information criterion (AIC) (Akaike 1974) using Modeltest-NG
0.1.6 (Darriba et al. 2019).
ML tree search (Felsenstein 1984) and bootstrapping (Felsenstein 1985; Lemoine
et al. 2018) was performed using RAxML-NG 0.9.0 (Kozlov et al. 2019) with 1,000
bootstrap replications under the substitution model SYM+I+G4 for ITS, TIM1+I+G4
Generic concept and species boundaries of the genus Erioscyphella 5
Table 1. Taxa analyzed in the phylogenetic analyses.
Specimen no.
(TNS-F-)
Taxon|Collection site Collected
Date
Host plants and parts Strain no.
(NBRC¶)
UNITE/GenBank acc ession no.#
ITS LSU mtSSU RPB2
†16740 Albotricha acutipila (P. Karst.) Raitv. J, Nagano, Ueda, Sugadaira Montane
Research Center
2006-06-17 culm of unidentied
bamboo
104380 AB481234 LC438571 LC431751 AB481354
†16497 Albotricha albotestacea (Desm.) Raitv. J, Nagano, Ueda, Sugadaira Montane
Research Center
2005-05-18 culm of Miscanthus
sinensis
101346 AB481235 LC424943 LC431747 AB481340
†16635 Brunnipila fuscescens (Pers.) Baral J, Gunma, Higashi-Agatsuma 2006-04-27 leaf of unidentied tree 104365 AB481255 LC424945 LC431750 AB481348
†16690 Brunnipila pseudocannabina (Raitv.) Tochihara,
Sasagawa & Hosoya
JAPAN, Akita, Kosaka 2006-05-26 stem of unidentied
herb
104374 AB481272 LC533520 LC533522 LC533521
†65670 Capitotricha bicolor (Bull.) Baral SWITZERLAND, Filisur 2016-06-06 twig of Prunus spinosa (FC-6101) LC424834 LC424942 LC533244 LC425011
†65752 Capitotricha rubi (Bres.) Baral SWITZERLAND, Saicourt 2016-06-04 twig of Rubus idaeus (FC-6075) LC438560 LC438573 LC533243 LC440395
†16439 Dasyscyphella longistipitata Hosoya JAPAN, Kanagawa, Yamakita 2005-04-17 cupule of Fagus crenata 101335 AB481239 LC424947 LC533228 AB481331
†16527 Dasyscyphella montana Raitv. J, Nagano, Ueda, Sugadaira Montane
Research Center
2005-05-21 wood of unidenti-
ed tree
102336 AB481242 LC438577 LC533241 AB481336
‡16556 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Oita, Kokonoe 2005-05 wood of unidenti-
ed tree
114449 UDB0779051 LC533153 LC533257 LC533198
‡16582 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Kanagawa, Yamakita 2005-07-02 wood of unidenti-
ed tree
104360 AB481249 LC533176 LC533233 LC533199
‡16606 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Kanagawa, Yamakita 2005-07-03 wood of unidenti-
ed tree
114450 UDB0779053 LC533154 LC533258 LC533200
‡16609 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Kanagawa, Yamakita 2005-07-03 wood of Cephalotaxus
harringtonia
101350 ††AB705234 LC533175 LC533256 LC533184
‡16639 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Ibaraki, Tsukuba Botanical Garden 2006-05-01 twig of unidentied
tree
114451 UDB0779054 LC533155 LC533259 LC533201
‡25579 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Tokyo, Hongo 2009-05-25 twig of unidentied
tree
(FC-1887) UDB0779057 LC533146 LC533250 LC533191
‡32163 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Kanagawa, Odawara 2010-05-14 twig of unidentied
tree
114456 UDB0779062 LC533158 LC533260 LC533203
‡38452 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Gunma, Naganohara 2013-06-27 wood of unidenti-
ed tree
114463 ††UDB0779069 LC533171 LC533262 LC533210
‡46416 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
T, Taipei 2012-04-15 wood of unidenti-
ed tree
(FC-2906) UDB0779067 LC533132 LC533277 LC549671
‡46841 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Gifu, Gujo 2012-05-28 wood of unidenti-
ed tree
114462 UDB0779086 LC533170 LC533279 LC533209
‡61773 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Kanagawa, Yokohama 2015-04-01 twig of unidentied
tree
114464 ††UDB0779074 LC533137 LC533264 LC533211
‡61931 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Kanagawa, Zushi 2015-04-16 wood of unidenti-
ed tree
114466 UDB0779072 LC533139 LC533266 LC533213
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
6
Specimen no.
(TNS-F-)
Taxon|Collection site Collected
Date
Host plants and parts Strain no.
(NBRC¶)
UNITE/GenBank acc ession no.#
ITS LSU mtSSU RPB2
‡80478 Erioscyphella abnormis (Mont.) Baral, Šandová
& B. Perić
J, Shizuoka, Oyama 2017-06-26 twig of unidentied
tree
113934 LC424837 LC424949 LC533283 LC425009
†26520 Erioscyphella boninensis Tochihara & Hosoya J, Tokyo, Chichijima Island 2009-06-28 trunk of unidenti-
ed tree
114447 UDB0779049 LC533151 LC533254 LC533196
‡46419 Erioscyphella brasiliensis (Mont.) Baral, Šandová
& B. Perić
T, Taipei 2012-04-20 wood of unidenti-
ed tree
(FC-2910) UDB0779068 LC533133 LC533278 LC549672
‡35049 Erioscyphella hainanensis (W.Y. Zhuang and
Zheng Wang) Hosoya and Tochihara (←Lach-
num hainanense W.Y. Zhuang and Zheng Wang)
J, Niigata, Minamiuonuma 2010-05-14 leaf of Quercus glauca 114457 UDB0779064 LC533168 LC533274 LC533205
‡35056 Erioscyphella hainanensis (W.Y. Zhuang and
Zheng Wang) Hosoya and Tochihara (←Lach-
num hainanense W.Y. Zhuang and Zheng Wang)
J, Niigata, Minamiuonuma 2010-05-14 leaf of Quercus serrata 114458 UDB0779065 LC533169 LC533275 LC533206
‡61775 Erioscyphella hainanensis (W.Y. Zhuang and
Zheng Wang) Hosoya and Tochihara (←Lach-
num hainanense W.Y. Zhuang and Zheng Wang)
J, Kanagawa, Hiratsuka 2015-04-12 leaf of Quercus myr-
sinifolia
114465 UDB0779071 LC533138 LC533265 LC533212
‡61941 Erioscyphella hainanensis (W.Y. Zhuang and
Zheng Wang) Hosoya and Tochihara (←Lach-
num hainanense W.Y. Zhuang and Zheng Wang)
J, Kanagawa, Kamakura 2015-04-24 leaf of Quercus glauca 112569 UDB0779073 LC533140 LC533280 LC533214
‡65722 Erioscyphella hainanensis (W.Y. Zhuang and
Zheng Wang) Hosoya and Tochihara (←Lach-
num hainanense W.Y. Zhuang and Zheng Wang)
J, Gunma, Midori 2016-04-24 leaf of Quercus serrata
subsp. Mongolicoides
114469 UDB0779076 LC533142 LC533281 LC533215
‡80356 Erioscyphella hainanensis (W.Y. Zhuang and
Zheng Wang) Hosoya and Tochihara (←Lach-
num hainanense W.Y. Zhuang and Zheng Wang)
J, Kanagawa, Hiratsuka 2017-05-18 leaf of Quercus glauca 114470 UDB0779077 LC533172 LC533282 LC533186
‡80371 Erioscyphella hainanensis (W.Y. Zhuang and
Zheng Wang) Hosoya and Tochihara (←Lach-
num hainanense W.Y. Zhuang and Zheng Wang)
J, Kanagawa, Hiratsuka 2017-05-18 leaf of Castanopsis
sieboldii
114472 UDB0779078 LC533135 LC533246 LC533188
‡26500 Erioscyphella insulae Tochihara & Hosoya J, Tokyo, Hahajima Island 2009-06-24 wood of unidenti-
ed tree
114445 UDB0779060 LC533149 LC533252 LC533194
‡39720 Erioscyphella insulae Tochihara & Hosoya J, Okinawa, Iriomote Island 2011-06-12 bark of unidenti-
ed tree
114459 UDB0779063 LC533177 LC533261 LC533207
‡61920 Erioscyphella paralushanensis Tochihara & Hosoya J, Shizuoka, Atami 2015-06-08 culm of Pleioblastus
argenteostriatus
114468 ††UDB0779075 LC533141 LC533267 LC533220
†81472 Erioscyphella otanii Tochihara J, Hokkaido, Horonobe, Teshio Experi-
mental Forest, Hokkaido University
2018-07-11 leaf of Sasa senanensis 114476 UDB0779085 LC533179 LC533286 ||LC533226
‡81272 Erioscyphella papillaris Tochihara J, Gunma, Minakami 2017-07-16 leaf of unidentied
bamboo
113937 UDB0779081 LC533161 LC533285 LC533204
‡80399 Erioscyphella sasibrevispora Tochihara & Hosoya J, Gunma, Higashi-Agatsuma 2017-06-06 sheath of Sasa veitchii ―UDB0779082/
LC669470
LC533173 LC533268 LC533216
Generic concept and species boundaries of the genus Erioscyphella 7
Specimen no.
(TNS-F-)
Taxon|Collection site Collected
Date
Host plants and parts Strain no.
(NBRC¶)
UNITE/GenBank acc ession no.#
ITS LSU mtSSU RPB2
‡81401 Erioscyphella sasibrevispora Tochihara & Hosoya J, Hokkaido, Tomakomai 2018-06-16 culm of Sasa nipponica 114475 UDB0779084/
LC669472
LC533174 LC533269 LC533217
‡26492 Erioscyphella sclerotii (A.L. Sm.) Baral, Šandová
& B. Perić
J, Tokyo, Hahajima Island 2009-06-24 wood of unidenti-
ed tree
114448 UDB0779050/
LC669438
LC533152 LC533255 LC533197
‡38480 Erioscyphella sclerotii (A.L. Sm.) Baral, Šandová
& B. Perić
T, Wulai 2013-07-12 twig of unidentied
tree
(FC-5208) ††UDB0779070 LC533134 LC533263 LC549673
‡16838 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang)
Sasagawa, Tochihara & Hosoya (←Lachnum ma-
pirianum var. sinense Z.H. Yu and W.Y. Zhuang)
J, Ibaraki, Tsukuba Botanical Garden 2007-06-15 leaf of unidentied
broad-leaved tree
104389 AB481280 LC533164 LC533235 AB481364
‡80354 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang)
Sasagawa, Tochihara & Hosoya (←Lachnum ma-
pirianum var. sinense Z.H. Yu and W.Y. Zhuang)
J, Kanagawa, Manazuru 2017-05 leaf of Castanopsis
sieboldi
114471 UDB0779083/
LC669471
LC533143 LC533245 LC533187
‡16841 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang)
Sasagawa, Tochihara & Hosoya (←Lachnum ma-
pirianum var. sinense Z.H. Yu and W.Y. Zhuang)
J, Ibaraki, Mt. Tsukuba 2007-06-23 leaf of unidentied
broad-leaved tree
104390 AB481281 LC533157 LC533236 LC533218
‡32161 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang)
Sasagawa, Tochihara & Hosoya (←Lachnum ma-
pirianum var. sinense Z.H. Yu and W.Y. Zhuang)
J, Kanagawa, Odawara 2010-05-14 leaf of Quercus myr-
sinifolia
113715 UDB0779061/
LC669449
LC533167 LC533273 LC533219
‡16837 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang)
Sasagawa, Tochihara & Hosoya (←Lachnum ma-
pirianum var. sinense Z.H. Yu and W.Y. Zhuang)
J, Ibaraki, Tsukuba Botanical Garden 2007-06-15 leaf of unidentied
broad-leaved tree
114452 UDB0779055/
LC669443
LC533156 LC533272 LC533202
†81520 Incrucipulum ciliare (Schrad.) Baral J, Shizuoka, Shizuoka 2018-08-18 leaf of Quercus mon-
golica subsp. crispula
113941 LC438566 LC438583 LC533284 LC438596
†17632 Incrucipulum longispineum Sasagawa & Hosoya J, Miyagi, Sendai 2006-07-29 leaf of Lyonia ovalifolia 102347 AB481256 LC438579 LC533234 AB481362
†81248 Lachnellula calyciformis (Batsch) Dharne J, Hokkaido, Engaru 2017-07-12 twig of Abies sachali-
nensis
113935 LC438561 LC438574 LC533247 LC438590
†16529 Lachnellula suecica (de Bary ex Fuckel) Nannf. J, Nagano, Ueda, Sugadaira Montane
Research Center
2005-05-21 twig of Larix kaempferi 101348 AB481248 LC424944 LC533231 AB481341
†16494 Lachnum asiaticum (Y. Otani) Raitv. J, Nagano, Ueda, Sugadaira Montane
Research Center
2005-05-18 culm of unidentied
bamboo
101341 AB481251 LC533162 LC533229 AB481334
‡17249 Lachnum mapirianum (Pat. & Gaillard) M.P.
Sharma
M, Gerik 2004-09-07 leaf of unidentied tree ―UDB0779088/
LC669476
LC533182 ―LC533223
‡17245 Lachnum mapirianum (Pat. & Gaillard) M.P.
Sharma
M, Gerik 2004-09-07 leaf of unidentied tree ―UDB0779087/
LC669475
LC533181 ―LC533222
‡16442 Lachnum novoguineense var. yunnanicum W.Y.
Zhuang
J, Nagano, Ueda, Sugadaira Montane
Research Center
2005-05-18 culm of unidentied
bamboo
102339 AB481270 LC533163 LC533232 AB481342
‡16642 Lachnum novoguineense var. yunnanicum W.Y.
Zhuang
J, Ibaraki, Mt. Tsukuba 2006-05-02 culm of unidentied
bamboo
104368 AB481271 LC533165 LC533227 §§LC533225
‡11197 Lachnum palmae sensu lato (←Lachnum palmae
(Kanouse) Spooner)
J, Shizuoka, Shimoda 2004-07-26 leaf of Livistona chinen-
sis var. subglobosa
106495 UDB0779047/
LC669435
LC533166 LC533248 LC533185
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
8
Specimen no.
(TNS-F-)
Taxon|Collection site Collected
Date
Host plants and parts Strain no.
(NBRC¶)
UNITE/GenBank acc ession no.#
ITS LSU mtSSU RPB2
‡13500 Lachnum palmae sensu lato (←Lachnum palmae
(Kanouse) Spooner)
J, Kagoshima, Yakushima Island 2005-10-19 leaf of Livistona chinen-
sis var. subglobosa
114441 ††LC425039/
UDB779046
LC429382 LC533240 ‡‡LC431718
‡17567 Lachnum palmae sensu lato (←Lachnum palmae
(Kanouse) Spooner)
New Z 2005-05-28 leaf of unidentied
palm
―UDB0779089/
LC669477
LC533183 LC533288 ―
‡24588 Lachnum palmae sensu lato (←Lachnum palmae
(Kanouse) Spooner)
J, Kagoshima, Amami-Oshima 2009-02-24 leaf of Livistona chinen-
sis var. subglobosa
114442 UDB0779052/
LC669440
LC533144 LC533270 LC533190
‡24600 Lachnum palmae sensu lato (←Lachnum palmae
(Kanouse) Spooner)
J, Kagoshima, Amami-Oshima 2009-02-25 leaf of Livistona chinen-
sis var. subglobosa
114443 UDB0779056/
LC669444
LC533145 LC533249 ||LC533224
‡26161 Lachnum palmae sensu lato (←Lachnum palmae
(Kanouse) Spooner)
J, Tokyo, Chichijima Island 2009-06-27 leaf of Livistona
boninensis
114446 UDB0779048/
LC669436
LC533150 LC533253 LC533195
‡26172 Lachnum palmae sensu lato (←Lachnum palmae
(Kanouse) Spooner)
J, Tokyo, Kita-Iwojima Island 2009-06-17 leaf of Livistona chinen-
sis var. subglobosa
(FC-1935) UDB0779058/
LC669446
LC533147 LC533251 LC533192
‡26185 Lachnum palmae sensu lato (←Lachnum palmae
(Kanouse) Spooner)
J, Tokyo, Kita-Iwojima Island 2009-06-18 leaf of Livistona chinen-
sis var. subglobosa
114444 UDB0779059/
LC669447
LC533148 LC533271 LC533193
‡39729 Lachnum palmae sensu lato (←Lachnum palmae
(Kanouse) Spooner)
J, Okinawa, Iriomote Island 2011-06-13 leaf of Livistona chinen-
sis var. subglobosa
114460 UDB0779066/
LC669454
LC533178 LC533276 LC533208
†16501 Lachnum pudibundum (Quél.) J. Schröt. J, Nagano, Ueda, Sugadaira Montane
Research Center
2005-05-18 wood of unidenti-
ed tree
102335 AB481259 LC533160 LC533230 AB481335
†81229 Lachnum rachidicola J.G. Han, Raitv. & H.D.
Shin
J, Hokkaido, Tomakomai, Tomakomai
Experimental Forest
2017-08-09 petiole of Juglans sp. 114473 UDB0779079/
LC669467
LC533136 ―LC533189
†16583 Lachnum virgineum (Batsch) P. Karst. J, Kanagawa, Yamakita 2005-07-02 wood of unidenti-
ed tree
104358 AB481268 AB926119 LC431748 AB481343
†65625 Neodasyscypha cerina (Pers.) Spooner S, Saicourt 2016-06-08 twig of Crataegus sp. (FC-6068) LC424836 LC424948 LC533242 LC425013
†17436 Proliferodiscus alboviridis (Sacc.) Spooner J, Ibaraki, Tsukuba Botanical Garden 2006-07-08 wood of unidenti-
ed tree
108594 LC438558 LC533159 LC533239 LC425014
§17909 Hyaloscypha spiralis (Velen.) J.G. Han, Hosoya
& H.D. Shin
J, Kumamoto, Kikuchi 2005-10-10 wood of unidenti-
ed tree
108585 ††LC438602 LC438604 LC533237 LC438606
§16472 Hymenoscyphus varicosporoides Tubaki J, Ibaraki, Kasumigaura 2005-05-05 wood of unidenti-
ed tree
104355 AB926052 LC424952 LC431746 AB481329
§18014 Urceolella carestiana (Rabenh.) Dennis J, Iwate, Hanamaki 2006-05-23 stem of Parathelypteris
nipponica
108588 ††LC438603 LC438605 LC533238 LC438607
† Lachnaceae except for Erioscyphella and its potential species tentatively identied based on morphology
‡ Erioscyphella or its potential species tentatively identied based on morphology
§ Outgroup
| Original taxon name labeled on the specimen is shown enclosed by “(←)” and is only shown when it is dierent from a name determined in this study.
¶ Cultures not donated in NBRC is beginning with “FC-”, local sux in TNS. ‘―’ represents no culture exist and DNA was extracted from apothecia.
# UNITE accession no. is beginning with ‘UDB’. GenBank accession no. is beginning with ‘AB’ or ‘LC’.
†† Primer pair ITS1 and ITS4 was used. In ITS sequences without notes (††), primer pair ITS1F and ITS4 was used.
‡‡ Primer pair fRPB2-5F and RPB2-P7R was used.
§§ Primer pair RPB2-P6Fa and bRPB2-7.1R2 was used.
|| Primer pair RPB2-P6Fa and RPB2-P7R was used. In RPB2 sequences without any notes (‡‡, §§, ||), primer pair RPB2-P6F and RPB2-P7R was used.
Generic concept and species boundaries of the genus Erioscyphella 9
Figure 1. ML best-scored phylogenetic tree based on the concatenated dataset of ITS, LSU, mtSSU, and RPB2 constructed using RAxML-NG. MLBP/MPBP/
BPP are represented on branches in this order. In MLBP/MPBP < 50% or BPP < 0.95, a hyphen appears. No evaluation values are shown on branches when MLBP
and MPBP < 50% and BPP < 0.95. e branch of a clade TNS-F-17245 + 17249 to its most recent common ancestor is only one-third of the intended length due
to space limitation.
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
10
for LSU, TPM1uf+I+G4 for mtSSU and RPB2 third codon position, GTR+I+G4
for RPB2 rst codon position, and TPM3uf+I+G4 for RPB2 second codon position.
Sequence matrix containing missing data typically yield multiple trees residing on a
phylogenetic terrace (Sanderson et al. 2011; Biczok et al. 2018). erefore, we checked
if the best-scored-tree did not lie on a terrace using the Python tool called ‘terraphy’
implemented in RAxML-NG 0.9.0.
MP analysis was conducted using PAUP* 4.0a 167 (Swoord 2002). All substitu-
tions were treated as unordered and of equal weights. All gaps were treated as missing
data. A heuristic parsimony search was carried out with 1,000 replicates of random
step addition, with a tree bisection reconnection (TBR) branch swapping algorithm,
Multrees option on, Steepest descent modication option on, and branch collapse
option set to MinBrlen. Bootstrap values (MPBP; Felsenstein 1985) were estimated
from 1,000 replicates of heuristic searches, with random taxon addition, TBR branch
swapping, and Multrees options o.
BI analysis was based on MrBayes 3.2.7a (Ronquist et al. 2012) under the substitu-
tion model SYM+I+G4 for ITS, GTR+I+G4 for LSU and RPB2 rst codon positions,
HKY+I+G4 for mtSSU and RPB2 third codon positions, and F81+I for RPB2 second
codon position. Two separate Metropolis-Coupled Markov Chains of Monte Carlo
(MCMCMC) ran simultaneously starting from random trees for 20 million genera-
tions, and trees were sampled every 500 generations. e average standard deviation of
split frequencies (ASDSF) and eective sample size (ESS) were checked using Tracer
1.7.1 (Rambaut 2018a) as an indication of convergence. Using post-burn-in trees, a
50% majority rule consensus tree was generated, and Bayesian posterior probabilities
(BPP) were calculated to evaluate node supports. Trees were visualized using FigTree
1.4.4 (Rambaut 2018b) based on the ML, MP, and BI analyses respectively. Branches
with MLBP and MPBP > 90% and BPP > 0.95 were regarded as strongly supported.
ITS-based species delimitation analyses (Fig. 2)
To maximize the number of ITS sequences, we used the UNITE Species Hypoth-
eses (SH) system provided by the UNITE database (Kõljalg et al. 2013; Nilsson et
al. 2015; GBIF 2018; Kõljalg et al. 2020). In the UNITE SH system, all fungal ITS
sequences are periodically divided into species-level clusters (species hypothesis; SH)
at optional sequence-distance thresholds (0%–3% in 0.5% steps), each of which is as-
signed to a unique UNITE SH code represented by a digital objective identier (DOI)
accessible from internet (Kõljalg et al. 2016, 2020; Nilsson et al. 2015).
Based on the UNITE SH system, we collected ITS sequences of Erioscyphella in
the following process: a) selectivity of closely related sequences: for every ITS sequence
newly obtained from TNS specimens (= query sequences, 49 sequences), UNITE SH
code at the 3% threshold value were searched in the UNITE database to gather se-
quences in wider scope, and all sequences within the UNITE SH code were download-
ed. b) selectivity based on taxon names: using the UNITE search page, ITS sequences
named Erioscyphella were searched, because only closely related sequences to query
sequences are ltered under the a) criterion. Sequences with synonyms of Eriosyphella
species were also searched, because the UNITE lookup function is not supported by
any backbone taxonomies to integrate synonyms. Sequences satisfying criterion a) or
Generic concept and species boundaries of the genus Erioscyphella 11
b) were downloaded for ITS-based species recognition. e obtained ITS sequences
were clustered into SHs based on an OTU clustering method, hierarchical cluster-
ing method, and two coalescent-based methods. For all ITS sequences, ITS1, 5.8S,
and ITS2 regions were extracted using ITSx (Nilsson et al. 2010) to construct an
accurate ITS dataset, because the inclusion of segments of adjacent regions (such as a
small subunit of 18S rRNA or LSU) may decrease the accuracy of the calculation of
ITS distances (Nilsson et al. 2010). OTU clustering was executed using VSEARCH
v2.17.2 (Rognes et al. 2016) implemented in the Qiime 2 microbiome analysis plat-
form (Bolyen et al. 2019).
e concatenated dataset of extracted ITS1, 5.8S, and ITS2 was incorporated
into VSEARCH, and OTU clustering at 97% and 98.5% similarity thresholds were
performed using the ‘-cluster_fast’ option. Hierarchical clustering based on pairwise
sequence distances was executed using the Assemble Species by Automatic Partition-
ing (ASAP) method (Puillandre et al. 2021). e datasets of extracted ITS1, 5.8S, and
ITS2 were separately aligned using MAFFT 7 under the Q-INS-i option and edited
using trimAl v1.2 (Capella-Gutiérrez et al. 2009) under the ‘-gappyout’ option. e
concatenated dataset of the three aligned partitions was analyzed using ASAP web
(https://bioinfo.mnhn.fr/abi/public/asap/asapweb.html). Jukes-Cantor (JC69) was
selected as a substitution model for computing pairwise distances of sequences. As
phylogeny-based species delimitation methods, the generalized mixed Yule-coalescent
(GMYC) model (Pons et al. 2006; Fujisawa and Barraclough 2013) and the Poisson
Tree Processes (PTP) model (Zhang et al. 2013) were used. In both models, specia-
Figure 2. Diagrammatic representation showing the species delimitation analyses using ITS sequences.
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
12
tion (species-level dierentiation) and coalescence (population-level dierentiation)
are identied based on the length of phylogenetic trees. GMYC requires the use of
phylogenetic trees following the molecular clock model (= ultrametric tree) because
it detects transition points from speciation to coalescence focusing on the time axis,
while PTP does not require ultrametric tree as it focuses on the number of nucleo-
tide substitutions. Ultrametric trees were estimated using BEAST v2.6.3. (Bouckaert
et al. 2019). e ITS dataset was divided into ITS1, 5.8S, and ITS2, and suitable
substitution models GTR+G for ITS1 and JC+G for 5.8S and ITS2 estimated using
Modeltest-NG 0.1.6. were applied. To estimate branch length, a Yule model and a
relaxed clock with a log-normal distribution were selected. MCMC chains were run
for 1.5×108 generations and sampled every 1,000 generations. After each run, conver-
gence was checked using Tracer 1.7.1, and the rst 10% were discarded as burn-in. A
consensus tree was generated using TreeAnnotator v1.10.4 in BEAST package, from
150,000 generated trees except for the rst 10% regarded as burn-in. A single-thresh-
old species delimitation analysis based on GMYC was conducted using the R package
‘splits’ (Fujisawa and Barraclough 2013).
For the species delimitation analyses using PTP, an unrooted ML phylogenetic tree
was constructed using RAxML-NG 0.9.0. e analysis used ITS1, 5.8S, and ITS2 par-
titions, aligned as previously described, under the substitution models TIM2+G4 for
ITS1, TPM2+I+G4 for 5.8S, and GTR+I+G4 for ITS2, estimated using Modeltest-
NG 0.1.6. based on the AIC. e species delimitation analysis was executed using the
generated ML best-scored tree with the bPTP web server (https://species.h-its.org/).
e MCMC run was set to 500,000 generations and burn-in rate was set to 0.1. e
convergence of MCMC runs was visually checked. In ML and Bayesian results, a result
generating fewer SHs was adopted to avoid excessive species division.
SHs generated in the species delimitation analyses and the UNITE SHs at 3% and
1.5% threshold values were compared with one another.
Species recognition
In the present study, we initially recognized species boundaries based on the two criteria:
1. Forming a monophyletic group in the phylogenetic analyses based on multi-
gene data (Fig. 1).
2. Members can be distinguished based on morphological and/or common eco-
logical features (such as host plants).
Species boundaries recognized by 1.and 2. were cross-checked based on the results
of ITS-based species delimitation analyses. When the species boundaries are supported
by the majority (= more than four methods) of the seven species delimitation methods
(UNITE SH at 3% threshold, UNITE SH at 1.5% threshold, VSEARCH 97% simi-
larity, VSEARCH 98.5% similarity, ASAP, GMYC, and PTP) (Fig. 3), we regard the
species as reasonable and carry out taxonomic treatments if necessary.
Generic concept and species boundaries of the genus Erioscyphella 13
Figure 3. Species delimitation analyses using ITS sequences of Erioscyphella and its potential members. Clusters based on UNITE SH at 3% and 1.5% threshold
values at UNITE v8.2, VSEARCH at 97% and 98.5% threshold values, ASAP, GMYC, and PTP are displayed. Schematic phylogenetic relationships are shown
using the ultrametric tree constructed for the GMYC analysis. e taxon names shown on the tree branches follow the results of the present study.
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
14
Results
Taxon sampling from TNS specimens
Forty-nine specimens in TNS were identied as candidates of Erioscyphella and mor-
phologically identied as E. abnormis, E. brasiliensis, E. sclerotii, Lachnum hainanense
W.Y. Zhuang & Zheng Wang, L. mapirianum (Pat. & Gaillard) M.P. Sharma, Lach-
num mapirianum var. sinense Z.H. Yu, W.Y. Zhuang, Lachnum novoguineense var. yun-
nanicum W.Y. Zhuang, and L. palmae (Kanouse) Spooner (Table 1), together with
six species of Erioscyphella described here as new ([E. boninensis, E. insulae, E. otanii,
E. papillaris, E. paralushanensis, and E. sasibrevispora], Table 1).
Phylogenetic analyses
e molecular phylogenetic analyses were based on 70 specimens selected from TNS
(Table 1). e concatenated sequence matrix was composed of 2488 bp (sites 1–332
for ITS, 333–1108 for LSU, 1109–1828 for mtSSU, and 1829–2488 for RPB2). In
the matrix, the following parts were treated as missing data: TNS-F-17245, 17249,
and 81229 for mtSSU, and TNS-F-17567 for RPB2. e matrix was registered in
TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S28477).
Among the four ML trees based on each region, no conicts were found in clades
with support > 70% (Suppl. material 1: Fig. S1). erefore, we considered these four
regions to be combinable, and phylogenetic analyses were based on the concatenated
sequence matrix. In the ML analysis, the best-scored tree generated did not reside
on the phylogenetic terrace. In the MP analysis, 766 nucleotide substitution sites
were detected, 601 of which were parsimony-informative. A total of 182,630 equally
parsimonious trees were generated with tree length = 2,985 steps, consistency index
(CI)=0.38, retention index (RI) = 0.73, and rescaled consistency index (RC) = 0.28.
In the BI analysis, when two runs reached 20 million generations and the rst 10,000
trees (25%) of generated trees were excluded, ASDSF was observed to fall below 0.004
and ESS of all parameters was over 200. e rst 10,000 trees were discarded as burn-
in. A 50% majority rule consensus tree was constructed and BPP was calculated based
on the remaining 30,000 trees.
As no topological contradictions occurred among the ML best-scored tree, MP
50% majority-rule consensus tree, and BI 50% majority-rule consensus tree, only ML
tree was illustrated, and MLBS, MPBS, and BPP were plotted on its branches (Fig. 1).
Based on the phylogenetic analyses, 49 candidates of Erioscyphella formed a strongly
supported clade (= Clade A, MLBP = 100%/MPBP = 100%/BPP = 1.00), apart from the
clade of Lachnum sensu stricto (= L. asiaticum (Y. Otani) Raitv., L. pudibundum (Quél.)
J. Schröt., L. rachidicola J.G. Han, Raitv. & H.D. Shin, and L. virgineum (Batsch) P.
Karst.) [type of Lachnum]) (Fig. 1). Clade A and Proliferodiscus alboviridis formed a rela-
tively strongly supported clade (Clade B, MLBP = 78%, MPBP = 82%, BPP = 1.00).
Within Clade A, each morphologically identied species and variety formed strong-
ly supported monophyletic groups of their own (Fig. 1), and ve strongly supported
Generic concept and species boundaries of the genus Erioscyphella 15
subclades were recognized (Clade I–V, Fig. 1). Lachnum mapirianum (TNS-F-17545,
17249) and E. insulae (TNS-F-26500, 39720) did not belong to any subclade. Clade
I was composed of E. boninensis, E. paralushanensis, L. hainanense, and L. mapirianum
var. sinense. Within Clade I, only E. paralushanensis occurred on bamboo sheaths, while
others occurred on fallen leaves of broad-leaved trees. Clade II was composed only of
L. palmae, which occurred on the palm petioles. Clade III was composed of E. otanii
and E. papillaris occurring on bamboo leaves. Clade IV was composed of L. novogu-
ineense var. yunnanicum, and E. sasibrevispora, occurring on bamboo sheaths. Clade V
was composed of E. abnormis, E. brasiliensis, and E. sclerotii, occurring on wood.
Morphological characters within Clade A
Members of Clade A had totally and densely granulate, hyaline to brown, thin-walled
hairs, fusiform to long liform ascospores, ectal excipulum composed of textura pris-
matica to textura angularis, asci lacking croziers at the bases, and smooth walled ectal
excipulum cells. Exceptionally, E. sasibrevispora, L. hainanense (Hosoya et al. 2013),
and L. novoguineense var. yunnanicum W.Y. Zhuang had croziers and E. boninensis had
granulated ectal excipulum.
Moreover, hairs of Clade A lacked crystals, but were equipped with apical amor-
phous materials and/or resinous materials. In the present study, “crystals” refers to am-
ber colored materials that positioned near the hair apices and were regular-shaped (e.g.
tetrahedral materials, masses of needle-like materials, or cross-shaped materials), de-
scribed by Raitviir (2002), Suková (2005) or Tochihara and Hosoya (2019). “Resinous
materials” refers to colored, refractive, irregular-shaped materials attached on any parts
of hairs, described by Spooner (1987). Crystals and resinous materials are easily de-
tatched from hairs and broken into fragments in the squash mount. “Apical amorphous
materials” is termed uniquely in this study, and refers to hyaline to brown, refractive,
irregular-shaped materials positioned outside the hair apices. ey are usually small
and inconspicuous cap-like shaped, and conspicuously globular in some species. Apical
amorphous materials do not grow to big masses and are not easily detached from hairs
in the squash mount.
In Clade A, members except for E. boninensis, E. sasibrevispora and L. novoguineense
var. yunnanicum had apical amorphous materials, and E. boninensis, E. paralushanensis,
and L. palmae complex also had resinous materials (see gures of described species and
Suppl. material 1: Fig. S2).
ITS-based species delimitation analyses
In UNITE v8.3, 87 ITS sequences were clustered into 23 SHs at 3% and 26 SHs at
1.5% threshold values (Table 2, Fig. 3). e UNITE SH code for each SH is presented
in Table 2. In OTU clustering using VSEARCH, 87 ITS sequences were clustered into
25 SHs at 97% similarity and 28 SHs at 98.5% similarity (Table 2, Fig. 3). VSEARCH
SH codes (allocated in this study uniquely; VSH97_1 to VSH97_25, VSH985_1 to
VSH985_28) are shown in Table 2.
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
16
Table 2. ITS sequences analyzed by the species delimitation analyses.
ITS sequence
GenBank/UNITE
accession no.
TNS-F
speci-
men
no.
Reference (initial
appearance)
Taxon name
(ultimately
allocated in
this study)
UNITE taxon
name
INSDC taxon
name
Country Host plants and
parts
UNITE SH code
(DOI) at 3%
threshold
UNITE SH code
(DOI) at 1.5%
threshold
VSEARCH
SH at 97%
similarity
VSEARCH
SH at 98.5%
similarity
AB267634 Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Ehime twig of Citrus junos SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
AB267636 (dupli-
cate; AB267635)
Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Ehime twig of Citrus junos SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
AB267641 (dupli-
cate; AB267639,
AB267640)
Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Tokushima twig of Citrus junos SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
AB267642 Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Tokushima twig of Citrus junos SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
JF937578 Zhao and Zhuang
(2011)
E. abnormis Lachnum abnorme Lachnum abnorme CHINA (unspecied) SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
JN033395 Han et al. (2014) E. abnormis Lachnum abnorme Lachnum abnorme KOREA Wood SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
UDB0779067/
LC669455
46416 this study E. abnormis - - TAIWAN, Taipei wood of unidenti-
ed tree
SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
UDB0779074/
LC669462
61773 this study E. abnormis - - JAPAN, Kanagawa,
Yokohama
twig of unidenti-
ed tree
SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
MK584950 Ekanayaka et al.
(2019)
E. abnormis E. abnormis E. abnormis CHINA, Yunnan (unspecied) SH1155612.08FU †SH1522994.08FU VSH97_1 VSH985_2
AB267637 Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Nara Twig SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
AB267638 Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Shizuoka Twig SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
AB481249 16582 Hosoya et al. (2010) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Kanagawa,
Yamakita
wood of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
AB705234 16609 Zhao et al. (2012) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Kanagawa,
Yamakita
wood of Cephalo-
taxus harringtonia
SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
LC424837 80478 this study E. abnormis - - JAPAN, Shizuoka,
Oyama
twig of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
MG712307 unpublished E. abnor mis Lachnum abnorme Lachnum abnorme CHINA (unspecied) SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
MK282241 unpublished E. abnormis Lachnum abnorme Lachnum abnorme (unspecied) (unspecied) SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
MK584957 Ekanayaka et al.
(2019)
E. abnormis E. aseptata E. aseptata THAILAND,
Chiang Rai
(unspecied) SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
MN082536 unpublished E. abnormis Lachnum abnorme Lachnum abnorme (unspecied) (unspecied) SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
MT995055 unpublished E. abnormis
(misregis-
tered?)
Chapsa patens Chapsa patens (unspecied) (unspecied) SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
MW007918 unpublished E. abnormis
(misregis-
tered?)
Chapsa patens Chapsa patens (unspecied) (unspecied) SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
Generic concept and species boundaries of the genus Erioscyphella 17
ITS sequence
GenBank/UNITE
accession no.
TNS-F
speci-
men
no.
Reference (initial
appearance)
Taxon name
(ultimately
allocated in
this study)
UNITE taxon
name
INSDC taxon
name
Country Host plants and
parts
UNITE SH code
(DOI) at 3%
threshold
UNITE SH code
(DOI) at 1.5%
threshold
VSEARCH
SH at 97%
similarity
VSEARCH
SH at 98.5%
similarity
UDB0779051/
LC669439
16556 this study E. abnormis - - JAPAN, Oita,
Kokonoe
wood of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
UDB0779053/
LC669441
16606 this study E. abnormis - - JAPAN, Kanagawa,
Yamakita
wood of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779054/
LC669442
16639 this study E. abnormis - - JAPAN, Ibaraki,
Tsukuba Botanical
Garden
twig of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779057/
LC669445
25579 this study E. abnormis - - JAPAN, Tokyo,
Hongo
twig of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779062/
LC669450
32163 this study E. abnormis - - JAPAN, Kanagawa,
Odawara
twig of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779069/
LC669457
38452 this study E. abnormis - - JAPAN, Gunma,
Naganohara
twig of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
UDB0779072/
LC669460
61931 this study E. abnormis - - JAPAN, Kanagawa,
Zushi
twig of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779086/
LC669474
46841 this study E. abnormis - - JAPAN, Gifu, Gujo twig of unidenti-
ed tree
SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
AB481250 16617 Hosoya et al. (2010) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Kanagawa,
Yamakita
twig of unidenti-
ed tree
‡SH1155612.08FU ‡SH1523013.08FU VSH97_1 VSH985_1
UDB0779055/
LC669443
16837 this study E. sinensis
(←Lachnum
mapirianum
var. sinense)
- - JAPAN, Ibaraki,
Tsukuba Botanical
Garden
leaf of unidentied
broad-leaved tree
SH1155682.08FU SH1523107.08FU VSH97_4 VSH985_5
AB481280 16838 Hosoya et al. (2010) E. sinensis
(←Lachnum
mapirianum
var. sinense)
Lachnum sp. Lachnum (Lach-
num sp. FC-2355)
JAPAN, Ibaraki,
Tsukuba Botanical
Garden
leaf of unidentied
broad-leaved tree
SH1155682.08FU SH1523107.08FU VSH97_4 VSH985_5
AB481281 16841 Hosoya et al. (2010) E. sinensis
(←Lachnum
mapirianum
var. sinense)
Lachnum sp. Lachnum (Lach-
num sp. FC-2358)
JAPAN, Ibaraki,
Mt. Tsukuba
leaf of unidentied
broad-leaved tree
SH1155682.08FU SH1523107.08FU VSH97_4 VSH985_5
UDB0779061/
LC669449
32161 this study E. sinensis
(←Lachnum
mapirianum
var. sinense)
- - JAPAN, Kanagawa,
Odawara
leaf of Quercus
myrsinifolia
SH1155682.08FU SH1523107.08FU VSH97_4 VSH985_5
UDB0779083/
LC669471
80354 this study E. sinensis
(←Lachnum
mapirianum
var. sinense)
- - JAPAN, Kanagawa,
Manazuru
leaf of Castanopsis
sieboldii
†SH1155682.08FU †SH1523107.08FU VSH97_4 VSH985_5
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
18
ITS sequence
GenBank/UNITE
accession no.
TNS-F
speci-
men
no.
Reference (initial
appearance)
Taxon name
(ultimately
allocated in
this study)
UNITE taxon
name
INSDC taxon
name
Country Host plants and
parts
UNITE SH code
(DOI) at 3%
threshold
UNITE SH code
(DOI) at 1.5%
threshold
VSEARCH
SH at 97%
similarity
VSEARCH
SH at 98.5%
similarity
UDB023346 unpublished E. curvispora E. curvispora - MONTENEGRO,
Žijevo Mountains
needle of Pinus
heldreichii
SH1155703.08FU SH1523136.08FU VSH97_12 VSH985_14
MH190414 Perić and Baral
(2014)
E. curvispora E. curvispora E. curvispora MONTENEGRO,
Žijevo Mountains
needle of Pinus
heldreichii
†SH1155703.08FU †SH1523136.08FU VSH97_12 VSH985_14
JF937580 Zhao and Zhuang
(2011)
E. brasiliensis Lachnum brasil-
iense
Lachnum brasil-
iense
CHINA (unspecied) SH1155705.08FU SH1523142.08FU VSH97_6 VSH985_7
MK584953 Ekanayaka et al.
(2019)
E. brasiliensis E. brasiliensis E. brasiliensis (unspecied) (unspecied) SH1155705.08FU SH1523142.08FU VSH97_6 VSH985_7
MK584967 Ekanayaka et al.
(2019)
E. brasiliensis E. brasiliensis E. brasiliensis THAILAND,
Chiang Rai
(unspecied) SH1155705.08FU SH1523142.08FU VSH97_6 VSH985_7
UDB0779068/
LC669456
46419 this study E. brasiliensis - - TAIWAN, Taipei wood of unidenti-
ed tree
SH1155705.08FU SH1523142.08FU VSH97_6 VSH985_7
JF937579 Zhao and Zhuang
(2011)
E. brasiliensis Lachnum brasil-
iense
Lachnum brasil-
iense
CHINA (unspecied) †SH1155705.08FU †SH1523142.08FU VSH97_6 VSH985_7
KX501132 Tello and Baral
(2016)
E. lunata E. lunata E. lunata SPAIN, Andalucía needle of Pinus
nigra subsp. nigra
†SH1155760.08FU †SH1523257.08FU VSH97_18 VSH985_19
JX984680 unpublished E. hai-
nanensis
(←Lachnum
hainanense)
Hyaloscyphaceae Fungi (uncultured
fungus)
KOREA, Seoul (Total suspended
particulate matter
(TSP) in urban air
during non-Asian
dust days)
SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
UDB0779064/
LC669452
35049 this study E. hai-
nanensis
(←Lachnum
hainanense)
- - JAPAN, Niigata,
Minamiuonuma
leaf of Quercus
glauca
SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
UDB0779065/
LC669453
35056 this study E. hai-
nanensis
(←Lachnum
hainanense)
- - JAPAN, Niigata,
Minamiuonuma
leaf of Quercus
serrata
SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
UDB0779073/
LC669461
61941 this study E. hai-
nanensis
(←Lachnum
hainanense)
- - JAPAN, Kanagawa,
Kamakura
leaf of Quercus
glauca
SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
UDB0779076/
LC669464
65722 this study E. hai-
nanensis
(←Lachnum
hainanense)
- - JAPAN, Gunma,
Midori
leaf of Quercus
serrata subsp.
mongolicoides
SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
Generic concept and species boundaries of the genus Erioscyphella 19
ITS sequence
GenBank/UNITE
accession no.
TNS-F
speci-
men
no.
Reference (initial
appearance)
Taxon name
(ultimately
allocated in
this study)
UNITE taxon
name
INSDC taxon
name
Country Host plants and
parts
UNITE SH code
(DOI) at 3%
threshold
UNITE SH code
(DOI) at 1.5%
threshold
VSEARCH
SH at 97%
similarity
VSEARCH
SH at 98.5%
similarity
MK282242 unpublished E. hai-
nanensis
(←Lachnum
hainanense)
Lachnum sp. Lachnum albidu-
lum
KOREA (unspecied) SH1155844.08FU †SH1523423.08FU VSH97_3 VSH985_4
UDB0779077/
LC669465
80356 this study E. hai-
nanensis
(←Lachnum
hainanense)
- - JAPAN, Kanagawa,
Hiratsuka
leaf of Quercus
glauca
SH1155844.08FU SH3597461.08FU VSH97_3 VSH985_9
UDB0779078/
LC669466
80371 this study E. hai-
nanensis
(←Lachnum
hainanense)
- - JAPAN, Kanagawa,
Hiratsuka
leaf of Castanopsis
sieboldii
SH1155844.08FU SH3597461.08FU VSH97_3 VSH985_9
UDB0779071/
LC669459
61775 this study E. hai-
nanensis
(←Lachnum
hainanense)
- - JAPAN, Kanagawa,
Hiratsuka
leaf of Quercus
myrsinifolia
†SH1155844.08FU †SH3597461.08FU VSH97_3 VSH985_9
UDB0779050/
LC669438
26492 this study E. sclerotii - - JAPAN, Tokyo,
Hahajima Island
wood of unidenti-
ed tree
SH1155848.08FU SH1523429.08FU VSH97_5 VSH985_6
JF937584 Zhao and Zhuang
(2011)
E. sclerotii Lachnum sclerotii Lachnum sclerotii CHINA (unspecied) SH1155848.08FU SH1523429.08FU VSH97_5 VSH985_6
MK584951 Ekanayaka et al.
(2019)
E. sclerotii E. sclerotii E. sclerotii THAILAND,
Chiang Rai
(unspecied) SH1155848.08FU SH1523429.08FU VSH97_5 VSH985_6
UDB0779070/
LC669458
38480 this study E. sclerotii - - TAIWAN, Wulai twig of unidenti-
ed tree
SH1155848.08FU SH1523429.08FU VSH97_5 VSH985_6
MK584969 Ekanayaka et al.
(2019)
E. sclerotii E. sclerotii E. sclerotii THAILAND,
Chiang Rai
(unspecied) †SH1155848.08FU †SH1523429.08FU VSH97_5 VSH985_6
AB481271 16642 Hosoya et al. (2010) Lachnum no-
voguineense
var. yunnani-
cum
Lachnum sp. Lachnum sp.
(Lachnum sp.
FC-2211)
JAPAN, Ibaraki,
Mt. Tsukuba
culm of unidenti-
ed bamboo
SH1236904.08FU SH1648536.08FU VSH97_10 VSH985_12
AB481270 16442 Hosoya et al. (2010) Lachnum no-
voguineense
var. yunnani-
cum
Lachnum sp. Lachnum sp.
(Lachnum sp.
FC-2117)
JAPAN, Nagano,
Ueda, Sugadaira
Montane Research
Center
culm of unidenti-
ed bamboo
†SH1236904.08FU †SH1648536.08FU VSH97_10 VSH985_12
MK584965 Ekanayaka et al.
(2019)
E. alba E. alba E. alba THAILAND,
Chiang Mai
(unspecied) †SH2596405.08FU †SH2712425.08FU VSH97_22 VSH985_25
AB267647 Miyoshi et al. (2007) Lachnum
palmae sensu
lato
Lachnum palmae Lachnum palmae JAPAN, Oita leaf of Livistona
chinensis
SH1149764.08FU SH1515235.08FU VSH97_7 VSH985_8
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
20
ITS sequence
GenBank/UNITE
accession no.
TNS-F
speci-
men
no.
Reference (initial
appearance)
Taxon name
(ultimately
allocated in
this study)
UNITE taxon
name
INSDC taxon
name
Country Host plants and
parts
UNITE SH code
(DOI) at 3%
threshold
UNITE SH code
(DOI) at 1.5%
threshold
VSEARCH
SH at 97%
similarity
VSEARCH
SH at 98.5%
similarity
LC425039
(duplicate;
UDB0779046)
13500 Johnston et al.
(2019)
Lachnum
palmae sensu
lato
Lachnum palmae Lachnum palmae JAPAN, Kagoshi-
ma, Yakushima
Island
leaf of Livistona
chinensis var. sub-
globosa
SH1149764.08FU SH1515235.08FU VSH97_7 VSH985_8
UDB0779066/
LC669454
39729 this study Lachnum
palmae sensu
lato
- - JAPAN, Okinawa,
Iriomote Island
leaf of Livistona
chinensis var. sub-
globosa
SH1149764.08FU SH1515235.08FU VSH97_7 VSH985_8
MG283320 Zhao et al. (2018) Lachnum
palmae sensu
lato
Lachnum palmae Lachnum palmae CHINA, Linzhou root of Przewalskia
tangutica (endo-
phyte)
†SH1149764.08FU †SH1515235.08FU VSH97_7 VSH985_8
UDB0779089/
LC669477
17567 this study Lachnum
palmae sensu
lato
- - NEW ZEALAND leaf of unidentied
palm
SH2594271.08FU SH2709065.08FU VSH97_15 VSH985_16
MH921862 unpublished Lachnum
palmae sensu
lato
Lachnum palmae Lachnum palmae NEW ZEALAND unidentied part of
Rhopalostylis sapida
†SH2594271.08FU †SH2709065.08FU VSH97_15 VSH985_16
UDB0779052/
LC669440
24588 this study Lachnum
palmae sensu
lato
- - JAPAN, Ka-
goshima, Amami-
Oshima
leaf of Livistona
chinensis var. sub-
globosa
SH3569651.08FU SH3597456.08FU VSH97_9 VSH985_17
UDB0779047/
LC669435
11197 this study Lachnum
palmae sensu
lato
- - JAPAN, Shizuoka,
Shimoda
leaf of Livistona
chinensis var. sub-
globosa
†SH3569651.08FU †SH3597456.08FU VSH97_9 VSH985_17
UDB0779048/
LC669436
26161 this study Lachnum
palmae sensu
lato
- - JAPAN, Tokyo,
Chichijima Island
leaf of Livistona
boninensis
SH3569651.08FU SH3597457.08FU VSH97_9 VSH985_11
UDB0779058/
LC669446
26172 this study Lachnum
palmae sensu
lato
- - JAPAN, Tokyo,
Kita-Iwojima Island
leaf of Livistona
chinensis var. sub-
globosa
SH3569651.08FU SH3597457.08FU VSH97_16 VSH985_11
UDB0779059/
LC669447
26185 this study Lachnum
palmae sensu
lato
- - JAPAN, Tokyo,
Kita-Iwojima Island
leaf of Livistona
chinensis var. sub-
globosa
SH3569651.08FU †SH3597457.08FU VSH97_16 VSH985_11
UDB0779056/
LC669444
24600 this study Lachnum
palmae sensu
lato
- - JAPAN, Ka-
goshima, Amami-
Oshima
leaf of Livistona
chinensis var. sub-
globosa
†SH3569653.08FU †SH3597459.08FU VSH97_25 VSH985_28
U58640 Cantrell and Hanlin
(1997)
E. euterpes Lachnum euterpes Lachnum euterpes PUERTO RICO (unspecied) †SH1236906.08FU †SH1648538.08FU VSH97_21 VSH985_24
KT384413 Ekanayaka et al.
(2019)
E. fusiformis Lachnum fusiforme Lachnum fusiforme THAILAND dead stems ‡SH1236907.08FU ‡SH1648539.08FU VSH97_11 VSH985_13
MK584948 Ekanayaka et al.
(2019)
E. fusiformis Lachnum fusiforme Lachnum fusiforme CHINA dead stems SH1236907.08FU SH1648539.08FU VSH97_11 VSH985_13
Generic concept and species boundaries of the genus Erioscyphella 21
ITS sequence
GenBank/UNITE
accession no.
TNS-F
speci-
men
no.
Reference (initial
appearance)
Taxon name
(ultimately
allocated in
this study)
UNITE taxon
name
INSDC taxon
name
Country Host plants and
parts
UNITE SH code
(DOI) at 3%
threshold
UNITE SH code
(DOI) at 1.5%
threshold
VSEARCH
SH at 97%
similarity
VSEARCH
SH at 98.5%
similarity
UDB0779049/
LC669437
26520 this study E. boninensis - - JAPAN, Tokyo,
Hahajima Island
wood of unidenti-
ed tree
†SH3569652.08FU †SH3597458.08FU VSH97_20 VSH985_21
UDB0779060/
LC669448
26500 this study E. insulae - - JAPAN, Tokyo,
Hahajima Island
wood of unidenti-
ed tree
SH3569654.08FU SH3597460.08FU VSH97_14 VSH985_15
UDB0779063/
LC669451
39720 this study E. insulae - - JAPAN, Okinawa,
Iriomote Island
bark of unidenti-
ed tree
†SH3569654.08FU †SH3597460.08FU VSH97_14 VSH985_15
UDB0779075/
LC669463
61920 this study E. paralusha-
nensis
- - JAPAN, Shizuoka,
Atami
culm of Pleioblastus
argenteostriatus
†SH3569655.08FU †SH3597462.08FU VSH97_19 VSH985_20
AF505515 E. lushanensis Lachnum lusha-
nense
Lachnum lusha-
nense
(unspecied) (unspecied) †SH1155706.08FU †SH1523143.08FU VSH97_8 VSH985_10
JF937582 Zhao and Zhuang
(2011)
E. lushanensis Lachnum lusha-
nense
Lachnum lusha-
nense
CHINA (unspecied) SH1155706.08FU SH1523143.08FU VSH97_8 VSH985_10
MG434782 unpublished E. lushanensis Erioscyphella sp. E. lushanensis INDIA, Tangmarg root tips of Pinus
wallichiana (ecto-
mycorrhiza)
(unassigned) (unassigned) VSH97_8 VSH985_10
UDB0779081/
LC669469
81272 this study E. papillaris - - JAPAN, Gunma,
Minakami
leaf of unidentied
bamboo
†SH3569656.08FU †SH3597463.08FU VSH97_23 VSH985_26
UDB0779084/
LC669472
81401 this study E. sasibrevis-
pora
- - JAPAN, Hokkaido,
Tomakomai
culm of Sasa nip-
ponica
SH3569657.08FU SH3597464.08FU VSH97_13 VSH985_23
UDB0779082/
LC669470
80399 this study E. sasibrevis-
pora
- - JAPAN, Gunma,
Higashi-Agatsuma
sheath of Sasa
veitchii
†SH3569657.08FU †SH3597464.08FU VSH97_13 VSH985_22
UDB0779085/
LC669473
81472 this study E. otanii - - JAPAN, Hokkaido,
Horonobe, Teshio
Experimental
Forest, Hokkaido
University
leaf of Sasa sena-
nensis
†SH3569658.08FU †SH3597465.08FU VSH97_24 VSH985_27
UDB0779087/
LC669475
17245 this study Lachnum
mapirianum
- - MALAYSIA, Gerik leaf of unidenti-
ed tree
†SH3569659.08FU †SH3597466.08FU VSH97_17 VSH985_18
UDB0779088/
LC669476
17249 this study Lachnum
mapirianum
- - MALAYSIA, Gerik leaf of unidenti-
ed tree
SH3569659.08FU SH3597466.08FU VSH97_17 VSH985_18
† Representative sequence of each SH
‡ Reference sequence of each SH
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
22
e extracted and aligned ITS sequences were composed of three partitions, ITS1
(162 bp), 5.8S (157 bp), and ITS2 (142 bp). e concatenated ITS sequence matrix was
registered in TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S28473).
In the ASAP analysis, the concatenated dataset of these partitions (461 bp) was input,
and 87 ITS sequences were clustered into 18 SHs with the lowest asap-score, reect-
ing better partitioning (Suppl. material 1: Fig. S3). In the GMYC analysis, 29 SHs
were delimited (Suppl. material 1: Fig. S4). e ultrametric tree constructed for the
GMYC analysis is available in TreeBase (http://purl.org/phylo/treebase/phylows/study/
TB2:S28473). For the PTP analyses, an ML best-scored tree was constructed (Suppl.
material 1: Fig. S5). PTP analyses delimited 23 SHs in the Bayesian support and 26
SHs in the ML support (Suppl. material 1 Fig. S6), and the former was adopted.
Comparing the number of SHs generated by dierent clustering methods and
applied thresholds, 18 SHs by ASAP, and 23 SHs by UNITE SH at 3% threshold
represented the lowest SH numbers (Fig. 3; Table 2). e ASAP results were too rough
to delimit the boundaries of E. abnormis, E. boninensis, E. brasiliensis, E. curvispora,
and E. sclerotii. SH-classication recognized by UNITE SH at 3% threshold mostly
corresponded to taxon names originally assigned to sequences.
Comparing the results of seven species delimitation methods (UNITE SH at 3%
threshold, UNITE SH at 1.5% threshold, VSEARCH 97% similarity, VSEARCH 98.5%
similarity, ASAP, GMYC, and PTP), sequences labeled as E. alba, E. brasiliensis, E. curvis-
pora, E. euterpes, E. fusiformis, E. lunata, E. sclerotii, L. mapirianum, L. mapirianum var. sin-
ense, L. novoguineense var. yunnanica, and six new species candidates were distinguished as
separate clusters by more than four delimitation methods (Fig. 3). ese species clusters did
not contradict with morphological/ecological and phylogenetic relationships (Fig. 1). Seven
sequences labeled as L. hainanense were clustered into one SH by four species delimitation
analyses, and part of the SHs included a sequence labeled as Lachnum albidulum (Fig. 3).
Erioscyphella abnormis, E. aseptate, and L. palmae did not form separate clusters
supported by majority of four species delimitation analyses (Fig. 3). Sequences labeled
as E. abnormis were clustered into one to four SHs, and some SHs included sequences
labeled as Chapsa patens (Nyl.) Frisch, E. aseptata, E. brasiliensis, and E. sclerotii (Fig. 3).
Twelve sequences labeled as L. palmae were clustered into four to six SHs (Fig. 3).
Discussion
Generic delimitation and generic concept of Erioscyphella
We accepted Clade A as a monophyletic unit for Erioscyphella which is supported by
morphology. Although Clade B comprised Clade A together with P. alboviridis, Clade
B should not be regarded as a genus delimitation of Erioscyphella, because Proliferodis-
cus diers from members of Clade A in having apothecia proliferating from the mar-
gins continuously and thick-walled and coarsely warted hairs (Haines and Dumont
1983; Spooner 1987). All members of Clade A are distinguishable from the other
Generic concept and species boundaries of the genus Erioscyphella 23
lachnacenous genera. In contrast to Erioscyphella, Albotricha and Dasyscyphella are dis-
tinguished by hair apices with no granulation (Hosoya et al. 2010), Brunnipila, Capi-
totricha, and Incrucipulum by hair-crystals (Baral and Krieglsteiner 1985; Tochihara
and Hosoya 2019), and Lachnellula by ectal excipulum composed of textura globose
to textura oblita (Dharne 1965). Typical members of Clade A can be easily segregated
from Neodasyscypha, because the characteristic features of Neodasyscypha, such as dark-
brown hairs, ectal-excipulum structure, and ellipsoid to fusoid ascospores < 10 µm
long (Spooner 1987), are rare in Clade A. Among members of Clade A and Lachnum
sensu stricto, the shape and length of ascospores were continuous (Fig. 4), as indicated
by Haines and Dumont (1984). However, ascospores longer than 15–20 µm were re-
stricted to Clade A (Fig. 4). Moreover, most members of Clade A have hairs with apical
amorphous materials, which are not seen in Lachnum sensu stricto. Members of Clade
A usually also have hairs not swelling at the apices and distantly septate, as Perić and
Baral (2014) pointed out for three tropical members, while members of Lachnum have
swelling apices. e combination of such characters allows us to dierentiate typical
members of Erioscyphella from Lachnum.
In summary, Erioscyphella is still dicult to dene solely based on morphology
because of multiple exceptional characters continuous to other genera, but its typical
members could be recognizable mainly by the hair structures and ascospore length.
Based on members of Clade A, Erioscyphella is tentatively described as follows: apothe-
cia occurring on dead hardwood leaves, rotten wood, bamboo sheaths, bamboo leaves
or palm leaves; asci mostly arising from simple septa, but occasionally from croziers;
ascospores fusiform to long needle-shaped, aseptate to multi-septate; paraphyses li-
form to narrowly lanceolate, shortly exceeding the asci, but rarely lanceolate and long
exceeding the asci; hairs straight or irregularly curved, usually not swollen at the apices,
thin-walled, hyaline, but sometimes brown, totally and densely granulated, usually
distantly septate, without needle-like or three-dimensional shaped crystals but mostly
equipped with hyaline to brown apical amorphous materials, and/or resinous materials
at any part of hairs; walls of ectal excipulum cells smooth but granulate in one species.
Perić and Baral (2014) pointed out that “yellow hymenium derived from carotenoid” is
one of the common characters of Erioscyphella. is feature was not discussed in this study
because some specimens were not observed when fresh; the hymenium color is variable (usu-
ally white hymenium becomes yellow) between fresh and dried states in lachnaceous species.
Host selectivity of Erioscyphella
In Erioscyphella, the tendency of selectivity of species to host plants or parts occurs
across the genus. Each subclade within Erioscyphella (Clade I–V) generally shared
tendencies toward host selectivity as follows: Clade I on leaves of broad-leaved trees,
except for E. paralushanensis occurring on bamboo sheaths, Clade II on palm leaves,
Clade III on bamboo leaves, Clade IV on bamboo sheaths, and Clade V on rotten
wood (Fig. 1). e results showed that selectivity to host plants, and parts of Erios-
cyphella, was acquired as apomorphic characters during speciation.
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
24
Is Erioscyphella limited to ‘tropical’ zones?
Erioscyphella (long-spored Lachnum) has long been known as the tropical genus in
Lachnaceae (Dennis 1954; Spooner 1987; Guatimosim et al. 2016). Most long-spored
species were described from tropical areas of Latin America (Dennis 1954) and tropi-
cal to temperate areas of Australasia (Spooner 1987). However, the new species or
new combinations proposed in this study were reported from Japan in subtropical
areas (E. boninensis and E. insulae), temperate area (E. hainanensis, E. palalushanen-
sis, and E. sinensis) and cool-temperate to subarctic areas (E. otanii, E. papillaris, and
E. sasibrevispora), showing that Erioscyphella is not limited to tropical zones, but is also
distributed in temperate to subarctic zones in the northern hemisphere.
Figure 4. Comparison of ascospores of Clade A (= Erioscyphella) and the clade of Lachnum sensu stricto
in Fig. 1. Subclade numbers for members of Clade A in Fig. 1 are shown in parentheses. Bars show varia-
tion of ascospore length within each species.
Generic concept and species boundaries of the genus Erioscyphella 25
Ascal iodine reactions seen in E. papillaris
Iodine reactions of the ascus apical apparatus have been classied into several types (in-
amyloid, hemiamyloid [Type RB and RR, and euamyloid Type BB]) (Baral 2009), and
the reaction ‘MLZ- without KOH pretreatment and MLZ+ with KOH pretreatment’,
observed in E. papillaris (Fig. 11E1 and Fig. E2) has been restricted to the type of
hemiamyloid. However, the apical apparatus of E. papillaris showed a dark blue reac-
tion in IKI without KOH pretreatment (Fig. 11E3), while the hemiamyloid apparatus
usually shows a red reaction under these conditions. e hemiamyloid ascal apparatus
could show IKI-blue without KOH pretreatment due to long storage in the herbarium
(Baral 2009), but this is not applicable for the material of E. papillaris, which has been
maintained for only two years in herbarium until observed. erefore, we assessed the
iodine reaction of E. papillaris as a new type, and color reactions with various solutions
of the species should be further examined using new materials, because there are few
apothecia in the type specimen.
Species-level taxonomic treatment of Erioscyphella
In this study, we carried out taxonomic treatment for species which were distinguished
by morphology/ecology and phylogenetic analyses, and formed single clusters in spe-
cies delimitation analyses. Based on this criteria, six undescribed species of Erioscyphella
have been proposed as new species of Erioscyphella [E. boninensis, E. insulae, E. otanii,
E. papillaris, E. paralushanensis, and E. sasibrevispora], and Lachnum hainanense and
L. mapirianum var. sinense have been proposed as new members of Erioscyphella. Inter-
pretation of species boundaries of L. hainanense was discussed in the taxonomy chap-
ter. For new species and new combinations, Japanese names were also denominated for
wider use of Japanese mycologists or amateurs.
In the phylogenetic analyses, Malaysian materials of L. mapirianum (TNS-
F-17245, 17249) and Japanese materials of L. novoguineense var. yunnanicum (TNS-
F-16442, 16642) were also found to be members of Erioscyphella (Fig. 1). However,
we hesitate to transfer the two species into Erioscyphella, as we cannot guarantee the
identication accuracy of the materials, because of inadequate type information of
the two species.
Taxonomic assessments of E. abnormis, L. aseptate, and L. palmae, which were not
accepted as independent species in species delimitation analyses, are discussed below.
Taxonomy of E. abnormis and its related species
In the species delimitation analyses, sequences labeled as E. abnormis formed a single
SH at UNITE SH 3% threshold (DOI: SH1155612.08FU) and divided into two to
four SHs at UNITE SH 1.5% threshold, VSEARCH, and GMYC (Fig. 3).
In ASAP, sequences labeled as E. abnormis belong to a single SH, but the SH also
contained sequences labeled as Chapsa patens, E. aseptata, E. brasiliensis, E. curvispora,
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
26
and E. sclerotii (Fig. 3). However, the phylogenetic analyses revealed that E. brasiliensis,
and E. sclerotii are separate from the clade of E. abnormis (Fig. 1), suggesting that the
two species are dierent from E. abnormis. Although E. curvispora was not included
in the phylogenetic analyses (Fig. 1), the apparent morphological and ecological dif-
ferentiation (Perić and Baral 2014) and low similarity of ITS (< 97%) with members of
E. abnormis (Fig. 3) suggest that E. curvispora is dierent from E. abnormis.
Erioscyphella aseptata was originally described in ailand and characterized by
having aseptate ascospores, unlike E. abnormis or E. sclerotii with septate ascospores
(Ekanayaka et al. 2019). However, the species delimitation analyses in this study sug-
gested the diculty of delimiting E. aseptata (MK584957) from E. abnormis (Fig. 3),
suggesting that E. aseptata is a morphologically atypical (aseptate-ascospored) indi-
vidual of E. abnormis.
Although two ITS sequences of C. patens (MT995055 = specimen no. FJ19131
and MW007918 = specimen no. FJ19049) were positioned in SHs dominated by
E. abnormis, LSU and mtSSU sequences of FJ19131 and LSU sequence of FJ19049
were closely related to Chapsa spp. [Graphidaceae, Ostropales]. Since Lachnaceae and
Graphidaceae are phylogenetically distant, the two ITS sequences MT995055 and
MW007918 have been misidentied.
Considering that the monophyly of E. abnormis is strongly supported
(Fig. 1) and members of the species share high ITS similarities (> 97%, compiled into
SH1155612.08FU) (Fig. 3, Table 2), E. abnormis is accepted here as a species with
some intraspecic morphological and phylogenetic variation.
Taxonomy of ‘Lachnum’ palmae
Lachnum palmae formed a strongly supported clade in the phylogenetic analyses
(Clade II in Fig. 1). ey also shared strong selectivity to palm leaves and character-
istic morphology such as thick-walled asci, hairs with resinous materials and apical
amorphous materials (Suppl. material 1: Fig. S2) and ectal excipulum composed of
thick-walled prismatic cells and interwoven hyphae. However, sequences labeled as
L. palmae were divided into 4 to 7 SHs in all species delimitation analyses (Fig. 3),
indicating that L. palmae is a species complex that includes multiple potential sister
species. At present, we avoid creating new species from the complex, because the mor-
phological and ecological dierences detected among SHs are not enough to delimit
species boundaries, although the size of asci and ascospores dier among some SHs,
as shown in Fig. 4. Phylogenetic analyses revealed that members of the L. palmae
complex belonged to Erioscyphella (Fig. 1). However, we could not judge which SH
within the complex is equivalent to L. palmae as originally described from Honduras
by Kanouse (1941) and redescribed by Spooner (1987) from the type plus another
specimen from New Zealand. ere are no L. palmae sequences from the tropical
American type locality, so phylogenetic characterization and recombination of the
species were avoided in the present study.
Generic concept and species boundaries of the genus Erioscyphella 27
Taxonomy
Erioscyphella boninensis Tochihara & Hosoya, sp. nov.
MycoBank No: 835702
Figs 5, 6
Diagnosis. Diers from all other Erioscyphella species by the granulate walls of the
ectal excipular cells.
Holotype. J, Bonin Islands, Chichijima Island, Mt. Tsutsujiyama, 27.060556,
142.222500, ca 270 m, 28 Jun. 2009, on fallen leaves of Pittosporum boninense,
T.Hosoya (TNS-F-26520).
GenBank/UNITE no. ex holotype. LC669437/UDB0779049 (ITS), LC533151
(LSU), LC533254 (mtSSU), LC533196 (RPB2).
Etymology. Referring to the type locality Bonin Islands.
Japanese name. Ogasawara-cha-hina-no-chawantake.
Description. Apothecia scattered, supercial, 0.5–1.0 mm in diameter, having
well-developed stipes, up to 1.5 mm high, cream to pale brown, externally cov-
ered with short and shiny hairs. Disc concave, cream to pale yellow. Ectal excipu-
lum textura prismatica composed of long elongated cells to textura angularis, 6–25
× 5–13 µm, hyaline to relatively brown colored, somewhat thick-walled; cell walls
covered by granules with a similar appearance to those on hairs. Stipe composed of
textura prismatica with a granulate surface as ectal excipular cells. Medullary excipu-
lum textura intricata of hyaline hyphae up to 3 µm wide. Hairs straight, cylindrical,
38–62 × 2.5–4.0 µm, hyaline, completely covered by brown granules, 2–3-septate,
thin-walled, arising from swelling cells completely covered by granules; apex lacking
crystals or apical amorphous materials, equipped with amber-colored resinous ma-
terials dissolvable with CB/LA at a little below the apex. Asci (36–)37.7–44(–46) ×
(3.5–)3.6–4.2(–4.5) µm (av. 41 ±3.2×3.9±0.3 µm, n = 16), 8-spored, cylindrical-
clavate; pore blue in MLZ without 3% KOH pretreatment; croziers absent at the
basal septa. Ascospores (9–)10–12.3(–13) × 1.2–1.7(–1.8) µm (av. 11 ± 1.2 × 1.5 ±
0.2 µm, n = 16), Q = (6.3–)6.9–9.2(–10) (av. 7.8 ± 1.5, n = 16), fusiform, aseptate.
Paraphyses straight, up to 2.5 µm wide, septate, exceeding the asci up to 5 µm, nar-
rowly lanceolate.
Culture characteristics. Colony of NBRC 114447/TNS-F-26520 on PDA um-
bonate forming a dome-shape, slightly sulcate. Context not shiny, velvety, bu at the
center, paler toward the margin, dark bu from the reverse. Sectors and zonation ab-
sent. Aerial mycelium white or bu, dense cottony, forming white mycelium strands
except in the margin. Margin distinct, entire, at. Asexual morph absent.
Distribution. J. (Bonin Islands). Known only from the type locality.
Notes. Granulation on the surface of the ectal excipular cells has been observed
only in Incrucipulum in Lachnaceae (Baral and Krieglsteiner 1985; Tochihara and Ho-
soya 2019), and E. boninensis is the rst report for such a character in Erioscyphella
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
28
(Fig. 5H, 6E). Phylogenetic analysis revealed that E. boninensis is closely related to
E. paralushanensis (Fig. 1). e two species (Clade IA, Fig. 1) have colored granules on
hairs and forming red mycelia on PDA. However, granulation of ectal excipulum is
seen only in E. boninensis.
Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochiha-
ra, comb. nov.
MycoBank No: 835707
≡ Lachnum hainanense W.Y. Zhuang & Zheng Wang, Mycotaxon 67: 25 (1998).
Diagnosis. Forming apothecia with long stipes and long hairs. Diering E. sinensis in
much shorter ascospores.
Japanese name. Shii-Kashi-hina-no-chawantake.
Specimens examined. J, Niigata, Minamiuonuma, 37.056808,
138.80705, ca 720 m, 14 May 2010, on fallen leaves of Quercus glauca, T.Hosoya
Figure 5. Erioscyphella boninensis TNS-F-26520 (Holotype) A dried apothecia B pure culture on PDA
(NBRC 114447) C ascus D ascal pore MLZ (+) E ascospores F paraphyses G ectal excipular cells H ectal
excipular cells with red granules I hairs with resinous matters arising from ectal excipular cells. Mounted
in CB/LA (C, E–I), MLZ (D). Scale bars: 1 mm (A); 10 µm (C–I).
Generic concept and species boundaries of the genus Erioscyphella 29
(TNS-F-35049). Ibid (TNS-F-35056). J, Kanagawa, Hiratsuka, 35.33861111,
139.285, ca 80 m, 12 Apr. 2015, on fallen leaves of Q. myrsinifolia, M.Nakajima
(TNS-F-61775). JAPAN, Kanagawa, Kamakura, 35.30756, 139.51958, ca 40 m,
24 Apr. 2015, on fallen leaves of Q. serrata, M.Nakajima (TNS-F-61941). J,
Gunma, Midori, 36.476684, 139.242771, ca 510 m, 9 May 2016, on fallen leaves
of Q. serrata, K.Furuya (TNS-F-65722). J, Kanagawa, Hiratsuka, 35.340139,
139.287167, ca 60 m, 18 May 2017, on fallen leaves of Q. glauca, Y.Tochiara
(TNS-F-80356). e same locality, on fallen leaves of Castanopsis sieboldii, Y.
Tochihara (TNS-F-80371).
Distribution. C (Hainan), J (Honshu: Kanto region).
Notes. Based on the UNITE SH system at a 3% threshold, ITS sequences of this
species were integrated into a single SH (DOI: SH1155844.08FU). SH1155844.08FU
included sequences labeled as ‘Hyaloscyphaceae’ (JX984680) in UNITE and ‘L. albid-
ulum’ (MK282242) in INSDC (Table 2). JX984680 was sequenced from air samples
in Seoul, South Korea, and was not tied to any fungal specimens or cultures. Lach-
num albidulum is common on leathery dicot leaves of the old and new world tropics
(Haines 1992). Erioscyphella hainanensis resembles L. albidulum in morphology, but
L. albidulum has yellow resinous substances at the tip of apothecial hairs and occurs
on dead leaves of Rubiaceae (Haines 1992), whereas E. hainanensis lacks resinous sub-
Figure 6. Erioscyphella boninensis TNS-F-26520 (Holotype) A ascospores B apothecium C vertical sec-
tion of an apothecium D expansion of a vertical section of an apothecium E ectal excipular cells F asci
G paraphyses H hairs.
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
30
stances and occurs on leaves of broad-leaved trees (Zhuang and Wang 1998b; Hosoya
et al. 2013). erefore, we presume that MK282242, coexisting with L. hainanense in
every SH, was misidentied as L. albidulum. No sequences are available for L. albidu-
lum specimens from the type locality. Lachnum hainanense was therefore judged as
acceptable species, and recombined into Erioscyphella.
Erioscyphella hainanensis resembles E. sinensis in occurring on dead leaves of
Quercus spp. or Castanopsis spp. However, E. hainanensis has much shorter ascospores
than E. sinensis. In this study, presence of minute, hyaline apical amorphous materi-
als and absence of any crystals or resinous materials were conrmed in both species
(Suppl. material 1: Fig. S2).
Erioscyphella insulae Tochihara & Hosoya, sp. nov.
MycoBank No: 835703
Figs 7, 8
Diagnosis. Characterized by pure white apothecia unlike related species Lachnum
nothofagi, and two-layered ectal excipulum.
Holotype. J, Okinawa, Yaeyama, Taketomi, Iriomote Island, Otomi,
24.297458, 123.866128, ca 50 m, 12 Jun. 2011, on fallen bark of unidentied tree,
T.Fukiharu (TNS-F-39720).
GenBank/UNITE no. ex holotype. LC669451/UDB0779063 (ITS), LC533177
(LSU), LC533261 (mtSSU), LC533207 (RPB2).
Other specimens examined. J, Bonin Islands, Hahajima Island, Sekimon,
26.666686, 142.152222, ca 260 m, 24 Jun. 2009, on fallen bark of unidentied tree,
T.Hosoya (TNS-F-26485, 26500).
Etymology. Referring to the occurrence of the species on remote islands in Japan.
Japanese name. Shima-hina-no-chawantake.
Description. Apothecia gregarious, supercial, 0.7–1.4(–2.5) mm in diameter, short-
and thick-stipitate, up to 0.8 mm high, externally white to cream throughout but some-
times pale brown in the lower parts, covered with white hairs. Disc concave, cream to pale
yellow (fresh state not observed). Ectal excipulum composed of two layers: outer layer
textura angularis, up to 20 µm thick, 3–28 × 2–8 µm, hyaline, thin to relatively thick-
walled, with cell walls smooth; inner layer up to 15 µm thick, textura porrecta composed
of hyaline hyphae up to 5 µm wide. Medullary excipulum up to 100 µm thick, composed
of hyaline hyphae forming textura intricata; hyphae up to 3 µm wide. Hairs straight or ir-
regularly curved, cylindrical, sometimes branched, up to 125×2.5–3.0 µm, hyaline, com-
pletely granulate, thin-walled; lacking crystals or resinous materials; apex usually equipped
with hyaline apical amorphous materials. Asci (88–)92–101(–106)×6–7.3(–8) µm (av.
96 ± 4.5 × 6.7 ± 0.6 µm, n = 18), 8-spored, thick-walled, cylindrical-clavate, arising
from ascogenous hyphae branching several times; pore blue in MLZ without 3% KOH
pretreatment; croziers absent at the basal septa. Ascospores (24–)26.7–34.5(–39)×(1.8–
)1.9–2.3(–2.5) µm (av. 31 ± 3.9 × 2.1 ± 0.2 µm, n = 18), Q = (11–)12.5–17(–20)
Generic concept and species boundaries of the genus Erioscyphella 31
Figure 7. Erioscyphella insulae TNS-F-39720 (Holotype) A dried apothecia B a pure culture on PDA
(NBRC 114459) C asci D ascal pore MLZ (+) E ascospores F ascogenous hyphae G paraphyses H layer
structures of excipulum H1 medullary excipulum H2 inner layer of ectal excipulum composed of hyphae
H3 outer layer of ectal excipulum composed of textura angularis I, J hairs with apical amorphous materi-
als. Mounted in CB/LA (C, E–J), MLZ (D). Scale bars: 1 mm (A); 10 µm (A–J).
(av. 14.7 ± 2.3, n = 18), showing various shapes and lengths, usually long fusiform and
sometimes hypsiloid or sigmoid due to bending of both ends, sometimes swelling or
constricted irregularly, aseptate or one- to three-septate (usually one-septate). Paraphyses
straight, narrowly lanceolate, up to 2.5 µm wide, septate, exceeding the asci up to 7.5 µm.
Culture characteristics. Colony of NBRC 114445/TNS-F-26500 and NBRC
114459/TNS-F-39720 on PDA relatively thick-planar, pruinose, white to cream, ivo-
ry at the margin, pale sepia. Sectors and zonation absent. Aerial mycelium white to pale
ocher, mainly developed except in the margin, not forming mycelial strands. Soluble
pigment amber colored produced at the center. Margin unclear, at and immersed into
agar, radially undulate. Anamorph not seen.
Distribution. J (Bonin Islands, Yaeyama Islands).
Notes. is fungus resembles Lachnum nothofagi (Dennis) Spooner in the size and
shape of apothecia, ascospores, asci, and hairs. However, E. insulae has completely hyaline
hairs and ectal excipulum, and hairs are equipped with apical materials (Fig. 7J, 8A),
whereas L. nothofagi has partly to totally brown hairs and ectal excipulum (Spooner 1987).
Lachnum nothofagi is currently known only from New Zealand and Australia and mainly
arises from Nothofagus spp., which are native in the southern hemisphere (Spooner 1987).
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
32
Erioscyphella otanii Tochihara, sp. nov.
MycoBank No: 835704
Figs 9, 10
Diagnosis. Characterized by pure white minute apothecia (< 0.3 mm in diameter) un-
like L. diminutum with rather colored apothecia, and smaller asci compared to similar
species Lachnum minutum.
Holotype. J, Hokkaido, Horonobe, Toikambetsu, Teshio Experimental For-
est, Field Science Center for Northern Biosphere, Hokkaido University, 44.993978,
142.130125, ca 400 m, 11 Jul. 2018, on fallen leaves of Sasa senanensis, Y.Tochihara
& K.Kaneko (TNS-F-81472).
GenBank/UNITE no. ex holotype. LC669471/UDB0779083 (ITS), LC533179
(LSU), LC533286 (mtSSU), LC533226 (RPB2).
Other specimen examined. J, Hokkaido, Sapporo, Mt. Moiwa, 43.024718,
141.318427, ca 530 m, 21 Jun. 1965, on fallen leaves of Sasa kurilensis, Y.Otani (TNS-
F-50482, in poor condition).
Etymology. Referring to the name of Dr Yoshio Otani, the rst discoverer of this
species.
Japanese name. Kita-sasaba-hina-no-chawantake.
Figure 8. Erioscyphella insulae TNS-F-39720 (Holotype) A expansion of a vertical section of an apo-
thecium B ascospores C apothecium D vertical section of an apothecium E asci F paraphyses G layer
structures of excipulum.
Generic concept and species boundaries of the genus Erioscyphella 33
Figure 9. Erioscyphella otanii TNS-F-81472 (Holotype) A dried apothecia B pure culture on PDA
(NBRC 114476) C asci D ascal pore MLZ (+) E ascospore F paraphyses G a hair H hair-apex with a
apical amorphous material I ectal excipular cells. Mounted in CB/LA (C, E–I), MLZ (D). Scale bars:
0.5 mm (A); 10 µm (C–I).
Description. Apothecia scattered, supercial, minute, 0.1–0.3 mm in diameter,
at rst spherical and later urceolate, having well-developed stipes, up to 0.3 mm high,
pure white, externally covered with short white hairs, never colored brown. Disc con-
cave, almost enclosed by an incurving margin when fresh and dry, cream to pale yellow
when dry (not observed when fresh). Ectal excipulum textura prismatica like stone
pavings arranged in rows, 3–25 × 3–8 µm, hyaline, relatively thick-walled; cell walls
smooth. Medullary excipulum textura intricata; hyphae up to 2.5 µm wide. Hairs
straight, cylindrical or tapering toward the apices, up to 60 µm long, up to 5 µm
wide near the bases and 2.5–3.0 µm wide near the apices, arising from swollen ectal
excipular cells, hyaline, up to 3-septate (usually 1- or 2-septate), thin-walled, com-
pletely granulated; granules dense near the apices and coarse toward the bases; apex
sometimes with a hyaline and inconspicuous apical amorphous materials not dissolved
with CB/LA, lacking any crystals or resinous materials. Asci (33–)34–38.8(–41)×4–5
µm (av. 37 ± 2.2 × 4.4 ± 0.4 µm, n = 15), 8-spored, cylindrical-clavate, relatively
thick-walled; pore blue in MLZ without 3% KOH pretreatment; croziers absent at
the basal septa. Ascospores (11.5–)12.3–14.6(–15) × (1.2–)1.36–1.7(–1.8) µm (av.
13.4 ± 1.2×1.6±0.2 µm, n = 15), Q = (6.7–)7.8–9.6(–10.8) (av. 8.7 ± 0.9, n = 15),
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
34
fusiform, aseptate. Paraphyses straight, narrowly lanceolate to lanceolate, up to 2.5 µm
wide, septate, exceeding the asci up to 10 µm.
Culture characteristics. Colony of NBRC 114476/TNS-F-81472 on PDA at,
partially protruding and forming mycelial mass, divided into two sectors. One sector
at, wooly to velvety, white to cream; dark ocher from the reverse. e other sector
with wooly context, white and partly yellow; pale ocher from the reverse. Aerial myce-
lia developed throughout the colony, white, sparse to cottony, not forming mycelium
strands. Margin distinct, at and immersed into the agar. Soluble pigment absent.
Asexual morph absent.
Distribution. J (Hokkaido; subarctic zone).
Notes. Erioscyphella otanii was rst collected and documented by Otani (1967)
under the misapplied name Dasyscyphus diminutus (TNS-F-50482). Based on the de-
scription, we concluded that the specimen was the same species as TNS-F-81472. e
present species is very similar to Lachnum diminutum (Roberge ex Desm.) Rehm in
the minute apothecia, ascospore size, and narrow paraphyses; however, E. otanii is pure
white when fresh and dry (Fig. 9A, in dried state) and occurs on bamboo leaves, while
L. diminutum is somewhat brown in the exterior parts of apothecia and occurs on
sheaths of Juncus spp. (Dennis 1949). In the mature state, the apothecia of E. otanii be-
come urceolate (Fig. 9A and Fig. 10B), whereas the apothecia of L. diminutum are at
(Dennis 1949). e ITS sequence of TNS-F-81472 showed low similarity (< 80%) with
that of L. diminutum collected in France (GenBank accession number: MH857306).
Based on the French sequence, L. diminutum is phylogenetically a good Lachnum.
Figure 10. Erioscyphella otanii TNS-F-81472 (Holotype) A ascospores B apothecium C vertical section
of an apothecium D hairs with cap-like structures arising from ectal excipular cells E expansion of a verti-
cal section of an apothecium F paraphyses G asci.
Generic concept and species boundaries of the genus Erioscyphella 35
Figure 11. Erioscyphella papillaris TNS-F-81272 (Holotype) A dried apothecia B pure culture on PDA
(NBRC 113937) C Ascus arising from ascogenous hyphae D an ascus E ascal pore iodine reactions E1 MLZ (-)
without 3% KOH pretreatment E2 MLZ (-) with 3% KOH pretreatment E3 IKI (+) without 3% KOH pre-
treatment F paraphysis G ascospores with guttules H ectal excipulum I hair-apex with a apical amorphous ma-
terial J hairs. Mounted in CB/LA (C , D, F –J ), MLZ (E1, E2), IKI (E3). Scale bars: 0.5 mm (A); 10 µm (C–J).
e appearance of E. otanii is also similar to that of the graminicolous species
Lachnum minutum W.Y. Zhuang and M. Ye documented in China (Ye and Zhuang
2003). Erioscyphella otanii is distinguished from L. minutum in having smaller asci,
although DNA sequences of the species are not available.
Erioscyphella papillaris Tochihara, sp. nov.
MycoBank No: 835705
Figs 11, 12
Diagnosis. Characterized by protruding papillary hairs with hyaline apical amorphous
materials.
Holotype. J, Gunma, Minakami, Yubiso, Mt. Tanigawadake, 36.064014,
141.344653, ca 710 m, 16 Jul. 2017, on both sides of a fallen leaf of bamboo,
Y.Tochihara (TNS-F-81272).
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
36
GenBank/UNITE no. ex holotype. LC669473/UDB0779085 (ITS), LC533161
(LSU), LC533285 (mtSSU), LC533204 (RPB2).
Etymology. Referring to papillate hair apices.
Japanese name. Sasaba-hina-no-chawantake.
Description. Apothecia gregarious, supercial, minute, 0.1–0.3 mm in diameter,
short-stipitate, up to 0.25 mm high, externally densely covered with pure white short
hairs. Disc concave, white to lemon yellow when fresh and dry. Ectal excipulum textura
prismatica composed of cuboid cells, 3–13 × 2.5–7 µm, hyaline, thin-walled, lacking
carotenoid pigments; cell walls smooth. Medullary excipulum textura intricata of hya-
line hyphae up to 3 µm wide. Hairs straight, cylindrical, 45–75 × 3–5 µm, 2–3-septate,
hyaline, totally granulate, thin-walled, arising from swollen cells; apical cells rather
longer than other cells, 30–40 µm long, with papillate at the apex, sometimes swelling,
Figure 12. Erioscyphella papillaris TNS-F-81272 (Holotype) A apothecium B vertical section of an apo-
thecium C ascospores D expansion of an vertical section of an apothecium E ectal excipular cells F asci
G paraphyses H hairs with cap-like structures.
Generic concept and species boundaries of the genus Erioscyphella 37
equipped with hyaline and globose apical amorphous materials not dissolved with CB/
LA, lacking any crystals or resinous matters. Asci (59–)59.8–66(–69) × (7.5–)7.6–
8.3(–9) µm (av. 63 ± 2.9 × 8.0 ± 0.4 µm, n = 16), 8-spored, cylindrical-clavate; pore
inamyloid with MLZ without 3% KOH pretreatment, faint blue with MLZ with 3%
KOH pretreatment, dark blue with IKI with and without KOH pretreatment; vesicle
apparatus inverted-v-shaped present near the apices; croziers absent at the basal septa;
base sympodially branched. Ascospores (16–)17.5–21.7(–24) × (2–)2.3–2.8(–3) µm
(av. 20 ± 2.1 × 2.6 ± 0.3 µm, n = 20), Q = (6.4–)6.8–8.9(–9.8) (av. 7.8 ± 1.0, n = 20),
fusiform, aseptate, or one-septate (rarely two-septate), lled with hyaline oil drops.
Paraphyses straight, cylindrical, up to 3 µm wide, septate, containing small hyaline
lipid bodies, equal or scarcely exceeding the asci.
Culture characteristics. Colony of NBRC 113937/TNS-F-81272 on PDA di-
vided into two semicircular zones. e rst zone umbonate, pruinose, white, pro-
ducing white aerial mycelia densely, presenting wooly appearance; margin distinct,
entire, at. e second zone at, glutinous, white to beige with concentric patterns,
producing few aerial mycelia; margin entire, at and immersed into agar, irregularly
undulate. e reverse uniform unrelated to the zoning position, beige to pale dark
brown throughout. Soluble pigment and asexual morph absent throughout the colony.
Distribution. J (Mt. Tanigawa). Currently known only from the type locality.
Notes. is species is similar to Lachnum sclerotii var. microascum in the dimen-
sion and shape of asci and ascospores, habitats, and inconspicuous ascus apex reaction
in MLZ (Zhuang 2004). However, E. papillaris has ascospores containing conspicu-
ous guttules in any mount (Fig. 11G) and liform paraphyses rarely exceeding the
asci (Fig. 11F, Fig. 12D, and Fig. 12G), whereas L. sclerotii var. microascum has non-
guttulate asci and narrowly lanceolate to lanceolate paraphyses exceeding the asci by
15–18 µm (Zhuang 2004). Although DNA sequences of L. sclerotii var. microascum are
not available, we judged the present fungus as dierent from it, because the presence
or absence of guttules in ascospores is a signicant taxonomic character at the species
level (Baral 2015).
Papillate hairs are also shown in the line drawings of Lachnum gahniae Spooner
(Spooner 1987), suggesting the relationship of the present fungus to Australasian spe-
cies. However, L. gahniae can be distinguished by having longer hairs, occurring on
dierent substrates (leaves of Cyperaceae) and showing dierent ascal-iodine reactions
(MLZ+) (Spooner 1987), although DNA sequences of L. gahnia are not available.
Erioscyphella paralushanensis Tochihara and Hosoya, sp. nov.
MycoBank No: 839618
Figs 13, 14
Diagnosis. Characterized by throughout red apothecia occurring on bamboo sheaths.
Similar to E. lushanensis in macro- and micromorphology and habitats, but has larger
asci and ascospores.
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
38
Holotype. J, Shizuoka, Atami, Izusan, 35.128834, 139.051194, ca 620 m,
8 Jun. 2015, on fallen sheaths of Pleioblastus argenteostriatus, M.Nakajima (TNS-
F-61920).
GenBank/UNITE no. ex holotype. LC669463/UDB0779075 (ITS), LC533141
(LSU), LC533267 (mtSSU), LC533220 (RPB2).
Etymology. Referring to the similarity with E. lushanensis.
Japanese name. Akage-hina-no-chawantake.
Description. Apothecia scattered, supercial, 0.7–1.5 mm in diameter, long-stipi-
tate, up to 2.0 mm high, externally covered with dark-red hairs. Disc concave, cream to
pale yellow. Ectal excipulum well-developed textura prismatica and partly t. angularis,
6–13 × 2.0–2.5 µm, hyaline, relatively thick-walled, with smooth walls. Medullary ex-
cipulum textura intricata of hyaline hyphae up to 2 µm wide. Hairs straight, cylindri-
cal, up to 160 µm long, 2.0–3.0 µm wide, pale brown but hyaline near the bases; hair
cells narrowly septate, > 7 µm long, covered by big and amber-colored granules; gran-
Figure 13. Erioscyphella paralushanensis TNS-F-61920 (Holotype) A apothecia B pure culture on PDA
(NBRC 114468) C ascus D ascal pore iodine reactions D1 MLZ (faintly +) without 3% KOH pretreat-
ment D2 MLZ (+) with 3% KOH pretreatment D3 IKI (+) without 3% KOH pretreatment E paraphysis
F ascospores G ectal excipular cells H marginal section of an apothecium generating hairs I hairs with red
resinous materials J apical amorphous materials of hairs. Mounted in CB/LA (C, E–J), MLZ (D1, D2),
IKI (D3). Scale bars: 0.5 mm (A); 10 µm (C–J).
Generic concept and species boundaries of the genus Erioscyphella 39
ules big and dense near the apices and smaller and sparse near the bases, up to 2 µm
in diameter near the apices, equipped with amber-colored resinous materials that dis-
solves in CB/LA at any position of hairs; apices with amber-colored apical amorphous
materials, lacking any crystals. Asci (59–)61.4–70.2(–73) × (4.5–)4.7–5.6(–6) µm (av.
65.8±4.4 × 5.2 ± 0.4 µm, n = 15), Q = (11.5–)12–13.6(–14.6) (av. 12.8±0.8,
n=15), 8-spored, cylindrical-clavate; pore faintly blue in MLZ without 3% pretreat-
ment, clear blue in MLZ with 3% KOH pretreatment and IKI without 3% KOH pre-
treatment. Ascospores (14–)15.8–20.7(–22) × (1.5–)1.7–2.0 µm (av. 18.2±2.5×1.8
± 0.2 µm, n = 15), Q = (7.5–)8.7–11.2(–12.6) (av. 9.9 ± 1.3, n = 15), septate, some-
times bent to U-shaped or S-shaped, containing conspicuous guttules; guttules hyaline
but sometimes red. Paraphyses straight, up to 2 µm wide, septate, exceeding the asci
5–10 µm, initially cylindrical to clavate, later becoming narrowly lanceolate.
Culture characteristics. Colony of NBRC 114468/TNS-F-61920 on PDA at,
sparse, dendritically spread. Context wooly, ocher to pale bu, dark bu from the re-
verse. Sectors and zonation absent. Aerial mycelium ocher to pale bu, dense cottony,
developed near the center, forming white mycelium strands; margin distinct, at and
partly immersed into the agar. Asexual morph absent. Soluble pigments present, bu,
dyeing agar without colony pale bu.
Distribution. J (Shizuoka). Currently known only from the type locality.
Notes. Erioscyphella paralushanensis is closely related to E. lushanensis in having red
hairs (Fig. 13I) and the ectal excipulum composed of well-developed rectangular cells
Figure 14. Erioscyphella paralushanensis TNS-F-61920 (Holotype) A apothecia B vertical section of
an apothecium C expansion of an vertical section of an apothecium D asci E hairs F ectal excipulum
G paraphyses H ascospores.
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
40
in common (Fig. 13H, Fig. 14C, and Fig. 14F) (Zhuang and Wang 1998a). Compared
with E. lushanensis, E. paralushanensis has slightly larger asci, ascospores and hairs. Red
guttules in ascospores were observed only in E. paralushanensis (Fig. 13F). In this study,
we proposed the present fungus as a new species, because species delimitation analyses
based on ITS sequences strongly supported that E. paralushanensis is dierent from E.
lushanensis (Fig. 3).
Erioscyphella sasibrevispora Tochihara & Hosoya, sp. nov.
MycoBank No: 835706
Figs 15, 16
Diagnosis. Characterized by wooly appearance and yellow to orange discs, and distin-
guished from similar species Lachnum novoguineense var. yunnanicum in having shorter
ascospores.
Holotype. J, Hokkaido, Tomakomai, Utonai, 42.705314, 141.7346, ca 10
m, 16 Jun. 2018, on fallen sheaths of Sasa nipponica, Y.Tochihara & T.Hosoya (TNS-
F-81401).
GenBank/UNITE no. ex holotype. LC669470/UDB0779082 (ITS), LC533174
(LSU), LC533269 (mtSSU), LC533217 (RPB2).
Other specimen examined. J, Gunma, Higashiagatsuma, 36.562253,
138.724139, ca 1330 m, 6 Jun. 2017, on fallen sheaths of Sasa veitchii, Y.Tochihara &
T.Hosoya (TNS-F-80399, in bad condition).
Etymology. “sasi” means bamboo [host plants] and “brevispora” means shorter
ascospores compared to L. novoguineense var. yunnanicum.
Japanese name. Sasa-no-youmou-chawantake.
Description. Apothecia gregarious, supercial, 0.6–1.3 mm in diameter, short-stip-
itate, up to 0.8 mm high, pure white, externally covered with long white hairs. Disc con-
cave, yellow to pale orange when fresh and dry. Ectal excipulum textura prismatica to t.
angularis, 3–16 × 2–10 µm, hyaline, thin-walled; surface smooth. Medullary excipulum
textura intricata of hyaline hyphae up to 2 µm wide. Hairs straight, delicate, cylindrical
with relatively acute apices, up to 190 × 2–3 µm, hyaline, totally granulate, thin-walled;
apical cell a little longer than other cells, lacking any crystals, resinous materials, or api-
cal amorphous materials. Asci (79–)82.5–90(–95) × (6–)6.6–8.1(–9) µm (av. 86 ± 4.0
× 7.4 ± 0.8 µm, n = 15), 8-spored, cylindrical-clavate; lateral parts sometimes swelling
irregularly; pore blue in MLZ without 3% KOH pretreatment; croziers with perforation
present at the basal septa. Ascospores (26–)27.9–36.1(–39)×(1.5–)1.7–2 µm (av. 32 ±
4.1 × 1.8 ± 0.2 µm, n = 17), Q = (13–)15–19.7(–21) (av. 17.5±2.3, n = 17), long fusi-
form, usually 3-septate, rarely 0- to 2-septate (only observed in TNS-F-81401 because
TNS-F-80399 was immature). Paraphyses straight, lanceolate, 2.5–4 µm wide, densely
septate, exceeding the asci up to 15 µm. Note that the description is solely based on the
holotype because another examined specimen TNS-F-80399 was in bad condition.
Generic concept and species boundaries of the genus Erioscyphella 41
Culture characteristics. Colony of NBRC 114475/TNS-F-81401 on PDA wrin-
kled. Context cottony and partially funiculose, white, turning ocher at the center;
almost ocher except for the white margin from the reverse. Sectors and zonation ab-
sent. Aerial mycelium developed throughout the colony, concolous, forming myce-
lium strands. Margin indistinct, at and immersed into agar. Soluble pigment absent.
Asexual morph absent.
Distribution. J (cool-temperate zone, subarctic zone).
Notes. Erioscyphella sasibrevispora is closely related to L. novoguineensis var. yun-
nanicum (TNS-F-16442, 16642) (Fig. 1) and occurs in the same habitats (that is,
bamboo sheaths) but has shorter asci and ascospores. e ascal bases of the two
species are very characteristic, in that they have croziers with perforations (Fig. 15G
and Fig. 16E). In Lachnaceae, this type of crozier has only been reported in Lachnel-
Figure 15. Erioscyphella sasibrevispora TNS-F-81401 (Holotype, A–F, H–J). Lachnum novoguineense var.
yunnanicum TNS-F-16442 (G) A dried apothecia B a pure culture on PDA (NBRC 114475) C ectal
excipular cells D ascus E an ascal pore MLZ (+) F ascal base with a perforated crozier G ascal base with a
perforated crozier H septated paraphyses I ascospores J vertical section through the apothecium. Mounted
in CB/LA (D, F–J), MLZ (E). Scale bars: 1 mm (A); 10 µm (C–J).
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
42
Figure 16. Erioscyphella sasibrevispora TNS-F-81401 (Holotype A – D, F, G). Lachnum novoguineense var.
yunnanicum TNS-F-16642 (E) A apothecium B vertical section of an apothecium C ascospores D asci
(with basal structures sometimes with perforation) E ascal base arising from a crozier with perforation
F paraphyses G ectal excipular cells H hairs.
lula (Baral 1984). Additionally, both species exceptionally lack any hair materials in
Erioscyphella.
e tropical species E. bambusina and Lachnum albidum var. americanum (Den-
nis) W.Y. Zhuang also occur on bamboo sheaths. However, compared with the present
fungus, the former has smaller ascospores and liform paraphyses (Dennis 1954), and
the latter has extremely large asci and ascospores (Dennis 1960). In cool-temperate
to subarctic zones, L. asiaticum and Lachnum sasae Raitv. occur on bamboo sheaths
(Otani 1967; Raitviir 1985), but their ascospores are much shorter than those of the
present fungus.
e wooly appearance and yellow disc of this species (Fig. 15A) resemble those of
Capitotricha rubi (Bres.) Baral; however, microscopic observations easily distinguish
the two species.
Generic concept and species boundaries of the genus Erioscyphella 43
Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya,
comb. et stat. nov.
MycoBank No: 835709
≡ Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang, Nova Hedwigia 74(3-
4): 422 (2002).
Diagnosis. Occurring on fallen leaves of of Quercus spp. or Castanopsis spp. in early
summer and having needle-like ascospores.
Japanese name. Shii-Kashi-hina-no-chawantake-modoki.
Specimen examined. J, Ibaraki, Tsukuba, Mt. Tsukuba, 36.228539, 140.103504,
ca 870 m, 23 Jun. 2007, on fallen leaves of Castanopsis sieboldii, R.Sasagawa (TNS-
F-16841). J, Ibaraki, Tsukuba, Amakubo, Tsukuba Botanical Garden, 36.101472,
140.110944, ca 20 m, 15 Jun. 2007, on fallen leaves of C. sieboldii, R.Sasagawa (TNS-
F-16838). JAPAN, Tottori, Yonago, Yonago Castle, 35.42437, 133.325472, ca 50 m, 3
Jun. 2018, on fallen leaves of C. sieboldii, Y.Tochihara (TNS-F-81383).
Distribution. C (Hainan, Yunnan; Yu and Zhuang 2003). J (warm-
temperate zone).
Notes. e present fungus was treated as Lachnum sp. 13 by Hosoya et al. (2010).
is fungus occurs in the same habitats as E. hainanensis, but it is easily distinguished in
having longer and needle-like ascospores. Erioscyphella sinensis resembles L. mapirianum
in the shape of ascospores, but the two species are dierent in that L. mapirianum has
long slender apothecial stipes, larger asci, longer ascospores, and wider paraphyses.
In the present study, we transferred this fungus to Erioscyphella and upgraded it
from variety to species level, because this fungus is not phylogenetically related to
‘L’. mapirianum (Fig. 1). e presence of apical amorphous materials of hairs was con-
rmed in this study (Suppl. material 1: Fig. S2).
Acknowledgements
We thank Dr Shimpei Hiruta at the National Museum of Nature and Science for
his kind support in the species delimitation analyses. We also thank Dr Toshimitsu
Fukiharu at the Natural History Museum and Institute, Chiba, Ms Michiru Fujisaki
and Rei Sasagawa at the Faculty of Life and Environmental Sciences, University of
Tsukuba, and Mr Minoru Nakajima at Kanagawa Kinoko no Kai for collecting and
donating their signicant fungal specimens to TNS.
References
Abarenkov K, Tedersoo L, Nilsson RH, Vellak K, Saar I, Veldre V, Parmasto E, Prous M, Aan
A, Ots M, Kurina O, Ostonen I, Jõgeva J, Halapuu S, Põldmaa K, Toots M, Truu J, Lars-
son K-H, Kõljalg U (2010) PlutoF – a web based workbench for ecological and taxonomic
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
44
research, with an online implementation for fungal ITS sequences. Evolutionary Bioinfor-
matics 6: 189–196. https://doi.org/10.4137/EBO.S6271
Akaike H (1974) A new look at the statistical model identication. IEEE Transactions on Au-
tomatic Control 19(6): 716–723. https://doi.org/10.1109/TAC.1974.1100705
Baral HO (1984) Taxonomische und ökologische Studien über die Koniferen bewohnenden
europäischen Arten der Gattung Lachnellula Karsten. Beiträge zur Kenntnis der Pilze Mit-
teleuropas 1: 143–156. [in German]
Baral HO (2009) Iodine reaction in Ascomycetes: why is Lugol’s solution superior to Melzer’s
reagent? http://www.gbif-mycology.de/HostedSites/Baral/IodineReaction.htm [Accessed
on: 2021-03-15]
Baral HO (2015) Hymenoscyphus menthae, H. macroguttatus and H. scutula, a comparative
taxonomic study emphasizing the value of spore guttulation and croziers. Ascomycete.org
7(6): 255–287. https://doi.org/10.25664/art-0147
Baral HO, Krieglsteiner GJ (1985) Bausteine zu einer Askomyzeten-Flora der Bundersrepub-
lik Deutschland. In: Süddeutchland gefundene inoperculte Diskomyceten mit taxono-
mischen, ökologischen, chorologischen Hinweisen und einer Farbtafel. Beiheften zur
Zeitschrift für Mykologie 6: 1–160. [in German]
Begerow D, Nilsson H, Unterseher M, Maier W (2010) Current state and perspectives of
fungal DNA barcoding and rapid identication procedures. Applied Microbiology and
Biotechnology 87: 99–108. https://doi.org/10.1007/s00253-010-2585-4
Biczok R, Bozsoky P, Eisenmann P, Ernst J, Ribizel T, Scholz F, Trefzer A, Weber F, Hamann
M, Stamatakis A (2018) Two C++ libraries for counting trees on a phylogenetic terrace.
Bioinformatics 34(19): 3399–3401. https://doi.org/10.1093/bioinformatics/bty384
Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, Alexander H,
Alm EJ, Arumugam M, Asnicar F, Bai Y, Bisanz JE, Bittinger K, Brejnrod A, Brislawn CJ,
Brown CT, Callahan BJ, Caraballo-Rodríguez AM, Chase J, Cope EK, Da Silva R, Diener
C, Dorrestein PC, Douglas GM, Durall DM, Duvallet C, Edwardson CF, Ernst M, Estaki
M, Fouquier J, Gauglitz JM, Gibbons SM, Gibson DL, Gonzalez A, Gorlick K, Guo J,
Hillmann B, Holmes S, Holste H, Huttenhower C, Huttley GA, Janssen S, Jarmusch AK,
Jiang L, Kaehler BD, Kang KB, Keefe CR, Keim P, Kelley ST, Knights D, Koester I, Ko-
sciolek T, Kreps J, Langille MGI, Lee J, Ley R, Liu YX, Lofteld E, Lozupone C, Maher
M, Marotz C, Martin BD, McDonald D, McIver LJ, Melnik AV, Metcalf JL, Morgan SC,
Morton JT, Naimey AT, Navas-Molina JA, Nothias LF, Orchanian SB, Pearson T, Peoples
SL, Petras D, Preuss ML, Pruesse E, Rasmussen LB, Rivers A, Robeson MS 2nd, Rosenthal
P, Segata N, Shaer M, Shier A, Sinha R, Song SJ, Spear JR, Swaord AD, ompson
LR, Torres PJ, Trinh P, Tripathi A, Turnbaugh PJ, Ul-Hasan S, van der Hooft JJJ, Vargas
F, Vázquez-Baeza Y, Vogtmann E, von Hippel M, Walters W, Wan Y, Wang M, Warren J,
Weber KC, Williamson CHD, Willis AD, Xu ZZ, Zaneveld JR, Zhang Y, Zhu Q, Knight
R, Caporaso JG (2019) Reproducible, interactive, scalable and extensible microbiome data
science using QIIME 2. Nature Biotechnology 37: 852–857. https://doi.org/10.1038/
s41587-019-0209-9
Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S, Fourment M, Gavryushkina A,
Heled J, Jones G, Kühnert D, Maio ND, Matschiner M, Mendes FK, Müller NF, Ogilvie
HA, Plessis L, Popinga A, Rambaut A, Rasmussen D, Siveroni I, Suchard MA, Wu C-H,
Generic concept and species boundaries of the genus Erioscyphella 45
Xie D, Zhang C, Stadler T, Drummond AJ (2019) BEAST 2.5: An advanced software plat-
form for Bayesian evolutionary analysis. PLOS Computational Biology 15(4): e1006650.
https://doi.org/10.1371/journal.pcbi.1006650
Cantrell SA, Hanlin RT (1997) Phylogenetic relationships in the family Hyaloscyphaceae in-
ferred from sequences of ITS regions, 5.8S ribosomal DNA and morphological characters.
Mycologia 89(5): 745–755. https://doi.org/10.1080/00275514.1997.12026841
Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T (2009) trimAl: a tool for automated align-
ment trimming in large-scale phylogenetic analyses. Bioinformatics 25(15): 1972–1973.
https://doi.org/10.1093/bioinformatics/btp348
Darriba D, Posada D, Kozlov AM, Stamatakis A, Morel B, Flouri T (2019) ModelTest-NG:
A new and scalable tool for the selection of DNA and protein evolutionary models. Mo-
lecular Biology and Evolution 37(1): 291–294. https://doi.org/10.1093/molbev/msz189
Dennis RWG (1949) A revision of the British Hyaloscyphaceae with notes on related European
species. Mycological Papers 32: 1–97.
Dennis RWG (1954) Some inoperculate discomycetes of tropical America. Kew Bulletin 9(2):
289–348. https://doi.org/10.2307/4114399
Dennis RWG (1960) Fungi venezuelani: III. Kew Bulletin 14(3): 418–458. https://doi.
org/10.2307/4114758
Dharne CG (1965) Taxonomic investigations on the discomycetous ge-
nus Lachnellula Karst. Phytopathologische Zeitschrift 53(2): 101–144.
https://doi.org/10.1111/j.1439-0434.1965.tb02194.x
Ekanayaka AH, Hyde KD, Gentekaki E, McKenzie EHC, Zhao Q, Bulgakov TS, Camporesi E
(2019) Preliminary classication of Leotiomycetes. Mycosphere 10: 310–489. https://doi.
org/10.5943/mycosphere/10/1/7
Felsenstein J (1984) Distance methods for inferring phylogenies: a justication. Evolution 38:
16–24. https://doi.org/10.1111/j.1558-5646.1984.tb00255.x
Felsenstein J (1985) Condence limits on phylogenies: an approach using the bootstrap. Evolu-
tion 39: 783–791. https://doi.org/10.2307/2408678
Fujisawa T, Barraclough TG (2013) Delimiting species using single-locus data and the General-
ized Mixed Yule Coalescent approach: a revised method and evaluation on simulated data
sets. Systematic Biology 62(5): 707–724. https://doi.org/10.1093/sysbio/syt033
Gardes M, Bruns TD (1993) ITS primers with enhanced specicity for basidiomycetes-appli-
cation to the identication of mycorrhizae and rusts. Molecular Ecology 2(2): 113–118.
https://doi.org/10.1111/j.1365-294X.1993.tb00005.x
GBIF (2018) Adding sequence-based identiers to backbone taxonomy reveals ‘dark taxa’
fungi. https://www.gbif.org/news/2LrgV5t3ZuGeU2WIymSEuk/adding-sequence-based-
identiers-to-backbonetaxonomy-reveals-dark-taxa-fungi [Accessed on: 2020-02-10]
Gelardi M, Vizzini A, Ercole E, Horak E, Ming Z, Li TH (2015) Circumscription and taxo-
nomic arrangement of Nigroboletus roseonigrescens Gen. Et Sp. Nov., a new member of
Boletaceae from tropical South-Eastern China. PloS ONE 10: e0134295. https://doi.
org/10.1371/journal.pone.0134295
Guatimosim E, Schwartsburd PB, Barreto RW, Crous PW (2016) Novel fungi from an ancient
niche: cercosporoid and related sexual morphs on ferns. Persoonia 37: 106–141. https://
doi.org/10.3767/003158516X690934
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
46
Haines JH (1980) Studies in the Hyaloscyphaceae. I: Some species of Dasyscyphus on tropical
ferns. Mycotaxon 11(1): 189–216.
Haines JH (1992) Studies in the Hyaloscyphaceae. VI: e genus Lachnum (ascomycetes) of
the Guayana Highlands. Nova Hedwigia 54: 97–112.
Haines JH, Dumont KP (1983) Studies in the Hyaloscyphaceae II: Proliferodiscus, A new genus
of Arachnopezizoideae. Mycologia 75(3): 535–543. https://doi.org/10.1080/00275514.1
983.12023717
Haines JH, Dumont KP (1984) Studies in the Hyaloscyphaceae III: e long-spored, lignicol-
ous species of Lachnum. Mycotaxon 19: 1–39.
Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis pro-
gram for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
Han JG, Hosoya T, Sung GH, Shin HD (2014) Phylogenetic reassessment of Hyaloscyphaceae
sensu lato (Helotiales, Leotiomycetes) based on multigene analyses. Fungal Biology 118:
150–167. https://doi.org/10.1016/j.funbio.2013.11.004
Hansen K, LoBuglio KF, Pster DH (2005) Evolutionary relationships of the cup-fungus genus
Peziza and Pezizaceae inferred from multiple nuclear genes: RPB2, β-tubulin, and LSU
rDNA. Molecular Phylogenetics and Evolution 36(1): 1–23. https://doi.org/10.1016/j.
ympev.2005.03.010
Hosaka K, Castellano MA (2008) Molecular phylogenetics of Geastrales with special emphasis
on the position of Sclerogaster. Bulletin of the National Science Museum. Series B, Botany
34(4): 161–173. https://www.kahaku.go.jp/research/publication/botany/download/34_4/
BNMNS_B340403.pdf [Accessed on: 2021-03-21]
Hosoya T (2021) Systematics, ecology, and application of Helotiales: Recent progress and fu-
ture perspectives for research with special emphasis on activities within Japan. Mycoscience
62(1): 1–9. https://doi.org/10.47371/mycosci.2020.05.002
Hosoya T, Saito Y, Sasagawa R (2013) Enumeration of remarkable Japanese discomycetes (7):
Notes on one operculate discomycete and one inoperculate discomycete. Bulletin of the
National Science Museum. Series B, Botany 39(4): 151–158. https://www.kahaku.go.jp/
research/publication/botany/download/39_4/BNMNS_B39-4_151-158.pdf [Accessed
on: 2020-03-12]
Hosoya T, Sasagawa R, Hosaka K, Gi-Ho S, Hirayama Y, Yamaguchi K, Toyama K, Kakishima
M (2010) Molecular phylogenetic studies of Lachnum and its allies based on the Japanese
material. Mycoscience 51(3): 170–180. https://doi.org/10.1007/S10267-009-0023-1
Index Fungorum (2021) Index Fungorum. http://www.indexfungorum.org/names/Names.asp
[Accessed on: 2021-04-15]
Johnston PR, Quijada L, Smith CA, Baral HO, Hosoya T, Baschien C, Pärtel K, Zhuang WY,
Haelewaters D, Park D, Carl S, López-Giráldez F, Wang Z, Townsend JP (2019) A mul-
tigene phylogeny toward a new phylogenetic classication of Leotiomycetes. IMA Fungus
10: e1. https://doi.org/10.1186/s43008-019-0002-x
Kanouse BB (1941) New and unusual species of discomycetes. Mycologia 33: 461–467. htt-
ps://doi.org/10.1080/00275514.1941.12020841
Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: im-
provements in performance and usability. Molecular Biology and Evolution 30(4): 772–
780. https://doi.org/10.1093/molbev/mst010
Generic concept and species boundaries of the genus Erioscyphella 47
Kirschstein W (1938) Über neue, seltene und kritische Ascomyceten und Fungi imperfecti. I.
Annales Mycologici 36(5–6): 367–400.
Kõljalg U, Tedersoo L, Nilsson RH, Abarenkov K (2016) Digital identiers for fungal species.
Science 352(6290): 1182–1183. https://doi.org/10.1126/science.aaf7115
Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AF, Bahram M, Bates ST, Bruns
TD, Bengtsson-Palme J, Callaghan TM, Douglas B, Drenkhan T, Eberhardt U, Dueñas
M, Grebenc T, Grith GW, Hartmann M, Kirk PM, Kohout P, Larsson E, Lindahl BD,
Lücking R, Martín MP, Matheny PB, Nguyen NH, Niskanen T, Oja J, Peay KG, Peintner
U, Peterson M, Põldmaa K, Saag L, Saar I, Schüßler A, Scott JA, Senés C, Smith ME, Suija
A, Taylor DL, Telleria MT, Weiss M, Larsson KH (2013) Towards a unied paradigm for
sequence-based identication of fungi. Molecular Ecology 22: 5271–5277. https://doi.
org/10.1111/mec.12481
Kõljalg U, Nilsson HR, Schigel D, Tedersoo L, Larsson K-H, May TW, Taylor AFS, Jeppesen
TS, Frøslev TG, Lindahl BD, Põldmaa K, Saar I, Suija A, Savchenko A, Yatsiuk I, Adojaan
K, Ivanov F, Piirmann T, Pöhönen R, Zirk A, Abarenkov K (2020) e Taxon Hypothesis
Paradigm – On the Unambiguous Detection and Communication of Taxa Microorgan-
isms 8(12): e1910. https://doi:10.3390/microorganisms8121910
Korf RP (1978) Nomenclatural and taxonomic notes on Lasiobelonium, Erioscypha and Erios-
cyphella. Mycotaxon 7(2): 399–406.
Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A (2019) RAxML-NG: a fast, scal-
able and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics
35(21): 4453–4455. https://doi.org/10.1093/bioinformatics/btz305
Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary
genetics analysis across computing platforms. Molecular Biology and Evolution 35(6):
1547–1549. https://doi.org/10.1093/molbev/msy096
Lemoine F, Entfellner JBD, Wilkinson E, Correia D, Felipe MD, Oliveira TD, Gascuel O
(2018) Renewing Felsenstein’s phylogenetic bootstrap in the era of big data. Nature 556:
452–456. https://doi.org/10.1038/s41586-018-0043-0
Liu YL, Whelen S, Hall BD (1999) Phylogenetic relationships among ascomycetes: evidence
from an RNA polymerase II subunit. Molecular Biology and Evolution 16: 1799–1808.
https://doi.org/10.1093/oxfordjournals.molbev.a026092
Matheny PB (2005) Improving phylogenetic inference of mushrooms with RPB1 and RPB2
nucleotide sequences (Inocybe, Agaricales). Molecular Phylogenetics and Evolution 35:
1–20. https://doi.org/10.1016/j.ympev.2004.11.014
Matheny PB, Wang Z, Binder M, Curtis JM, Lim YW, Nilsson RH, Hughes KW, Hofstetter
V, Ammirati JF, Schoch CL, Langer E, Langer G, McLaughlin DJ, Wilson AW, Frøslev T,
Ge ZW, Kerrigan RW, Slot JC, Yang ZL, Baroni TJ, Fischer M, Hosaka K, Matsuura K,
Seidl MT, Vauras J, Hibbett DS (2007) Contributions of rpb2 and tef1 to the phylogeny
of mushrooms and allies (Basidiomycota, Fungi). Molecular Phylogenetics and Evolution
43(2): 430–451. https://doi.org/10.1016/j.ympev.2006.08.024
Miyoshi T, Ono Y, Shimizu S (2007) Occurrence of concave stem canker of citrus in Ehime
prefecture [Japan] and detection of the pathogenic fungus Lachnum abnorme by PCR. Jap-
anese Journal of Phytopathology 73(1): 9–14. https://doi.org/10.3186/jjphytopath.73.9
[in Japanese]
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
48
Nilsson RH, Abarenkov K, Veldre V, Nylinder S, De Wit P, Brosché S, Alfredsson JF, Ry-
berg M, Kristiansson E (2010). An open source chimera checker for the fungal ITS re-
gion. Molecular Ecology Resources 10(6): 1076– 1081. https://doi.org/10.1111/j.1755-
0998.2010.02850.x
Nilsson RH, Tedersoo L, Ryberg M, Kristiansson E, Hartmann M, Unterseher M, Porter TM,
Bengtsson-Palme J, Walker DM, de Sousa F, Gamper HA, Larsson E, Larsson KH, Kõljalg
U, Edgar RC, Abarenkov K (2015) A comprehensive, automatically updated fungal ITS
sequence dataset for reference-based chimera control in environmental sequencing eorts.
Microbes and Environments 30(2): 145–150. https://doi.org/10.1264/jsme2.ME14121
Otani Y (1967) Notes on some cup fungi of the Hyaloscyphaceae collected in Hokkaido, Japan.
Transactions of the Mycological Society of Japan 8: 33–42.
Perić B, Baral HO (2014) Erioscyphella curvispora spec. nov. from Montenegro. Mycologia
Montenegrina 17: 89–104. https://www.etis.ee/File/DownloadPublic/ab9f7b44-b094-
4148-8508-a48479be0ba9? [Accessed on: 2020-02-15]
Pons J, Barraclough TG, Gomez-Zurita J, Cardoso A, Duran DP, Hazell S, Kamoun S,
Sumlin WD, Vogler AP (2006) Sequence-based species delimitation for the DNA
taxonomy of undescribed insects. Systematic Biology 55(4): 595–609. https://doi.
org/10.1080/10635150600852011
Puillandre N, Brouillet S, Achaz G (2021) ASAP: assemble species by automatic partitioning.
Molecular Ecology Resources 21(2): 609–620. https://doi.org/10.1111/1755-0998.13281
Raitviir A (1985) Species Hyaloscyphacearum in Sasa spp. inventae. Novosti Sistematiki Niz-
shikh Rastenii 22: 157–162.
Raitviir A (2002) A revision of the genus Dasyscyphella (Hyaloscyphaceae, Helotiales). Polish
Botanical Journal 47(2): 227–241.
Rambaut A (2018a) Tracer. Molecular evolution, phylogenetics and epidemiology, Edinburgh.
http://beast.community/tracer [Accessed on: 2021-03-15]
Rambaut A (2018b) FigTree. Molecular evolution, phylogenetics and epidemiology, Edin-
burgh. http://tree.bio.ed.ac.uk/software/gtree/ [Accessed on: 2020-03-15]
Rognes T, Flouri T, Nichols B, Quince C, Mahé F (2016) VSEARCH: a versatile open source
tool for metagenomics. PeerJ 4: e2584. https://doi.org/10.7717/peerj.2584
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L,
Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: ecient Bayesian phylogenetic in-
ference and model choice across a large model space. Systematic Biology 61: 539–542.
https://doi.org/10.1093/sysbio/sys029
Sanderson MJ, McMahon MM, Steel M (2011) Terraces in phylogenetic tree space. Science
333(6041): 448–450. https://doi.org/10.1126/science.1206357
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, Fungal
Barcoding Consortium (2012) Nuclear ribosomal internal transcribed spacer (ITS) region
as a universal DNA barcode marker for Fungi. PNAS 109(16): 6241–6246. https://doi.
org/10.1073/pnas.1117018109
Suková M (2005) A revision of selected material of lignicolous species of Brunnipila, Capitotri-
cha, Dasyscyphella and Neodasyscypha from the Czech Republic. Czech Mycology 57(1–2):
139–172. https://doi.org/10.33585/cmy.57108
Generic concept and species boundaries of the genus Erioscyphella 49
Spooner BM (1987) Helotiales of Australasia: Geoglossaceae, Orbiliaceae, Sclerotiniaceae, Hy-
aloscyphaceae. Bibliotheca Micologica 116: 1–711.
Swoord DL (2002) PAUP*. Phylogenetic analysis using parsimony (* and other methods).
Version 4.0 b10. Sinauer Associates, Sunderland, MA.
Tello S, Baral HO (2016) Erioscyphella lunata (Lachnaceae), a rare discomycete collected in
Spain. Ascomycete.org 8(4): 157–162. https://doi.org/10.25664/ART-0183
Tochihara Y, Hosoya T (2019) ree new species of Incrucipulum (Lachnaceae, Helotiales, Asco-
mycota) from Japan. Phytotaxa 403: 25–38. https://doi.org/10.11646/phytotaxa.403.1.2
Vilgalys R, Hester M (1990) Rapid genetic identication and mapping of enzymatically ampli-
ed ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–
4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
White T, Bruns TD, Lee A, Taylor JW (1990) Amplication and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Snisky JJ, White TJ
(Eds) PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego,
315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Ye M, Zhuang WY (2003) New taxa of Lachnum (Helotiales, Hyaloscyphaceae) from tem-
perate China. Nova Hedwigia 76(3–4): 443–450. https://doi.org/10.1127/0029-
5035/2003/0076-0443
Zhao M, Yuan LY, Guo DL, Ye Y, Da-Wa ZM, Wang XL, Ma FW, Chen L, Gu YC, Ding
LS, Zhou Y (2018) Bioactive halogenated dihydroisocoumarins produced by the endo-
phytic fungus Lachnum palmae isolated from Przewalskia tangutica. Phytochemistry 148:
97–103. https://doi.org/10.1016/j.phytochem.2018.01.018
Zhao P, Zhuang WY (2011) Evaluation of ITS region as a possible DNA barcode for the genus
Lachnum (Helotiales). Mycosystema 30(6): 932–937.
Zhao YJ, Hosoya T, Baral HO, Hosaka K, Kakishima M (2012) Hymenoscyphus pseudoalbidus,
the correct name for Lambertella albida reported from Japan. Mycotaxon 122: 25–41.
https://doi.org/10.5248/122.25
Zhuang WY (2004) New taxa of Lachnum (Ascomycetes, Helotiales) on bamboo and a key to
the bambusicolous species of the genus. Nova Hedwigia 78(3–4): 425–433. https://doi.
org/10.1127/0029-5035/2004/0078-0425
Zhuang WY, Wang Z (1998a) Some new species and new records of discomycetes in China.
VIII. Mycotaxon 66: 429–438.
Zhuang WY, Wang Z (1998b) Discomycetes of tropical China. I. Collections from Hainan
Island. Mycotaxon 67: 21–31.
Zhang J, Kapli P, Pavlidis P, Stamatakis A (2013) A general species delimitation method with
applications to phylogenetic placements. Bioinformatics 15(29): 2869–2876. https://doi.
org/10.1093/bioinformatics/btt499
Zoller S, Scheidegger C, Sperisen C (1999) PCR primers for the amplication of mitochon-
drial small subunit ribosomal DNA of lichen-forming ascomycetes. e Lichenologist 31:
511–516. https://doi.org/10.1006/lich.1999.0220
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
50
Supplementary material 1
Figure S1. ML trees
Authors: Yukito Tochihara, Tsuyoshi Hosoya
Data type: Image.
Explanation note: ML trees based on ITS (A), LSU (B), mtSSU (C) and RPB2 (D)
constructed using MEGA X. Bootstrap values > 50% are indicated on branches and
branches with MLBS > 70% are shown bold.
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.87.73082.suppl1
Supplementary material 2
Figure S2. Hair apices
Authors: Yukito Tochihara, Tsuyoshi Hosoya
Data type: Image.
Explanation note: Hair apices of members of Clade A Erioscyphella abnormis TNS-
F-32163 B E. abnormis TNS-F-61773 C E. brasiliensis TNS-F-46419 D E. sclerotii
TNS-F-26492 E ‘Lachnum’ mapirianum TNS-F-17245 F ‘Lachnum’ palmae TNS-
F-17567 F1 Hair with resinous matters F2 Hair with apical amorphous material G
‘Lachnum’ palmae TNS-F-24600 G1 Hair with a resinous matter G2 Hair with api-
cal amorphous materials H E. hainanensis TNS-F-80371 I E. sinensis TNS-F-80354.
Mounted in CB/LA. Scale bars: 10 mm. Arrowheads show hair apical materials.
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.87.73082.suppl2
Generic concept and species boundaries of the genus Erioscyphella 51
Supplementary material 3
Figure S3. Result of the ASAP species delimitation analysis
Authors: Yukito Tochihara, Tsuyoshi Hosoya
Data type: Image.
Explanation note: e graph shows the distribution of ASAP scores according to parti-
tioning results, and the phylogenetic tree shows the way of partitioning.
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.87.73082.suppl3
Supplementary material 4
Figure S4. Result of the GMYC species delimitation analysis
Authors: Yukito Tochihara, Tsuyoshi Hosoya
Data type: Image.
Explanation note: Number with each node shows the support value that each cluster
is an independent species.
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.87.73082.suppl4
Supplementary material 5
Figure S5. ML best-scored phylogenetic tree based on concatenated dataset of
ITS1, 5.8S, and ITS2 constructed by RAxML-NG
Authors: Yukito Tochihara, Tsuyoshi Hosoya
Data type: Image.
Explanation note: GenBank/UNITE accession number and TNS specimen number (if
any) is shown for each taxon. MLBP > 50% were attached on branches.
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.87.73082.suppl5
Yukito Tochihara & Tsuyoshi Hosoya / MycoKeys 87: 1–52 (2022)
52
Supplementary material 6
Figure S6. Results of PTP species delimitation analyses
Authors: Yukito Tochihara, Tsuyoshi Hosoya
Data type: Image.
Explanation note: Number with each node shows the probability of the likelihood
that each cluster is an independent species. Clusters showed by red branches are
regarded as species.
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/mycokeys.87.73082.suppl6
Available via license: CC BY 4.0
Content may be subject to copyright.
