Cloning and codon optimization of a novel feline interferon omega gene for production by Pichia pastoris and its antiviral efficacy in polyethylene glycol-modified form

Abstract

Feline viral diseases, such as feline panleukopenia, feline infectious peritonitis, and feline coronaviral enteritis, seriously endanger the health of cats, and restrict the development of pet industry. Meanwhile, there is a current lack of effective vaccines to protect against feline viral diseases. Thus, effective therapeutic agents are highly desirable. Interferons (IFNs) are important mediators of the antiviral host defense in animals, particularly type I IFNs. In this study, a novel feline IFN omega (feIFN-ω) gene was extracted from the cat stimulated with feline parvovirus (FPV) combined with poly(I:C), and following codon optimization encoding the feIFN-ω, the desired gene (feIFN-ω’) fragment was inserted into plasmid pPICZαA, and transformed into Pichia pastoris GS115, generating a recombinant P. pastoris GS115 strain expressing the feIFN-ω’. After induction, we found that the expression level of the feIFN-ω’ was two times more than that of feIFN-ω (p < 0.01). Subsequently, the feIFN-ω’ was purified and modified with polyethylene glycol, and its antiviral efficacy was evaluated in vitro and in vivo, using vesicular stomatitis virus (VSV) and FPV as model virus. Our results clearly demonstrated that the feIFN-ω’ had significant antiviral activities on both homologous and heterologous animal cells in vitro. Importantly, the feIFN-ω’ can effectively promote the expression of antiviral proteins IFIT3, ISG15, Mx1, and ISG56, and further enhance host defense to eliminate FPV infection in vivo, suggesting a potential candidate for the development of therapeutic agent against feline viral diseases.

Full text

RESEARCH PAPER
Cloning and codon optimization of a novel feline interferon omega gene for
production by Pichia pastoris and its antiviral efficacy in polyethylene
glycol-modified form
Yixin Wang
a
,#
, Sheng Jiang
a
,#
, Xiaoxia Jiang
a
,#
, Xiaobo Sun
a
, Xueting Guan
b
, Yanyan Han
a
, Linhan Zhong
a
,
Houhui Song
a,c,d
, and Yigang Xu
a,c,d
a
Key Laboratory of Applied Technology on Green-eco-healthy Animal Husbandry of Zhejiang Province, College of Animal Science &
Technology College of Veterinary Medicine, Zhejiang A&f University, Hangzhou, P.R. China;
b
College of Animal Science & Technology,
Northeast Agricultural University, Harbin, P.R. China;
c
Zhejiang Provincial Engineering Laboratory for Animal Health Inspection and Internet
Technology, College of Animal Science & Technology College of Veterinary Medicine, Zhejiang A&f University, Hangzhou, P.R. China;
d
Zhejiang International Science and Technology Cooperation Base for Veterinary Medicine and Health Management, College of Animal
Science & Technology College of Veterinary Medicine, Zhejiang A&f University, Hangzhou, P.R. China
ABSTRACT
Feline viral diseases, such as feline panleukopenia, feline infectious peritonitis, and feline corona-
viral enteritis, seriously endanger the health of cats, and restrict the development of pet industry.
Meanwhile, there is a current lack of effective vaccines to protect against feline viral diseases.
Thus, effective therapeutic agents are highly desirable. Interferons (IFNs) are important mediators
of the antiviral host defense in animals, particularly type I IFNs. In this study, a novel feline IFN
omega (feIFN-ω) gene was extracted from the cat stimulated with feline parvovirus (FPV) com-
bined with poly(I:C), and following codon optimization encoding the feIFN-ω, the desired gene
(feIFN-ω’) fragment was inserted into plasmid pPICZαA, and transformed into Pichia pastoris
GS115, generating a recombinant P. pastoris GS115 strain expressing the feIFN-ω’. After induction,
we found that the expression level of the feIFN-ω’ was two times more than that of feIFN-ω
(p < 0.01). Subsequently, the feIFN-ω’ was purified and modified with polyethylene glycol, and its
antiviral efficacy was evaluated in vitro and in vivo, using vesicular stomatitis virus (VSV) and FPV
as model virus. Our results clearly demonstrated that the feIFN-ω’ had significant antiviral
activities on both homologous and heterologous animal cells in vitro. Importantly, the feIFN-ω’
can effectively promote the expression of antiviral proteins IFIT3, ISG15, Mx1, and ISG56, and
further enhance host defense to eliminate FPV infection in vivo, suggesting a potential candidate
for the development of therapeutic agent against feline viral diseases.
ARTICLE HISTORY
Received 25 November 2021
Revised 29 December 2021
Accepted 11 January 2022
KEYWORDS
feIFN-ω; codon optimization;
Pichia pastoris; antiviral
efficacy
Introduction
Interferon (IFN) is an antiviral protein found from
influenza virus-infected chicken embryos in 1957, and
subsequent studies have demonstrated that human and
animal cells also can produce IFNs, which are consid-
ered as the main natural immune barrier for the host
against viral infections [1–5]. IFNs are the main choice
of antiviral drugs in the current clinical use. According
to the structure, functional characteristics, and receptor
of IFNs, IFNs can be divided into three subtypes
including type I, type II and type III [6]. Among
them, type I IFNs play an important role in promoting
host defense against virus infections, including IFN-α,
IFN-β, IFN-ε, IFN-ω, IFN-κ, IFN-δ, IFN-τ, and IFN-ζ,
in particular IFN-α, and IFN-ω, with potent immuno-
modulatory, antiviral, and antiproliferative properties
[7]. Type II IFN, also known as IFN-γ, can induce
a series of immune responses and regulate immune
system, which acts as an antiviral agent by mainly
inhibiting viral activity [8]. Type III IFN, or IFN-λ
family, is composed of IFN-λ1, IFN-λ2, IFN-λ3, and
IFN-λ4, with antiviral activity [9,10].
Nowadays, it is more and more common to keep
companion animals, especially pet cats. However, cat
viral diseases, such as feline infectious peritonitis
caused by feline infectious peritonitis virus (FIPV),
feline panleukopenia caused by feline parvovirus
(FPV), and cat enteritis caused by feline enteric coro-
navirus seriously endanger the health of cats and the
development of the pet cat industry [11–14]. In addi-
tion, there is a current lack of effective vaccines to
protect against cat viral diseases. Therefore, effective
therapeutic agents for cat viral diseases are highly
CONTACT Yigang Xu yigangxu@zafu.edu.cn; yigangxu_china@sohu.com
#
Yixin Wang, Sheng Jiang, and Xiaoxia Jiang are joint first authors.
VIRULENCE
2022, VOL. 13, NO. 1, 297–309
https://doi.org/10.1080/21505594.2022.2029330
© 2022 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted
use, distribution, and reproduction in any medium, provided the original work is properly cited.

desirable. IFN-ω, first reported in 1985 [15], is secreted
primarily by leukocytes, which has now been found in
humans [16] and some animals including cats [17,18],
pigs [19], and horses [20], etc. IFN-ω combines with
IFN receptor complex and activates phosphatidylinosi-
tol-3-kinase/protein kinase B (P13K/Akt) signal path-
way to exert antiviral activity, thereby achieving the
effect of inhibiting viruses [21,22]. Compared with
IFN-α, IFN-ω can significantly inhibit virus replication
[23–25], suggesting a promising antiviral agent.
In this study, in order to develop a potent antiviral
agent for the treatment of cat viral diseases, a gene
encoding a novel feline IFN-ω (feIFN-ω) was obtained
from the peripheral blood of the cat stimulated with
FPV combined with poly(I:C). Following codon opti-
mization of the gene encoding feIFN-ω, the desired
feIFN-ω’ was produced by a recombinant Pichia pas-
toris strain, and after being modified with polyethylene
glycol, the antiviral efficacy of the feIFN-ω’ was evalu-
ated in vitro and in vivo.
Materials and methods
Animal, viruses, bacterial strain, cells, and plasmid
Healthy 4-month-old Dragon Li cats (n = 20) were
purchased from a pet market in China. Animal experi-
ments were carried out in accordance with the recom-
mendations in the Guide for the Care and Use of
Laboratory Animals of the National Institutes of
Health, and were approved by the Ethical Committee
for Animal Experiments of Zhejiang A&F University
(ZAFUAC2021021), China. Vesicular stomatitis virus
(VSV) and feline parvovirus (FPV) were kept in our
laboratory. Pichia pastoris strain GS115 (P. pastoris
GS115) kept in our laboratory was cultured in Yeast-
extract Peptone Dextrose (YPD) medium (Solarbio,
China) at 30°C. Madin–Darby bovine kidney (MDBK)
cells, Madin–Darby canine kidney (MDCK) cells, and
feline kidney (F81) cells were cultured in Dulbecco’s
Modified Eagle Medium, DMEM (Gibco, USA) supple-
mented with 10% fetal bovine serum, FBS (Gibco, USA)
in a 5% CO
2
incubator at 37°C. The plasmid pPICZαA
kept in our laboratory was used to construct recombi-
nant P. pastoris expressing feline IFN-ω.
Cloning of gene encoding feIFN-ω
The cat was co-stimulated by 500 µL of FPV (10
3
TCID
50
) and 500 µL of 1.0 mg/mL poly(I:C) (Sigma,
USA) through subcutaneous injection route for three
consecutive days. On day 10 post-stimulation, the per-
ipheral blood of the cat was collected, and the total
RNA was extracted by Total RNA Isolation kit
(Invitrogen, USA) followed by reverse transcription,
generating first-strand cDNA. Next, using the cDNA
as template, a gene encoding feIFN-ω was obtained by
PCR amplification with the primer pair listed in
Table 1. After that, the PCR product of interest was
purified and subcloned into pMD-19 T plasmid, gen-
erating recombinant plasmid pMD-ω, followed by gene
sequencing (Kumei, China).
Gene sequence analysis
The gene encoding feIFN-ω were deposited in
GenBank under accession number MT754935.
Homology and phylogenetic tree analysis of the
feIFN-ω gene were performed using DNASTAR and
MEGA7 software.
Codon optimization of the feIFN-ω gene sequences
In this study, we aimed to produce the feIFN-ω by yeast
to test its antiviral efficacy in vitro and in vivo, and
therefore we optimized the codons of the gene encod-
ing the feIFN-ω according to the codon usage bias of
P. pastoris, including predominant codons usage, the
adjustment of GC content, and AT-rich repeat region.
However, no amino acid sequences of the feIFN-ω were
changed. Subsequently, the optimized gene (named
feIFN-ω’) was synthesized (Kumei, China), which was
harbored in a recombinant plasmid pMD-ω’.
Table 1. Primers used in this study.
Gene Primer sequences (5’→3’) References
feIFN-ω F: ATGGCCCTCCTGCTCCC In this work
R: AGATGAGCCCAGGTCTCCAT
FPV-VP2 F: CTGGAGGACGAGGGATACAGTGAC In this work
R: GGTCGCCGAGGAGGACAAGG
Mx1 F: TTCGGAGGTGGAGGAGGCAATC In this work
R: CAGGGAGGTCTATCAGGGTCAGATC
ISG15 F: AACCACAAGGGTCGCACCATTG In this work
R: TGCTGGCATATCTGCTGCTTGAG
IFIT3 F: TGAAGCTGGCAAGAATGGAGAGAAG In this work
R: GGAGGTCGGTGACATCAGAATATGC
ISG56 F: GCAACTACGCCTGGCTGTATCAC In this work
R: CCCACCCTTCCTCACAGTCCATC
IL-1β F: ATTGTGGCTATGGAGAAACTGAAG [38]
R: TCTTCTTCAAAGATGCAGCAAAAG
IL-4 F: CCCCTAAGAACACAAGTGACAAG [42]
R: CCTTTGAGGAATTTGGTGGAG
IL-6 F: GTGTGACAACTATAACAAATGTGAGG [38]
R: GTCTCCTGATTGAACCCAGATTG
IL-10 F: ACTTTCTTTCAAACCAAGGACGAG [38]
R: GGCATCACCTCCTCCAAATAAAAC
IL-12 F: TGGCCTTCTGAAGCGTGTTG [42]
R: GAAGTACACAGTGGAGTGTCAGG
TNF-α F: TGCTTGTGCCTCAGCCTC In this work
R: ACTGGCTTGTCACTCGGAGT
β-actin F: GACTACCTCATGAAGATCCTCACG [38]
R: CCTTGATGTCACGCACAATTTCC
298 Y. WANG ET AL.

Expression of the feIFN-ω’ by recombinant
P. pastoris and modification with polyethylene
glycol
The recombinant plasmid pMD-ω containing the feIFN-
ω gene (or pMD-ω’ containing the optimized feIFN-ω’
gene) and vector pPICZαA were, respectively, digested by
BamH I and Kpn I (NEB, USA), and the gene fragments
of interest were purified, followed by ligation with T4
DNA ligase (Takara, China), generating the recombinant
plasmid pPICZαA-ω (or pPICZαA-ω’). Next, the recom-
binant plasmid pPICZαA-ω (or pPICZαA-ω’) was linear-
ized by AVRII enzyme digestion (NEB, USA), and then
the linearized pPICZαA-ω (or pPICZαA-ω’) was electro-
porated into the P. pastoris GS115 competent cells, fol-
lowed by screening positive clones on YPD plates
supplemented with 100 µg/mL of Zeocin (Sigma, USA),
generating the recombinant strains named GS115-
pPICZαA-ω or GS115-pPICZαA-ω’. In order to produce
the feline interferon, the recombinant strain GS115-
pPICZαA-ω (or GS115-pPICZαA-ω’) was grown over-
night to an OD
600
of approximately 1.5 in BMGY med-
ium (Solarbio, China). After centrifugation, the cells
pellets were transferred into BMMY medium containing
1.5% YNB, biotin, and 0.05% methanol (Solarbio, China),
and cultured for 120 h. Sterile-filtered methanol was
supplemented every 24 h to maintain induction condi-
tion. The expression level of the feIFN-ω in GS115-
pPICZαA-ω (and GS115-pPICZαA-ω’) and its culture
supernatants was analyzed by 12% SDS-PAGE. After
that, the feIFN-ω’ was purified by Ni
2+
affinity chromato-
graphy column, and PEGylation was conducted in
sodium borate buffer with the feIFN-ω’ and 40 kDa
mPEG-2-N-hydroxysuccinimide, and then the polyethy-
lene glycol-modified feIFN-ω’ was purified by
a Q-Sepharose column [26].
Determination of antiviral activity of the feIFN-ω’
in vitro
The antiviral activity of the recombinant feIFN-ω’ was
determined by microdose cytopathogenic effect inhibi-
tion assay (MCIA) in vitro using VSV and FPV as
model viruses. The supernatants from induced GS115-
pPICZαA-ω’ were serially 10-fold diluted in DMEM sup-
plemented with 5% FBS, and were then added into a 96-
well plate (8 replicates per dilution) followed by addition
of MDBK cells to a concentration of 5 × 10
4
cells/well.
Then, the MDBK cells were incubated at 37°C in a 5%
CO2 incubator for 24 h. After discarding the superna-
tants, the MDBK cells were infected with VSV (or FPV) at
an MOI of 1.0. When the cytopathic effect (CPE) reached
100% in virus control group (untreated with feIFN-ω’),
the cells were stained with 0.1% (w/v) of crystal violet, and
incubated at 37°C for 30 min. After elution with 50%
ethanol-0.1% acetic acid, absorbance was measured at
595 nm. In parallel, the supernatants from GS115-
pPICZαA were used as negative control. Subsequently,
the antiviral activity of the feIFN-ω’ purified by Ni
2+
affinity chromatography column at a concentration of
0.001 ng ~ 10 ng was determined by MCIA, using FPV
as model virus and INTERCAT IFN (Toray Industries,
Japan) as feline IFN positive control. The test was
repeated five times. Furthermore, the species-specific
antiviral activity was also determined by the ability of
the feIFN-ω’ to inhibit the CPE of VSV on F81 cells,
MDCK cells, and MDBK cells. In parallel, the
INTERCAT IFN was used as feline IFN control. The
assay was repeated three times (8 replicates each sample).
Determination of antiviral activity of the
polyethylene glycol-modified feIFN-ω’ in vivo
In order to determine the antiviral efficacy of the poly-
ethylene glycol-modified feIFN-ω’ in vivo, eighteen
4-month-old Dragon Li cats were randomly divided
into three groups: FPV infection group (cat was
infected with 10
5
TCID
50
FPV via subcutaneous and
digestive routes; n = 6), feIFN-ω’ treatment group (cat
was infected with FPV followed by treatment with the
polyethylene glycol-modified feIFN-ω’ at a dose of
150 μg/0.5 mL, twice, 5 days apart; n = 6), and normal
control group (mock group; n = 6). On days 5 and 15
after challenge, three cats were randomly selected from
each group, respectively, and the viral loads of the FPV
in blood, kidney, liver, spleen, intestine, and feces of the
cats were determined using a SYBR Green I-based real-
time quantitative RT-PCR (RT-qPCR) assay with the
primer pair targeting the FPV VP2 gene (listed in
Table 1). Meanwhile, the presence of viral antigen in
the intestinal tract of the cats from each group was
detected on day 10 after the primary feIFN-ω’ treat-
ment by an immunohistochemistry (IHC) assay using
a mouse anti-FPV VP2 polyclonal antibody (prepared
in our laboratory; diluted at 1:100) as the primary anti-
body and HRP-conjugated goat anti-mouse IgG anti-
body (Abcam, USA; diluted at 1:1000) as the secondary
antibody. Moreover, the cats in each group were bled
on days 0, 5, 10, and 15 after FPV infection using the
blood-diluting pipettes, followed by total white blood
cell (WBC) counts with Fuchs-Rosenthal counting
chambers. At the same time, using β-actin as internal
control, the mRNA transcript levels of antiviral pro-
teins Mx1, ISG15, ISG56, and IFIT3, and cytokines
including IL-1β, TNF-α, IL-4, IL-6, IL-10, and IL-12
in the blood samples of the cats from each group were
determined on day 10 after feIFN-ω’ treatment by RT-
qPCR assay with the primer pairs listed in Table 1. In
VIRULENCE 299

addition, the protein expression levels of the antiviral
proteins Mx1, ISG15, ISG56, and IFIT3 were deter-
mined by Western blot using rabbit anti-Mx1/ISG15/
ISG56/IFIT3 polyclonal antibody (ABclonal, USA;
diluted at 1:1000) as the primary antibody and HRP-
conjugated goat anti-rabbit IgG antibody (Abcam,
USA; diluted at 1:2000) as the secondary antibody,
respectively. After that, the immunoblot band was
visualized using chemiluminescent substrate reagent
(Thermo Fisher Scientific, USA).
Statistical analysis
In this work, data were shown as mean ± standard
error (SE) values, and Tukey’s multiple comparison
tests and one-way analysis of variance (ANOVA) were
used to analyze the differences among groups by
GraphPad Prism V8.0 software.
Results
Cloning and phylogenetic analysis of feIFN-ω gene
After being stimulated by FPV combined with poly(I:C),
a gene of approximately 612 bp encoding feIFN-ω was
amplified by RT-PCR from the peripheral blood of the cat
(Figure 1a), and phylogenetic analysis of the feIFN-ω gene
was performed by the neighbor-joining method (1000
replicates) using MEGA 7 software to explore the evolu-
tionary relationships between the feIFN-ω gene obtained in
this study and other IFNs published in GenBank. As shown
in Figure 1b, the feIFN-ω gene that was obtained in this
study belonged to the type I IFN family, which shared
relatively distant genetic relationships with other feIFN-ωs
published in GenBank, indicating that a novel feIFN-ω was
obtained in this study. We further predicted the three-
dimensional (3D) structure of the feIFN-ω by an online
tool (http://www.sbg.bio.ic.ac.uk), and result demonstrated
Figure 1. A: Amplification of feIFN-ω gene by RT-PCR. M: DNA Marker DL2000; lanes 1–5: the feIFN-ω gene amplified from the
peripheral blood of cat. B: Phylogenetic tree analysis of the feIFN-ω gene by neighbor-joining method (1000 replicates) using MEGA
7 software. C: Predicted three-dimensional structure of the feIFN-ω.
300 Y. WANG ET AL.

Figure 2. A: Codon optimization of the feIFN-ω according to the codon usage bias of P. pastoris. B: The expression level of feIFN-ω by
the GS115-pPICZαA-ω before codon optimization. M: Protein marker; lane 1: feIFN-ω in cells; lane 2: feIFN-ω in supernatants; lane 3:
purified feIFN-ω. C: The expression level of feIFN-ω’ by the GS115-pPICZαA-ω’ after codon optimization. M: Protein marker; lane 1:
feIFN-ω’ in cells; lane 2: feIFN-ω’ in supernatants; lane 3: purified feIFN-ω’. D: Comparison of feIFN-ω expression levels before and
after codon optimization.
VIRULENCE 301

that the 3D structure of the feIFN-ω conformed to the 3D
structural characteristics of type I IFN (Figure 1c).
Codon optimization of the gene encoding feIFN-ω
and its expression by P. pastoris
In order to achieve highly efficient expression of the
feIFN-ω by P. pastoris, the gene sequences encoding the
feIFN-ω were optimized according to the codon usage
bias of P. pastoris (Figure 2a). Subsequently, the recom-
binant strain GS115-pPICZαA-ω expressing feIFN-ω
and strain GS115-pPICZαA-ω’ expressing feIFN-ω’
(optimized feIFN-ω) was constructed, respectively.
Following induction with methanol, the IFN protein
of interest that was expressed by the recombinant
strains was detected by SDS-PAGE, and results showed
that the feline IFN-ω can be effectively produced by the
recombinant strain GS115-pPICZαA-ω (Figure 2b) and
strain GS115-pPICZαA-ω’ (Figure 2c). By contrast, we
found that the expression level of optimized feIFN-ω’
was two times more than that of unoptimized feIFN-ω
(p < 0.01) (Figure 2d).
Figure 3. Antiviral activity of the supernatants of the GS115-
pPICZαA-ω’ induced by methanol. F81 cells were incubated in
the presence of the indicated dilutions of supernatants contain-
ing feIFN-ω for 24 h, followed by infection with VSV and FPV,
respectively. When CPE in virus control group reached 100%,
the cells were stained with crystal violet followed by measuring
the absorbance at 595 nm. The connecting curve (red line in
the figure) in each group was set up using GraphPad Prism 8.0
software.
Figure 4. Antiviral activity of the purified feIFN-ω’ using FPV as
model virus. F81 cells grown to confluence were treated with
the indicated amounts of purified feIFN-ω’ for 24 h, followed by
infection with FPV at an MOI of 1.0. When CPE in virus control
group reached 100%, the cells were stained with crystal violet
followed by measuring the absorbance at 595 nm. In parallel,
Intercat IFN was used as positive control. *p < 0.05; **p < 0.01.
Figure 5. Antiviral activities of the purified feIFN-ω’ and Intercat
IFN on F81 cells, MDCK cells, and MDBK cells utilizing
a standard VSV assay.
302 Y. WANG ET AL.

Biological activity of the recombinant feIFN-ω’
in vitro
In order to evaluate the biological activity of the recom-
binant GS115-expressed feIFN-ω’, we first tested the
antiviral activity of the supernatants of the recombinant
strain GS115-pPICZαA-ω’ induced with methanol,
using VSV and FPV as model viruses. As shown in
Figure 3, a significant reduction in the VSV- and FPV-
induced CPE on the MDBK cells can be observed,
exhibiting an effective antiviral activity with a dose-
dependence. Subsequently, we tested the antiviral activ-
ity of the purified recombinant feIFN-ω’ expressed by
Figure 6. A: Changes of viral loads in blood, kidney, liver, spleen, intestine, and feces of the cats in normal control group, FPV
infection group, and feIFN-ω treatment group determined by a RT-qPCR assay. B: The total WBC counts of the cats in each group.
VIRULENCE 303

the GS115-pPICZαA-ω’ using INTERCAT IFN as feline
interferon-ω positive control, and results showed that
the purified feIFN-ω’ displayed significant antiviral
activity with a dose-dependence (Figure 4). By contrast,
the antiviral activity of the recombinant feIFN-ω’ was
better than that of the INTERCAT IFN control.
Furthermore, we tested the species-specific antiviral
activity of the purified feIFN-ω’ by determining the
ability to inhibit the CPE of VSV on F81 cells, MDCK
cells, and MDBK cells, using INTERCAT IFN as
a control. As shown in Figure 5, a significant reduction
in the VSV-induced CPE on the F81 cells, MDCK cells,
and MDBK cells can be observed with a dose-
dependence in the feIFN-ω’ treatment cell groups.
However, in INTERCAT IFN treatment cell groups,
significant reduction in the VSV-induced CPE on F81
cells can only be observed, but not on MDCK cells, and
MDBK cells.
Antiviral activity of the recombinant feIFN-ω’
in vivo
In order to evaluate the antiviral activity of the recom-
binant feIFN-ω’ in vivo, the cats were infected with
FPV followed by the feIFN-ω’ therapy. Our results
showed that after the feIFN-ω’ treatment, virus loads
in blood, kidney, liver, spleen, intestine, and feces of the
cats in the feIFN-ω’ treatment group significantly
decreased on days 10 after feIFN-ω’ treatment, indicat-
ing effective antiviral activity of the recombinant feIFN-
ω’ in vivo (Figure 6a). However, in FPV-infected cat
group (without feIFN-ω’ treatment), the virus titers in
blood, kidney, liver, spleen, intestine, and feces of the
cats significantly increased, and some cats developed
severe clinical symptoms and were euthanized after the
experiment. During a 15-day monitoring period, we
counted the total WBC in blood of the cats in each
group, and results showed that compared to the normal
control group, the total WBC counts in FPV-infected
cat group significantly decreased, while the total WBC
counts of the FPV-infected cats were gradually returned
to normal after treatment with the feIFN-ω’
(Figure 6b).
In addition, on day 10 after the feIFN-ω’ treatment,
we determined the mRNA transcript levels and protein
expression levels of the antiviral proteins Mx1, ISG15,
ISG56, and IFIT3 in the blood of the cats from each
group using RT-qPCR assay and Western blot assay,
respectively. As shown in Figure 7, both the mRNA
transcript levels (Figure 7a) and protein expression
levels (Figure 7b) of these antiviral proteins were sig-
nificantly higher than those in mock control group
(p < 0.01) and FPV infection group (p < 0.05), indicat-
ing that the feIFN-ω’ can effectively promote the
expression of antiviral proteins. Furthermore, we also
determined the mRNA transcript levels of cytokines IL-
1β, TNF-α, IL-4, IL-6, IL-10, and IL-12 in the blood
Figure 7. The mRNA transcript levels (a) and protein expression levels (b) of antiviral proteins Mx1, ISG15, ISG56, and IFIT3 in the
blood of the cats from each group were detected by SYBR Green I RT-qPCR and Western blot, respectively, using β-actin as internal
control. The lowercase letters “a versus b, and b versus c” indicate significant difference of p < 0.05; “a versus c” indicates significant
difference of p < 0.01.
304 Y. WANG ET AL.

samples of the cats from each group by RT-qPCR, and
results showed that compared to the FPV infection
group, the levels of these cytokines significantly
decreased (p < 0.05 or p < 0.01) in the feIFN-ω’ treat-
ment, but still significantly higher (p < 0.05) than those
in the mock control group (Figure 8). Finally, we used
the IHC assay to detect the FPV loaded in the intestinal
tract of the cat from each group on day 10 after feIFN-
ω’ treatment, and found that there was no virus
detected in the feIFN-ω’ treatment group, while large
Figure 8. The mRNA transcript levels of cytokines IL-1β, TNF-α, IL-4, IL-6, IL-10, and IL-12 in the blood samples of the cats from each
group were determined by RT-qPCR assay on day 10 after feIFN-ω’ treatment. The lowercase letters “a versus b, b versus c, and
c versus d” indicate significant difference of p < 0.05; “a versus c, and b versus d” indicates significant difference of p < 0.01; “a
versus d” indicates significant difference of p < 0.001.
Figure 9. The presence of viral antigen in the intestinal tract of the cats from each group was detected on day 10 after feIFN-ω’
treatment by IHC assay using mouse anti-FPV VP2 polyclonal antibody as the primary antibody and HRP-conjugated goat anti-mouse
IgG antibody as the secondary antibody.
VIRULENCE 305

amounts of viruses were observed in the FPV infection
group (Figure 9).
Discussion
Viral diseases in pet cats such as feline leukemia, feline
panleukopenia, and feline infectious peritonitis, with
high incidences, are still difficult to prevent due to the
lack of effective vaccine products. IFN with good anti-
viral activity shows positive effects for treating viral
diseases in cats [27–30]. In this study, a gene encoding
a novel feIFN-ω was cloned from the peripheral blood
of cat stimulated with FPV combined with ploy (I:C),
and with codon optimization of the feIFN-ω gene, the
IFN-ω was produced by a recombinant P. pastoris
induced with methanol, and its antiviral activity was
evaluated in vitro and in vivo.
Protein expression system includes prokaryotic and
eukaryotic systems. Although prokaryotic expression
system is most commonly used [18], the activity of
expressed proteins is not good. For example, using
prokaryotic system to produce interferon, it is neces-
sary to extract the inclusion bodies in cells to obtain the
protein of interest, followed by denaturation, refolding,
conformational change in vitro, which is time-
consuming and laborious, increases the production
cost, and also leads to serious protein loss with some
biological activity loss [31,32]. Yeast expression system
is a kind of eukaryotic expression system, and the
expressed target protein can complete the modified
folding closest to the natural protein in cells [33], and
can be secreted into the supernatants, which is condu-
cive to target protein extraction and purification,
achieving the goal of low cost and high return [34].
Therefore, we used a yeast (P. pastoris) expression
system to produce the feIFN-ω in this study, and our
result showed that the feIFN-ω can be effectively
expressed by P. pastoris and secreted into supernatants.
Importantly, the efficient expression of exogenous
protein in P. pastoris is related to the conformity of
expression system, selection of vectors, expression con-
ditions, and other factors [35,36]. Moreover, rare
codons will affect the transcription and translation;
the difference between the foreign gene and the host
will affect the expression of the target protein; continu-
ously repeated AT bases will end transcription in
advance [35]. Therefore, codon optimization is
a commonly adopted strategy for improved protein
expression [36]. In this study, in order to further
improve the expression level of the feIFN-ω in recom-
binant P. pastoris, the gene sequences encoding the
feIFN-ω were subjected to optimization according to
the codon usage bias for P. pastoris, such as using high-
frequency dominant codon, reducing the GC content,
adjusting AT-rich regions, etc. [37–39]. With the codon
optimization, the expression level of the feIFN-ω’ (after
optimization) by the recombinant GS115-pPICZαA-ω’
was nearly two times higher than that of the feIFN-ω
(before optimization) expressed by the recombinant
GS115-pPICZαA-ω, indicating that the optimization
of codon usage bias for P. pastoris could significantly
improve protein expression of the interest.
Subsequently, we systematically assessed the antiviral
activity of the feIFN-ω’ in vitro and in vivo. In vitro, we
first analyzed the antiviral activity of the supernatants
secreted by GS115-pPICZαA-ω’, and results showed
Figure 10. Global overview of the gene clone, codon optimization, expression, purification and antiviral effect evaluation of the
novel feIFN-ω.
306 Y. WANG ET AL.

that the supernatants displayed effective antiviral activ-
ity with a dose-dependence, and significant reduction
in CPE on the MDBK cells infected by VSV and FPV
was observed, while not observed in negative control
group. Then, we purified the recombinant feIFN-ω’ and
further tested its antiviral activity, and our data showed
that the purified feIFN-ω’ also displayed effective anti-
viral activity, and significant reduction in the FPV-
induced CPE can be observed. By contrast, the antiviral
effect of the feIFN-ω’ obtained in this study was better
than that of INTERCAT IFN. Utilizing a standard VSV
assay, we evaluated the antiviral effect of the feIFN-ω’
on F81 cells (feline), MDBK cells (bovine), and MDCK
cells (canine) using the INTERCAT IFN as positive
control, and our data showed that the feIFN-ω’ showed
highly efficient antiviral effect against VSV on homo-
logous and heterologous animal cells. However, the
INTERCAT IFN only showed effective antiviral effect
against VSV on homologous animal cells, but not on
MDBK and MDCK, which was consistent with pre-
vious report [17].
Before performing in vivo experiments to evaluate
the antiviral effect of the recombinant feIFN-ω’, in
order to enhance the stability of the feIFN-ω’ and
extend its half-life in vivo, the feIFN-ω’ was modified
with polyethylene glycol. And then, the animal experi-
ment was carried out. The cats were infected with feline
parvovirus (FPV), followed by feIFN-ω’ treatment,
using FPV-infected cats without interferon treatment
as control. We found that the viral loads in blood,
kidney, liver, spleen, intestine, and feces of the FPV-
infected cats with the feIFN-ω’ treatment (feIFN-ω’
treatment group) significantly decreased, and the virus
could be effectively eliminated detected by IHC assay,
indicating that the FPV replication was effectively
inhibited. However, the viral loads in FPV-infected
cats without feIFN-ω’ treatment (FPV infection
group) continued to increase. FPV infection can cause
panleukopenia in cats. So, we determined the total
WBC levels in the cats from mock control group,
FPV infection group, and feIFN-ω’ treatment group.
Our data showed that the total WBC counts signifi-
cantly decreased after virus infection, and with the
feIFN-ω’ treatment, the total WBC counts in feIFN-ω’
treatment group were gradually returned to normal, but
not in FPV infection group, indicating effective thera-
peutic effect of the feIFN-ω’. To further explore the
antiviral effect of the feIFN-ω’, the mRNA levels and
protein levels of the antiviral proteins Mx1, ISG15,
ISG56, and IFIT3 in the blood of the cats from each
group were determined, and from these results, we
clearly see that the feIFN-ω’ treatment can significantly
promote the expression of antiviral proteins Mx1,
ISG15, ISG56, and IFIT3, which would further exert
their antiviral functions to inhibit the replication of
FPV. Many studies have also demonstrated that inter-
feron ω could stimulate the expression of the antiviral
proteins ISGs [40,41]. In addition, we also found that
the mRNA transcript levels of pro-inflammatory cyto-
kines IL-1β, TNF-α, IL-6, and IL-12, and anti-
inflammatory cytokines IL-4, and IL-10 tended to
decrease (p < 0.05 or p < 0.01) in the cats from the
feIFN-ω’ treatment group, compared with the FPV
infection group. These findings are consistent with an
overall reduction of pro-inflammatory pathways in cats
treated with IFN [24].
A global overview of the gene clone, codon optimi-
zation, expression, and antiviral effect evaluation of
a novel feIFN-ω is given in Figure 10. In conclusion,
we cloned a gene encoding a novel feIFN-ω, optimized
its codons according to the codon usage bias of
P. pastoris, and achieved highly efficient expression of
the feIFN-ω from a recombinant P. pastoris. The anti-
viral efficacy of the feIFN-ω was subsequently evalu-
ated, and our results clearly demonstrated that the
feIFN-ω displayed effective antiviral activity against
VSV and FPV, suggesting a promising therapeutic
agent for viral diseases in cats.
Acknowledgments
This work was supported by the Research and Development
Fund of Zhejiang A&F University (grant number
2021FR034), the National Key R&D Program of China
(grant number 2016YFD0501003), and Heilongjiang
Provincial Natural Science Foundation of China (grant num-
ber LH2021C046).
Disclosure statement
No potential conflict of interest was reported by the authors.
Funding
This work was supported by the Research and Development
Fund of Zhejiang A&F University (grant number
2021FR034), the National Key R&D Program of China
(grant number 2016YFD0501003), and Heilongjiang
Provincial Natural Science Foundation of China (grant num-
ber LH2021C046).
Data availability statement
The authors confirm that the data supporting the findings of
this study are available within the article [and/or] its supple-
mentary materials. https://www.ncbi.nlm.nih.gov/nuccore/
MT754935.1
VIRULENCE 307

ORCID
Xiaobo Sun http://orcid.org/0000-0003-0487-5915
Houhui Song http://orcid.org/0000-0001-6530-5794
Yigang Xu http://orcid.org/0000-0001-7085-7227
References
[1] Sedger LM. MicroRNA control of interferons and
interferon induced anti-viral activity. Mol Immunol.
2013;56(4):781–793.
[2] Russell KD, Sergei VK, Joan ED. Interferon induction
and function at the mucosal surface. Immunol Rev.
2013;255(1):25–39.
[3] Mou C, Pan S, Wu H, et al. Disruption of interferon-β
production by the N pro of atypical porcine pestivirus.
Virulence. 2021;12(1):654–665.
[4] Fanunza E, Carletti F, Quartu M, et al. Zika virus NS2A
inhibits interferon signaling by degradation of STAT1
and STAT2. Virulence. 2021;12(1):1580–1596.
[5] Shang J, Zheng Y, Mo J, et al. Sox4 represses host
innate immunity to facilitate pathogen infection by
hijacking the TLR signaling networks. Virulence.
2021;12(1):704–722.
[6] Lin JD, Feng N, Sen A, et al. Distinct roles of type I and
type III interferons in intestinal immunity to homolo-
gous and heterologous rotavirus infections. PloS
Pathog. 2016;12(4):e1005600.
[7] Minayoshi Y, Maeda H, Yanagisawa H, et al.
Development of Kupffer cell targeting
type-I interferon for the treatment of hepatitis via
inducing anti-inflammatory and immunomodulatory
actions. Drug Deliv. 2018;25(1):1055–1065.
[8] Platanias LC. Mechanisms of type I and type II
interferon-mediated signaling. Nat Rev Immunol.
2005;5(5):375–386.
[9] Lopusna K, Rezuchova I, Betakova T, et al. Interferons
lambda, new cytokines with antiviral activity. Acta
Virol. 2013;57(2):171–179.
[10] Gao D, Yu X, Zhang B, et al. Role of autophagy in
inhibiting the proliferation of A549 cells by type III
interferon. Cell Biol Int. 2019;43(6):605–612.
[11] Stuetzer B, Hartmann K. Feline parvovirus infection
and associated diseases. Vet J. 2014;201(2):150–155.
[12] Cheng N, Zhao Y, Han Q, et al. Development of
a reverse genetics system for a feline panleukopenia
virus. Virus Genes. 2019;55(1):95–103.
[13] Cave T, Thompson H, Reid S, et al. Kitten mortality in
the United Kingdom: a retrospective analysis of 274
histopathological examinations (1986 to 2000). Vet
Rec. 2002;151(17):497–501.
[14] Domenech A, Miro G, Collado VM, et al. Use of
recombinant interferon omega in feline retrovirosis:
from theory to practice. Vet Immunol Immunopathol.
2011;143(3–4):301–306.
[15] Freaney JE, Zhang Q, Yigit E, et al. High density
nucleosome occupancy map of human chromosome
9p21-22 reveals chromatin organization of the type
I interferon gene cluster. J Interf Cytok Res. 2014;34
(9):676–685.
[16] Xu C, Song X, Fu L, et al. Antiviral potential of exo-
genous human omega interferon to inhibit pandemic
2009 A (H1N1) influenza virus. Viral Immunol.
2011;24(5):369–374.
[17] Yang LM, Xue QH, Sun L, et al. Cloning and charac-
terization of A Novel feline IFN-ω. J Interf Cytok Res.
2007;27(2):119–127.
[18] Wang X, Li F, Han M, et al. Cloning, prokaryotic
soluble expression, and analysis of antiviral activity of
two novel feline IFN-ω proteins. Viruses. 2020;12
(3):335.
[19] Sang Y, Rowland RR, Hesse RA, et al. Differential
expression and activity of the porcine type
I interferon family. Physiol Genomics. 2010;42
(2):248–258.
[20] Detournay O, Morrison DA, Wagner B, et al. Genomic
analysis and mRNA expression of equine type
I interferon genes. J Interf Cytok Res. 2013;33
(12):746–759.
[21] Seo Y, Kim M, Choi M, et al. Possible role of
phosphoinositide-3-kinase in Mx1 protein translation
and antiviral activity of interferon-omega-stimulated
HeLa cells. Pharmacology. 2011;87(3–4):224–231.
[22] Klarquist J, Cantrell R, Lehn MA, et al. Type I IFN
drives experimental systemic lupus erythematosus by
distinct mechanisms in CD4 T cells and B cells.
Immunohorizons. 2020;4(3):140–152.
[23] de Mari K, Maynard L, Sanquer A, et al. Therapeutic
effects of recombinant feline interferon-omega on
feline leukemia virus (FeLV)-infected and FeLV/feline
immunodeficiency virus (FIV)-coinfected symptomatic
cats. J Vet Intern Med. 2004;18(4):477–482.
[24] Leal RO, Gil S, Duarte A, et al. Evaluation of viremia,
proviral load and cytokine profile in naturally feline
immunodeficiency virus infected cats treated with two
different protocols of recombinant feline interferon
omega. Res Vet Sci. 2015;99:87–95.
[25] Skorvanova L, Svancarova P, Svetlikova D, et al.
Protective efficacy of IFN-ω AND IFN-λs against influ-
enza viruses in induced A549 cells. Acta Virol. 2015;59
(4):413–417.
[26] Du Y, Tian H, Gao XD, et al. Pharmacokinetic
properties of a 40 kDa branched polyethylene glycol-
modified form of consensus interferon-α (PEG-
CIFN) in Rhesus monkeys. Biopharm Drug Dispos.
2008;29(8):481–484.
[27] Leal RO, Gil S, Sepúlveda N, et al. Monitoring acute
phase proteins in retrovirus infected cats undergoing
feline interferon-ω therapy. J Small Anim Pract.
2014;55(1):39–45.
[28] Matsumoto H, Teshima T, Iizuka Y, et al. Evaluation
of the efficacy of the subcutaneous low recombinant
feline interferon-omega administration protocol for
feline chronic gingivitis-stomatitis in feline
calicivirus-positive cats. Res Vet Sci. 2018;118:3
24–330.
[29] Liu Y, Liu X, Kang H, et al. Identification of feline
interferon regulatory factor 1 as an efficient antiviral
factor against the replication of feline calicivirus and
other feline viruses. Biomed Res Int. 2018;8:1–10.
[30] Fiorito F, Cantiello A, Granato GE, et al. Clinical
improvement in feline herpesvirus 1 infected cats by
oral low dose of interleukin-12 plus interferon-gamma.
Comp Immunol Microbiol Infect Dis. 2016;48:41–47.
308 Y. WANG ET AL.

[31] Vincentelli R, Canaan S, Campanacci V, et al.
High-throughput automated refolding screening of
inclusion bodies. Protein Sci. 2004;13(10):278
2–2792.
[32] Feng Y, Zhang M, Zhang L, et al. An automatic refold-
ing apparatus for preparative-scale protein production.
PLoS ONE. 2012;7(9):e45891.
[33] Cregg JM, Cereghino JL, Shi J. Recombinant protein
expression in Pichia pastoris. Mol Biotechnol. 2000;16
(1):23–52.
[34] Wang QH, Gao LL, Liang HC, et al. [Research
advances of the influence factors of high level expres-
sion of recombinant protein in Pichia pastoris]. Acta
Pharma Sin. 2014;49(12):1644–1649.
[35] Baghban R, Farajnia S, Ghasemi Y, et al. New devel-
opments in Pichia pastoris expression system, review
and update. Curr Pharm Biotechnol. 2018;19
(6):451–467.
[36] Xu Y, Liu K, Han Y, et al. Codon usage bias regulates
gene expression and protein conformation in yeast
expression system P. pastoris. Microb Cell Fact.
2021;20(1):91.
[37] Kudla G, Lipinski L, Caffin F, et al. High guanine and
cytosine content increases mRNA levels in mammalian
cells. PLoS Biol. 2006;4(6):e180.
[38] Kiktev DA, Sheng Z, Lobachev KS, et al. GC content
elevates mutation and recombination rates in the yeast
Saccharomyces cerevisiae. Proc Natl Acad Sci. 2018;115
(30):E7109–E7118.
[39] Scott VL, Shack LA, Eells JB, et al. Immunomodulator
expression in trophoblasts from the feline immunodefi-
ciency virus (FIV)-infected cat. Virol J. 2011;8(1):336.
[40] Shields LE, Jennings J, Liu Q, et al. Cross-species gen-
ome-wide analysis reveals molecular and functional
diversity of the unconventional interferon-ω subtype.
Front Immunol. 2019;10:1431.
[41] Gao M, Guo Y, Luo X, et al. Design, biological activity
and signaling pathway of bovine consensus omega
interferon expressed in Pichia pastoris. Mol Immunol.
2019;106:46–52.
[42] Taglinger K, Van Nguyen N, Helps CR, et al.
Quantitative real-time RT-PCR measurement of cyto-
kine mRNA expression in the skin of normal cats and
cats with allergic skin disease. Vet Immunol
Immunopathol. 2008;122(3–4):216–230.
VIRULENCE 309