![Differential plating method. (A) Scheme showing the steps of differential plating method 411 according to Hinfray et al [50]. Briefly, a total testicular cell suspension obtained from enzymatic 412 digestion was harvested (step A) in L-15 culture medium. After 2 days of culture, only somatic cells 413 with adhesive properties (Sertoli cells, brown triangular shape; Leydig cells, yellow oval shape) 414 adhere to the bottom of the plate (step B), while germ cells (non-adherent cells; blue shape cells) 415 remain floating or loosely attached to the bottom of the plate (step C). After washing steps, it is 416 possible to remove the germ cells (floating and also those germ cells weakly attached to the somatic 417](https://www.researchgate.net/publication/357336479/figure/fig1/AS:1105420596842497@1640564216397/Differential-plating-method-A-Scheme-showing-the-steps-of-differential-plating-method_Q320.jpg)
Available via license: CC BY-NC-ND 4.0
Content may be subject to copyright.
Gdnf, a germ cell-derived factor, regulates zebrafish germ cell stemness 1
through the creation of new spermatogonial niches (germ and Sertoli cells) 2
and inhibition of spermatogonial differentiation in an autocrine and 3
paracrine manners 4
Lucas B. Doretto1, Arno J. Butzge1, Rafael T. Nakajima1, Emanuel R. M. Martinez1, Beatriz 5
Marques1, Maira da Silva Rodrigues1, Ivana F. Rosa1, Juliana M. B. Ricci1, Aldo Tovo-Neto1, 6
Daniel F. Costa1, Guilherme Malafaia1,2, Changwei Shao3, Rafael H. Nóbrega1* 7
8
1Reproductive and Molecular Biology Group, Department of Structural and Functional 9
Biology, Institute of Biosciences, São Paulo State University (UNESP), Botucatu, São Paulo, 10
Brazil. 11
2Biological Research Laboratory, Goiano Federal Institution – Urata Campus. Rodovia 12
Geraldo Silva Nascimento, 2,5 km, Zona Rural, Urutaí, GO, Brazil. 13
3Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Science (CAFS), 14
Laboratory for Marine Fisheries Science and Food Production Processes, Pilot National 15
Laboratory for Marine Science and Technology Qingdao, 266071, China 16
17
18 * Corresponding author: 19 Dr. Rafael H. Nóbrega 20 São Paulo State University (UNESP) - Botucatu - Brazil 21 Institute of Biosciences 22 Department of Structural and Functional Biology 23 Division Morphology 24 Reproductive and Molecular Biology Group 25 Email address: rafael.nobrega@unesp.br 26 27
28
29
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Abstract 30
Glial cell line-derived neurotrophic factor (GDNF) and its receptor (GDNF Family Receptor 31
1 - GFR 1) are well known to mediate spermatogonial stem cell (SSC) proliferation and 32
survival in the mammalian testes. In nonmammalian species, Gdnf and Gfr 1 orthologs have 33
been found but their functions remain poorly investigated in the testis. Considering this 34
background, this study aimed to understand the roles of Gdnf-Gfr 1 signaling pathway in the 35
zebrafish testis by combining in vivo, in silico and ex vivo approaches. Our analysis showed 36
that zebrafish exhibited two paralogs of Gndf (gdnfa and gdnfb) and its receptor, Gfr 1 37
(gfr 1a and gfr 1b), in agreement with the teleost-specific third round (3R) of whole genome 38
duplication. Expression analysis further revealed that gdnfa and gfr 1a were the most 39
expressed copies in the zebrafish adult testes. Subsequently, we demonstrated that gdnfa is 40
expressed in the germ cells, while Gfr 1a was detected in early spermatogonia (mainly in 41
types Aund and Adiff) and Sertoli cells. Functional ex vivo analysis showed that Gdnf 42
promoted the creation of new available niches by stimulating proliferation of both type Aund
43
spermatogonia and their surrounding Sertoli cells, but without changing pou5f3 mRNA 44
levels. Strikingly, Gdnf also inhibited late spermatogonial differentiation as shown by the 45
decrease of type B spermatogonia and down-regulation of dazl in the co-treatment with Fsh. 46
Altogether, our data revealed for the first time that a germ cell-derived factor is associated 47
with maintaining germ cell stemness through the creation of new available niches, supporting 48
development of differentiating spermatogonial cysts and inhibiting late spermatogonial 49
differentiation in autocrine and paracrine manners. 50
51
Keywords: Gdnf; Gfr 1; spermatogonial stem cell; spermatogenesis; zebrafish 52
53
54
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Introduction 55
GDNF (Glial cell line-derived neurotrophic factor) is a closely related member of 56
TGF- superfamily which belongs to the GDNF family of ligands (GFLs). This family of 57
ligands consists of Gdnf, neurturin, artemin and persephin [1]. The importance of GDNF for 58
spermatogonial stem cell (SSC) maintenance was unveiled by Meng et al. [2] who showed 59
that mice with impaired GDNF signaling exhibited a progressive loss of SSCs, while its pan-60
ectopic overexpression promoted germ cell hyperplasia, and ultimately tumors [2]. Moreover, 61
further studies showed that GDNF promoted in vitro expansion of mouse germline stem cells 62
[3, 4], being considered as an indispensable factor for long-term culture of SSCs of several 63
rodents [3, 5, 6]. More recently, experiments using mice that ectopically expressed stage-64
specific GDNF in Sertoli cells revealed that GDNF increased SSC self-renewal by blocking 65
differentiation rather than actively stimulating their proliferation [7]. Altogether, these studies 66
demonstrated that GDNF is an important factor for mammalian SSC self-renewal, 67
proliferation of the stem cell direct progenitors and maintenance of the SSC undifferentiated 68
state (see review in Parekh et al. [8] Mäkelä and Hobbs [9]). 69
GDNF signaling occurs through binding the non-signaling co-receptor of the GDNF 70
Family Receptor 1 (GFR 1), which are tethered to the plasma membrane through 71
glycosylphosphatidylinositol-anchors [1]. The complex GDNF-GFR 1 associates to a single 72
transmembrane RET receptor tyrosine kinase, promoting dimerization and activation of 73
RET's intracellular kinase domain, leading to stimulation of multiple downstream pathways 74
[1]. In the mammalian testes, GDNF is produced by testicular somatic cells, including Sertoli 75
cells [2, 10, 11], peritubular myoid cells under influence of androgens [12,13] and testicular 76
endothelial cells which seem the major GDNF-producing source in the mouse testis [14]. 77
GFR 1 is expressed in a subpopulation of single type A spermatogonia (As) (inhibitor of 78
DNA binding 4 +) which is considered the purest functional SSC population in mice [15, 16]. 79
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
GFR 1 is not exclusively expressed in SSCs, but it is also detected in types A paired (Apr) 80
and aligned (Aal) spermatogonia in the mouse testis [17-21]. Similar expression pattern for 81
GFR 1 has been reported in the testes of numerous mammalian species, such as hamster 82
[22], pig [23], collared peccary [24, 25], buffalo [26], different equine species [27], and 83
primates including humans [28, 29]. The mechanisms underlying the regulation of GDNF, 84
especially in Sertoli cells, are not fully understood. This lack of knowledge is partially 85
attributed to difficulties on working with adult primary Sertoli cells and due to the absence of 86
efficient ex vivo organ culture systems that conserve adult Sertoli cell functions (see review in 87
Parekh et al [8] and Mäkelä and Hobbs [9]. 88
In nonmammalian species, particularly in the group of fish, Gdnf/Gfr 1 homologs 89
have been found in a limited number of species, such as dogfish (Scyliorhinus canicula) [30, 90
31], rainbow trout (Oncorhynchus mykiss) [32-34] and medaka (Oryzias latipes) [35]. Unlike 91
mammals, Gdnf and Gfr 1 were found co-expressed in type A undifferentiated 92
spermatogonia of the above-mentioned species, suggesting an autocrine mechanism for Gdnf-93
mediated functions in fish testes [32]. The physiological relevance of Gdnf for type A 94
undifferentiated spermatogonia has been further demonstrated by in vitro studies showing 95
that recombinant human GDNF promoted proliferation and long-term maintenance of dogfish 96
spermatogonia with stem characteristics [31]. Similar findings were found by Wei et al. [36] 97
who showed that two Gdnf homologs in medaka, named Gdnfa and Gdnfb, stimulated 98
proliferation of SG3, a spermatogonial stem cell line derived from adult medaka. On the other 99
hand, studies in rainbow trout revealed that gdnfb mRNA levels increased during the arrest of 100
spermatogenic cycle (end of germ cell proliferation and differentiation), suggesting that 101
Gdnfb is likely involved in the repression of SSC differentiation rather than proliferation 102
[33]. Therefore, more studies are needed to unravel the possible autocrine/paracrine roles of 103
Gdnf on SSC niche in fish, aiming to expand our knowledge about the critical factors 104
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
involved in the SSC activity in these animals, as well as predicting the consequences of 105
changes involved in the physiological mechanisms related to the Gdnf. According to Oatley 106
and Brinster [37], the reduction or loss of SSC function disrupts spermatogenesis leading to 107
subfertility or infertility in males and, therefore, knowing the mechanisms that regulate SSC 108
homeostasis is imperative for the conservation of species or for its use as an experimental 109
model in studies focusing on the treatment of pathological conditions of the reproductive 110
organs of humans. 111
Considering this background and the lack of knowledge on Gdnf-Gfr 1 signaling in 112
the zebrafish testis, this study initially performed phylogenetic and conserved synteny 113
analysis of Gfr 1 followed by expression profiling of gdnf (gdnfa and gdnfb) and gfr 1 114
(gfr 1a and gfr 1b) transcripts in the zebrafish testes. Subsequently, the cellular types 115
expressing Gdnf and Gfr 1 were identified in the zebrafish testis, and the biological effects of 116
Gdnf were assessed using an ex vivo testis culture system established for zebrafish. To the 117
best of our knowledge, the present study was pioneer in evidencing that Gdnf is expressed in 118
the germ cells of zebrafish, whereas its co-receptor, Gfr 1, was detected in Sertoli cells and 119
among different types of spermatogonia, in which signal was more intense in type A 120
undifferentiated spermatogonia. Moreover, we showed that Gdnf, a germinal signal, exerts 121
autocrine and paracrine roles in the regulation of zebrafish testicular function through 122
stimulating survival of type A spermatogonia, and inducing mitosis of Sertoli cells, 123
respectively. 124
125
2 Material and methods 126
2.1 Zebrafish stocks 127
Sexually mature zebrafish (Danio rerio, outbred) (4-5 months old) were bred and 128
raised in the aquarium facility of the Department of Structural and Functional Biology, 129
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Institute of Biosciences, São Paulo State University (Botucatu, Brazil). Fish were kept in 130
tanks of 6-L in the recirculating system and temperature conditions similar to the natural 131
environment (27ºC) under proper photothermal conditions (14 hours of light and 10 hours 132
dark). Salinity, pH, dissolved oxygen and ammonia were monitored in all tanks every day. 133
Fish were fed twice a day using commercial food (Zeigler®, Gardners, PA, USA). No 134
mortality was observed during experiments. Handling and experimentation were consistent 135
with Brazilian legislation regulated by National Council for the Control of Animal 136
Experimental (CONCEA) and Ethical Principles in Animal Research of São Paulo State 137
University (Protocol n. 666-CEUA). Zebrafish is a tropical freshwater fish natural to rivers in 138
Southern Asia, mainly in Northern India, Pakistan, Bhutan and Nepal [38-40], has been 139
considered a versatile model for reproductive biology [41], besides being used as a model for 140
translational research on human health and disease [42]. Therefore, these aspects justify the 141
choice of this species in our study. 142
143
2.2 Sequence analysis 144
The predicted amino acid sequences for Gfr 1a and Gfr 1b of D. rerio (Q98TT9 and 145
Q98TT8, respectively), GFRA1 of Homo sapiens (P56159), Rattus norvegicus (Q62997) and 146
Mus musculus (P97785) were obtained from The Universal Protein Resource (UniProt, 147
accessed 09/12/2019), and aligned using the MEGA algorithm allocated on the Geneious Pro 148
4.8.5 software [43]. For the phylogenetic analysis, we retrieved the protein sequences of 149
GFR 1 (Gfr 1a and Gfr 1b) from The Universal Protein Resource (UniProt, accessed 150
02/25/2020), from National Center for Biotechnology Information (NCBI, 02/25/2020) and 151
Ensembl (accessed 02/25/2020 [44]). For this analysis, we retrieved vertebrate sequences for 152
GFR 1 and Growth arrest-specific protein 1 (GAS1) from human (GAS1 as an outgroup) 153
(Figure 2). The predicted amino-acid sequences were aligned using the Muscle algorithm 154
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
[45] allocated on the Geneious Pro 4.8.5 software [43]. The choice of the best-fit model of 155
evolution was performed with SMS [46]. Phylogenetic reconstruction was determined by 156
Bayesian methods implemented in Beast v1.7.0 software [47]. This step was carried out 157
according to Geraldo et al. [48], with adaptations. Brunch values were supported by posterior 158
probabilities obtained by Bayesian analysis. For Bayesian method generations, the burn-in 159
was determined in Tracer [47] through log likelihood scores, and data were summarized in 160
TreeAnnotator [47] after trees that were out of the convergence area had been discarded. The 161
visualization and the final tree edition were performed using FigTree v1.3.1 [47]. In the 162
phylogenetic analyses, the proportion of invariable sites and -distributed rate variation 163
across sites were estimated, and the substitution of rate categories were set in four categories. 164
The parameters set to reconstruct the phylogeny are shown in Table S2. To construct the 165
syntenic regions of GFRA1 (human), Gfr 1 (rat and mouse), gfr 1a and gfr 1b (zebrafish) 166
genes, we used the GenBank database, available at the National Center for Biotechnology 167
Information (NCBI; http://www.ncbi.nlm.nih.gov/) and Ensembl [44]. 168
169
2.3 Expression profiling of gdnf (gdnfa and gdnfb) and gfr 1 (gfr 1a and gfr 1b) 170
transcripts in the zebrafish testes 171
To investigate the transcript abundance of gdnf (gdnfa and gdnfb) and gfr 1 (gfr 1a 172
and gfr 1b) in the zebrafish testes, total RNA from testes (n = 4 males) was extracted by 173
using the commercial RNAqueous®-Micro kit (Ambion, Austin, USA), according to 174
manufacturer’s instructions. The cDNA synthesis was performed as usual procedures [49]. 175
Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was conducted 176
using 10 µL 2× SYBR-Green Universal Master Mix, 2 µL of forward primer (9 mM), 2 µL of 177
reverse primer (9 mM), 1 µL of DEPC water, and 5 µL of cDNA. The relative mRNA levels 178
of gdnfa (glial cell-derived neurotrophic factor a), gdnfb (glial cell-derived neurotrophic 179
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
factor b), gfr 1a (gdnf family receptor alpha 1a) and gfr 1b (gdnf family receptor alpha 1b) 180
(Cts) were normalized by the reference genes ef1 (elongation factor 1 ) and -actin, 181
expressed as relative values of control group (as fold induction), according to the 2−( CT) 182
method. Primers were designed based on zebrafish sequences available at Genbank (NCBI, 183
https://www.ncbi.nlm.nih.gov/genbank/) (Table 1). 184
185
2.4 Differential plating method 186
To identify the testicular cell fractions (germ or somatic cell enriched fractions) 187
expressing gdnfa in zebrafish, a differential plating method was carried out as previously 188
described by Hinfray et al. [50]. To this end, testes (n = 20 males) were digested with 0,2% 189
collagenase (Sigma Aldrich, San Luis, MI, USA) and 0,12% dispase (Sigma Aldrich, San 190
Luis, MI, USA), as described previously [49]. The total cell suspension was then submitted to 191
a differential plating method, where the somatic cells adhere to the bottom of the plate, while 192
germ cells either remain in suspension after 2–3 days of culture or only weakly associated 193
with the firmly adhering somatic cells [50]. By using this method, germ and somatic cell 194
enriched fractions can be obtained [50]. Total RNA from the cell suspensions (total, germ cell 195
enriched, and somatic cell enriched) was extracted using PureLink® RNA Mini Kit (Ambion, 196
Austin, TX, USA), according to manufacturer’s instructions. After cDNA synthesis using 197
SuperScript® II Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA) and random 198
hexamers, the relative mRNA levels of pou5f3 (POU domain, class 5, transcription factor 3) 199
(spermatogonia marker) and gdnfa were determined by qRT-PCR. -actin and ef1 were used 200
as housekeeping genes. The quantification cycle (Cq) values were determined in a StepOne 201
system (Life Technologies, Carlsbad, CA, USA) using SYBR Green (Invitrogen, Carlsbad, 202
CA, USA) and specific primers (Table 1). All RT-qPCR reactions (10-20 µL) used 900 nM 203
for each primer (forward and reverse) and 300 ng of total cDNA. Each reaction was 204
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
performed in duplicate and relative gene expression levels were calculated according to the 205
2−( CT) method. 206
207
2.5 Immunofluorescence and Western blot 208
Testes (n = 10 males) were fixed with 4% paraformaldehyde in PBS (Phosphate 209
Buffered Saline) (1X, pH 7.4) for 1 hour, embedded in paraplast (Sigma Aldrich, San Luis, 210
MI, USA) and sectioned at 5 m thickness. After deparaffinization and rehydration, sections 211
were submitted to antigen retrieval by heating slides in sodium citrate buffer (10 mM sodium 212
citrate, 0,05% Tween 20, pH 6.0) until temperature reaches 95-100°C in a microwave. To 213
reduce background fluorescence, slides were incubated with NaBH4 (sodium borohydride - 214
0.01g dissolved in 1 mL of distilled water) (Sigma Aldrich, San Luis, MI, USA) for 3 215
minutes. Subsequently, slides were rinsed with 1X PBS (pH 7.4) and incubated with the 216
biotinylated primary antibody rabbit anti-zebrafish Gfr 1a (1:300, 1X PBS pH 7.4) at 4°C 217
overnight. Zebrafish polyclonal biotinylated antibody anti-Gfr 1a was synthesized by 218
Rheabiotech (Campinas, Brazil) using the specific antigen sequence 219
‘RLDCVKANELCLKEPGCSSK’ located at the N-terminus of zebrafish Gfr 1a (Figure 1). 220
This antibody is also potentially able to recognize other Gfr 1 isoforms, such as GFR 1 of 221
humans, rodents, and Gfr 1b of zebrafish (Figure 1). After rising, the slides were incubated 222
with Dylight 488 Streptavidin (BioLegend®- San Diego, CA, USA) (1:400) or Alexa Fluor 223
594 Streptavidin (BioLegend®- San Diego, CA, USA) (1:400) in 1X PBS (pH 7.4) for 60 224
minutes at room temperature. Subsequently, sections were counterstained with Hoechst 225
(1:2000, 1X PBS pH 7.4) (Invitrogen, Carlsbad, CA, USA), or Propidium iodide (PI) 226
(BioLegend®- San Diego, CA, USA) (1 mg PI to 1 mL distilled water), and mounted with 227
ProLong Gold Antifade (Thermo Fisher Scientific, Waltham, MA, USA). Control sections 228
were prepared by preadsorbing the zebrafish Gfr 1a antibody with the corresponding peptide 229
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
(10 g/1 µL of antibody, Rheabiotech, Campinas, Brazil) or by omitting the primary 230
antibody. Slides were photographed using a Leica SP5 laser scanning confocal microscope 231
(Leica, Wetzlar, Germany) from the Electron Microscopy Center, Institute of Biosciences, 232
São Paulo State University (Botucatu, Brazil) and germ cells were classified based on 233
morphological criteria established by Leal et al. [51]. 234
For the Western blot analysis, testes (n = 10 males) were homogenized in an 235
extraction TBST buffer (10 mM Tris–HCl, pH 7.5; 150 mM NaCl; 0,1% Tween 20) 236
containing a cocktail of protease inhibitors (Roche Applied Science, Mannheim, Germany). 237
Subsequently, the homogenate was incubated on ice for 15–20 minutes before sonication (3× 238
1 minute on ice), and centrifuged at 4000 rpm at 4°C for 20 minutes in order to determine the 239
total protein concentration through NanoVue spectrophotometer (GE Healthcare, Chicago, 240
IL, USA). A total of 40 µg protein was analyzed by sodium dodecyl sulfate polyacrylamide 241
gel electrophoresis (SDS-PAGE). Protein extracts were blotted onto a nitrocellulose 242
membrane (Amersham, Little Chalfont, UK), blocked with 3% non-fat milk diluted in 1X 243
Tris-buffered saline (TBS) (150 mM NaCl, 50 mM Tris-HCl, pH 7.6.) for 1 hour, and 244
incubated with the primary antibody rabbit anti-zebrafish Gfr 1a (1:500, Rheabiotech, 245
Campinas, Brazil) at 4°C overnight. The membrane was washed with TBS and incubated 246
with horseradish peroxidase-conjugated anti-rabbit IgG (1:5000, Santa Cruz Biotechnologies, 247
Dallas, TX, EUA) for 2 hours. After washing, blots were developed with chemiluminescence 248
substrate kit (Pierce ECL Western Blotting Substrate-GE Healthcare, Chicago, IL, USA) and 249
the signal was captured by a CCD camera (ImageQuant LAS 4000 mini®, GE Healthcare, 250
Chicago, IL, USA). As controls, some membranes were alternatively incubated with a 251
primary antibody that has been preadsorbed with the respective peptide, as described above. 252
253
2.6 Recombinant human GDNF 254
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
To evaluate the effects of Gdnf on zebrafish spermatogenesis (see below), a 255
recombinant human GDNF (rhGDNF) purchased from PeproTech® (London, UK) (catalog 256
number 450-10; https://www.peprotech.com/en/recombinant-human-gdnf#productreviews) 257
was used. The recombinant hormone was dissolved in sterile Lebovitz medium (L-15) 258
(Sigma-Aldrich, St. Louis, USA) at the concentration of 100 µg/mL, and subsequently 259
aliquoted and stored at -20º C until use. After identifying the binding sites between rhGDNF 260
and human GFR 1A, a 3D structure model was built to predict the interaction sites between 261
rhGDNF and zebrafish Gfr 1a (Q98TT9). The 3D protein structure used was obtained 262
through SWISS-MODEL (swissmodel.expasy.org) with multiple target sequences 263
representing different subunits of a hetero-oligomer (hetero-2-2-mer), and analyzed the 264
quality of the modeling with the Ramachandran allocated in Rampage software [52]. The 265
template (4ux8.1) and the final model were viewed in the software Pymol (The PyMOL 266
Molecular Graphics System, Version 1.8 Schrödinger, LLC). 267
268
2.7 Testis tissue culture 269
The effects of rhGDNF on zebrafish spermatogenesis were investigated using a 270
previously established ex vivo culture system [53]. After dissecting out the testes (paired 271
structure) (n = 30 males), each testis (left and right) was placed on a nitrocellulose membrane 272
measuring 0.25 cm2 (25 µm of thickness and 0.22 µm of porosity) on top of a cylinder of 273
agarose (1.5% w/v, Ringer’s solution—pH 7.4) with 1 mL of culture medium into a 24-well 274
plate. In this system, one testis (left) was incubated in the presence of rhGDNF (100 ng/mL - 275
based on Gautier et al [55]) and its contra-lateral one (right) in a basal culture medium (L-276
15). The medium was changed every 3 days of culture. After 7 days, testes were collected for 277
histomorphometrical analysis, BrdU (bromodeoxyuridine) incorporation assay, and gene 278
expression (RT-qPCR) (see below). Additional cultures were carried out to assess the 279
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
interaction of Gdnf with Fsh-mediated effects on zebrafish spermatogonial phase [49]. To 280
this end, zebrafish testes (n = 10 males) were incubated with recombinant zebrafish Fsh 281
(rzfFsh) (100 ng/mL [53]) (U-Protein Express B.V; Utrecht, the Netherlands) in the presence 282
or absence of rhGDNF (100 ng/mL) for 7 days. After the culture period, testes were collected 283
for gene expression analyses (RT-qPCR). 284
For histomorphometrical analysis, zebrafish testicular explants (n =10) were fixed in 285
4% buffered glutaraldehyde at 4 °C overnight, dehydrated, embedded in Technovit (7100-286
Heraeus Kulzer, Wehrheim, Germany), sectioned at 4µm thickness, and stained with 0.1% 287
toluidine blue to quantify the different germ cell types at 40× and 100× objectives using a 288
high-resolution light microscope (Leica DM6000 BD, Leica Microsystems, Wetzlar, 289
Germany). In this analysis, five histological fields for each animal were randomly selected 290
for counting the frequency of germ cell cysts [type A undifferentiated spermatogonia (Aund), 291
type A differentiated spermatogonia (Adiff), type B spermatogonia (SPG B), spermatocytes 292
(SPC), and spermatids (SPT)], as previously described [49,56]. 293
To evaluate the effects of rhGDNF on germ cell proliferation, 100 µg/mL BrdU 294
(Sigma Aldrich, San Luis, MI, USA) was added to the culture medium during the last 6 hours 295
of incubation. After incubation, zebrafish testes (n = 10) were fixed at 4 °C overnight in 296
freshly prepared methacarn (60% [v/v] absolute ethanol, 30% chloroform, and 10% acetic 297
acid) for 4 h. Subsequently, testes were dehydrated, embedded in Technovit 7100 (7100-298
Heraeus Kulzer, Wehrheim, Germany), sectioned at 4µm thickness, and submitted to BrdU 299
immunodetection, as previously described [51,56]. The mitotic index or BrdU incorporation 300
ratio of types Aund, Adiff and Sertoli cells was performed as described previously [51,56,57]. 301
For the gene expression analyses, total RNA from testicular explants (n = 20 males) 302
was extracted by using the commercial RNAqueous®-Micro kit (Ambion, Austin, USA), 303
according to manufacturer’s instructions. The cDNA synthesis was performed as described 304
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
above. RT-qPCR reactions were conducted using 10 µL 2× SYBR-Green Universal Master 305
Mix (Bio-Rad, Hercules, CA, USA), 2 µL of forward primer (9 mM), 2 µL of reverse primer 306
(9 mM), 1 µL of DEPC water, and 5 µL of cDNA. The relative mRNA levels of gdnfa (glial 307
cell-derived neurotrophic factor a), gfr 1a (gdnf family receptor alpha 1a), gfr 1b (gdnf 308
family receptor alpha 1b), amh (anti-Müllerian hormone), igf3 (insulin-like growth factor 3), 309
fshr (follicle stimulating hormone receptor), pou5f3 (POU domain, class 5, transcription 310
factor 3), dazl (deleted in azoospermia-like) and sycp3l (synaptonemal complex protein 3) 311
were evaluated. The mRNA levels of the targets (Cts) were normalized by the reference gene 312
-actin, expressed as relative values of basal expression levels, according to 2−( CT) method. 313
Primers were designed based on zebrafish sequences available at Genbank (NCBI, 314
https://www.ncbi.nlm.nih.gov/genbank/) (Table 1). 315
316
Target genes
Primers sequence (5'
-
3')
Reference
s
ef1
GCCGTCCCACCGACAAG (Fw)
Morais et al. [56]
CCACACGACCCACAGGTACAG (Rv)
b-actin
AGACATCAGGGAGTGATGGT (Fw)
Tovo-Neto et al.[57]
CAATACCGTGCTCAATGGGG (Rv)
gdnfa
GAAGCTCCGGTCTGTATGGA (Fw)
This paper
GGAGCTCAGGAGCAACAAAC (Rv)
gdnfb
AGGAGTAAATCAGTGGGCCAAA (Fw)
This paper
AGTAGCTGAATATGAGCTCCTCC (Rv)
gfr 1a
TCGACTGGCTCCCATCTATTC (Fw)
This paper
AGGTGTCATTCAGGTTGCAGG (Rv)
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
gfr 1b
CCTGTGCTTGATTTAGTGCA (Fw)
This paper
GCATCCGTACTTTCCCAAAC (Rv)
igf3
TGTGCGGAGACAGAGGCTTT (Fw)
Morais et al. [56]
CGCCGCACTTTCTTGGATT (Rv)
amh
CTCTGACCTTGATGAGCCTCATTT (Fw)
García-Lopez et al. [54]
GGATGTCCCTTAAGAACTTTTGCA (Rv)
fshr
GAGGATTCCCAGTAATGCTTTCCT (Fw)
García-Lopez et al. [54]
TCTATCTCACGAATCCCGTTCTTC (Rv)
pou5f3
GAGAGATGTAGTGCGTGTAT (Fw)
Tovo-Neto et al. [57]
GCTCGTAATACTGTGCTTCA (Rv)
dazl
AGTGCAGACTTTGCTAACCCTTATGTA (Fw)
Morais et al. [56]
GTCCACTGCTCCAAGTTGCTCT (Rv)
sycp3l
AGAAGCTGACCCAAGATCATTCC (Fw)
García-Lopez et al. [54]
AGCTTCAGTTGCTGGCGAAA (Rv)
gdnfa-ish
T7Rpps - CCGCAGTGAGAGCCCCG (Fw)
This paper
T3Rpps - TCCCGTTAGGTCATATTGTTCCTC (Rv)
Table 1. Primers used for gene expression analysis (RT-qPCR) and to generate DNA 317 templates for digoxigenin (DIG)-labeled cRNA probe synthesis for in situ hybridization 318 (ISH) (Supplemental material). Fw, forward; Rv, reverse; T7Rpps – T7 RNA polymerase 319 promoter sequence at its 5´-end (5´ CCGGGGGGTGTAATACGACTCACTATAGGG-3`), 320 T3Rpps – T3 RNA polymerase promoter sequence at its 5`-end 321 (T3´GGGCGGGTGTTATTAACCCTCACTAAAGGG-3`). 322 323
2.8 In silico analysis of putative regulatory sequences upstream human GDNF, mouse 324
Gdnf and zebrafish gdnfa 325
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
To retrieved the putative regulatory sequences upstream human GDNF 326
(NM_000514.4), mouse Gdnf (NM_010275.3) and zebrafish gdnfa (NM_131732.2), the 327
transcription start site (TSS) was found in the Eukaryotic Promoter Database (EPD) and the 328
promoter regulatory regions (3´to 5´) was prospected by the flanking regions (2000 bp) 329
extracted from National Center for Biotechnology Information (NCBI). The cAMP response 330
elements (CRE, 4 different sequences), androgen receptor binding site (AR, full and half 331
sequences), several NF-kB-binding sites, N-Box, E-Box, TATA-Box, and GC-Box (Table 332
S3) were prospected using sequences described in the literature [8, 59-64]. 333
334
2.9 Statistical analyses 335
Graphpad Prism 7.0 (Graphpad Software, Inc., San Diego, CA, USA, 336
http://www.graphpad.com) was used for all statistical analysis. Data were initially checked 337
for deviations from variance normality and homogeneity, before the analysis. Data normality 338
was assessed through Shapiro-Wilks test, and variance homogeneity was assessed through 339
Bartlette's test. Significant differences between two groups were identified using paired 340
Student's t-test, at 5% probability. Comparisons of more than two groups were performed 341
with one-way ANOVA followed by Student-Newman-Keuls test, at 5% probability. 342
343
3. Results 344
3.1 Sequence analyses, phylogenetic tree and genomic organization of zebrafish Gfr 1a 345
and Gfr 1b 346
Sequence analysis revealed that both the predicted zebrafish Gfr 1a and Gfr 1b have 347
sequence characteristics of Gfr family members, such as the three cysteine-rich domains 348
(D1-3), 28 cysteine residues (plus 2 in the terminal region), and two triplets (MLF and RRR) 349
in the domain D2 (Figure 1). Sequence alignment of zebrafish Gfr 1a and 1b with different 350
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
GFR 1s (human and rodents) revealed that the three cysteine-rich domains (D1, D2, D3) are 351
highly conserved among the species, highlighting, in particular, the conserved residues and 352
motifs in the domain D2 critical for GFR 1 binding to GDNF and eliciting downstream 353
signal transduction as shown in mammals (Figure 1). Sequence analyses also demonstrated 354
that zebrafish Gfr 1a and 1b have a 67,1% identity to each other, and the Gfr 1a showed 355
higher identity with mammalian GFR 1 (61,7%, 61,1% and 60,9% similarity to human, rat 356
and mouse GFR 1, respectively) when compared to Gfr 1b (57,4%, 57,2% and 57% identity 357
to human, rat and mouse GFR 1, respectively) (Figure 1). 358
Phylogenetic analysis further confirmed that both zebrafish Gfr 1a and Gfr 1b are 359
related to other fish Gfr 1a and Gfr 1b predicted sequences, respectively, and these isoforms 360
diverge and form two separate fish-specific subclades (estimated posterior probability = 1) 361
(Figure 2A). On the other hand, the GFR 1 sequences from other vertebrates (mammals, 362
birds, reptiles, amphibians and Chondrichthyes) are clustered and form a separate clade from 363
the fish Gfr 1 (estimated posterior probability = 0.851) (Figure 2A). 364
A cross-species comparison of chromosome neighboring genes revealed that both of 365
zebrafish gfr 1a- and gfr 1b- containing regions are syntenic to human GFR 1- and rodents 366
Gfr 1- containing regions (Figure 2B). This analysis also showed that zebrafish gfr 1b gene 367
(chromosome 12, NC_007123.7) showed a larger group of syntenic genes (8 out of 14 genes 368
analyzed) when compared to zebrafish gfr 1a (chromosome 13, NC_007124.7) (2 out of 14 369
genes analyzed) (Figure 2B). 370
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Figure 1.
GFR 1 predicted amino acid sequence alignment. Numbers on the left top indicate amino acid positions, dashes indicate deletions, and black boxes
indicate shared sequences. The three cysteine-rich domains (D1-3), 28 cysteine residues (*) (plus 2 in the terminal region) and two triplets (MLF and RRR)
(green boxes) are highly conserved among human, rodents and zebrafish. At the end of the alignment are the percentage identity values of zebrafish Gfr 1a
and Gfr 1b to the other corresponding sequences. The blue box indicates the amino acid sequence recognized by anti-zebrafish Gfr 1a antibody
(Rheabiotech, Campinas, Brazil - see Material and Methods section). Purple line indicates the putative motifs critical for GFR 1 binding to GDNF and
eliciting downstream signal transduction.
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Figure 2.
(A) Phylogenetic analysis of GFR 1 predicted amino acid sequences across vertebrates.
Zebrafish Gfr 1a and 1b (both underlined) are clustered with other fish-specific Gfr 1a (yellow
box) and Gfr 1b (green box) sequences, respectively, forming two separate subclades. Note that the
GFR 1 sequences from other vertebrates (mammals, birds, reptiles, amphibians and
Chondrichthyes) formed a separate clade (brown box). Branch values represent posterior
probabilities obtained by Bayesian analysis (see Table S1). (B-C) Genomic organization and
synteny comparisons among human GFR 1, rodents Gfr 1 and zebrafish gfr 1b (B) or zebrafish
gfr 1a (C). The syntenic regions were analyzed based on the alignment of the target genes and
genomic annotation according to the GenBank database, available at National Center for
Biotechnology Information and Ensembl.
371
3.2 Expression profiling of gdnf (gdnfa and gdnfb) and gfr 1 (gfr 1a and gfr 1b) in the 372
zebrafish testes and identification of gdnfa expressing cells 373
RT-qPCR analyses revealed that both gfr 1a and gfr 1b were expressed in the 374
zebrafish testes, and the gfr 1a transcripts were significantly more expressed than gfr 1b 375
(Figure 3). With regard to Gdnf ligands (Gdnfa and Gdnfb), transcript analysis showed that 376
gdnfa was by far the most abundant ligand in the zebrafish testes as compared with gdnfb 377
levels [Ct = 28,54 (Me) for gdnfa vs. Ct = 31,04 (Me) for gdnfb] (Figure 3). 378
379
380 381 382 Figure 3. Relative mRNA expression 383 levels of gfdna, gdnfb, gfr 1a and 384 gfr 1b in the zebrafish testes. Bars 385 represent the mean ± SEM (n = 4) and 386 different letters denote significant 387 differences among the evaluated genes 388 (ANOVA followed by Student-389 Newman-Keuls test, p < 0.05). 390 391
Considering the transcript abundance of the Gdnf ligands, we attempted next to 392
identify the cellular types expressing gdnfa mRNA in the zebrafish testes by employing in 393
situ hybridization with specific antisense cRNA probe (Table 1, Figure S1), and RT-qPCR 394
using RNA from isolated testicular cell populations (germ cell-enriched population and 395
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
testicular somatic cells) (Figure 4). The first approach showed that gdnfa mRNA was 396
expressed in germ cells at different stages of development (Figure S1). Nevertheless, due to 397
limited resolution, it was not possible to unravel whether the signal was present or not in the 398
Sertoli cells (Figure S1). This was attributed to the fact that cytoplasmic extensions of Sertoli 399
cells protrude towards the lumen of a cyst in between the germ cells, making it difficult to 400
accurately locate the signal. The precise identification of gdnfa expression sites was then 401
accomplished through using testicular cell populations (germ cell-enriched population and 402
testicular somatic cells) obtained after the differential plating method (Figure 4A-C). In this 403
approach, RT-qPCR analysis showed an increase of gdnfa transcript levels in the germ cell-404
enriched population when compared to the levels found in the total testicular cell suspension 405
(Figure 4D). Similar pattern of expression was found for pou5f3, a marker of types Aund, Adiff 406
and B spermatogonia (Souza, Doretto, Nóbrega - unpublished data), which confirmed the 407
germ cell enrichment after the differential plating (Figure 4D). When analyzing the testicular 408
somatic cell population, we found that gdnfa mRNA levels decreased significantly as 409
compared to the levels observed in the germ cell-enriched fraction (Figure 4E). 410
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Figure 4. Differential plating method. (A) Scheme showing the steps of differential plating method 411 according to Hinfray et al [50]. Briefly, a total testicular cell suspension obtained from enzymatic 412 digestion was harvested (step A) in L-15 culture medium. After 2 days of culture, only somatic cells 413 with adhesive properties (Sertoli cells, brown triangular shape; Leydig cells, yellow oval shape) 414 adhere to the bottom of the plate (step B), while germ cells (non-adherent cells; blue shape cells) 415 remain floating or loosely attached to the bottom of the plate (step C). After washing steps, it is 416 possible to remove the germ cells (floating and also those germ cells weakly attached to the somatic 417
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
cells), leaving the adherent somatic cells (Sertoli cells, Leydig cells, fibroblast and others) at the 418 bottom of the plate. The firmly attached somatic cells can be obtained after extensive washing with 419 trypsin. (B) Total testicular cell suspension after 2 days of culture. Note somatic adherent cells (SC) 420 with cytoplasm extensions towards different germ cells (GC). (C) After extensive washing, somatic 421 adherent cells (SC) remain attached to the bottom of the plate, while the floating and the weakly 422 attached germ cells were removed. Scale bars: 20 µm. (D, E) Gene expression analysis of isolated 423 zebrafish testicular cell populations: total cell suspension (black bar), germ cell enriched population 424 (white bar), and testicular somatic cells (hatched bar). Cells were obtained from two independent 425 experiments of differential plating method. Bars represent relative mRNA levels of target genes 426 (gdnfa or pou5f3) expressed as mean ± SEM; asterisks indicate significant differences between the 427 cell populations (unpaired t-test, *p < 0.05, **p < 0.01, ***p < 0.001). 428 429
3.4 Localization of Gfr 1a protein in zebrafish testis 430
Immunofluorescence revealed that Gfr 1a protein was found in all generations of 431
zebrafish spermatogonia, as types A undifferentiated (Aund), differentiated (Adiff) and B (SPG 432
B) spermatogonia, but it was not detected in meiotic and post-meiotic germ cells, such as 433
spermatocytes (SPC), spermatids (SPT) and spermatozoa (SPZ) (Figure 5). It is worthy to 434
note that the staining pattern among the different generations of spermatogonia varied with 435
the development stage (Figure 5 A, C-E). The Gfr 1a signal was finely dispersed in the cell 436
surface and cytoplasm of type Aund spermatogonia (Figure 5C), and later, became more 437
aggregated, forming intensely stained spots in type Adiff spermatogonia (Figure 5D). In type 438
B spermatogonia, the Gfr 1a signal becomes finely dispersed again (Figure 5E), and 439
gradually decreases as the number of spermatogonia B increases within the cyst, until being 440
undetectable in the SPC cysts (Figure 5A). Furthermore, Gfr 1a was also found in Sertoli 441
cells contacting germ cells in different stages of development (Figure 5A, B). The specificity 442
of the antibody (anti-zebrafish Gfr 1a) was confirmed by immunoblots (Figure 5F), and 443
control sections using either preadsorbed antibody with the corresponding peptide or omitting 444
the antibody (Figure S2). 445
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Figure 5. Cellular localization of Gfr 1a protein in zebrafish testis. (A-E) Immunofluorescence for 446 Gfr 1a protein (green - A; red - B-E) on testis sections of sexually mature zebrafish. The 447 spermatogonial generations, including type A undifferentiated spermatogonia (Aund), type A 448 differentiated spermatogonia (Adiff) and type B spermatogonia (SPG B), were immunoreactive to 449
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Gfra1a, although staining pattern among them varied according the developmental stage. The signal 450 was not found in spermatocytes (SPC), spermatids (SPT) and spermatozoa (SPZ). Note that Sertoli 451 cells (SC) contacting germ cells in all stages of development were also immunoreactive to Gfr 1a. 452 Cell nuclei were counterstained with propidium iodide (A) or Hoechst (B-E). Scale bars: 15 µm. (F) 453 Gfr 1a (approximately 52 kDa - kilodaltons) immunoblots of whole testes with (+) or without (-) 454 preadsorbed antibody, confirming the presence of the protein in the zebrafish testes and the antibody 455 specificity. 456 457 458 3.5 3D model for predicting the interaction between rhGDNF and zebrafish Gfr 1a 459
To investigate the rhGDNF effects on zebrafish spermatogenesis, we first generated a 460
3D structure model to predict the possible interaction sites between human GDNF and 461
zebrafish Gfr 1a (Figure 6A, box2, box3). The 3D structure (hetero-2-2-mer) was built 462
according to the homology of the 4ux8.1 template, and showed a GMQE value of 0.63 with 463
74% of identity and a resolution of 24Å (method: Electron Microscopy) when compared to 464
human GDNF-GFR 1 interaction (merged in the 3D structure) (Figure 6A - box2, box3). 465
Moreover, the predictive model demonstrated that 89.8% of the amino acid residues were in 466
the most favorable regions, 7% of residues were situated in allowed regions (~2% expected), 467
and 3.1% in the outlier regions according to Ramachandran plots. The 3D structures of the 468
hetero-2-2-mer (GDNF-zebrafish Gfr 1a) were based on the homology modeling templates, 469
and are shown in Figure 6A (box2, box3). A more detailed information regarding the 470
predictive interaction model between GDNF and zebrafish Gfr 1a can be found at 471
Supplementary Material (Figure S3, Video S1). Moreover, the alignment of zebrafish Gdnfa 472
with rhGDNF showed conserved regions, particularly in the binding sites to human GFR 1 473
or zebrafish Gfr 1a (Figure 6B). 474
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
475
Figure 6. A 3D model to predict the interaction between rhGDNF and zebrafish Gfr 1a. (A) Box 1 476 depicts the molecular components of the complex GDNF-GFR 1-RET. Box 2 and 3 show the 477 predictive 3D model (template 4ux8.1), in which the structural similarities between zebrafish Gfr 1a 478 and human GFR 1 is represented by orange-purple, and the identity of the structure formed at the 479 binding sites is indicated by red. In box 2, the color green shows the conserved amino-acid sequences 480 between zebrafish Gfr 1a and human GFR 1, and blue indicates the GNDF protein. In box 3, we 481 highlighted the interaction sites between human GDNF and zebrafish Gfr 1a/human GFR 1. (B) 482 Alignment of zebrafish Gdnfa with rhGDNF. The blue lines indicate the conserved binding sites to 483 zebrafish Gfr 1a or human GFR 1. 484 485
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
3.6 Biological effects of rhGDNF on spermatogenesis, cellular proliferation and gene 486
expression analysis 487
To investigate the potential role of Gdnf in zebrafish spermatogenesis, we first 488
examined whether rhGDNF could affect germ cell composition and cellular proliferation, 489
using a previously established primary testis tissue culture system (Figure 7A-D). The results 490
showed that rhGDNF (100 ng/mL) increased the abundance of types Aund and Adiff 491
spermatogonia as compared to basal condition (Figure 7C). This data is also consistent with 492
the proliferation activity of these cells showing that treatment with rhGDNF (100 ng/mL) 493
augmented the mitotic index of both types of spermatogonia (Aund and Adiff) as compared to 494
their basal mitotic index (Figure 7A, B, D). Moreover, histomorphometrical analysis showed 495
that rhGDNF decreased the frequency of type B spermatogonia, whereas no effects were seen 496
for meiotic and post-meiotic germ cells (Figure 7C). In this study, we also quantified Sertoli 497
cell proliferation (Figure 7E), reasoning that change in the proliferation of Sertoli cells 498
associated with types Aund or Adiff spermatogonia would indicate creation of new niche space 499
or supporting development of differentiating spermatogonia cysts, respectively [65]. Our 500
results then demonstrated that treatment with rhGDNF stimulated Sertoli cell proliferation, 501
particularly of those Sertoli cells associated with proliferating types Aund and Adiff
502
spermatogonia (Figure 7E). 503
In order to elucidate the molecular mechanisms mediated by rhGDNF on basal or 504
Fsh-induced spermatogenesis, we performed gene expression analyses of selected genes 505
related with Gdnf signaling (gdnfa, gfr 1a and gfr 1b), Sertoli cell growth factors (igf3 and 506
amh), Fsh signaling (fshr) and germ cell markers (undifferentiated and differentiated 507
spermatogonia - pou5f3; differentiated spermatogonia and preleptotene spermatocytes - dazl; 508
and primary spermatocytes - scyp3l) (Figure 8). 509
510
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
511 Figure 7. Effects of Gdnf on germ cell composition and cellular proliferation, using a previously 512 established primary testis tissue culture system. (A-B) BrdU immunodetection from zebrafish 513 testicular explants incubated for 7 days in the absence (Basal) or presence of rhGDNF (100 ng/mL), 514 demonstrating a higher proliferation activity for type A undifferentiated spermatogonia (Aund) and 515 type A differentiated spermatogonia (Adiff) in the presence of rhGDNF. (C) Cystic frequency of 516 zebrafish testis explants after 7 days of incubation in the absence (Basal) or presence of rhGDNF (100 517
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
ng/mL). Types Aund, Adiff and B spermatogonia (SPG B), spermatocytes (SPC) and spermatids (SPT) 518 were counted. (D) Mitotic indices of type Aund and Adiff spermatogonia after incubation for 7 days in 519 the absence (Basal) and presence of rhGDNF (100 ng/mL). (E) Mitotic indices of Sertoli cells in 520 association with BrdU-negative or BrdU-positive type Aund and Adiff spermatogonia after incubation 521 for 7 days in the absence (Basal) or presence of rhGDNF (100 ng/mL). Bars represent the mean ± 522 SEM (n = 10). Paired t-test, *** p < 0.001; ** p < 0.01. Scale bars: 15 µm. 523 524
RT-qPCR analysis of zebrafish testis tissue ex vivo revealed that rhGDNF increased 525
the transcript levels of gdnfa and gfr 1a, whereas gfr 1b mRNA levels remained unaltered 526
when compared with basal condition levels (Figure 8A-C). The transcript abundance for the 527
other genes (Sertoli cell growth factors, Fsh signaling and germ cell markers) did not change 528
following rhGDNF treatment (Figure 8D-I). We further investigated whether rhGDNF could 529
affect the Fsh-induced changes in testicular gene expression, since Fsh is considered the 530
major endocrine player regulating zebrafish spermatogonial phase [56-57,66]. We first 531
showed that Fsh did not modulate the transcript levels of gdnfa, gfr 1a or gfr 1b in the 532
zebrafish testes (Figure 8A-C). However, Fsh was able to nullify the rhGDNF-increased 533
gdnfa and gfr 1a mRNA levels following co-treatment (Figure 8A, B). With respect to 534
Sertoli cell growth factors, we demonstrated that rhGDNF did not change the Fsh-mediated 535
expression on igf3 (Figure 8D) or amh mRNA levels (Figure 8E). As expected and in 536
agreement with previous studies [67,56], Fsh increased igf3 mRNA levels (Figure 8D), and 537
down-regulated amh transcripts (Figure 8E). The other evaluated genes were not responsive 538
to either Fsh or to its co-treatment with rhGDNF (Figure 8F-I). Nevertheless, it is worth 539
mentioning that transcript levels of fshr, pou5f3 and dazl were significantly higher in the 540
explants cultivated with rhGDNF than in those co-treated with rhGDNF + Fsh (Figure 8F-541
H). 542
543
544
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
545
Figure 8. Relative mRNA levels of genes related to Gdnf signaling (gdnfa, gfr 1a and gfr 1b), 546 Sertoli cell growth factors (igf3 and amh), Fsh signaling (fshr) and germ cell markers (undifferentiated 547 and differentiated spermatogonia - pou5f3; differentiated spermatogonia and preleptotene 548 spermatocytes - dazl; and primary spermatocytes - scyp3l). Testicular explants were cultivated for 7 549 days with rhGDNF, rzfFsh or both (rhGDNF + rzfFsh). The relative mRNA levels were normalized 550 with the -actin levels. Bars represent the mean ± SEM (n = 20). Paired/unpaired t-test in which 551 different letters denote significant differences (p < 0.05) among treatment conditions. 552 553
3.7 In silico analysis of putative regulatory sequences upstream human GDNF, 554
mouse Gdnf and zebrafish gdnfa 555
To support our expression analysis, we investigated the putative regulatory sequences 556
upstream the transcriptional start site (TSS) of human GDNF (NM_000514.4), mouse Gdnf 557
(NM_010275.3), and zebrafish gdnfa (NM_131732.2) (Figure 9). The in silico analysis 558
showed three different types of cAMP response elements (CRE), several N-box and E-box 559
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
motifs, one NF-kB binding site and a TATA-Box within the 2000bp upstream of human 560
GDNF (Figure 9, Table S2). The upstream sequence of the Gdnf mouse gene showed similar 561
regulatory binding sites as the human GDNF (Figure 9, Table S2). For zebrafish, we 562
predicted a non-canonical TATA-Box, one CRE close to a GC-Box, one N-Box, four E-Box 563
and two androgen receptor (AR) half binding site within 2000bp upstream of gdnfa (Figure 564
9, Table S2). 565
566
Figure 9. Predicted regulatory sequences upstream human GDNF, mouse Gdnf and zebrafish gdnfa. 567 (A) The upstream region (2000bp) of human GDNF contains three different sequences of cAMP 568 response elements (CRE), four E-box sequences, three N-box sequences and one Nf-kB binding site. 569 The upstream region (2000bp) of mouse Gdnf contains a N-box/E-box-rich region at bp -1,300 to -570 1,900 and additional E-boxes downstream, one androgen receptor binding site (AR), two Nf-kB 571 binding sites and three different sequences of CRE close to the TSS (transcriptional start site). The 572 upstream region (2000bp) of zebrafish gdnfa contains four E-box sequences and one N-box sequence, 573 two AR half sequences and only one CRE close to a GC-box and the TSS. TSS is the transcription 574 start site (position +1). (B) Sequence of putative binding sites upstream of zebrafish gdnfa. In the 575 opened orange box is shown the TATA-box sequence, in gray the GC-box, in dark green the CRE, in 576 pink the E-box, in blue the N-box, and in the orange closed box the AR half binding site. 577 578
579
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
580
4. Discussion 581
This study demonstrated the involvement of Gdnf/Gfr 1 signaling pathway in the 582
regulation of zebrafish spermatogonial phase. Our first analysis identified two zebrafish 583
paralogs for the Gfr 1 encoding gene, named as zebrafish gfr 1a and gfr 1b. The predicted 584
amino acid sequence of zebrafish Gfr 1a and Gfr 1b revealed high identity to GFR 1 from 585
other mammalian species investigated in this study (>60% and >57% sequence identity for 586
Gfr 1a and Gfr 1b, respectively). Moreover, both paralogs have conserved domains and 587
residues which are typical of the GFR 1 family members, such as three cysteine-rich 588
domains (D1, D2, D3), 28 cysteine residues (plus 2 in the terminal region) and two triplets 589
(MLF and RRR) [68-70]. Studies in mice using site-directed mutagenesis have shown that 590
some of these conserved regions (e.g. two triplets - MLF and RRR - in the D2) are critical for 591
Gfr 1 binding to Gdnf, activating the receptor complex and eliciting downstream signal 592
transduction [68, 70]. This evidence suggested that theoretically both zebrafish Gfr 1a and 593
Gfr 1b could bind and elicit a response to Gdnf/GDNF (e.g. rhGDNF). Moreover, in 594
agreement with previous studies [71-72], phylogenetic analysis demonstrated that zebrafish 595
Gfr 1a and 1b are clustered to other fish Gfr 1a and 1b, and the paralogs diverged and form 596
two distinct sub-clades within the fish clade. Additional analysis of chromosome neighboring 597
genes revealed that both zebrafish gfr 1a- and gfr 1b- containing regions are syntenic to 598
human GFR 1- and rodents Gfr 1-containing regions. Altogether, this evidence confirmed 599
that zebrafish gfr 1a and gfr 1b are duplicated genes that diverged from each other after the 600
teleost-specific whole genome duplication. Around 320 million years ago, it is well 601
established that the common ancestor of the teleosts experienced a third round of whole 602
genome duplication [73-74]. This event was responsible to generate a large number of 603
duplicated genes that could follow different evolutionary paths such as co-expression (both 604
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
copies retain the ancestral function), non-functionalization (function loss or complete deletion 605
of one copy), sub-functionalization (specialization of each copy, sub function partition), or 606
neo-functionalization (acquisition of a novel function) [73-74]. In this study, we could not 607
conclude the specific roles of Gfr 1a and Gfr 1b, although data on protein localization and 608
expression analysis suggested that zebrafish Gfr 1a is the mammalian GFR 1 homologous 609
copy (see discussion below). However, additional studies (e.g. specific knockout for each 610
copy) are required to confirm this hypothesis, and to unravel the specific role of each Gfra1 611
paralog in the zebrafish spermatogenesis. 612
When evaluating the expression profiling of Gfr 1a and Gfr 1b, we found that both 613
paralogs are expressed in the zebrafish testes, although gfr 1a transcripts were significantly 614
more abundant than gfr 1b. Focusing our analysis in the zebrafish Gfr 1a, we developed a 615
specific antibody to identify the cell types expressing Gfr 1a in the adult zebrafish testis. Our 616
data revealed that Gfr 1a was detected in all types of zebrafish spermatogonia, although the 617
staining pattern varied among the different generations of spermatogonia. Gfr 1a was mainly 618
expressed in early types of spermatogonia (Aund and Adiff), and its expression gradually 619
decreased as spermatogonial clones became larger and more differentiated. Likewise, 620
accumulative evidences have demonstrated that GFRA1 is a conserved marker for all types of 621
undifferentiated spermatogonia in different mammalian species [22-29,75-76] and the 622
frequency of GFRA1+ spermatogonia decreases as spermatogonia progress from As to Aal 623
[76]. Similarly, in other fish species, mRNA or protein levels of Gfr 1a were found mainly in 624
type Aund spermatogonia of dogfish (Scyliorhinus canicula) [30,31], rainbow trout 625
(Oncorhynchus mykiss) [32-34], medaka (Oryzias latipes) [35] and tilapia (Oreochromis 626
niloticus) [78]. In rainbow trout, Nakajima et al [32] reported that gfr 1 transcripts decreased 627
throughout the spermatogonial development, and became undetectable in spermatids and 628
spermatozoa. In medaka, Zhao et al [71] showed a moderate signal for gfr 1a and gfr 1b 629
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
mRNA in spermatocytes, but no expression was found in spermatids and spermatozoa. 630
Altogether these evidence are in agreement with our results, and support our hypothesis that 631
Gndf-Gfr 1a signaling pathway is important for the regulation of zebrafish spermatogonial 632
phase, but is not required for meiotic and post-meiotic phases. Strikingly, our study also 633
detected the Gfr 1a protein among Sertoli cells associated with different types of germ cells. 634
In rainbow trout, Maouche et al [72] demonstrated that gfr 1a1 transcripts were mainly 635
expressed in somatic testicular cells, while gfr 1a2 was restricted to type Aund 636
spermatogonia. To our knowledge, our study and the one in rainbow trout [72] were the first 637
evidences to suggest that Gndf-Gfr 1a is not only involved in the control of spermatogonial 638
phase, but also can modulate the functions of the cyst-forming Sertoli cells. 639
Investigation of the expression profiling of Gdnf ligands (Gdnfa and Gdnfb) revealed 640
that gdnfa transcripts are predominantly more abundant than gdnfb (Ct = 28,54 for gdnfa vs. 641
Ct = 31,04 for gdnfb), indicating that Gdnfa might be the main ligand in the zebrafish testis. 642
Further in situ hybridization and RT-qPCR analysis demonstrated that gdnfa was mainly 643
expressed in the zebrafish germ cells. No expression was observed in somatic testicular cells 644
for gdnfa. In both analyses, we were not able to identify the specific germ cell types that 645
express gdnfa in the zebrafish testis. Nakajima and collaborators [32], on the other hand, 646
demonstrated in rainbow trout immature testes that gdnf mRNA and protein were expressed 647
in type Aund spermatogonia. Moreover, the same authors showed that gdnf and gfr 1 were co-648
expressed in germ cells, and their expression changed synchronously during the germ cell 649
development [32]. Altogether, this evidence supports our findings that zebrafish Gdnfa is a 650
germ cell derived factor that exerts both autocrine and paracrine functions on spermatogonia 651
and Sertoli cells, respectively. Moreover, this data provides new insights on Gndf-Gfr 1a 652
signaling pathway in fish when compared to mammals. In mammals, GDNF is secreted by 653
testicular somatic cells (Sertoli cells [2,10,11], peritubular myoid cells [12,13] and testicular 654
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
endothelial cells [14]), acting only as a paracrine factor on GFRA1-expressing 655
undifferentiated spermatogonia [22-29, 75-76]. This difference in the Gdnf-producing sites is 656
likely related to events that took place after the teleost-specific whole genome duplication, 657
such as non- and neo-functionalization of the Gdnf paralogs. In addition, these findings 658
indicate that the common ancestor of Gdnf was expressed in the testicular somatic cells of 659
fish and mammals, and the expression of Gdnf in the germ cells is an evolutionary novelty in 660
the fish group. To support this hypothesis, identification of Gdnf paralogs and their cellular 661
site expression in other vertebrate species, including fish, are necessary. 662
The biological roles of Gdnf on zebrafish spermatogenesis were assessed through 663
employing a recombinant human GDNF (rhGDNF) in an ex vivo testis culture system 664
previously established for zebrafish [53a]. There is strong evidence that human recombinant 665
hormone (rhGDNF) can bind to zebrafish Gfr 1a and elicit a downstream signal transduction 666
in the zebrafish testes. The first evidence is the predictive 3D model which examines the 667
interaction sites between human GDNF and zebrafish Gfr 1a based on the binding 668
interaction with human GFR 1. This analysis revealed structural similarities between 669
zebrafish Gfr 1a and human GFR 1 (Figure 6A, box2), and higher identity of the structure 670
formed at the binding sites between human GDNF and both receptors, human and zebrafish 671
GFR 1/Gfr 1a, respectively (Figure 6A, box2). Moreover, this analysis also showed that 672
most of the amino acid residues identified as crucial for ligand-receptor interaction are 673
conserved in the zebrafish Gfr 1a, with exceptions for the residues Gly155 and Ile175, which 674
were replaced by Glu and Thr, respectively. The predictive 3D model was also supported by 675
Ramachandran plots which showed that 89.8% of the amino acid residues were in the most 676
favorable regions, 7% of residues situated in allowed regions (~2% expected), and 3.1% in 677
the outlier regions. The second evidence is the sequence alignment demonstrating conserved 678
regions between zebrafish Gdnfa (most abundant ligand) and rhGDNF, in particular, in the 679
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
binding sites to human GFR 1 and zebrafish Gfr 1a. Lastly, the biological effects per se 680
(e.g. proliferation and gene expression - see below) are the third evidence that rhGDNF not 681
only can bind to zebrafish Gfr 1a, but also trans-activates the receptor complex to trigger 682
molecular and cellular responses in the zebrafish testis. 683
With regards to biological functions, our results demonstrated that rhGDNF (100 684
ng/mL) increased the mitotic index of types Aund and Adiff spermatogonia when compared to 685
basal condition. Consistently, histomorphometric analysis revealed that both types A 686
spermatogonia (Aund and Adiff) became more abundant, while type B significantly decreased 687
following the rhGDNF treatment. Altogether, these results indicated that Gdnf not only 688
stimulates proliferation of the most undifferentiated spermatogonia (Aund and Adiff), but is 689
also involved with blocking late differentiation into type B spermatogonia. Similar functions 690
have been described for GDNF/Gdnf in mammalian and non-mammalian species. In 691
mammalian species, particularly rodents, Gdnf promotes self-renewing proliferation of SSC 692
[2]; see review in Parekh et al. [8] and Mäkelä and Hobbs [9]), although a recent study in 693
mice has shown that Gdnf could be more associated with blocking differentiation rather than 694
actively stimulating SSC proliferation [7]. In dogfish, rhGDNF promoted in vitro 695
proliferation and long-term maintenance of spermatogonia with stem characteristics [31]. In 696
medaka, Wei et al. [36] demonstrated that recombinant medaka Gdnfa and Gdnfb were 697
involved in the proliferation and survival of medaka SSCs. Furthermore, the knockdown of 698
medaka gfr 1a and gfr 1b subsequently confirmed that both receptors mediated the 699
proliferation and survival of medaka SSCs [71]. In this study, Zhao et al [71] also showed 700
that genes related with differentiation (e.g. c-kit) were up-regulated when lowering the 701
expression of both receptors. Altogether, these evidences in different species sustain our 702
conclusion that Gndf-Gfr 1 signaling pathway is associated with increasing/maintaining the 703
pool of early types of spermatogonia (Aund and Adiff) in the zebrafish testes through actively 704
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
promoting their proliferation and also by inhibiting their differentiation. Moreover, as 705
zebrafish Gdnfa and its receptor (Gfr 1a) are co-expressed, it is important to highlight that 706
the above-mentioned effects are related to an autocrine loop of Gdnf on type A 707
spermatogonia of zebrafish. 708
In this study, we also quantified Sertoli cell proliferation, reasoning that change in the 709
proliferation of Sertoli cells associated with types Aund or Adiff spermatogonia would indicate 710
creation of new niche space or supporting development of differentiating spermatogonial 711
cysts, respectively [65]. In fish, in contrast to mammals, Sertoli cells are not terminally 712
differentiated and continue to proliferate during spermatogenesis of adult males of different 713
species, which also includes zebrafish [54, 75, 79]. Strikingly, our results demonstrated that 714
Gndf promotes proliferation of Sertoli cells that are particularly associated with types Aund 715
and Adiff spermatogonia which are also undergoing mitosis (BrdU-positive cells). This data 716
indicates for the first time that a germ cell derived factor is involved in the creation of new 717
spermatogenic cysts, i.e. new available niches, as well as supporting the development of early 718
differentiating spermatogonial cysts. In the first case, as Gdnf stimulates proliferation of type 719
Aund, the newly formed, single spermatogonium must recruit its own Sertoli cells to form a 720
new spermatogenic cyst. Therefore, it is reasonable that new Sertoli cells would be produced 721
to create a niche into which the newly formed, single type Aund can be recruited or attracted 722
(germ cell homing). Consistently, in mice, Gdnf has been shown to be important for germ 723
stem cell homing as it acts as SSC chemotactic factor [80]. In the second case (supporting 724
development of differentiating spermatogonial cysts), Gdnf-induced Sertoli proliferation 725
would provide structural and nutritional support for the development of early differentiating 726
spermatogonia. In both cases, Gdnf effects on Sertoli cells might be mediated directly 727
through Gfr 1a which is also expressed in Sertoli cells of zebrafish. In agreement with our 728
observation, it was reported in rodents that Gdnf also promoted the proliferation of 729
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
immature Sertoli cells through its interaction with Gfr 1 and neural cell adhesion molecule 730
(NCAM) both co-expressed in Sertoli cells [81-82] 731
We further evaluated whether Gdnf could modulate testicular gene expression or 732
affect Fsh-induced gene expression in zebrafish explants. Previous studies have shown that 733
Fsh is the major endocrine player regulating zebrafish spermatogonial development through 734
targeting Sertoli and Leydig cells functions, such as sex steroid and growth factor production 735
[49, 56, 66, 83, 84]. Our results showed that Gdnf positively modulates its own regulatory 736
pathway (Gdnfa-Gfr 1a), increasing the transcript levels of both gdnfa and gfr 1a in the 737
zebrafish testicular explants. This would be the first demonstration that a germ cell factor can 738
affect the spermatogonial niche through an autocrine and paracrine loop. It seems that Gdnf 739
signaling would enhance its own production and sensitivity to favor the creation of new 740
spermatogonial niches (type Aund spermatogonia and Sertoli cells). Noteworthy, gfr 1b was 741
not modulated by any treatment, which supports that zebrafish Gfr 1a could be the 742
mammalian GFR 1 homologous form. Moreover, we showed that Fsh did not modulate 743
gdnfa expression in zebrafish testicular explants. Similarly, Bellaiche et al [33] demonstrated 744
that Fsh also did not modulate the expression of gdnfb in immature and early maturing 745
rainbow trout testicular explants. This regulation in fish is different from the one reported in 746
mammals, where Fsh has shown to stimulate the expression of Gdnf in the testes [84]. One 747
possible explanation for this different regulation would be the distinct cellular sites 748
expressing Gdnf in the mammalian and fish testes. In zebrafish, Gdnf is mainly secreted by 749
germ cells, which are not the direct targets of Fsh, while in mammals, Gdnf is secreted by 750
somatic cells, including Sertoli cells, which are known to express Fsh receptor. Additionally, 751
to support our data, we performed in silico analysis within −2000 to +1 bp upstream of the 752
zebrafish gdnfa gene to search cAMP response elements (CREs). As it is well known, Fsh 753
activates the cAMP-dependent protein kinase A signaling pathway, resulting in 754
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
phosphorylation of the cAMP response element-binding protein (CREB), which is required to 755
transactivate several genes containing CREs [85]. Moreover, Lamberti and Vicini [60] 756
demonstrated that three CRE binding sites in the murine Gdnf promoter are directly involved 757
in the basal and cAMP-induced expression of Gdnf in murine Sertoli cells. In our in silico 758
analysis, we demonstrated that zebrafish gdnfa promoter (−2000 to +1 bp) has less 759
conserved DNA binding sites as comparable with human and mouse GDNF/Gdnf promoter. 760
Moreover, our analysis showed only one CRE site near the zebrafish gdnfa transcription start 761
site, instead of three CREs as reported in human and mouse. This difference in promoter 762
region and quantity of CRE binding sites could be the reason that Fsh could not stimulate 763
gdnfa expression in zebrafish. 764
The GDNF/Gdnf promoter region also contains several E-boxes and N-boxes that 765
allow the binding of basic helix-loop-helix proteins with possible repressor activity on 766
GDNF/Gdnf expression through Notch signaling [62]. Activation of the Notch receptor 767
cleaves and releases the Notch intracellular domain (NICD) in the cytoplasm which migrates 768
to the nucleus where it forms a transcriptional complex with the DNA-binding protein RBPJ 769
(recombining binding protein suppressor of hairless) [88]. The canonical targets of RBPJ 770
include the HES and HEY families of transcriptional repressors, which are basic helix-loop-771
helix proteins (bHLH) [89-91]. Transcriptional repressors of the HES family (HES1–7) bind 772
to N-box promoter regions of their target genes, while repressors belonging to the HEY 773
family (HEY1, HEY2, HEYL) bind to E-box promoter regions [90]. In zebrafish, it is known 774
that Fsh stimulates Notch signaling [66]. Therefore, we speculate that Fsh nullified the Gdnf-775
increased gdnfa expression through Notch pathway and transcription repressors HES and 776
HEY which would bind to N/E-boxes within the zebrafish gdnfa promoter region. However, 777
functional studies on the zebrafish gdnfa promoter region are required to elucidate how Fsh 778
and Gdnf regulate the expression of gdnfa. 779
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
In this study, we demonstrated that gfr 1a transcripts were up-regulated by Fsh, but 780
not at the same intensity as in Gdnf treatment (3-fold increase as compared to Fsh). In 781
immature rainbow trout, Bellaiche et al [33] also reported that gfra1a mRNA levels were 782
increased following in vitro treatment with Fsh (100 ng/mL - same concentration as used in 783
our work). Moreover, the same authors reported that testicular gfra1a levels increased 784
towards the end of the reproductive cycle which coincides with the natural elevation of 785
plasma Fsh levels in rainbow trout [33]. Therefore, different from mammalian species where 786
Fsh up-regulated GDNF, we have evidence from two teleost species that Fsh modulates the 787
Gdnf-Gfr 1 pathway through stimulating not the ligand, but the receptor (gfra1a) mRNA 788
levels. However, there are some questions that remain unclear. The first question concerns 789
whether the Fsh-induced expression of gfra1a is mediated by Sertoli, germ cells or both. In 790
this work, we have demonstrated that gfra1a is expressed by Sertoli and germ cells, while the 791
Fsh receptor is exclusively expressed by somatic cells (Sertoli and Leydig cells) [54]. 792
Therefore, if Fsh-induced gfra1a expression is mediated by germ cells, this indicates that the 793
regulation occurs indirectly through growth factors or androgens released by somatic cells 794
(Sertoli and Leydig cells). Moreover, we cannot exclude that the increase of gfra1a could 795
also be a consequence of the proliferation of spermatogonia or/and Sertoli cells stimulated by 796
Fsh. Altogether, more studies are necessary to address the nature of Fsh regulation on gfra1a 797
expression levels in the zebrafish testis. Although Gdnf or Fsh, independently, stimulated 798
gfra1a mRNA levels in the zebrafish testis, we observed that co-treatment affected negatively 799
the Gdnf-induced expression of gfra1a in the zebrafish testicular explants. This is also noted 800
for other genes such as pou5f3 and dazl, whose expression were higher in the Gdnf treatment 801
as compared to co-treatment with Fsh. For pou5f3, a stem cell marker, this observation 802
suggested that Gdnf could be more involved in the maintenance of stemness than increasing 803
the number of stem cells in the zebrafish testis. On the contrary, Fsh would be more 804
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
associated with proliferation towards differentiation, as pou5f3 was significantly decreased 805
following Fsh co-treatment. Therefore, our data indicate that the pro-differentiating effects of 806
Fsh seemed to be more potent over the stem cell maintenance properties of Gdnf. On the 807
other hand, at the level of differentiation, Gdnf decreased the Fsh effects on spermatogonial 808
differentiation as the expression of dazl, a marker of late spermatogonial differentiation, was 809
significantly down-regulated. Altogether, this observation suggests that Gdnf could promote 810
stem cell maintenance through blocking spermatogonial differentiation. This conclusion is 811
also supported by histomorphometrical data showing that Gdnf decreased the frequency of 812
type B spermatogonia, and, somehow in agreement with the higher expression of Gfr 1a in 813
type Adiff spermatogonia, which might be the one of the principal targets of Gdnf in the 814
zebrafish testes. 815
As Gdnf is a member of TGF- superfamily, its role on inhibiting spermatogonial 816
differentiation is likely consistent with other TGF- superfamily member’s role, such as 817
Amh. Amh is a Sertoli cell growth factor which has been characterized as an inhibitor of 818
spermatogonial differentiation in zebrafish [57, 67 92], see review in Adolfi et al, [93]. In this 819
regard, we also examined whether Gdnf role could be modulated through Amh or by 820
inhibiting Igf3, a pro-differentiation Sertoli cell growth factor (56-57, 83-84). Our data 821
showed that rhGDNF did not modulate either amh or igf3 mRNA levels in the zebrafish 822
testicular explants. Therefore, Gdnf role on inhibiting zebrafish spermatogonial 823
differentiation is not mediated by Amh or Igf3, and it could be either mediated directly on 824
germ cells (autocrine) or indirectly through a different unknown growth factor released by 825
somatic cells (paracrine). 826
Figure 10 depicts our main findings regarding Gdnf actions on zebrafish testis. Gdnf 827
is a germ cell growth factor that acts on type A spermatogonia and Sertoli cells in an 828
autocrine and paracrine manner, respectively. Gdnf receptor, named as Gfr 1a, is expressed 829
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
in type A spermatogonia (highly expressed in types Aund and Adiff) and Sertoli cells. The main 830
actions of Gdnf are: 1) creation of new available niches by stimulating proliferation of both 831
type Aund spermatogonia and their surrounding Sertoli cells. In this context, we highlight that 832
Gdnf stimulates proliferation of Sertoli cells which are associated with type Aund undergoing 833
mitosis. As consequence, Gdnf increases the number of available niches and maintains the 834
stemness pool in the zebrafish testes. 2) Gdnf also supports the development of differentiating 835
spermatogonial cysts through proliferation of type Adiff and their surrounding Sertoli cells; 836
and finally, it also 3) inhibits late spermatogonial differentiation as shown by the decrease of 837
type B spermatogonia and down-regulation of dazl in the co-treatment with Fsh. Altogether 838
our data indicates that although the autocrine and paracrine roles of Gdnf are evolutionary 839
novelties in fish, Gdnf still exhibits similar/conserved functions as regards the mammalian 840
GDNF. Our data showed that Gdnf is not increasing the number of SSCs in the testis, but 841
rather is responsible for maintaining the spermatogonial stemness in the zebrafish testes by 842
tightly regulating the processes of creation of new available niches, supporting development 843
of early differentiating spermatogonial cysts and inhibiting late spermatogonial 844
differentiation. 845
846
847
848
849
850
851
852
853
854
855
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
856
Figure 10. Summarizing effects of Gdnf in the zebrafish spermatogonial niche. Gdnf is a germ cell 857 growth factor which acts on type A spermatogonia and their surrounding Sertoli cells in an autocrine 858 and paracrine manner, respectively. Gdnf receptor, named as Gfr 1a, is expressed in type A 859 spermatogonia (early spermatogonia, with higher expression in types Aund and Adiff) and Sertoli 860 cells. The main actions of Gdnf are: 1) creation of new available niches; 2) supporting the 861 development of early differentiating spermatogonial cysts; and 3) blocking late spermatogonial 862 differentiation. 863 864 865 866 867 868 869 870 871 872
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Acknowledgments 873
This research was supported by São Paulo Research Foundation (FAPESP) (2016/12101-4/ 874
2017/08274-3 granted to L.B.D.; 2014/07620–7 and 2020/03569-8 - granted to R.H.N.) and 875
financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – 876
Brasil (CAPES) – Finance Code 001” (granted to L.D.B.). R.H.N and G.M. are granted with 877
productivity scholarships from Brazilian National Council for Scientific and Technological 878
Development (CNPq) (proc. n. 305808/2020-6 and 307743/2018–7, respectively). 879
880
Authors Contribution 881
Conceived and designed the experiments: RHN, LBD, AJB, ERMM. Performed the 882
experiments: LBD, AJB, ERMM, RTN, BM, JMBR, IFR, MRS, ATN, DFC. Analyzed the 883
data: LBD, AJB, BM, RTN. Contributed reagents/materials/analysis tools: RTN, RHN. 884
Wrote the manuscript: LBD, GM, CS, RHN. 885
886
Conflicts of Interest 887
The authors declare no conflict of interest. 888
889
6. References 890
1. Zihlmann, K. B., Ducray, A. D., Schaller, B., Huber, A. W., Krebs, S. H., Andres, R. 891 H., ... & Widmer, H. R. The GDNF family members neurturin, artemin and persephin 892 promote the morphological differentiation of cultured ventral mesencephalic 893 dopaminergic neurons. Brain Res Bull. 2005, 68(1-2), 42-53. 894 895 2. Meng, X. Regulation of Cell Fate Decision of Undifferentiated Spermatogonia by 896 GDNF. Science (80). 2000, 287, 1489–1493. 897 898 3. Kubota, H., Avarbock, M. R., Brinster, R. L. Growth factors essential for self-renewal 899 and expansion of mouse spermatogonial stem cells. Proc. Natl. Acad. Sci. U. S. A. 900 101.47. 2004, 16489-16494. 901 902
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
4. Sharma, M., & Braun, R. E. Cyclical expression of GDNF is required for 903 spermatogonial stem cell homeostasis. Dev 145.5. 2018, dev151555. 904 905 5. Kakiuchi, K., Taniguchi, K., & Kubota, H. Conserved and non-conserved 906 characteristics of porcine glial cell line-derived neurotrophic factor expressed in the 907 testis. Sci. Rep. 8.1. 2018, 1-14. 908 909 6. Kubota, H., Wu, X., Avarbock, M. R., & Brinster, R. L. Glial cell line derived 910 neurotrophic factor and endothelial cells promote self renewal of rabbit germ cells 911 with spermatogonial stem cell properties. The FASEB journal 25.8. 2011, 2604-2614. 912 913 7. Sharma, M., & Braun, R. E. Cyclical expression of GDNF is required for 914 spermatogonial stem cell homeostasis. Dev 145.5. 2018, dev151555. 915 916 8. Parekh, P., Garcia, T. X., & Hofmann, M. C. Regulation of GDNF expression in 917 Sertoli cells. Reprod. 2019. 918 919 9. Mäkelä, J. A., & Hobbs, R. M. Molecular regulation of spermatogonial stem cell 920 renewal and differentiation. Reprod. 158.5 2019, R169-R187. 921 922 10. Fuchs, E.; Tumbar, T.; Guasch, G. Socializing with the neighbors: Stem cells and their 923 niche. Cell. 2004, 116, 769–778. 924 925 11. Hofmann, Marie-Claude. Gdnf signaling pathways within the mammalian 926 spermatogonial stem cell niche. Mol. Cell. Endocrinol. 288.1-2. 2008, 95-103. 927 928 12. Chen, L. Y., Willis, W. D., & Eddy, E. M. Targeting the Gdnf Gene in peritubular 929 myoid cells disrupts undifferentiated spermatogonial cell development. Proc. Natl. 930 Acad. Sci. U. S. A.113.7. 2016, 1829-1834. 931 932 13. Chen, L. Y., Brown, P. R., Willis, W. B., & Eddy, E. M. Peritubular myoid cells 933 participate in male mouse spermatogonial stem cell maintenance. End 155.12. 2014, 934 4964-4974. 935 936 14. Bhang, D. H., Kim, B. J., Kim, B. G., Schadler, K., Baek, K. H., Kim, Y. H., ... & 937 Ryeom, S. Testicular endothelial cells are a critical population in the germline stem 938 cell niche. Nat. Commun. 9.1. 2018, 1-16. 939 940 15. Helsel, A. R., Yang, Q. E., Oatley, M. J., Lord, T., Sablitzky, F., & Oatley, J. M. ID4 941 levels dictate the stem cell state in mouse spermatogonia. Dev 144.4. 2017, 624-634. 942 943 16. Lord, T., & Oatley, J. M. Functional assessment of spermatogonial stem cell purity in 944 experimental cell populations. Stem Cell Res 29. 2018, 129-133. 945 946
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
17. Viglietto, G.; Dolci, S.; Bruni, P.; Baldassarre, G.; Chiariotti, L.; Melillo, R.M.; 947 Salvatore, G.; Chiappetta, G.; Sferratore, F.; Fusco, A.; et al. Glial cell line-derived 948 neutrotrophic factor and neurturin can act as paracrine growth factors stimulating DNA 949 synthesis of Ret-expressing spermatogonia. Int. J. Oncol. 2000, 16, 783 950 951 18. Dettin, L.; Rubinstein, N.; Aoki, A.; Rabinovich, G. A.; Maldonado, C. A. Regulated 952 expression and ultrastructural localization of galectin-1, a proapoptotic -galactoside-953 binding lectin, during spermatogenesis in rat testis. Biol. Reprod 2003. 68(1), 51-59. 954 955 19. Hofmann, M.C.; Braydich-Stolle, L.; Dym, M. Isolation of male germ-line stem cells; 956 Influence of GDNF. Dev. Biol. 2005, 279, 114–124. 957 958 20. Ebata, K. T.; Zhang, X.; Nagano, M. C. Expression patterns of cell surface molecules 959 on male germ line stem cells during postnatal mouse development. Mol. Reprod. Dev. 960 2005. 72(2), 171-181. 961 962 21. Grasso, M.; Fuso, A.; Dovere, L.; De Rooij, D. G.; Stefanini, M.; Boitani, C.; Vicini, 963 E. Distribution of GFRA1-expressing spermatogonia in adult mouse testis. Reprod. 964 2012. 143(3), 325-332. 965 966 22. Sato, T.; Aiyama, Y.; Ishii-Inagaki, M.; Hara, K.; Tsunekawa, N.; Harikae, K.; ... 967 Kanai, Y. Cyclical and patch-like GDNF distribution along the basal surface of Sertoli 968 cells in mouse and hamster testes. PloS one. 2011. 6(12), e28367. 969 970 23. Kuijk, E. W.; Colenbrander, B.; Roelen, B. A. The effects of growth factors on in 971 vitro-cultured porcine testicular cells. Reprod. 2009. 138(4), 721-731. 972 973 24. Campos-Junior, P.H.A.; Costa, G.M.J.; Lacerda, S.M.S.N.; Rezende-Neto, J. V.; de 974 Paula, A.M.; Hofmann, M.-C.; de França, L.R. The Spermatogonial Stem Cell Niche 975 in the Collared Peccary (Tayassu tajacu). Biol. Reprod. 2012, 86, 1–10. 976 977 25. Lara, N.L.M.; Costa, G.M.J.; Avelar, G.F.; Guimarães, D.A.; França, L.R. Postnatal 978 testis development in the collared peccary (Tayassu tajacu), with emphasis on 979 spermatogonial stem cells markers and niche. Gen. Comp. Endocrinol. 2019, v. 10 980 273, p. 98–107. 981 982 26. Mahla, R. S.; Reddy, N.; Goel, S. Spermatogonial stem cells (SSCs) in buffalo 983 (Bubalus bubalis) testis. PLoS One. 2012, 7(4), e36020. 984 985 27. Costa, G.M.J.; Avelar, G.F.; Rezende-Neto, J. V.; Campos-Junior, P.H.A.; Lacerda, 986 S.M.S.N.; Andrade, B.S.C.; Thomé, R.G.; Hofmann, M.-C.; Franca, L.R. 987 Spermatogonial Stem Cell Markers and Niche in Equids. PLoS One. 2012, 7, e44091. 988 989
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
28. Gassei, K.; Ehmcke, J.; Dhir, R.; Schlatt, S. Magnetic activated cell sorting allows 990 isolation of spermatogonia from adult primate testes and reveals distinct 991 GFRa1 positive subpopulations in men. J. Med. Primatol. 2010, 39(2), 83-91. 992 993 29. He, Z.; Kokkinaki, M.; Jiang, J.; Dobrinski, I.; Dym, M. Isolation, characterization, 994 and culture of human spermatogonia. Biol. Reprod. 2010, 82(2), 363-372. 995 996 30. Bosseboeuf, A.; Gautier, A.; Auvray, P.; Mazan, S.; Sourdaine, P. Characterization of 997 spermatogonial markers in the mature testis of the dogfish (Scyliorhinus canicula L.). 998 Reprod. 2014, 147, 125–139. 999 1000 31. Gautier, A.; Bosseboeuf, A.; Auvray, P.; Sourdaine, P. Maintenance of potential 1001 spermatogonial stem cells in vitro by GDNF treatment in a chondrichthyan model 1002 (Scyliorhinus canicula L.). Biol. Reprod. 2014, 91, 1–15. 1003 1004 32. Nakajima, S.; Hayashi, M.; Kouguchi, T.; Yamaguchi, K.; Miwa, M.; Yoshizaki, G. 1005 Expression patterns of gdnf and gfr 1 in rainbow trout testis. Gene Expr. Patterns. 1006 2014, 14(2), 111-120. 1007 1008 33. Bellaiche, J.; Lareyre, J.-J.; Cauty, C.; Yano, A.; Allemand, I.; Le Gac, F. 1009 Spermatogonial Stem Cell Quest: nanos2, Marker of a Subpopulation of 1010 Undifferentiated A Spermatogonia in Trout Testis. Biol. Reprod. 2014, 90. 1011 1012 34. Maouche, A.; Curran, E.; Goupil, A.S.; Sambroni, E.; Bellaiche, J.; Le Gac, F.; 1013 Lareyre, J.J. New insights into the evolution, hormonal regulation, and spatiotemporal 1014 expression profiles of genes involved in the Gfra1/Gdnf and Kit/Kitlg regulatory 1015 pathways in rainbow trout testis. Fish Physiol. Biochem. 2018, 44, 1599–1616. 1016 1017 35. Zhao, Y.; Yang, Z.; Wang, Y.; Luo, Y.; Da, F.; Tao, W.; ... Wei, J. Both Gfr 1a and 1018 Gfr 1b are nvolved in the self-renewal and maintenance of spermatogonial stem cells 1019 in medaka. Stem Cells Dev. 2018, 27(23), 1658-1670.36. 1020 1021 36. Wei, J.; Liu, L.; Fan, Z.; Hong, Y.; Zhao, Y.; Zhou, L.; Wang, D. Identification, 1022 prokaryote expression of medaka gdnfa/b and their biological activity in a 1023 spermatogonial cell line. Stem Cells Dev. 2017, 26(3), 197-205. 1024 1025 37. Oatley, J. M.; Brinster, R. L. The germline stem cell niche unit in mammalian testes. 1026 Physiol. Rev. 2012, 92(2), 577-595. 1027 1028 38. Grunwald, D. J. and Eisen, J. S. Headwaters of the zebrafish—emergence of a new 1029 model vertebrate. Nat. Rev. Genet. 2002, 3(9), 717-724. 1030 1031
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
39. Spence, R.; Fatema, M. K.; Reichard, M.; Huq, K. A.; Wahab, M. A.; Ahmed, Z. F.; 1032 Smith, C. The distribution and habitat preferences of the zebrafish in Bangladesh. J. 1033 Fish Biol. 2006, 69(5), 1435-1448. 1034 1035 40. Engeszer, R. E.; Da Barbiano, L. A.; Ryan, M. J.; Parichy, D. M. Timing and plasticity 1036 of shoaling behaviour in the zebrafish, Danio rerio. Anim Behav. 2007, 74(5), 1269-1037 1275. 1038 1039 41. Hajam, Y. A.; Rani, R.; Sharma, P.; Kumar, R. Verma, S. K. Zebrafish (Danio rerio): 1040 A Versatile Model for Reproductive Biology. Recent updates in molecular 1041 Endocrinology and Reproductive Physiology of Fish. 2021, 105-120. 1042 1043 42. Phillips, J. B. and Westerfield, M. Zebrafish models in translational research: tipping 1044 the scales toward advancements in human health. Dis Model Mech. 2014, 7(7), 739-1045 743. 1046 1047 43. Drummond, A. J.; Ashton, B.; Cheung, M.; Heled, J.; Kearse, M.; Moir, R.; ... Wilson, 1048 A. Geneious v4. 8.5. 2009. 1049 1050 44. Flicek, P.; Amode, M. R.; Barrell, D.; Beal, K.; Brent, S.; Chen, Y.; ... Searle, S. M. 1051 Ensembl 2011. Nucleic acids res. 2010, 39 (suppl_1), D800-D806. 1052 1053 45. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high 1054 throughput. Nucleic acids res. 2004, 32(5), 1792-1797. 1055 1056 46. Lefort, V.; Longueville, J. E.; Gascuel, O. SMS: smart model selection in PhyML. 1057 Mol. Biol. Evol. 2017, 34(9), 2422-2424. 1058 1059 47. Drummond, A. J., & Rambaut, A. BEAST: Bayesian evolutionary analysis by 1060 sampling trees. BMC Evol. Biol. 2007, 7(1), 1-8. 1061 1062
48. Geraldo, M. T.; Valente, G. T.; Braz, A. S.; Martins, C. The discovery of Foxl2 1063 paralogs in chondrichthyan, coelacanth and tetrapod genomes reveals an ancient 1064 duplication in vertebrates. Heredity. 2013, 111(1), 57-65. 1065 1066 49. Nóbrega, R.H.; Greebe, C.D.; van de Kant, H.; Bogerd, J.; de França, L.R.; Schulz, 1067 R.W. Spermatogonial stem cell niche and spermatogonial stem cell transplantation in 1068 zebrafish. PLoS One. 2010, 5, 1–16. 1069 1070 50. Hinfray, N.; Nóbrega, R. H.; Caulier, M.; Baudiffier, D.; Maillot-Marechal, E.; 1071 Chadili, E.; ... Brion, F. Cyp17a1 and Cyp19a1 in the zebrafish testis are differentially 1072 affected by oestradiol. J Endocrinol. 2013, 216(3), 375-88. 1073 1074
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
51. Leal, M.C.; Cardoso, E.R.; Nóbrega, R.H.; Batlouni, S.R.; Bogerd, J.; França, L.R.; 1075 Schulz, R.W. Histological and Stereological Evaluation of Zebrafish (Danio rerio) 1076 Spermatogenesis with an Emphasis on Spermatogonial Generations. Biol. Reprod. 1077 2009a, 81, 177–187.52. 1078 1079 52. Lovell, S.C.; Davis, I.W.; Arendall III, W.B.; De Bakker,P.I.W.; Word, J.M.; Prisant, 1080 M.G.; Richardson, J.S.; Richardson, D.C. Structure validation by Calpha geometry: 1081 phi, psi and Cbeta deviation. Proteins: Struct. Funct. Genet. 2002, 50(3):437-450. 1082 1083 53. Leal, M.C.; de Waal, P.P.; García-López, Á.; Chen, S.X.; Bogerd, J.; Schulz, R.W. 1084 Zebrafish primary testis tissue culture: An approach to study testis function ex vivo. 1085 Gen. Comp. Endocrinol. 2009b, 162, 134–138. 1086 1087 54. García-López, Á.; De Jonge, H.; Nóbrega, R.H.; De Waal, P.P.; Van Dijk, W.; 1088 Hemrika, W.; Taranger, G.L.; Bogerd, J.; Schulz, R.W. Studies in zebrafish reveal 1089 unusual cellular expression patterns of gonadotropin receptor messenger ribonucleic 1090 acids in the testis and unexpected functional differentiation of the gonadotropins. 1091 Endocrinology. 2010, 151, 2349–2360. 1092 1093 55. Gautier, A.; Bosseboeuf, A.; Auvray, P.; Sourdaine, P. Maintenance of potential 1094 spermatogonial stem cells in vitro by GDNF treatment in a chondrichthyan model 1095 (Scyliorhinus canicula L.). Biol. Reprod. 2014, 91, 1–15. 1096 1097 56. Nóbrega, R.H.; De Souza Morais, R.D.V.; Crespo, D.; De Waal, P.P.; De França, L.R.; 1098 Schulz, R.W.; Bogerd, J. Fsh stimulates spermatogonial proliferation and 1099 differentiation in zebrafish via Igf3. Endocrinology. 2015, 156, 3804–3817. 1100 1101 57. Morais, R.D.V.S.; Crespo, D.; Nóbrega, R.H.; Lemos, M.S.; van de Kant, H.J.G.; de 1102 França, L.R.; Male, R.; Bogerd, J.; Schulz, R.W. Antagonistic regulation of 1103 spermatogonial differentiation in zebrafish (Danio rerio) by Igf3 and Amh. Mol. Cell. 1104 Endocrinol. 2017, 454, 112–124. 1105 1106 58. Tovo-Neto, A.; Martinez, E. R.; Melo, A. G.; Doretto, L. B.; Butzge, A. J.; Rodrigues, 1107 M. S.; ... Nóbrega, R. H. Cortisol Directly Stimulates Spermatogonial Differentiation, 1108 Meiosis, and Spermiogenesis in Zebrafish (Danio rerio) Testicular Explants. 1109 Biomolecules. 2020, 10(3), 429. 1110 1111 59. Bucher, P. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter 1112 elements derived from 502 unrelated promoter sequences. J Mol Biol. 1990, 212(4), 1113 563-578. 1114 1115 60. Wang Q.; Li W., Liu X.S.; Carroll J.S.; Jänne O.A.; Keeton E.K.; Chinnaiyan A.M.; 1116 Pienta K.J.; Brown M. A Hierarchical Network of Transcription Factors Governs 1117
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Androgen Receptor-Dependent Prostate Cancer Growth. Molecular Cell. 2007, 27, 3, 1118 380-392. 1119 1120 61. Lamberti D.; Vicini E. Promoter analysis of the gene encoding GDNF in murine 1121 Sertoli cells. Mol. Cell. Endocrinol. 2014, 394 105–114. 1122 1123 62. Garcia T.X.; Parekh P.; Gandhi P.; Sinha K.; Hofmann M.C. The NOTCH ligand 1124 JAG1 regulates GDNF expression in Sertoli cells. Stem Cells Dev. 2017, 26 585–598. 1125 1126 63. Kuri P.; Ellwanger K.; Kufer T.A.; Leptin M.; Bajoghli B. A high-sensitivity bi-1127 directional reporter to monitor NF- B activity in cell culture and zebrafish in real time. 1128 J Cell Sci. 2017, 130(3), 648–657. 1129 1130 64. Fornes O.; Castro-Mondragon J.A.; Khan A.; Lee R.; Zhang X.; Richmond P.A.; Modi 1131 B.P.; Correard S.; Gheorghe M.; Baranaši D.; Santana-Garcia W.; Tan G.; Chèneby 1132 J.; Ballester B.; Parcy F.; Sandelin A.; Lenhard B.; Wasserman W.W; Mathelier A. 1133 JASPAR 2020: update of the open-access database of transcription factor binding 1134 profiles. Nucleic Acids Res. 2020, 48, D1, D87–D92. 1135 1136 65. França, L.R.; Nóbrega, R.H.; Morais, R.D.V.S.; De Castro Assis, L.H.; Schulz, R.W. 1137 Sertoli cell structure and function in anamniote vertebrates. In Sertoli Cell Biology. 1138 2015, Elsevier, pp. 385–407. 1139 1140 66. Crespo, D., Assis, L. H., Furmanek, T., Bogerd, J., & Schulz, R. W. Expression 1141 profiling identifies Sertoli and Leydig cell genes as Fsh targets in adult zebrafish testis. 1142 Mol. Cell. Endocrinol. 2016, 437, 237-251. 1143 1144 67. Skaar, K.S.; Nóbrega, R.H.; Magaraki, A.; Olsen, L.C.; Schulz, R.W.; Male, R. 1145 Proteolytically activated, recombinant anti-Müllerian hormone inhibits androgen 1146 secretion, proliferation, and differentiation of spermatogonia in adult zebrafish testis 1147 organ cultures. Endocrinology. 2011, 152, 3527–3540. 1148 1149 68. Wang, L.M.; Zhang, Q.; Zhang, Q.; Zhu, W.; He, C.; Lu, C.L; Chen, Z.Y. Identification 1150 of the key amino acids of glial cell line-derived neurotrophic factor family receptor 1 1151 involved in its biological function. J Biol Chem. 2004, 279, 109-116. 1152 1153 69. Airaksinen, M. S.; Holm, L.; Hätinen, T. Evolution of the GDNF family ligands and 1154 receptors. Brain, Behav Evol. 2006, 68, 181-190. 1155 1156 70. Wang, X. Structural studies of GDNF family ligands with their receptors—Insights into 1157 ligand recognition and activation of receptor tyrosine kinase RET. Biochim Biophys 1158 Acta Proteins Proteom. 2013, 1834, 2205-2212. 1159 1160
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
71. Zhao, Y.; Yang, Z.; Wang, Y.; Luo, Y.; Da, F.; Tao, W.; Wei, J. Both Gfr 1a and 1161 Gfr 1b Are Involved in the Self-Renewal and Maintenance of Spermatogonial Stem 1162 Cells in Medaka. Stem Cells Dev. 2018, 27, 1658-1670. 1163 1164 72. Maouche, A. Caractérisation de voies de régulation paracrine potentiellement impliquées 1165 dans le devenir des cellules souches spermatogoniales chez la truite arc-en-ciel 1166 (Oncorhynchus mykiss) (Doctoral dissertation, Université Bretagne Loire (COMUE)). 1167 2018. 1168 1169 73. Hoegg, S.; Brinkmann, H.; Taylor, J.S.; Meyer, A. Phylogenetic timing of the fish-1170 specific genome duplication correlates with the diversification of teleost fish. J Mol 1171 Evol. 2004, 59, 190-203. 1172 1173 74. Meyer, A.; Van de Peer, Y. From 2R to 3R: evidence for a fish specific genome 1174 duplication (FSGD). Int J Bioassays. 2005, 27, 937-945. 1175 1176 75. Buaas, F.W.; Kirsh, A. L.; Sharma, M.; McLean, D. J.; Morris, J. L.; Griswold, M. D.; 1177 Braun, R.E. Plzf is required in adult male germ cells for stem cell self-renewal. Nat 1178 Genet. 2004, 36, 647-652. 1179 1180 76. Costoya, J. A.; Hobbs, R. M.; Barna, M.; Cattoretti, G.; Manova, K.; Sukhwani, M.; 1181 Pandolfi, P.P. Essential role of Plzf in maintenance of spermatogonial stem cells. Nat 1182 genet. 2004, 36, 653-659. 1183 1184 77. Grasso, M.; Fuso, A.; Dovere, L.; De Rooij, D. G.; Stefanini, M.; Boitani, C.; Vicini, E. 1185 Distribution of GFRA1-expressing spermatogonia in adult mouse testis. Reproduction. 1186 2012, 143, 325-332. 1187 1188 78. Lacerda, S.M.S.N.; Costa, G.M.J.; da Silva, M.D.A.; Campos-Junior, P.H.A.; Segatelli, 1189 T.M.; Peixoto, M.T.D.; de França, L.R. Phenotypic characterization and in vitro 1190 propagation and transplantation of the Nile tilapia (Oreochromis niloticus) 1191 spermatogonial stem cells. Gen Com Endocrinol. 2013, 192, 95-106. 1192 1193 79. Schulz, R.W.; Menting, S.; Bogerd, J.; França, L.R.; Vilela, D. A.; Godinho, H.P; Sertoli 1194 cell proliferation in the adult testis—evidence from two fish species belonging to 1195 different orders. Biol Reprod. 2005, 73, 891-898. 1196 1197 80. Kanatsu-Shinohara, M.; Inoue, K.; Takashima, S.; Takehashi, M.; Ogonuki, N.; 1198 Morimoto, H.; Shinohara, T. Reconstitution of mouse spermatogonial stem cell niches 1199 in culture. Cell Stem Cell. 2012, 11, 567-578. 1200 1201 81. Wu, Z.; Templeman, J. L.; Smith, R. A.; Mackay, S. Effects of glial cell line derived 1202 neurotrophic factor on isolated developing mouse Sertoli cells in vitro. J Anat. 2005, 1203 206, 175-184. 1204
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
1205 82. Wang, Q.; Liu, H.; Shi, Y.; Pan, Z.; Wang, J. Activation of the GFRa1/NCAM pathway 1206 stimulates Sertoli cell proliferation in vitro. Belg J Zool. 2008, 138, 177-183. 1207 1208 83. Safian, D.; Ryane, N.; Bogerd, J.; Schulz, R. W. Fsh stimulates Leydig cell Wnt5a 1209 production, enriching zebrafish type A spermatogonia. J Endocrinol. 2018, 239, 351-1210 363. 1211 1212 84. Safian, D.; Bogerd, J.; Schulz, R.W. Regulation of spermatogonial development by Fsh: 1213 The complementary roles of locally produced Igf and Wnt signaling molecules in adult 1214 zebrafish testis. Gen Comp Endocrinol. 2019, 284, 113244. 1215 1216 85. Simon, L.; Ekman, G.C.; Tyagi, G.; Hess, R.A.; Murphy, K.M.; Cooke, P.S. Common 1217 and distinct factors regulate expression of mRNA for ETV5 and GDNF, Sertoli cell 1218 proteins essential for spermatogonial stem cell maintenance. Exp Cell Res. 2007, 313, 1219 3090-3099. 1220 1221 86. Walker, W.H.; Fucci, L.I.N.D.A.; Habener, J.F. Expression of the gene encoding 1222 transcription factor cyclic adenosine 3', 5'-monophosphate (cAMP) response element-1223 binding protein (CREB): regulation by follicle-stimulating hormone-induced cAMP 1224 signaling in primary rat Sertoli cells. Endocrinology. 1995, 136, 3534-3545. 1225 1226 87. Garcia, T.X.; Parekh, P.; Gandhi, P.; Sinha, K.; Hofmann, M.C. The NOTCH ligand 1227 JAG1 regulates GDNF expression in Sertoli cells. Stem Cells Dev. 2017, 26, 585-598. 1228 1229 88. Tanigaki, K.; Honjo, T. Two opposing roles of RBP-J in Notch signaling. Curr Top Dev 1230 Biol. 2010, 92, 231-252. 1231 1232 89. Iso, T.; Kedes, L.; Hamamori, Y. HES and HERP families: multiple effectors of the 1233 Notch signaling pathway. J Cell Physiol. 2003, 194, 237-255. 1234 1235 90. Kageyama, R.; Ohtsuka, T.; Kobayashi, T. The Hes gene family: repressors and 1236 oscillators that orchestrate embryogenesis. Development. 2007, 1243-1251. 1237 1238 91. Bray, S.; Bernard, F. Notch targets and their regulation. Curr Top Dev Biol. 2010, 92, 1239 253-275. 1240 1241 92. Lin, Q.; Mei, J.; Li, Z.; Zhang, X.; Zhou, L.; Gui, J.F. Distinct and cooperative roles of 1242 amh and dmrt1 in self-renewal and differentiation of male germ cells in 1243 zebrafish. Genetics. 2017, 207, 1007-1022. 1244 1245 93. Adolfi, M.C.; Nakajima, R.T.; Nóbrega, R.H.; Schartl, M. Intersex, hermaphroditism, 1246 and gonadal plasticity in vertebrates: Evolution of the Müllerian duct and 1247 Amh/Amh5r2 signaling. Ann Rev Animal Biosci. 2019, 7, 149-172. 1248
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Supplemental material 1249
1. Material and Methods 1250
1.1 gdnfa expression in zebrafish adult testis 1251
For in situ hybridization, a zebrafish gdnfa-specific PCR product was generated with 1252
primers gdnfa-ish-Fw and gdnfa-ish-Rv (Table 1). The ~160 bp PCR product was gel 1253
purified, and served as a template for digoxigenin (DIG)-labelled cRNA probe synthesis 1254
using the RNA labeling (Roche) kit. Gonads were fixed in 4% paraformaldehyde (PFA) in 1255
PBS at 4ºC for 2 hours. The protocol used for whole mount (WISH) and in situ hybridization 1256
(paraffin embedded) were performed with adaptations, as described previously [1]. Detection 1257
of hybridization signal was done with HNPP Fluorescent Detection Set (Roche). Nuclei 1258
counter-staining was performed with DAPI (Sigma) (1:10000) diluted in PBS (Phosphate 1259
Buffered Saline pH 7.4, ster -). 1260
1261
2. Results 1262
2.1 Morphological characteristics and in situ hybridization for gdnfa in adult zebrafish 1263
testis 1264
1265
1266
1267
1268
1269
1270
1271
1272
1273
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Supplemental Figure 1. Morphological characteristics and in situ hybridization for gdnfa in 1274 adult zebrafish testis. A-B. Adult zebrafish testis section showing different germ cysts 1275 (arrow) and Sertoli cells (arrowhead). Bars- 5µM C-E. Detection of gdnfa mRNA by in situ 1276 hybridization. Bars - 10 µM. Aund – type A undifferentiated spermatogonia, Adiff type A 1277 differentiated spermatogonia, SPG B – type B spermatogonia, SPC – spermatocytes, SPT – 1278 spermatids, SPZ – spermatozoa and SC - Sertoli cell 1279 1280 1281 2.2 Control sections using either preadsorbed antibody with the corresponding peptide or 1282 omitting the antibody 1283
1284
Supplemental Figure 2. Control sections of immunofluorescence of cellular localization of 1285 Gfr 1a protein in zebrafish testis (green - A; red – B) using either preadsorbed antibody with the 1286 corresponding peptide or omitting the antibody confirming the antibody specificity. Bars - 10 1287 µM. Aund – type A undifferentiated spermatogonia, Adiff type A differentiated 1288 spermatogonia, SPG B – type B spermatogonia, SPC – spermatocytes, SPT – spermatids, 1289 SPZ – spermatozoa and SC - Sertoli cell. 1290 1291 1292 1293
1294
1295
1296
1297
1298
1299
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
2.3 Detailed interaction between rhGDNF and the zebrafish receptor Gfr 1a 1300
1301
1302
1303
1304
1305
1306
1307
1308
1309
1310
1311
1312
1313
1314
1315
Supplemental Figure 3. Predicted protein complex models of Danio rerio Gfr 1 and 1316 rhGNDF (hetero-2-2-mer). In A, the template is chosen according to results performed by 1317 SWISS-MODEL (swissmodel.expasy.org). Blue arrowheads show the Gfr 1 protein structure 1318 and in orange the ligand sites bind to rhGNDF protein. Dark grey represents the rhGNDF 1319 proteins and light grey the ligand sites bind to Gfr 1. In B, the 3D model of the Gfr 1-Gndf 1320 protein structure. In green, the Gfr 1 protein structure and in purple the ligand sites bind to 1321 Gndf protein. Yellow represents the rhGNDF proteins and in red the ligand sites that bind to 1322 Gfra1a. Arrows indicating two ligands of N-Acetyl-D-glucosamine. In C, we merged the 1323 template and the model of the hetero-2-2-mer showing the similarity of the structures and the 1324 identity of the structure formed at the binding sites between Gfr 1 and rhGNDF proteins 1325 (orange-purple and light grey-red). Arrows indicating two ligands of the ligand N-Acetyl-D-1326 Glucosamine. 1327 1328 1329 1330 1331 1332 1333
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
1334
Video 1 here. 1335
1336
1337
Video 1. Video of the detailed interaction between the rhGDNF and its possible ortholog 1338 receptor in zebrafish adult testis, Gfr 1a. Despite the evolutionary distance between both 1339 receptor and ligand, the ligand is still able to respond to the recombinante human GDNF. 1340 1341 1342 1343 1344 1345 1346 1347 1348
1349
1350
Table S1. Parameters set to reconstruct the phylogeny. 1351
1352
Bayesiana (Beast v1.7.0)
Substitution model JTT
Base frequencies estimated
Starting tree Randomly generated
Generetations/Burn-in 10 000 000/10 000
Sample frequency 1000
Branch support Posterior probability
Reference (Homo
sapiens) Predicted sequence Position related +1
TATA-box
TATAAA -33
CRE1
CCTCTGACTTCAGCC -161
CRE2
GTTTAGGTCAGA -93
CRE3
GGGCACGTCACGCA -57
E-box
CATCTG -388
E-box
CAAGTG -1294
E-box
CAGTTG -1694 and -1709
E-box
CACGTG -1277; -1461 and -
1853
NF-kB
GGAGATTCC -1445
Reference (
Mus
musculus) Predicted sequence Position related +1
TATA-box
TATAAA -33
CRE1
CCTCTGACTTCAGCC -161
CRE2
GTTTAGGTCAGA -93
CRE3
GGGCACGTCACGCA -57
E-box
CAACTG -805 and -1394
E-box
CAGATG -1587 and -1865
E-box
CAGTTG -1690
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
Table S2. Predicted regulatory binding sites of the GDNF promoter in Homo sapiens, Mus 1353 musculus and Danio rerio. 1354 1355 1356 1357 3. Reference 1358
1. Thisse, C.; Thisse, B. High-resolution in situ hybridization to whole-mount zebrafish 1359
embryos. Nat Protoc. 2008, 3, 59-69. 1360
1361 1362
N-box
CACCTG -1373; -1451 and -
1843
N-box
CACCAG -1660
AR
TCTTCCAGAACACATACTCCCCAACAA -829
NF-kB
GGAGATTCCG -1435
NF-kB
AGTGGCCTT -1480
Reference (
Danio
rerio) Predicted sequence Position related +1
TATA-box
TTAAAAAGCGC -28
GC-box
GGGCGG -75
CRE canonical
TGACGTCA -59
E-box
CAGTTG -350
E-box
CAACTG -705; -1411 and -1777
N-box
CACCAG -1696
AR – half site
AGAACA -1027 and -1805
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
.CC-BY-NC-ND 4.0 International licenseavailable under a
(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprintthis version posted December 26, 2021. ; https://doi.org/10.1101/2021.12.25.474164doi: bioRxiv preprint
