Available via license: CC BY 4.0
Content may be subject to copyright.
cells
Article
Deleterious Role of Th9 Cells in Pulmonary Fibrosis
Kui Miao Deng †, Xiang Sheng Yang †, Qun Luo †, Yi Xin She, Qing Yang Yu and Xiao Xiao Tang *
Citation: Deng, K.M.; Yang, X.S.;
Luo, Q.; She, Y.X.; Yu, Q.Y.; Tang, X.X.
Deleterious Role of Th9 Cells in
Pulmonary Fibrosis. Cells 2021,10,
3209. https://doi.org/10.3390/
cells10113209
Academic Editors:
Anna Serrano-Mollar and C
Arnold Spek
Received: 17 September 2021
Accepted: 9 November 2021
Published: 17 November 2021
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
State Key Laboratory of Respiratory Disease, National Clinical Research Center for Respiratory Disease, National
Center for Respiratory Medicine, Guangzhou Institute of Respiratory Health, The First Affiliated Hospital of
Guangzhou Medical University, Guangzhou 510182, China; dengkuimiao@163.com (K.M.D.);
xiangshy2008@126.com (X.S.Y.); luoqunx@163.com (Q.L.); sheyixinsemail@163.com (Y.X.S.);
yuqingyang0413@163.com (Q.Y.Y.)
*Correspondence: tangxiaoxiao@gird.cn
† Contributed equally to this work.
Abstract:
Idiopathic pulmonary fibrosis (IPF) is a progressive and fatal lung disease of unknown
etiology. Immune disorders play an important role in IPF pathogenesis. Here, we show that Th9 cells
differentiate and activate in the lung tissue of patients with IPF and bleomycin (BLM)-induced lung
fibrosis mice. Moreover, we found that Th9 cells promote pulmonary fibrosis in two ways. On the
one hand, Th9 cells promote fibroblast differentiation, activation, and collagen secretion by secreting
IL-9. On the other hand, they promote differentiation of Th0 cells into Th2 cells by secreting IL-4.
Th9 cells and Th2 cells can promote each other, accelerating the Th1/Th2 imbalance and eventually
forming a positive feedback of pulmonary fibrosis. In addition, we found that neutralizing IL-9
in both preventive and therapeutic settings ameliorates bleomycin-induced pulmonary fibrosis.
Furthermore, we identified several critical signaling pathways involved in the effect of neutralizing
IL-9 on pulmonary fibrosis by proteomics study. From an immunological perspective, we elucidated
the novel role and underlying mechanism of Th9 cells in pulmonary fibrosis. Our study suggested
that Th9-based immunotherapy may be employed as a treatment strategy for IPF.
Keywords: idiopathic pulmonary fibrosis; Th9 cells; Th2 cells; interleukin-9
1. Introduction
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, incurable, and fatal
disease characterized by pulmonary fibrosis [
1
]. Its main pathological feature is persistent
alveolar epithelial cell injury, as well as abnormal proliferation and activation of fibrob-
lasts [
2
]. Excessive extracellular matrix deposition and structural destruction of lung tissue
lead to fibrosis and dysfunction of the lung, respiratory failure, and eventually death.
The incidence of IPF has continued to increase in recent years and the disease course is
irreversible. IPF is more common in middle-aged and older males, with a poor prognosis
and a median survival of only 2–3 years [
3
]. The pathogenesis of IPF is not completely
understood, and currently there is no effective treatment. The two oral drugs approved
by the US FDA, nintedanib and pirfenidone, can only relieve symptoms or slow disease
progression. The latest guidelines just weakly recommended them for IPF drug treat-
ment [
1
]. In recent years, several drugs have been tested in clinical trials, but their effects
are limited [
4
]. Therefore, development of new and effective treatment strategies has been
of great significance and is desperately needed.
Innate and acquired immune responses play an important role in the pathogenesis of
IPF [
5
]. T cells are widely present in active disease areas and tertiary lymphatic structures
in patients with IPF [
6
]. CD4
+
helper T cells (Th cells) are divided into different subtypes
according to the type of cytokines they produce. Stimulated by antigen, resting CD4
+
T cells (Th0 cells) can further differentiate into Th1 and Th2 cells under the influence of
polarization signals in the microenvironment. IFN-
γ
promotes Th1 differentiation, while
IL-4 promotes Th2 differentiation. Th1 and Th2 cells cross-inhibit each other and form a
Cells 2021,10, 3209. https://doi.org/10.3390/cells10113209 https://www.mdpi.com/journal/cells
Cells 2021,10, 3209 2 of 30
negative feedback loop. Th1 cells and Th2 cells each secrete a variety of cytokines, forming
a complex cytokine network to regulate the immune response. The cytokines secreted by
Th1 cells mainly include IL-2, IFN-
γ
, TNF, IL-12, and IL-18, while the cytokines secreted by
Th2 cells mainly include IL-4, IL-5, IL-6, IL-10, IL-13, and monocyte chemotactic protein-1
(MCP-1). Th1 and Th2 immune responses exert negative feedback through the secretion
of cytokines and maintain the immune balance. In recent years, Th1/Th2 imbalance
has been shown to play an important role in the pathogenesis of pulmonary fibrosis.
During fibrosis, Th1 cells inhibit the proliferation of fibroblasts and the formation of fibrous
tissue by secreting anti-fibrotic factors such as IFN-
γ
and IL-12 [
7
,
8
]. IL-4 secreted by Th2
cells has been shown to induce fibroblast aggregation, and promote fibroblast activation
and proliferation. Another Th2 cytokine, IL-13, can induce lung fibrosis by selectively
stimulating and activating TGF-
β
[
9
–
12
]. These studies indicated that the Th1 response
is anti-fibrotic, whereas the Th2 response is pro-fibrotic. Several studies have confirmed
an increased level of Th2 cytokines in the serum of patients with pulmonary fibrosis as
compared to that of health controls [
13
–
15
], indicating that the progression of pulmonary
fibrosis may be related to a strong Th2 pro-fibrotic response [16].
Previous studies have shown that TGF-
β
and IL-4 levels are elevated in patients with
IPF [
12
,
17
]. Th9 cells, a new CD4
+
T cell subset, can either be differentiated directly from
resting CD4
+
(Th0) cells stimulated by IL-4 and TGF-
β
or can be transdifferentiated from
Th2 cells stimulated by TGF-
β
[
18
]. Therefore, elevated TGF-
β
and IL-4 may lead to an
increased Th9 differentiation in the lungs of patients with IPF. However, the role of Th9
cells in the pathogenesis of pulmonary fibrosis has not yet been explored and determined.
A study showed that Th9 cells have pro-inflammatory and anti-inflammatory effects in
autoimmune diseases [
19
]. The main cytokine secreted by Th9 cells is IL-9 [
20
], which
exerts its effects on a variety of cells, and whether it promotes pulmonary fibrosis is also
controversial. On the one hand, IL-9 can recruit mast cells and promote their secretion
of TGF-
β
[
20
,
21
]. It can also promote fibrosis by inhibiting the antigen-presenting cell-
mediated Th1-type immune response and downregulating the expression of anti-fibrotic
molecules such as IL-12 and IFN-
γ
[
22
]. On the other hand, IL-9 exerts an anti-fibrotic
effect by inducing differentiation of monocyte-macrophage and synthesis of an anti-fibrotic
molecule PGE2 [
23
]. In animal studies, Sugimoto et al. found that IL-9 neutralizing
antibody ameliorated silica-induced pulmonary fibrosis in mice [
24
]. Arras et al. found
that IL-9 has a protective role in pulmonary fibrosis by comparing IL-9 overexpressing
transgenic mice (Tg5 mice) and wild-type controls [
25
]. In a clinical study, Li et al. found
that the serum level of IL-9 in patients with IPF during infection phase was significantly
higher than that in the stable phase and healthy controls, suggesting that IL-9 is a risk factor
for patients with IPF [
26
]. Similarly, Jiang et al. measured serum IL-9 levels in 61 patients
with connective tissue disease-associated interstitial lung disease (CTD-ILD) and found
that their serum IL-9 levels were negatively correlated with lung function [
27
]. Unlike
the above studies, Koichi et al. measured serum IL-9 levels in 71 patients with systemic
sclerosis (SSc) and found that IL-9 is a protective factor for patients with SSc [
28
]. Therefore,
more in-depth research is needed to determine whether IL-9 is pro-fibrotic or anti-fibrotic.
Other than secreting IL-9, one study suggested that Th9 cells also secrete some Th2
type cytokines such as IL-4 [
29
]. An elevated IL-4 has been reported in bronchoalveolar
lavage fluid (BALF) from patients with pulmonary fibrosis [
12
]. Additionally, anti-IL-4
chimeric protein has an anti-fibrotic effect after nasal drip into BLM mice [30].
Based on the above evidence, we hypothesized that Th9 cells abnormally differentiate
and activate when TGF-
β
is abundantly enriched in pulmonary fibrosis. On the one
hand, Th9 cells and Th2 cells promote each other (may via IL-4), accelerating the Th1/Th2
imbalance and forming a positive feedback of the pro-fibrosis process. On the other hand,
Th9 cells secrete IL-9, which promotes the proliferation and activation of fibroblasts as
well as collagen secretion, eventually leading to pulmonary fibrosis. Our hypothesis is
different from regarding Th9/IL-9 as a whole in previous studies, and this study is the first
to explore the role of Th9 cells in promoting pulmonary fibrosis via IL-9 and IL-4.
Cells 2021,10, 3209 3 of 30
2. Results
2.1. Th9 Differentiation and Activation Increase in the PBMC and Lung Tissue of Patients with IPF
Immune disorder has been regarded as one of the important pathogeneses of IPF.
Previous studies have shown that TGF-
β
and IL-4 are elevated in patients with IPF (
TGF-β
is increased in lung tissue and IL-4 is increased in BALF). The differentiation of Th9 cells
depends on TGF-
β
and IL-4 [
12
,
17
], therefore, we speculated that Th9 differentiation
increases in the patients of IPF. In order to determine the Th9 ratio in patients with IPF, we
isolated peripheral blood mononuclear cells (PBMC) from the whole blood and analyzed
it by flow cytometry (Figure 1A) (Table 1). The results showed that the proportion of
Th9 cells in CD4
+
T lymphocytes in the PBMC of patients with IPF was significantly
higher than that in healthy controls (Figure 1B) and positively correlated with CT score
(
Figure 1C
), indicating that the increase of Th9 cells is positively correlated with the severity
of pulmonary fibrosis in patients with IPF.
Table 1.
Demographic and clinical characteristics of healthy controls and patients with IPF (Th9 cells
in PBMC).
Characteristic Patients with IPF (n= 16) Healthy Controls (n= 19) pValue
Age (years) 64.13 ±6.62 65.45 ±7.39 0.60
Male, n(%) 16 (100%) 19 (100%) -
PBMC: peripheral blood mononuclear cell. Data are presented as n(%), mean ±SD.
To clarify whether the distribution and differentiation of Th9 cells are altered in the
lungs of patients with IPF, we examined PU.1 (the specific transcription factor of Th9
cells) in the lung tissues of patients with IPF (n= 14) and controls (n= 4) by immunohis-
tochemistry (Table 2). As expected, the expression of PU.1 in the lungs of patients with
IPF was significantly increased as compared to the controls (Figure 1D), indicating an
increased differentiation of Th9 cells in the lungs of patients with IPF. As the main cytokine
secreted by Th9 cells is IL-9, we then examined the expression and distribution of IL-9 in
the lung tissue of patients with IPF (n= 14) and controls (n= 4) by immunohistochemistry.
The results showed an increased IL-9 expression in the lungs of patients with IPF as well
(Figure 1D).
Table 2.
Demographic and clinical characteristics of controls and patients with IPF (lung
tissue immunohistochemistry).
Characteristic Patients with IPF (n= 14) Controls (n= 4) pValue
Age (years) 58.86 ±8.75 60.5 ±3 0.72
Male, n(%) 12 (85.71%) 4 (100%) -
FEV1 (%pre) 88.43 ±8.75 94.25 ±5.06 0.15
FVC (%pre) 73.21 ±5.96 88.5 ±3 <0.001 ***
DLCO (%pre) 62.43 ±6.38 87.25 ±3.77 <0.001 ***
Data are presented as n(%), mean
±
SD. FVC (% predicted), forced vital capacity (% predicted); FEV1 (% pre-
dicted), forced expiratory volume in 1 s (% predicted); DL
CO
(% predicted), carbon monoxide diffusing capacity
(% predicted). *** p< 0.001.
Cells 2021,10, 3209 4 of 30
Cells 2021, 10, x 4 of 30
Figure 1. Cont.
Cells 2021,10, 3209 5 of 30
Cells 2021, 10, x 5 of 30
Figure 1. Increased Th9 cell differentiation and IL-9 expression in patients with IPF. (A) Representative pseudo-color plot
showing proportion of Th9 cells to CD4+ T cells in PBMC of patients with IPF and healthy controls by flow cytometry. (B)
Proportions of Th9 cells to CD4+ T cells in PBMC between patients with IPF (n = 16) and healthy controls (n = 19). (C)
Correlation analysis between proportion of Th9 cells in PBMC and HRCT score of pulmonary fibrosis (n = 16). (D) Repre-
sentative images of PU.1 and IL-9 immunostaining in serial sections of lung tissue from patients with IPF (n = 14) and
controls (n = 4). Scale bars, 100 μm. PBMC, peripheral blood mononuclear cell. HRCT, high resolution CT. *** p < 0.001.
2.2. Th9 Differentiation and Activation Increase in Lung Tissue of BLM-Induced Lung Fibrosis
Mice
We then harvested the lungs of BLM mice on day 7, 14, and 21 after BLM treatment
and analyzed the content and activation of Th9 cells by flow cytometry (Figure 2A). We
found that starting from day 14 after BLM treatment, the proportion of Th9 cells in CD4+
T lymphocytes in the lungs of the model group was significantly higher than that in the
control group (control group: 0.3413 ± 0.04497%, model group: 0.7787 ± 0.1534%, p < 0.01)
and this trend persisted until day 21 after BLM treatment (day 21: control group: 0.4669 ±
0.0714%, model group: 0.8054 ± 0.1093%, p < 0.05) (Figure 2B). These results demonstrated
that the number of Th9 cells in the lung tissue of BLM mice increased. We also examined
the expression level of PU.1 and Irf4, two transcription factors important for Th9 differen-
tiation, in BALF cells of BLM mice and control mice. We found that, starting from day 14
after treatment, the expression levels of PU.1 and Irf4 in the BLM-treated group were sig-
nificantly higher than those in the control group (PU.1: day 14, p < 0.05; day 21, p < 0.01;
Irf4: day 14, p < 0.05; day 21, p < 0.05) (Figure 2C). Consistent with this, the flow cytometry
results also suggested that Th9 cell activation in the lungs of BLM mice was significantly
higher than that in the control group (day 7, p < 0.01; day 14, p < 0.001; day 21, p < 0.0001)
(Figure 2D), indicating an increased number and function of Th9 cells in the lungs of BLM
mice. In addition, previous studies have shown that various CD4+ T cell subsets are not
stable and mutual transformation is observed among these subsets [31]. Th9 cell subset
can also transform into other Th cell subsets in a polarized microenvironment [32]. There-
fore, we tested whether Th9 cells in the lungs of BLM mice functioned as other subsets,
especially Th2 subset. In addition to IL-9, we found that Th9 cells in the model group had
a higher proportion of CD4+IL9+IL-4+ T cell subset, suggesting an increased IL-4 secretion
by Th9 cells in the lungs of BLM mice (day 14: control group: 5.106 ± 0.7764%, model
Figure 1.
Increased Th9 cell differentiation and IL-9 expression in patients with IPF. (
A
) Representative pseudo-color plot
showing proportion of Th9 cells to CD4
+
T cells in PBMC of patients with IPF and healthy controls by flow cytometry.
(
B
) Proportions of Th9 cells to CD4
+
T cells in PBMC between patients with IPF (n= 16) and healthy controls (
n= 19
).
(
C
) Correlation analysis between proportion of Th9 cells in PBMC and HRCT score of pulmonary fibrosis (n= 16). (
D
) Rep-
resentative images of PU.1 and IL-9 immunostaining in serial sections of lung tissue from patients with IPF (n= 14) and
controls (n= 4). Scale bars, 100 µm. PBMC, peripheral blood mononuclear cell. HRCT, high resolution CT. *** p< 0.001.
2.2. Th9 Differentiation and Activation Increase in Lung Tissue of BLM-Induced Lung
Fibrosis Mice
We then harvested the lungs of BLM mice on day 7, 14, and 21 after BLM treatment
and analyzed the content and activation of Th9 cells by flow cytometry (Figure 2A). We
found that starting from day 14 after BLM treatment, the proportion of Th9 cells in CD4
+
T
lymphocytes in the lungs of the model group was significantly higher than that in the control
group (control group: 0.3413
±
0.04497%, model group: 0.7787
±
0.1534%,
p< 0.01
) and this
trend persisted until day 21 after BLM treatment (day 21: control group:
0.4669 ±0.0714%
,
model group: 0.8054
±
0.1093%, p< 0.05) (Figure 2B). These results demonstrated that the
number of Th9 cells in the lung tissue of BLM mice increased. We also examined the expression
level of PU.1 and Irf4, two transcription factors important for Th9 differentiation, in BALF
cells of BLM mice and control mice. We found that, starting from day 14 after treatment,
the expression levels of PU.1 and Irf4 in the BLM-treated group were significantly higher
than those in the control group (PU.1: day 14, p< 0.05; day 21, p< 0.01; Irf4: day 14, p< 0.05;
day 21, p< 0.05) (Figure 2C). Consistent with this, the flow cytometry results also suggested
that Th9 cell activation in the lungs of BLM mice was significantly higher than that in the
control group (day 7,
p< 0.01
; day 14,
p< 0.001
; day 21, p< 0.0001) (Figure 2D), indicating an
increased number and function of Th9 cells in the lungs of BLM mice. In addition, previous
studies have shown that various CD4
+
T cell subsets are not stable and mutual transformation
is observed among these subsets [
31
]. Th9 cell subset can also transform into other Th cell
subsets in a polarized microenvironment [
32
]. Therefore, we tested whether Th9 cells in the
lungs of BLM mice functioned as other subsets, especially Th2 subset. In addition to IL-9,
we found that Th9 cells in the model group had a higher proportion of CD4
+
IL9
+
IL-4
+
T
cell subset, suggesting an increased IL-4 secretion by Th9 cells in the lungs of BLM mice
(day 14: control group: 5.106
±
0.7764%, model group: 9.391
±
1.528%, p< 0.05; day 21:
control group: 6.700 ±0.9240%, model group: 10.33 ±0.9359%, p< 0.05) (Figure 2E).
Cells 2021,10, 3209 6 of 30
Cells 2021, 10, x 6 of 30
group: 9.391 ± 1.528%, p < 0.05; day 21: control group: 6.700 ± 0.9240%, model group: 10.33
± 0.9359%, p < 0.05) (Figure 2E).
Figure 2. Cont.
Cells 2021,10, 3209 7 of 30
Cells 2021, 10, x 7 of 30
Figure 2. Increased Th9 cell differentiation and activation in the lung of bleomycin (BLM)-induced pulmonary fibrosis
mice. (A) Representative pseudo-color plot showing proportion of Th9 cells to CD4+ T cells in the lungs of BLM mice and
control mice (CD4+ IL-9+ T cells were defined as Th9 cells). (B) Proportion of Th9 cells in the lung tissue of BLM mice and
control mice (n = 6 to 9) at the indicated time points calculated by flow cytometry. (C) Quantitative PCR analysis of PU.1
and Irf4 in the BALF cells of BLM mice and control mice at the indicated time points. (D) Activation of Th9 cells in the
lung of BLM mice and control mice at the indicated time points. (E) Increased expression of IL-4 in Th9 cells (CD4+ IL-9+
IL-4+ T cells) in the lung of BLM mice. P values were determined by two-sided Student’s t-test. BALF, bronchoalveolar
lavage fluid. * p < 0.05, ** p < 0.01, *** p < 0.001.
2.3. IL-9 Promotes Fibroblast Proliferation and Activation In Vitro
Previous studies have shown that IL-9 promotes cell proliferation [33,34]. Lung fi-
broblasts, the major effector cells of the progressive fibrotic process in IPF, secrete excess
extracellular matrix, and eventually lead to pulmonary fibrosis. In order to test the effect
of IL-9 on the proliferation of fibroblasts, we isolated lung fibroblasts from wild-type mice
and stimulated them with IL-9 alone or in the presence of TGF-β (TGF-β was used to
mimic the lung microenvironment in pulmonary fibrosis) for 24 or 48 h, and the cell pro-
liferation rate was determined by CCK8 assay. The results showed that 24 h after IL-9
stimulation, the cell proliferation rate was significantly increased as compared to the con-
trol group, either in the absence (p = 0.0108) or presence (p = 0.0144) of TGF-β. 48 h after
stimulation, the change trend of each group was consistent with that of 24 h (Figure 3A).
Figure 2.
Increased Th9 cell differentiation and activation in the lung of bleomycin (BLM)-induced pulmonary fibrosis mice.
(
A
) Representative pseudo-color plot showing proportion of Th9 cells to CD4
+
T cells in the lungs of BLM mice and control
mice (CD4
+
IL-9
+
T cells were defined as Th9 cells). (
B
) Proportion of Th9 cells in the lung tissue of BLM mice and control
mice (n= 6 to 9) at the indicated time points calculated by flow cytometry. (
C
) Quantitative PCR analysis of PU.1 and Irf4 in
the BALF cells of BLM mice and control mice at the indicated time points. (
D
) Activation of Th9 cells in the lung of BLM
mice and control mice at the indicated time points. (
E
) Increased expression of IL-4 in Th9 cells (CD4
+
IL-9
+
IL-4
+
T cells)
in the lung of BLM mice. pvalues were determined by two-sided Student’s t-test. BALF, bronchoalveolar lavage fluid.
*p< 0.05, ** p< 0.01, *** p< 0.001.
2.3. IL-9 Promotes Fibroblast Proliferation and Activation In Vitro
Previous studies have shown that IL-9 promotes cell proliferation [
33
,
34
]. Lung
fibroblasts, the major effector cells of the progressive fibrotic process in IPF, secrete excess
extracellular matrix, and eventually lead to pulmonary fibrosis. In order to test the effect
of IL-9 on the proliferation of fibroblasts, we isolated lung fibroblasts from wild-type
mice and stimulated them with IL-9 alone or in the presence of TGF-
β
(TGF-
β
was used
to mimic the lung microenvironment in pulmonary fibrosis) for 24 or 48 h, and the cell
proliferation rate was determined by CCK8 assay. The results showed that 24 h after
IL-9 stimulation, the cell proliferation rate was significantly increased as compared to
the control group, either in the absence (p= 0.0108) or presence (p= 0.0144) of TGF-
β
.
Cells 2021,10, 3209 8 of 30
48 h after stimulation, the change trend of each group was consistent with that of 24 h
(Figure 3A). These data demonstrated that IL-9 alone or together with TGF-
β
can promote
the proliferation of mouse primary lung fibroblasts
in vitro
. During the development of
pulmonary fibrosis, fibroblasts differentiate into myofibroblasts and secrete more collagen.
To clarify whether IL-9 activates fibroblasts, we stimulated fibroblasts with IL-9 alone or
in the presence of TGF-
β
. Real-time quantitative PCR was used to detect the expression
of
α
-SMA, which is a marker of fibroblast activation. 24 h after stimulation, IL-9, either
alone or together with TGF-
β
, increased the expression level of
α
-SMA as compared to the
control group (p< 0.001, p= 0.0252). 48 h of stimulation showed the same change trend
of each group as that of 24 h (Figure 3B). These results indicated that IL-9, either in the
absence or presence of TGF-
β
, can increase activation of mouse primary lung fibroblasts
in vitro
. In addition to real-time qPCR, we also detected an enhanced expression level of
α
-SMA by immunofluorescence (Figure 3C). In order to verify the results at the protein
level, we detected the
α
-SMA expression by Western blot and found that it was markedly
increased after IL-9 stimulation than that in the control (Figure 3D), corroborated the
immunofluorescence results. During the progress of IPF, (myo)fibroblasts secrete a large
amount of extracellular matrix, including collagen I. In order to determine the effect of IL-9
on collagen I secretion by fibroblasts, we stimulated fibroblasts with IL-9 alone or in the
presence of TGF-
β
for 24 h or 48 h and then detected the Col1a1 expression by real-time
qPCR. The results showed that 24 h after stimulation, Col1a1 expression in IL-9 group was
remarkably higher than that in the control group (p< 0.001). The mRNA expression of
Col1a1 in the IL-9 and TGF-
β
-stimulated group was also significantly higher than that
in the TGF-
β
-stimulated group (p= 0.0091). 48 h after stimulation, the change trend of
each group was consistent with that of 24 h (Figure 3E). We obtained similar results by
Western blot (Figure 3F). These data demonstrated that IL-9 alone or together with TGF-
β
can promote the Col1a1 secretion of mouse primary lung fibroblasts
in vitro
. Previous
studies have shown that an increased STAT3 and SMAD2/3 phosphorylation participates
in IPF progression [
35
,
36
]. We therefore wondered if they are involved in the effect of
IL-9 on fibroblasts. The results showed that stimulation of fibroblasts with IL-9 alone or
together with TGF-
β
for 24 h increased the phosphorylation of STAT3 (p= 0.043, p= 0.0341)
and SMAD2/3 (p= 0.0366, p= 0.0126), and stimulation for 48 h showed a similar pattern
(Figure 3G). Taken together, these results indicated that IL-9 can promote proliferation,
activation, and collagen secretion of fibroblasts. Moreover, an increased phosphorylation
of STAT3 and SMAD2/3 may be involved in the effect of IL-9 on fibroblasts.
Cells 2021, 10, x 8 of 30
These data demonstrated that IL-9 alone or together with TGF-β can promote the prolif-
eration of mouse primary lung fibroblasts in vitro. During the development of pulmonary
fibrosis, fibroblasts differentiate into myofibroblasts and secrete more collagen. To clarify
whether IL-9 activates fibroblasts, we stimulated fibroblasts with IL-9 alone or in the pres-
ence of TGF-β. Real-time quantitative PCR was used to detect the expression of α-SMA,
which is a marker of fibroblast activation. 24 h after stimulation, IL-9, either alone or to-
gether with TGF-β, increased the expression level of α-SMA as compared to the control
group (p < 0.001, p = 0.0252). 48 h of stimulation showed the same change trend of each
group as that of 24 h (Figure 3B). These results indicated that IL-9, either in the absence or
presence of TGF-β, can increase activation of mouse primary lung fibroblasts in vitro. In
addition to real-time qPCR, we also detected an enhanced expression level of α-SMA by
immunofluorescence (Figure 3C). In order to verify the results at the protein level, we
detected the α-SMA expression by Western blot and found that it was markedly increased
after IL-9 stimulation than that in the control (Figure 3D), corroborated the immunofluo-
rescence results. During the progress of IPF, (myo)fibroblasts secrete a large amount of
extracellular matrix, including collagen I. In order to determine the effect of IL-9 on colla-
gen I secretion by fibroblasts, we stimulated fibroblasts with IL-9 alone or in the presence
of TGF-β for 24 h or 48 h and then detected the Col1a1 expression by real-time qPCR. The
results showed that 24 h after stimulation, Col1a1 expression in IL-9 group was remarka-
bly higher than that in the control group (p < 0.001). The mRNA expression of Col1a1 in
the IL-9 and TGF-β-stimulated group was also significantly higher than that in the TGF-
β-stimulated group (p = 0.0091). 48 h after stimulation, the change trend of each group was
consistent with that of 24 h (Figure 3E). We obtained similar results by Western blot (Fig-
ure 3F). These data demonstrated that IL-9 alone or together with TGF-β can promote the
Col1a1 secretion of mouse primary lung fibroblasts in vitro. Previous studies have shown
that an increased STAT3 and SMAD2/3 phosphorylation participates in IPF progression
[35,36]. We therefore wondered if they are involved in the effect of IL-9 on fibroblasts. The
results showed that stimulation of fibroblasts with IL-9 alone or together with TGF-β for
24 h increased the phosphorylation of STAT3 (p = 0.043, p = 0.0341) and SMAD2/3 (p =
0.0366, p = 0.0126), and stimulation for 48 h showed a similar pattern (Figure 3G). Taken
together, these results indicated that IL-9 can promote proliferation, activation, and colla-
gen secretion of fibroblasts. Moreover, an increased phosphorylation of STAT3 and
SMAD2/3 may be involved in the effect of IL-9 on fibroblasts.
Figure 3. Cont.
Cells 2021,10, 3209 9 of 30
Cells 2021, 10, x 9 of 30
Figure 3. Cont.
Cells 2021,10, 3209 10 of 30
Cells 2021, 10, x 10 of 30
Figure 3. IL-9 promotes fibroblast proliferation and activation in vitro. (A) IL-9 (10 ng/mL, 24 h or 48 h) increased prolif-
eration of primary mouse lung fibroblasts in the presence or absence of TGF-β (5 ng/mL) examined by CCK8 assay. (B)
Quantitative PCR analysis of α-SMA in primary mouse lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the
presence or absence of TGF-β (5 ng/mL). (C) Representative images and quantitative analysis of α-SMA immunostaining
in primary mouse lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the presence or absence of TGF-β (5 ng/mL)
(n = 4). Scale bars, 200 μm. (D) Representative Western blot images and quantitative analysis of α-SMA in primary mouse
lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the presence or absence of TGF-β (5 ng/mL) (n = 6). β-Actin
was used as a loading control. (E) Quantitative PCR analysis of Col1a1 in primary mouse lung fibroblasts treated with IL-
Figure 3.
IL-9 promotes fibroblast proliferation and activation
in vitro
. (
A
) IL-9 (10 ng/mL, 24 h or 48 h) increased
proliferation of primary mouse lung fibroblasts in the presence or absence of TGF-
β
(5 ng/mL) examined by CCK8 assay.
(
B
) Quantitative PCR analysis of
α
-SMA in primary mouse lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the
presence or absence of TGF-
β
(5 ng/mL). (
C
) Representative images and quantitative analysis of
α
-SMA immunostaining in
primary mouse lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the presence or absence of TGF-
β
(5 ng/mL)
(
n= 4
). Scale bars, 200
µ
m. (
D
) Representative Western blot images and quantitative analysis of
α
-SMA in primary mouse
lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the presence or absence of TGF-β(5 ng/mL) (n= 6). β-Actin
Cells 2021,10, 3209 11 of 30
was used as a loading control. (
E
) Quantitative PCR analysis of Col1a1 in primary mouse lung fibroblasts treated with IL-9
(10 ng/mL, 24 h or 48 h) in the presence or absence of TGF-
β
(5 ng/mL) (n= 5). (
F
) Representative Western blot images
and quantitative analysis of COL1A1 in primary mouse lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the
presence or absence of TGF-
β
(5 ng/mL) (n= 6).
β
-Actin was used as a loading control. (
G
) Representative Western blot
images and quantitative analysis of STAT3 and SMAD2/3 phosphorylation and their total expression in primary mouse
lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the presence or absence of TGF-
β
(5 ng/mL) (n= 6). Data were
expressed as mean
±
SEM. * p< 0.05; ** p< 0.01, *** p< 0.001. pvalues were determined by one-way ANOVA (Tukey’s test).
2.4. Th9 Cells Promote Th0 Cells to Differentiate into Th2 Cells and Induce Lung Fibroblasts to
Secrete More Collagen
We next explored the effects of Th9 cells on lung cells. To test the effect of Th9 cells on
Th0 cells
in vitro
, CD4
+
Th0 cells in the lungs of BLM mice and control mice were sorted by
flow cytometry and induced into Th9 cells
in vitro
, and then co-cultured respectively with
Th0 cells sorted from normal mice (Figure 4A). 6 days after co-culture, Th2 cell content was
detected by flow cytometry. As compared to the cells that were not induced into Th9 cells
(Ctrl-Th9
−
group: 4.660
±
0.3282%; BLM-Th9
−
group: 3.326
±
0.3808%), cells that were
induced into Th9 (either derived from normal mice or BLM mice) were found to promote
the differentiation of Th0 cells to Th2 cells (Ctrl-Th9
+
group: 6.523
±
0.3881%, p< 0.01;
BLM-Th9
+
group: 4.782
±
0.3843%, p< 0.05) (Figure 4B). As we know, Th0 cells selectively
differentiate into Th1 or Th2 cells in different microenvironments and Th1/Th2 is in a
dynamic balance under normal circumstances. The above experiments showed that Th9
cells can promote the differentiation of Th0 cells to Th2 cells, thereby accelerating Th1/Th2
imbalance and forming a positive feedback to promote fibrosis. We then examined the
effect of Th9 cells on collagen secretion of cultured fibroblasts. Th9 cells induced
in vitro
were co-cultured with mouse lung fibroblasts for 6 days and collagen content in the cell
supernatant was assayed by ELISA (Figure 4A). As compared to the cells that were not
induced, co-culture with the induced Th9 cells (whether derived from normal mice or BLM
mice) resulted in a higher collagen content in the cell supernatant, indicating that Th9 cells
can induce lung fibroblasts to secrete more collagen in vitro (p< 0.01) (Figure 4C).
Cells 2021, 10, x 11 of 30
9 (10 ng/mL, 24 h or 48 h) in the presence or absence of TGF-β (5 ng/mL) (n = 5). (F) Representative Western blot images
and quantitative analysis of COL1A1 in primary mouse lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the
presence or absence of TGF-β (5 ng/mL) (n = 6). β-Actin was used as a loading control. (G) Representative Western blot
images and quantitative analysis of STAT3 and SMAD2/3 phosphorylation and their total expression in primary mouse
lung fibroblasts treated with IL-9 (10 ng/mL, 24 h or 48 h) in the presence or absence of TGF-β (5 ng/mL) (n = 6). Data were
expressed as mean ± SEM. * p < 0.05; ** p < 0.01, *** p < 0.001. p values were determined by one-way ANOVA (Tukey’s test).
2.4. Th9 Cells Promote Th0 Cells to Differentiate into Th2 Cells and Induce Lung Fibroblasts to
Secrete More Collagen
We next explored the effects of Th9 cells on lung cells. To test the effect of Th9 cells
on Th0 cells in vitro, CD4+ Th0 cells in the lungs of BLM mice and control mice were sorted
by flow cytometry and induced into Th9 cells in vitro, and then co-cultured respectively
with Th0 cells sorted from normal mice (Figure 4A). 6 days after co-culture, Th2 cell con-
tent was detected by flow cytometry. As compared to the cells that were not induced into
Th9 cells (Ctrl-Th9- group: 4.660 ± 0.3282%; BLM-Th9- group: 3.326 ± 0.3808%), cells that
were induced into Th9 (either derived from normal mice or BLM mice) were found to
promote the differentiation of Th0 cells to Th2 cells (Ctrl-Th9+ group: 6.523 ± 0.3881%, p <
0.01; BLM-Th9+ group: 4.782 ± 0.3843%, p < 0.05) (Figure 4B). As we know, Th0 cells selec-
tively differentiate into Th1 or Th2 cells in different microenvironments and Th1/Th2 is in
a dynamic balance under normal circumstances. The above experiments showed that Th9
cells can promote the differentiation of Th0 cells to Th2 cells, thereby accelerating Th1/Th2
imbalance and forming a positive feedback to promote fibrosis. We then examined the
effect of Th9 cells on collagen secretion of cultured fibroblasts. Th9 cells induced in vitro
were co-cultured with mouse lung fibroblasts for 6 days and collagen content in the cell
supernatant was assayed by ELISA (Figure 4A). As compared to the cells that were not
induced, co-culture with the induced Th9 cells (whether derived from normal mice or
BLM mice) resulted in a higher collagen content in the cell supernatant, indicating that
Th9 cells can induce lung fibroblasts to secrete more collagen in vitro (p < 0.01) (Figure
4C).
Figure 4. Cont.
Cells 2021,10, 3209 12 of 30
Cells 2021, 10, x 12 of 30
Figure 4. Th9 cells promote Th0 cells (Naive CD4+ T cells) differentiating to Th2 cells and induce lung fibroblasts to secrete
more collagen. (A) Flowchart of the co-culture assay. (B) Co-culture of Th9 cells and Th0 cells promotes the differentiation
of Th0 cells to Th2 cells (n = 5 to 6). (C) Co-culture of Th9 cells and lung fibroblasts induces fibroblasts to secrete more
collagen (n = 3). P values were determined by two-sided Student’s t-test. Data were expressed as mean ± SEM. * p < 0.05;
** p < 0.01.
2.5. Preventive Treatment of Neutralizing IL-9 Reduces Pulmonary Fibrosis and Collagen Secre-
tion
The above experiments demonstrated that Th9 cells and IL-9 promote pulmonary
fibrosis. Next, we verified whether neutralizing IL-9 could reduce pulmonary fibrosis of
BLM mice. The BLM model undergoes an inflammatory phase (0–7 d) and a fibrosis phase
(after 7 d). Animal drug administration during these two phases is regarded as preventive
and therapeutic, respectively [37]. From the first day after BLM instillation, we intraperi-
toneally injected BLM mice with IL-9 neutralizing antibody every 3 days (Figure 5A). HE
staining showed that, 21 days after BLM treatment, the lung tissue of BLM group (BLM +
PBS) and IgG isotype control group (BLM + Isotype) had severe damage and inflamma-
tory cell infiltration (indicated by the black arrow). BLM + Isotype group was defined as
the control group. The inflammatory response in the lungs of IL-9 neutralizing antibody
group was significantly decreased (Figure 5B). The degree of pulmonary fibrosis was eval-
uated with Ashcroft score (the more severe the degree of fibrosis, the higher the Ashcroft
score) and we found that neutralizing IL-9 had remarkable lower Ashcroft scores than
control group (p = 0.0024) (Figure 5B). Distribution of collagen fibers in the lung tissue and
degree of fibrosis were also evaluated by Masson staining (the more severe the degree of
fibrosis, the higher the fibrosis score). It was found that 21 days after BLM instillation,
collagen deposition in the mice lungs of BLM group and IgG isotype control group mark-
edly increased; whereas IL-9 neutralizing antibody group had less collagen deposition
Figure 4.
Th9 cells promote Th0 cells (Naive CD4
+
T cells) differentiating to Th2 cells and induce lung fibroblasts to secrete
more collagen. (
A
) Flowchart of the co-culture assay. (
B
) Co-culture of Th9 cells and Th0 cells promotes the differentiation of
Th0 cells to Th2 cells (n= 5 to 6). (
C
) Co-culture of Th9 cells and lung fibroblasts induces fibroblasts to secrete more collagen
(n= 3). pvalues were determined by two-sided Student’s t-test. Data were expressed as mean
±
SEM. * p< 0.05; ** p< 0.01.
2.5. Preventive Treatment of Neutralizing IL-9 Reduces Pulmonary Fibrosis and Collagen Secretion
The above experiments demonstrated that Th9 cells and IL-9 promote pulmonary
fibrosis. Next, we verified whether neutralizing IL-9 could reduce pulmonary fibrosis
of BLM mice. The BLM model undergoes an inflammatory phase (0–7 d) and a fibrosis
phase (after 7 d). Animal drug administration during these two phases is regarded as
preventive and therapeutic, respectively [
37
]. From the first day after BLM instillation,
we intraperitoneally injected BLM mice with IL-9 neutralizing antibody every 3 days
(
Figure 5A
). HE staining showed that, 21 days after BLM treatment, the lung tissue of BLM
group (BLM + PBS) and IgG isotype control group (BLM + Isotype) had severe damage
and inflammatory cell infiltration (indicated by the black arrow). BLM + Isotype group was
defined as the control group. The inflammatory response in the lungs of IL-9 neutralizing
antibody group was significantly decreased (Figure 5B). The degree of pulmonary fibrosis
was evaluated with Ashcroft score (the more severe the degree of fibrosis, the higher the
Ashcroft score) and we found that neutralizing IL-9 had remarkable lower Ashcroft scores
than control group (p= 0.0024) (Figure 5B). Distribution of collagen fibers in the lung
tissue and degree of fibrosis were also evaluated by Masson staining (the more severe
the degree of fibrosis, the higher the fibrosis score). It was found that 21 days after BLM
instillation, collagen deposition in the mice lungs of BLM group and IgG isotype control
group markedly increased; whereas IL-9 neutralizing antibody group had less collagen
deposition than control group (Figure 5C). Similarily, the fibrosis score of IL-9 neutralizing
antibody group was significantly lower than that of control group as well (p= 0.0032)
(Figure 5C).
Cells 2021,10, 3209 13 of 30
In addition, we found that neutralizing IL-9 significantly reduced the expression of
α
-SMA (an indicator for fibroblast activation) in lung tissue by real-time qPCR as compared
to control group (p= 0.0078), indicating a decreased activation of fibroblasts (Figure 5D).
Meanwhile, expression level of Col1a1 in the treated group was significantly lower than
that of control group (p= 0.035) (Figure 5E). In addition, protein level of COL1A1 in the
treated group was decreased as compared to control group (p= 0.0022) (Figure 5F). We also
measured the content of hydroxyproline (a major component of collagen) in lung tissue and
found a markedly reduced level in the treated group (p= 0.0379) (Figure 5G). Neutralizing
IL-9 significantly reduced phosphorylation of STAT3 (p= 0.0093) and SMAD2/3 (
p= 0.0048
)
(Figure 5H). These results demonstrated that neutralizing IL-9 reduces the degree of
pulmonary fibrosis and collagen secretion. Moreover, phosphorylation of STAT3 and
SMAD2/3 is involved.
Cells 2021, 10, x 13 of 30
than control group (Figure 5C). Similarily, the fibrosis score of IL-9 neutralizing antibody
group was significantly lower than that of control group as well (p = 0.0032) (Figure 5C).
In addition, we found that neutralizing IL-9 significantly reduced the expression of
α-SMA (an indicator for fibroblast activation) in lung tissue by real-time qPCR as com-
pared to control group (p = 0.0078), indicating a decreased activation of fibroblasts (Figure
5D). Meanwhile, expression level of Col1a1 in the treated group was significantly lower
than that of control group (p = 0.035) (Figure 5E). In addition, protein level of COL1A1 in
the treated group was decreased as compared to control group (p = 0.0022) (Figure 5F).
We also measured the content of hydroxyproline (a major component of collagen) in lung
tissue and found a markedly reduced level in the treated group (p = 0.0379) (Figure 5G).
Neutralizing IL-9 significantly reduced phosphorylation of STAT3 (p = 0.0093) and
SMAD2/3 (p = 0.0048) (Figure 5H). These results demonstrated that neutralizing IL-9 re-
duces the degree of pulmonary fibrosis and collagen secretion. Moreover, phosphoryla-
tion of STAT3 and SMAD2/3 is involved.
Figure 5. Cont.
Cells 2021,10, 3209 14 of 30
Cells 2021, 10, x 14 of 30
Figure 5. Cont.
Cells 2021,10, 3209 15 of 30
Cells 2021, 10, x 15 of 30
Figure 5. Neutralizing IL-9 attenuates pulmonary fibrosis and collagen content in the bleomycin (BLM)-induced pulmo-
nary fibrosis mice (preventive intervention). (A) Schematic showing therapeutic intervention in the BLM model. Drugs
(PBS/Isotype/anti-IL-9, every 3 days) were injected intraperitoneally starting at day 1, and lungs were assessed on day 21
after BLM administration. (B) Representative HE staining and quantitative analysis of lung sections from mice of different
experimental groups (n = 6 to 12). Inflammatory cell infiltration was indicated by black arrows. Scale bars, 50 μm. (C)
Representative Masson’s trichrome staining and quantitative analysis of lung sections from mice of different experimental
groups (n = 6 to 12). Deposited collagen was indicated by black arrows. Scale bars, 50 μm. (D–E) Quantitative PCR analysis
of α-SMA (D), Col1a1 (E) (n = 6 to 8) in mice of different experimental groups. (F) Representative Western blot images and
quantitative analysis of COL1A1 in lung homogenates from mice of different experimental groups (n = 6). β-Actin was
used as a loading control. (G) Lung hydroxyproline content in mice of different experimental groups (n = 6 to 7). (H)
Representative Western blot images and quantitative analysis of STAT3 and SMAD2/3 phosphorylation and total expres-
sion of STAT3 and SMAD2/3 in lung homogenates from mice of different experimental groups. (C–H) p values were de-
termined by one-way ANOVA. Data were expressed as mean ± SEM. * p < 0.05; ** p < 0.01.
2.6. Effects of IL-9 Neutralizing Antibody on the Ratio of Th9 Cells, Th2 Cells, and Th1/Th2 in
Lung Lymphocytes of BLM Mice in Preventive Treatment
We performed flow cytometry analysis of lung lymphocytes from BLM mice (Figure
6A) and found that IL-9 neutralizing antibody reduced the ratio of Th9 cells in CD4+ T
cells in the lungs as compared to that of control group (p = 0.008) (Figure 6B,C). Does
neutralizing IL-9 affect Th1 and Th2 content and Th1/Th2 ratio? We then analyzed the
proportion of Th1, Th2, and Th1/Th2 in the lung CD4+ T cells of BLM mice, and found no
Figure 5.
Neutralizing IL-9 attenuates pulmonary fibrosis and collagen content in the bleomycin (BLM)-induced pulmonary
fibrosis mice (preventive intervention). (
A
) Schematic showing therapeutic intervention in the BLM model. Drugs
(PBS/Isotype/anti-IL-9, every 3 days) were injected intraperitoneally starting at day 1, and lungs were assessed on
day 21 after BLM administration. (
B
) Representative HE staining and quantitative analysis of lung sections from mice
of different experimental groups (n= 6 to 12). Inflammatory cell infiltration was indicated by black arrows. Scale bars,
50
µ
m. (
C
) Representative Masson’s trichrome staining and quantitative analysis of lung sections from mice of different
experimental groups (n= 6 to 12). Deposited collagen was indicated by black arrows. Scale bars, 50
µ
m. (
D
–
E
) Quantitative
PCR analysis of
α
-SMA (
D
), Col1a1 (
E
) (n= 6 to 8) in mice of different experimental groups. (
F
) Representative Western
blot images and quantitative analysis of COL1A1 in lung homogenates from mice of different experimental groups (
n= 6
).
β
-Actin was used as a loading control. (
G
) Lung hydroxyproline content in mice of different experimental groups (
n=6to7
).
(
H
) Representative Western blot images and quantitative analysis of STAT3 and SMAD2/3 phosphorylation and total
expression of STAT3 and SMAD2/3 in lung homogenates from mice of different experimental groups. (
C
–
H
)pvalues were
determined by one-way ANOVA. Data were expressed as mean ±SEM. * p< 0.05; ** p< 0.01.
2.6. Effects of IL-9 Neutralizing Antibody on the Ratio of Th9 Cells, Th2 Cells, and Th1/Th2 in
Lung Lymphocytes of BLM Mice in Preventive Treatment
We performed flow cytometry analysis of lung lymphocytes from BLM mice (
Figure 6A
)
and found that IL-9 neutralizing antibody reduced the ratio of Th9 cells in CD4
+
T cells in
the lungs as compared to that of control group (p= 0.008) (Figure 6B,C). Does neutralizing
IL-9 affect Th1 and Th2 content and Th1/Th2 ratio? We then analyzed the proportion of Th1,
Cells 2021,10, 3209 16 of 30
Th2, and Th1/Th2 in the lung CD4
+
T cells of BLM mice, and found no statistical difference
in the proportion of Th1 cells among the groups (Figure 6D,E). However, the proportion
of Th2 cells in lung CD4
+
T cells of the IL-9 neutralizing antibody group was markedly
lower than that of control group (p= 0.001) (Figure 6F,G). In addition, IL-9 neutralizing
antibody increased the Th1/Th2 ratio in the lungs as compared to control group (p= 0.0021)
(
Figure 6H
). The above results indicated that the imbalance of Th1/Th2 in the lungs of
BLM mice is due to an elevated Th2 response. IL-9 neutralizing antibody restores Th1/Th2
balance and reduces pulmonary fibrosis by inhibiting Th2 cell differentiation.
Cells 2021, 10, x 16 of 30
statistical difference in the proportion of Th1 cells among the groups (Figure 6D,E). How-
ever, the proportion of Th2 cells in lung CD4+ T cells of the IL-9 neutralizing antibody
group was markedly lower than that of control group (p = 0.001) (Figure 6F,G). In addition,
IL-9 neutralizing antibody increased the Th1/Th2 ratio in the lungs as compared to control
group (p = 0.0021) (Figure 6H). The above results indicated that the imbalance of Th1/Th2
in the lungs of BLM mice is due to an elevated Th2 response. IL-9 neutralizing antibody
restores Th1/Th2 balance and reduces pulmonary fibrosis by inhibiting Th2 cell differen-
tiation.
Figure 6. Cont.
Cells 2021,10, 3209 17 of 30
Cells 2021, 10, x 17 of 30
Figure 6. Effects of IL-9 neutralizing antibody on the ratio of Th9 cells, Th2 cells, and Th1/Th2 in lung lymphocytes of
BLM-induced pulmonary fibrosis mice (preventive intervention). (A) Flow cytometric analysis of INF-γ, IL-4, and IL-9 in
Figure 6.
Effects of IL-9 neutralizing antibody on the ratio of Th9 cells, Th2 cells, and Th1/Th2 in lung lymphocytes of
BLM-induced pulmonary fibrosis mice (preventive intervention). (
A
) Flow cytometric analysis of INF-
γ
, IL-4, and IL-9 in the
mice lung tissue. Gating strategy was used to identify Th1, Th2, and Th9 cells in the lungs of mice (CD4
+
IL-9
+
T cells were
Cells 2021,10, 3209 18 of 30
defined as Th9 cells, CD4
+
IFN-
γ+
T cells were defined as Th1 cells, CD4
+
IL-4
+
T cells were defined as Th2 cells). (
B
,
D
,
F
)
Representative pseudo-color plot showing proportion of Th9, Th1, and Th2 to CD4
+
T cells in the mice lung detected by flow
cytometry (
C
,
E
,
G
) Proportions of Th9, Th1, and Th2 cells to CD4
+
T cells in the lungs of mice from different experimental
groups. (
H
) Th1/Th2 ratio in the lungs of mice from different experimental groups. pvalues were determined by one-way
ANOVA (Tukey’s test). Data were expressed as mean ±SEM. * p<0.05, ** p<0.01, *** p<0.001.
Most clinical drugs that have only been tested in preventive intervention studies
proved to be ineffective. Therefore, therapeutic intervention, rather than preventive in-
tervention, is more in line with clinical practice. We started therapeutic intervention on
the day 7 after BLM instillation and administered drugs to mice every 3 days to examine
whether this intervention could reduce the degree of pulmonary fibrosis (Figure S1A).
Similar as what we observed in the preventive study therapeutic treatment of neutralizing
IL-9 reduces pulmonary fibrosis and collagen secretion of BLM mice. Phosphorylation of
STAT3 and SMAD2/3 is involved as well (Figure S1B–G). Furthermore, IL-9 neutralizing
antibody can also restore Th1/Th2 balance (Figure S2).
2.7. Proteomics Study Identify Additional Signal Pathways Involved in the Effect of IL-9
Neutralizing Antibody on Pulmonary Fibrosis
We also conducted a comparative proteomics study in an attempt to identify genes and
important signal pathways involved in this intervention. A heatmap represents abundance
profile of all differentially expressed proteins in the four groups (
Figure 7A
). To better
understand the function of these differentially expressed proteins, they were subjected
to a protein–protein interaction (PPI) network analysis using the STRING database. The
PPI network was analyzed for highly connected nodes by MCODE. Six highly connected
clusters have been identified including complement and coagulation cascades, protein
refolding, ribosome biogenesis in eukaryotes, DNA binding, cardiac muscle contraction,
and platelet activation (Figure 7B). We also performed GO-based enrichment and KEGG
pathway enrichment analysis of proteins (Figure 7C). Negative regulation of JAK-STAT
cascade, regulation of MAPK cascade, cytokine-mediated signaling pathway, PPAR signal-
ing pathway, etc. were enriched. To draw an unbiased picture of the proteomic changes
occurring in different groups, we next clustered the 438 differential proteins on the basis of
their expression in different interventions into nine distinct profiles (Figure 7D). Cluster 1
(e.g., C9, Fgf1, Yap1, Gp5) and 8 (e.g., C8g, Tgtp1, Tie1, Lamp3) represent those proteins
that decline post BLM instillation and increase in the intervention group, whereas cluster 2
(e.g., Vmac, Ppp1r14b, Irgq) and 9 (e.g., Tgfbi, Col15a1, Nfkbie, Timp1) consist of proteins
that rise post BLM instillation and decline in the intervention group. These four clusters
are of our interest as they include the proteins that have the opposite effect of BLM.
Cells 2021,10, 3209 19 of 30
Cells 2021, 10, x 19 of 30
Figure 7. Cont.
Cells 2021,10, 3209 20 of 30
Cells 2021, 10, x 20 of 30
Figure 7. Cont.
Cells 2021,10, 3209 21 of 30
Cells 2021, 10, x 21 of 30
Figure 7. Proteomics analysis of lung homogenates from mice of four groups (therapeutic intervention). (A) Heatmap
representation of abundance profile of all differentially expressed proteins in four groups. (B) Network diagram showing
interactions between proteins extracted from STRING database. MCODE method was used to calculate clusters. Six clus-
ters were identified. (C) GO-based enrichment and KEGG pathway enrichment analysis of proteins. (D) Clustering of
proteome expression profiles.
3. Discussion
IPF is a chronic, progressive, lethal disease characterized by pulmonary fibrosis that
is difficult to cure. Our study showed that Th9 cells have increased differentiation and
activation in the lung tissue of patients with IPF and BLM mice. We also found that Th9
cells promote pulmonary fibrosis via IL-9 and IL-4 mediated pathways. Furthermore, IL-
9 neutralizing antibody alleviates pulmonary fibrosis.
Disorders of immune regulation play an important role in the pathogenesis of IPF
[5]. Previous studies have found that Th9 cells abnormally elevated in bronchial asthma
and cystic fibrosis, promoting disease progression [38,39]. We speculated that Th9 cells
may also be abnormal and play a deleterious role in pulmonary fibrosis. Our study con-
firmed this conjecture. We found an increased differentiation and activation of Th9 cells
in the lung tissues of IPF patients and BLM mice.
Figure 7.
Proteomics analysis of lung homogenates from mice of four groups (therapeutic intervention). (
A
) Heatmap
representation of abundance profile of all differentially expressed proteins in four groups. (
B
) Network diagram showing
interactions between proteins extracted from STRING database. MCODE method was used to calculate clusters. Six clusters
were identified. (
C
) GO-based enrichment and KEGG pathway enrichment analysis of proteins. (
D
) Clustering of proteome
expression profiles.
3. Discussion
IPF is a chronic, progressive, lethal disease characterized by pulmonary fibrosis that
is difficult to cure. Our study showed that Th9 cells have increased differentiation and
activation in the lung tissue of patients with IPF and BLM mice. We also found that Th9
cells promote pulmonary fibrosis via IL-9 and IL-4 mediated pathways. Furthermore, IL-9
neutralizing antibody alleviates pulmonary fibrosis.
Disorders of immune regulation play an important role in the pathogenesis of IPF [
5
].
Previous studies have found that Th9 cells abnormally elevated in bronchial asthma and
cystic fibrosis, promoting disease progression [
38
,
39
]. We speculated that Th9 cells may
also be abnormal and play a deleterious role in pulmonary fibrosis. Our study confirmed
this conjecture. We found an increased differentiation and activation of Th9 cells in the
lung tissues of IPF patients and BLM mice.
The role of Th9 cells in pulmonary fibrosis is unknown. As we found an elevated
level of IL-9 (the main cytokine secreted by Th9 cells) in BALF from BLM mice, we therefore
Cells 2021,10, 3209 22 of 30
first investigated the
in vitro
effect of IL-9 on fibroblasts, the major effector cells of pulmonary
fibrosis. We used TGF-
β
(the main fibrogenic growth factor) to simulate the pulmonary fibrosis
microenvironment and found that IL-9 promoted the proliferation and activation of mouse
primary lung fibroblasts, either alone or in the presence of TGF-
β
. Previous studies have
shown that IL-9 affects a variety of cells, and its role in promoting or inhibiting pulmonary
fibrosis varies from cell to cell. On the one hand, IL-9 can recruit mast cells and promote their
secretion of TGF-
β
[
20
,
21
]. It can also inhibit the Th1-type immune response partially mediated
by antigen-presenting cells and downregulate the expression of anti-fibrotic molecules IL-12
and IFN-
γ
, having a pro-fibrotic effect [
22
]. On the other hand, IL-9 can induce monocyte-
macrophage differentiation, thereby inducing the synthesis of the anti-fibrotic molecule PGE2
and exerting an anti-fibrotic effect [
23
]. Previous studies have reported that IL-9 affects the
progress of pulmonary fibrosis. However, their findings are inconsistent [
24
–
28
,
40
,
41
]. In order
to clarify the role of IL-9 in pulmonary fibrosis, we administered IL-9 neutralizing antibody to
intervene BLM-induced pulmonary fibrosis in mice. Similar to a study by Sugimoto et al. [
24
],
we found that neutralizing IL-9 effectively reduced the degree of pulmonary fibrosis in BLM
mice. Both our and Sugimoto’s studies suggested that IL-9 promotes pulmonary fibrosis.
Contrary to this conclusion, Arras et al. found that IL-9 overexpression alleviated pulmonary
fibrosis by inhibiting Th2 response in bleomycin or silica-induced pulmonary fibrosis mice
models [
25
,
41
]. Why were their findings inconsistent with our and those of Sugimoto? We
noticed that they used Tg5 mice, a transgenic mice overexpressing IL-9. Immune regulation is
a complex system, and cytokines form an interconnected and interacting network [
42
]. The
extreme abundance of an individual factor will affect the formation and operation of the entire
network system, and such an immune environment will not occur in a real disease state. Hoyle
et al. also thought that the Th2 response inhibition of Tg5 mice with IL-9 overexpression
and a resulted Th1/Th2 imbalance actually would not occur in lung fibrosis models in the
natural state [
43
]. Therefore, this may be one of the reasons why Arras’ study was different
from our study as well as Sugimoto’s.
We analyzed the percentages of various lung lymphocyte subsets of BLM mice by flow
cytometry and found that the proportion of CD4
+
IL9
+
IL-4
+
T cell subset was increased in
the lung tissue of BLM mice, suggesting an increased IL-4 secretion by Th9 cells in the lungs
of BLM mice. However, whether Th9 cells secrete IL-4 is controversial. By inducing Th0
cells to differentiate into Th9 cells with IL-4 and TGF-
βin vitro
, Schmitt and Veldhoen did
not detect IL-4 content in the cell culture supernatant by ELISA [
44
,
45
]. In contrast, Saeki’s
study showed that Th9 cells have the ability to secrete IL-4 [
29
]. IL-4 can stimulate Th0 cells
to differentiate into Th2 cells [
46
]. We then hypothesized that Th9 cells may promote the
differentiation of Th0 cells to Th2 cells by secreting IL-4, thereby accelerating the Th1/Th2
imbalance and forming a positive feedback to promote fibrosis process. Therefore, we
co-cultured
in vitro
differentiated Th9 cells with Th0 cells and found that Th9 cells indeed
promoted the differentiation of Th0 cells to Th2 cells. In addition, IL-4 can also promote
fibroblast proliferation and activation [
10
,
47
]. We then examined the effects of Th9 cells
on fibroblasts
in vitro
and found that Th9 cells promoted collagen secretion. This may be
due to the combined effect of IL-4 and IL-9 secreted by Th9 cells (we have already shown
that IL-9 promotes fibroblast activation and collagen secretion). Collectively, these results
indicate that Th9 cells promote fibrosis in vitro.
Our results also showed that IL-9 neutralizing antibody can reduce the proportions
of Th2 cells and Th9 cells in the lungs of BLM mice. Arendse et al. found that neutralizing
IL-9 reduced Th2 response in mice [
48
]. Munitz et al. reported that IL-9 can recruit Th2 cells
through mast cells [
49
]. These studies indicated that neutralizing IL-9
in vivo
may reduce the
Th2 proportion. Moretti et al. found that IL-9 increased IL-2 production by mast cells, resulting
in an expansion of CD25
+
type 2 congenital lymphoid cells (ILC2) and subsequent activation
of Th9 cells, suggesting that neutralizing IL-9 may reduce Th9 cell activation by blocking this
pathway [
39
]. Cai et al. also showed that neutralizing IL-9 reduced the proportion of Th9 cells
in mice [
50
]. Consistent with these findings, we found that neutralizing IL-9 reduced the
proportions of Th2 cells and Th9 cells in the lungs of mice.
Cells 2021,10, 3209 23 of 30
Activation of STAT3 participates in fibrosis pathways, leading to lung fibrosis by
promoting epithelial damage and fibroblast activation [
51
,
52
]. Smad family contains a
series of structurally similar proteins, which are the main signal transducers of TGF-
β
superfamily receptors and essential for regulating cell development and growth [
53
].
SMAD2/3 participates in the pulmonary fibrosis pathway, and targeting TGF-
β
-mediated
SMAD2/3 signaling prevents fibrosis [
36
]. Our results suggest that neutralizing IL-9 may
alleviate pulmonary fibrosis by regulating the STAT3 and SMAD2/3 pathways.
Interventions in BLM model are usually divided into preventive and therapeutic [
37
].
We first tested preventive intervention from day 1 after the animal model was established.
Intratracheal administration of BLM in mice caused a strong inflammatory response in
the lungs. Prophylactic administration of IL-9 neutralizing antibody in mice exerted
an anti-fibrotic effect via reducing lung inflammation in the early stage (inflammatory
phase) and inhibiting extracellular matrix secretion by the (myo)fibroblasts in the late stage
(fibrotic phase). Our results showed that IL-9 neutralizing antibody could also play a role
in therapeutic intervention (Supplementary Figures).
For the first time, our study reported the deleterious role and underlying mechanism
of Th9 cells in patients with IPF and BLM mice, which is different from regarding Th9/IL-9
as a whole in previous studies. We clarified the pro-fibrotic effect of IL-9 and studied its
molecular mechanism. In addition, we discovered that Th9 cells also promote pulmonary
fibrosis via increasing IL-4-mediated Th2 cell differentiation. Moreover, neutralizing IL-9
effectively reduced the degree of pulmonary fibrosis. One of the limitations of this study,
same as many other studies, is that the histological changes, morbidity, or mortality of
BLM mice are not completely similar to IPF, although it is a classic model for studying
pulmonary fibrosis. Besides, there is currently no specific Th9 cell blocker that enables us
to examine the effect of blocking Th9 cells on lung fibrosis in vivo.
In summary, we first elucidated the role of Th9 cells in promoting pulmonary fibrosis
through the secretion of IL-9 and IL-4. Moreover, we showed that IL-9 neutralizing antibody
ameliorated the degree of pulmonary fibrosis. Our study illustrates the pathogenesis of
pulmonary fibrosis from an immunological perspective. In recent years, with the great
success of CTLA-4 and PD-1 inhibitors, immunotherapy has played an increasingly important
role [
54
,
55
]. At present, more and more immunologic clinical studies are ongoing [
56
–
58
]. In
addition, many basic studies have also found that immunotherapy can effectively reduce
pulmonary fibrosis and has potential for clinical applications [
59
,
60
]. Our findings suggest
that Th9-based immunotherapy may be employed as a treatment strategy for IPF.
4. Materials and Methods
4.1. Reagents and Antibodies
The reagents and antibodies used in this study were listed in Tables 3and 4, respectively.
Table 3. Reagent information.
Reagent Source Catalog#
LEAFTM Purified anti-mouse IL-9 antibody Biolegend 504802
Ultra-LEAFTM Purified Armenian Hamster IgG Isotype Control Biolegend 400940
Recombinant Mouse IL-9 R&D Systems 409-ML
Recombinant Mouse TGF-beta 1 R&D Systems 7666-MB
Recombinant Mouse IL-4 R&D Systems 404-ML
Mouse cross linked C-telopeptide of type I collagen (CTX-I) ELISA Kit
CUSABIO CSB-E12782m
TB Green®Premix Ex TaqTM II (Tli RNaseH Plus) Takara RR820A
PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) Takara RR047A
Bleomycin (BLM) Hanhui Pharmaceuticals
Cells 2021,10, 3209 24 of 30
Table 4. Antibody information.
Primary Antibody Application/Dilution Species Source (Catalog#)
PU.1 ICH (1:200) Human Abcam (ab76543)
IL-9 ICH (1:200) Human Abcam (181397)
α-SMA WB (1:1000), IF (1:200) Rabbit Abcam (ab5694)
COL1A1 WB (1:500) Rabbit Abclonal (A1352)
STAT3 WB (1:1000) Rabbit Cell Signaling Technology (4904)
p-STAT3 WB (1:1000) Rabbit Cell Signaling Technology (9145)
SMAD2/3 WB (1:1000) Rabbit Cell Signaling Technology (8685)
p-SMAD2/3 WB (1:1000) Rabbit Cell Signaling Technology (8828)
β-actin WB (1:5000) Mouse EASYBIO (BE0021-100)
4.2. Human Subjects
Lung tissue of IPF patients obtained from surgical lung biopsies, used for immuno-
histochemistry (n= 14), were from The First Affiliated Hospital of Guangzhou Medical
University (Guangzhou, China). The IPF patients were diagnosed according to the 2018
ATS/ERS/JRS/ALAT guideline diagnostic criteria [
1
]. There were 12 males and 2 females,
and the mean age was 58.86 ±8.75 years old. Control samples were paracancerous tissue
of patients with lung cancer (n= 4). This study was reviewed and approved by the Ethics
Committee of The First Affiliated Hospital of Guangzhou Medical University.
4.3. Bleomycin-Induced Pulmonary Fibrosis Mice Model and Intervention Study
All animal experiments were approved by the Institutional Animal Care and Use
Committee (IACUC) of Guangzhou Medical University. Male C57BL/6J mice (8–9 weeks
old) were purchased from Hua Fu Kang company (Beijing, China). Intratracheal adminis-
tration and BALF collection were performed as previously described [
60
]. In brief, single
intratracheal instillation of saline (50
µ
L) or BLM (2 mg/kg, dissolved in 50
µ
L saline)
was administrated to the mice. Mice were randomized into four experimental groups
(
saline + PBS
group, BLM + PBS group, BLM + Isotype group, BLM + anti-IL-9 group).
In the prevention intervention study, mice were administered drugs via intraperitoneal
injections on day 1, 4, 7, 10, 13, 16, 19. In the therapeutic intervention study, mice were
injected with drugs on day 7, 10, 13, 16, 19. In both cases, lungs were harvested on day 21
post bleomycin challenge. At the designate time point after BLM instillation, mice were
euthanized with pentobarbital. The BALF and lungs were harvested for further analysis.
4.4. CCK Assay
Cell Counting Kit-8 (CCK-8) assay (Yeasen) was used to determine the viability of
primary mouse lung fibroblasts. Cells were seeded overnight in a 96-well plate at a density
of 2
×
10
3
cells per well, and stimulated with IL-9 (10 ng/mL) or TGF-
β
(5 ng/mL) for
24 h and 48 h, respectively. 10 µL CCK-8 solution was mixed with 90 µL DMEM/F12 and
added to each well. After incubating for 3 h, the absorbance was measured at a wavelength
of 450 nm.
4.5. Histology and Fibrosis Assessment
Left lungs of the mice were fixed in 4% paraformaldehyde formalin for 24 h and
embedded in paraffin. Slices were stained with hematoxylin/eosin (H&E) and Masson
trichrome according to standard procedures. Ashcroft score and fibrosis score were used to
quantify the degree of lung fibrosis [
61
,
62
]. Readers blinded to the treatments randomly
and non-repetitively scored 100 fields under a
×
20 objective. Then the total score was
averaged. According to the score table, the Ashcroft score is between 0 and 8, while the
Masson fibrosis score is between 0 and 3.
Cells 2021,10, 3209 25 of 30
4.6. Hydroxyproline Assay
Hydroxyproline content in lung tissue was determined by hydroxyproline assay kit
(Nanjing Jiancheng Bioengineering Institute, Nanjing, China) as previously described (2).
In brief, lung tissue was dissolved in sodium hydroxide at 95
◦
C for 20 min. Hydrolysate
was oxidized by chloramine T. Then, Dimethyl-amino-benzaldehyde was added to the
suspension to form a compound and the OD value of the compound was detected at
550 nm. The hydroxyproline content in the lung tissue was calculated from the OD value
using a standard curve and expressed as microgram per gram (µg/g) of lung tissue.
4.7. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)
Total RNA was extracted from lung tissues or cells using TRIzol reagent (Invitrogen,
Carlsbad, CA, USA) according to the manufacturer’s protocol. Total RNA was reverse
transcribed with PrimeScript
TM
RT reagent Kit with gDNA Eraser (Perfect Real Time)
(Takara, Otsu, Japan) and qRT-PCR was performed in triplicate using TB Green
®
Premix
Ex Taq
TM
II (Tli RNaseH Plus) (Takara, Otsu, Japan) on the Biosystems
®
QuantStudio
TM
5 Flex Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). GAPDH was
used as an endogenous control. Relative RNA expression levels were calculated using the
2−∆∆Ct method. The primer sequences are listed in Table 5.
Table 5. Primer sequence.
Gene Mouse Primer Sequence(F/R)
Col1a1 CCCGTTGGCAAAGATGGTAG
ACCTTGGCTACCCTGAGAAC
α-SMA GCTGGTGATGATGCTCCCA
GCCCATTCCAACCATTACTCC
PU.1 GTTCTCGTCCAAGCACAAGG
TTCTTCACCTCGCCTGTCTT
Irf4 AGACCAGACTTGCAAGCTCT
CACCAAAGCACAGAGTCACC
Gapdh AACGACCCCTTCATTGACCT
CATTCTCGGCCTTGACTGTG
4.8. Flow Cytometry
4.8.1. Human
Human peripheral blood mononuclear cells (PBMC) were isolated from blood sam-
ples using Ficoll–Paque Plus (GE Healthcare, Pittsburgh, PA, USA). Isolated cells were
incubated with phorbol 12-myristate 13-acetate (PMA) (50 ng/mL; Abcam, Cambridge,
MA, USA), ionomycin (1
µ
g/mL; Abcam, Cambridge, MA, USA) and GolgiPlug (1
µ
g/mL,
BD Biosciences, San Diego, CA, USA) for 6 h at 37
◦
C under a 5% CO
2
atmosphere. Next,
cells were transferred to flow cytometry tubes (2
×
10
6
cells per tube) and blocked with
Human BD Fc Block
TM
(BD Biosciences, San Diego, CA, USA) for 10 min at room tem-
perature. PerCP-Cy5-conjugated anti-human CD3 (BioLegend, San Diego, CA, USA),
Brilliant Violet 510-conjugated anti-human CD8 (BioLegend, San Diego, CA, USA) and
Alexa 488-conjugated anti-human CD4 (BD Biosciences, San Diego, CA, USA) antibodies
were added to the cells, and incubated for 30 min in the dark at 4
◦
C. After fixation and
permeabilization (BD Biosciences, San Diego, CA, USA), cells were intracellularly stained
with Alexa Fluor
®
647 mouse anti-human IL-9 antibody (BD Biosciences, San Diego, CA,
USA) and incubated for 30 min in the dark at 4
◦
C. Th9 cells were defined as CD4
+
IL-9
+
T cells.
Cells 2021,10, 3209 26 of 30
4.8.2. Mouse
The lung tissue of the mice was digested with collagenase and gently dispersed
through a 70
µ
m cell strainer (BD Falcon) to prepare a single cell suspension, and the
lung lymphocytes were separated by mouse lymphocyte separation medium (DAKEWE,
Shenzhen, China). The isolated cells wash twice with Hanks’ Balanced Salt Solution and
diluted to a concentration of 2
×
10
6
cells/mL in RPMI 1640 culture medium supplemented
with 10% heat-inactivated FBS and penicillin/streptomycin (Gibco, Grand Island, NY,
USA). Cells were stimulated by PMA (50 ng/mL; Abcam, Cambridge, MA, USA) and
ionomycin (1
µ
g/mL; Abcam, Cambridge, MA, USA) for 1 h, and incubated with Brefeldin
A (1
µ
g/mL; Abcam, Cambridge, MA, USA) for 4 h to avoid cytokine secretion. Then,
anti-mouse CD16/32-V450 antibody (eBioscience, San Diego, CA, USA) was added into
the cells at room temperature for 10 min. Then, APC-Cy7-conjugated anti-mouse CD3,
PE-Cy5-conjugated anti-mouse CD4 and FITC-conjugated anti-mouse CD8 (BD Biosciences,
San Diego, CA, USA) antibodies were added into the cells, and incubated for 30 min in
the dark at 4
◦
C. After surface staining, the cells were intracellularly stained with anti-
mouse IL-9-PE, anti-mouse IL-4-PE and INF-
γ
-APC antibodies (BD Biosciences, San Diego,
CA, USA) after fixation and permeabilization. Th9, Th2, and Th1 cells were defined as
IL-9+CD4+, IL-4+CD4+, and IFN-γ+CD4+T cells respectively.
4.9. Isolation and Culture of Primary Fibroblasts
Primary fibroblasts were isolated from C57BL/6J mice as previously described [
63
]
and were cultured in DMEM/F12 supplemented with 10% FBS and 1% antibiotics in 5%
CO
2
at 37
◦
C in a humidified atmosphere. Cells of passages 4–6 were used for experiments.
4.10. Western Blot Analysis
The mouse lung tissues and cells were homogenized in RIPA lysis buffer containing
protease and phosphatase inhibitors (Sigma, P5726, P0044, St. Louis, MO, USA). The protein
concentration was determined using the BCA Protein Assay Kit (Thermo Fisher Scientific,
23227, Waltham, MA, USA) and mixed with 5X Protein Loading Buffer (Beyotime, P0015L,
Shanghai, China), followed by boiling at 95
◦
C for 10 min. Proteins samples were separated
by electrophoresis on a 10% sodium dodecyl sulfate-polyacrylamide gel and transferred to
polyvinylidene fluoride (PVDF) membranes. After blocking, membranes were incubated
with the primary antibodies (Table 4) overnight at 4
◦
C followed by HRP-conjugated
secondary antibodies (Gsebio, JC-PB001H, JC-PB002H, Xi’an, China). Immunoblots were
detected using ECL Western blotting substrate (Thermo Fisher Scientific, 34580, Waltham,
MA, USA) and visualized using Tanon-5200 System (Tanon, Shanghai, China). Protein
band intensity was quantified using ImageJ software (NIH, Bethesda, MA, USA).
4.11. Co-Culture
Mouse lungs were harvested 3 weeks after BLM or saline instillation and prepared
for lymphocyte single cell suspension as described above. After surface staining with
CD3 and CD4, Th0 cells (CD3
+
CD4
+
cells) were sorted by flow cytometry as described
above and then induced to Th9 cells (CD3
+
CD4
+
IL-9
+
cells) by stimulating with IL-4 and
TGF-
β
for six days. These cells were co-cultured with freshly isolated mouse Th0 cells or
lung fibroblasts at a 1:1 ratio (Figure 4A). Th2 cells (CD3
+
CD4
+
IL-4
+
cells) proportion and
collagen content were determined by flow cytometry and ELISA, respectively.
4.12. Immunofluorescence and Image Analysis
Lung fibroblasts were seeded on a slide in 24-well plate at a density of 5
×
10
4
cells per
well. Cells were fixed in cold 4% paraformaldehyde and permeabilized with 0.5% Triton
X-100 in PBS. After blocking with 0.5% BSA and 0.1% Tween-20 in PBS, cells were incubated
with primary antibody against α-SMA (ab5694, Abcam, Cambridge, MA, USA), followed
by FITC-conjugated secondary antibody (ab6717, Abcam, Cambridge, MA, USA). DAPI
was used as a nuclear counterstain. Images were acquired with an Operetta high-content
Cells 2021,10, 3209 27 of 30
imaging system IX83 (Olympus). Fluorescence intensity for
α
-SMA staining was analyzed
by Image J software (NIH, Bethesda, MA, USA).
4.13. Mass Spectrometry and Data Analysis
In brief, mouse lung tissues were ground, lysed, and digested, respectively. Equal
amounts of peptides from each sample were fractionated by offline basic pH reverse
phase liquid chromatography (LC). Fractionated peptides were analyzed by LC-MS/MS.
Using the MaxQuant software, spectra were searched against the Mus_musculus_10090
(17045 sequences) concatenated with reverse decoy database and filtered to achieve 1%
FDR at either unique protein level. To minimize redundancy, protein identifications from
shared peptide sequences were grouped into unique proteins according to the principal
of parsimony. LFQ intensities were extracted, filtered, normalized, and summarized into
peptide and protein quantification. One-way ANOVA was used to identify DE events.
To define Raptor-dependent events, z-score-based DE analysis was performed, in which
proteins with significant z scores (1.96 as cutoff) were overlapped in two experiments.
Principal-component analysis and hierarchical clustering were performed using R (v.3.0.1).
4.14. Statistical Analysis
Statistical analysis was performed by using two-sided unpaired Student’s t-test. Re-
sults are expressed as mean
±
standard error of the mean (SEM) or mean
±
standard
deviation (SD). One-way analysis of variance (ANOVA), followed by Bonferroni’s or
Tukey’s multiple comparisons test, was used when comparing more than two sets of data.
Correlation analysis was determined by Pearson’s correlation test. All data were analyzed
using SPSS 25.0 software (SPSS Inc., Chicago, IL, USA). For all comparisons, p< 0.05 was
considered statistically significant.
Supplementary Materials:
The following are available online at https://www.mdpi.com/article/
10.3390/cells10113209/s1, Figure S1: Neutralizing IL-9 attenuates pulmonary fibrosis and colla-
gen content in the bleomycin (BLM)-induced pulmonary fibrosis mice (therapeutic intervention).
(
A
) Schematic showing therapeutic intervention in the BLM model. Drugs (PBS/Isotype/anti-IL-9,
every 3 days) were injected intraperitoneally starting at day 7, and lungs were assessed on day 21
after BLM administration. (
B
) Representative HE staining and quantitative analysis of lung sections
from mice of different experimental groups (n= 6 to 8). Inflammatory cell infiltration was indicated
by black arrows. Scale bars, 50
µ
m. (
C
) Representative Masson’s trichrome staining and quantitative
analysis of lung sections from mice of different experimental groups (n= 6 to 8). Deposited collagen
was indicated by black arrows. Scale bars, 50
µ
m. (
D
)Col1a1 in mice of different experimental
groups (n= 6 to 8). (
E
) Representative western blot images and quantitative analysis of COL1A1
in lung homogenates from mice of different experimental groups (n= 6).
β
-Actin was used as a
loading control. (
F
) Lung hydroxyproline content in mice of different experimental groups (
n=6to7
).
(
G
) Representative images and quantitative analysis of western blots of STAT3 and SMAD2/3 phos-
phorylation and their total expression in lung homogenates from mice of different experimental
groups. (
B
–
G
)pvalues were determined by one-way ANOVA. Data were expressed as mean
±
SEM.
*, p< 0.05; **, p< 0.01, ***, p< 0.001. Figure S2: Effects of IL-9 neutralizing antibody on the ratio of Th9
cells, Th2 cells, and Th1/Th2 in lung lymphocytes of bleomycin (BLM)-induced pulmonary fibrosis
mice (therapeutic intervention). (
A
,
C
,
E
) Representative pseudo-color plot showing proportion of
Th9, Th1, Th2 to CD4
+
T cells in the mice lung detected by flow cytometry. (
B
,
D
,
F
) Proportions of Th9,
Th1, Th2 cells to CD4
+
T cells in the lungs of mice from different experimental groups. (
G
) Th1/Th2
ratio in the lungs of mice from different experimental groups. pvalues were determined by one-way
ANOVA (Tukey’s test). Data were expressed as mean ±SEM. *, p< 0.05, **, p< 0.01, ***, p< 0.001.
Author Contributions:
X.X.T. conceived, designed, and supervised the study. K.M.D., X.S.Y., Y.X.S.
and Q.Y.Y. conducted experiments. K.M.D., X.S.Y. and X.X.T. analyzed the data. K.M.D. and Q.L.
collected clinical samples. X.X.T. and K.M.D. interpreted the data and wrote the manuscript. All
authors have read and agreed to the published version of the manuscript.
Funding:
This work was supported by the National High-Level Talents Program (X.X.T.), the National
Natural Science Foundation of China (81770015, X.X.T.), Local Innovative and Research Teams Project
Cells 2021,10, 3209 28 of 30
of Guangdong Pearl River Talents Program (2017BT01S155), Open Project of State Key Laboratory
of Respiratory Disease (SKLRD-OP-202109), Special Fund for Science and Technology Innovation
of Guangdong Province (2020B1111330001), and Guangzhou Institute of Respiratory Health Open
Project (funds provided by China Evergrande Group)-Project No. 2020GIRHHMS16.
Institutional Review Board Statement:
This study was reviewed and approved by the Ethics Com-
mittee of The First Affiliated Hospital of Guangzhou Medical University (2020-71).
Informed Consent Statement:
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no competing interest.
References
1.
Raghu, G.; Remy-Jardin, M.; Myers, J.L.; Richeldi, L.; Ryerson, C.J.; Lederer, D.J.; Behr, J.; Cottin, V.; Danoff, S.K.; Morell, F.; et al.
Diagnosis of Idiopathic Pulmonary Fibrosis. An Official ATS/ERS/JRS/ALAT Clinical Practice Guideline. Am. J. Respir. Crit.
Care Med. 2018,198, e44–e68. [CrossRef] [PubMed]
2.
Wang, Z.N.; Tang, X.X. New Perspectives on the Aberrant Alveolar Repair of Idiopathic Pulmonary Fibrosis. Front. Cell Dev. Biol.
2020,8, 580026. [CrossRef] [PubMed]
3.
Ley, B.; Collard, H.R.; King, T.E. Clinical Course and Prediction of Survival in Idiopathic Pulmonary Fibrosis. Am. J. Respir. Crit.
Care Med. 2011,183, 431–440. [CrossRef]
4.
Mora, A.L.; Rojas, M.; Pardo, A.; Selman, M. Emerging therapies for idiopathic pulmonary fibrosis, a progressive age-related
disease. Nat. Rev. Drug Discov. 2017,16, 755–772. [CrossRef]
5.
Martinez, F.J.; Collard, H.R.; Pardo, A.; Raghu, G.; Richeldi, L.; Selman, M.; Swigris, J.J.; Taniguchi, H.; Wells, A.U. Idiopathic
pulmonary fibrosis. Nat. Rev. Dis. Primers 2017,3, 17074. [CrossRef] [PubMed]
6. Liu, H.; Jakubzick, C.; Osterburg, A.R.; Nelson, R.L.; Gupta, N.; McCormack, F.X.; Borchers, M.T. Dendritic Cell Trafficking and
Function in Rare Lung Diseases. Am. J. Respir. Cell Mol. Biol. 2017,57, 393–402. [CrossRef]
7.
Smolen, J.S.; Kay, J.; Doyle, M.K.; Landewé, R.; Matteson, E.L.; Wollenhaupt, J.; Gaylis, N.; Murphy, F.T.; Neal, J.S.; Zhou, Y.; et al.
Golimumab in patients with active rheumatoid arthritis after treatment with tumour necrosis factor
α
inhibitors (GO-AFTER
study): A multicentre, randomised, double-blind, placebo-controlled, phase III trial. Lancet 2009,374, 210–221. [CrossRef]
8.
Keane, M.P.; Belperio, J.A.; Burdick, M.D.; Strieter, R.M. IL-12 attenuates bleomycin-induced pulmonary fibrosis. Am. J. Physiol.
Lung Cell Mol. Physiol. 2001,281, L92–L97. [CrossRef] [PubMed]
9.
Saito, A.; Okazaki, H.; Sugawara, I.; Yamamoto, K.; Takizawa, H. Potential action of IL-4 and IL-13 as fibrogenic factors on lung
fibroblasts in vitro. Int. Arch. Allergy Immunol. 2003,132, 168–176. [CrossRef]
10.
Hashimoto, S.; Gon, Y.; Takeshita, I.; Maruoka, S.; Horie, T. IL-4 and IL-13 induce myofibroblastic phenotype of human lung
fibroblasts through c-Jun NH2-terminal kinase-dependent pathway. J. Allergy Clin. Immunol. 2001,107, 1001–1008. [CrossRef]
11.
Kraft, M.; Lewis, C.; Pham, D.; Chu, H.W. IL-4, IL-13, and dexamethasone augment fibroblast proliferation in asthma. J. Allergy
Clin. Immunol. 2001,107, 602–606. [CrossRef]
12.
Park, S.W.; Ahn, M.H.; Jang, H.K.; Jang, A.S.; Kim, D.J.; Koh, E.S.; Park, J.S.; Uh, S.T.; Kim, Y.H.; Park, J.S.; et al. Interleukin-13 and
its receptors in idiopathic interstitial pneumonia: Clinical implications for lung function. J. Korean Med. Sci.
2009
,24, 614–620.
[CrossRef]
13.
Alhamad, E.H.; Cal, J.G.; Shakoor, Z.; Almogren, A.; AlBoukai, A.A. Cytokine gene polymorphisms and serum cytokine levels in
patients with idiopathic pulmonary fibrosis. BMC Med. Genet. 2013,14, 66. [CrossRef] [PubMed]
14.
Papiris, S.A.; Tomos, I.P.; Karakatsani, A.; Spathis, A.; Korbila, I.; Analitis, A.; Kolilekas, L.; Kagouridis, K.; Loukides, S.;
Karakitsos, P.; et al. High levels of IL-6 and IL-8 characterize early-on idiopathic pulmonary fibrosis acute exacerbations. Cytokine
2018,102, 168–172. [CrossRef]
15.
Cai, F.; Hornauer, H.; Peng, K.; Schofield, C.A.; Scheerens, H.; Morimoto, A.M. Bioanalytical challenges and improved detection
of circulating levels of IL-13. Bioanalysis 2016,8, 323–332. [CrossRef] [PubMed]
16.
Heukels, P.; Moor, C.C.; von der Thüsen, J.H.; Wijsenbeek, M.S.; Kool, M. Inflammation and immunity in IPF pathogenesis and
treatment. Respir. Med. 2019,147, 79–91. [CrossRef] [PubMed]
17. Tatler, A.L.; Jenkins, G. TGF-beta activation and lung fibrosis. Proc. Am. Thorac. Soc. 2012,9, 130–136. [CrossRef] [PubMed]
18. Kaplan, M.H. Th9 cells: Differentiation and disease. Immunol. Rev. 2013,252, 104–115. [CrossRef]
19.
Deng, Y.; Wang, Z.; Chang, C.; Lu, L.; Lau, C.S.; Lu, Q. Th9 cells and IL-9 in autoimmune disorders: Pathogenesis and therapeutic
potentials. Hum. Immunol. 2017,78, 120–128. [CrossRef]
20.
Zhao, P.; Xiao, X.; Ghobrial, R.M.; Li, X.C. IL-9 and Th9 cells: Progress and challenges. Int. Immunol.
2013
,25, 547–551. [CrossRef]
21.
Overed-Sayer, C.; Rapley, L.; Mustelin, T.; Clarke, D.L. Are mast cells instrumental for fibrotic diseases? Front. Pharmacol.
2013
,
4, 174. [CrossRef] [PubMed]
22.
Noelle, R.J.; Nowak, E.C. Cellular sources and immune functions of interleukin-9. Nat. Rev. Immunol.
2010
,10, 683–687. [CrossRef]
23. Goswami, R.; Kaplan, M.H. A brief history of IL-9. J. Immunol. 2011,186, 3283–3288. [CrossRef] [PubMed]
Cells 2021,10, 3209 29 of 30
24.
Sugimoto, N.; Suzukawa, M.; Nagase, H.; Koizumi, Y.; Ro, S.; Kobayashi, K.; Yoshihara, H.; Kojima, Y.; Kamiyama-Hara, A.;
Hebisawa, A.; et al. IL-9 Blockade Suppresses Silica-induced Lung Inflammation and Fibrosis in Mice. Am. J. Respir. Cell Mol. Biol.
2019,60, 232–243. [CrossRef]
25.
Arras, M.; Huaux, F.; Vink, A.; Delos, M.; Coutelier, J.P.; Many, M.C.; Barbarin, V.; Renauld, J.C.; Lison, D. Interleukin-9 reduces
lung fibrosis and type 2 immune polarization induced by silica particles in a murine model. Am. J. Respir. Cell Mol. Biol.
2001
,24,
368–375. [CrossRef] [PubMed]
26.
Weng, D.; Chen, X.Q.; Qiu, H.; Zhang, Y.; Li, Q.H.; Zhao, M.M.; Wu, Q.; Chen, T.; Hu, Y.; Wang, L.S.; et al. The Role of Infection in
Acute Exacerbation of Idiopathic Pulmonary Fibrosis. Mediat. Inflamm. 2019,2019, 5160694. [CrossRef] [PubMed]
27.
Jiang, S.; Wang, Z.; Ouyang, H.; Liu, Z.; Li, L.; Shi, Y. Aberrant expression of cytokine interleukin 9 along with interleukin 4
and interferon gamma in connective tissue disease-associated interstitial lung disease: Association with severity of pulmonary
fibrosis. Arch. Med. Sci. 2016,12, 101–106. [CrossRef]
28.
Yanaba, K.; Yoshizaki, A.; Asano, Y.; Kadono, T.; Sato, S. Serum interleukin 9 levels are increased in patients with systemic
sclerosis: Association with lower frequency and severity of pulmonary fibrosis. J. Rheumatol. 2011,38, 2193–2197. [CrossRef]
29.
Saeki, M.; Kaminuma, O.; Nishimura, T.; Kitamura, N.; Mori, A.; Hiroi, T. Th9 cells elicit eosinophil-independent bronchial
hyperresponsiveness in mice. Allergol. Int. 2016,65, S24–S29. [CrossRef]
30.
Jakubzick, C.; Choi, E.S.; Joshi, B.H.; Keane, M.P.; Kunkel, S.L.; Puri, R.K.; Hogaboam, C.M. Therapeutic attenuation of pulmonary
fibrosis via targeting of IL-4- and IL-13-responsive cells. J. Immunol. 2003,171, 2684–2693. [CrossRef] [PubMed]
31. Zhou, L.; Chong, M.M.; Littman, D.R. Plasticity of CD4+T cell lineage differentiation. Immunity 2009,30, 646–655. [CrossRef]
32.
Tan, C.; Aziz, M.K.; Lovaas, J.D.; Vistica, B.P.; Shi, G.; Wawrousek, E.F.; Gery, I. Antigen-specific Th9 cells exhibit uniqueness in
their kinetics of cytokine production and short retention at the inflammatory site. J. Immunol.
2010
,185, 6795–6801. [CrossRef]
[PubMed]
33.
Hu, B.; Qiu-Lan, H.; Lei, R.E.; Shi, C.; Jiang, H.X.; Qin, S.Y. Interleukin-9 Promotes Pancreatic Cancer Cells Proliferation and
Migration via the miR-200a/Beta-Catenin Axis. Biomed. Res. Int. 2017,2017, 2831056. [CrossRef] [PubMed]
34.
Lei, R.-E.; Shi, C.; Zhang, P.-L.; Hu, B.-L.; Jiang, H.-X.; Qin, S.-Y. IL-9 promotes proliferation and metastasis of hepatocellular
cancer cells by activating JAK2/STAT3 pathway. Int J. Clin. Exp. Pathol. 2017,10, 7940–7946.
35.
Prele, C.M.; Yao, E.; O’Donoghue, R.J.; Mutsaers, S.E.; Knight, D.A. STAT3: A central mediator of pulmonary fibrosis? Proc. Am.
Thorac. Soc. 2012,9, 177–182. [CrossRef]
36.
Walton, K.L.; Johnson, K.E.; Harrison, C.A. Targeting TGF-beta Mediated SMAD Signaling for the Prevention of Fibrosis. Front.
Pharmacol. 2017,8, 461. [CrossRef] [PubMed]
37.
Moeller, A.; Ask, K.; Warburton, D.; Gauldie, J.; Kolb, M. The bleomycin animal model: A useful tool to investigate treatment
options for idiopathic pulmonary fibrosis? Int. J. Biochem. Cell Biol. 2008,40, 362–382. [CrossRef]
38.
Hoppenot, D.; Malakauskas, K.; Lavinskien
˙
e, S.; Bajori
¯
unien
˙
e, I.; Kalinauskait
˙
e, V.; Sakalauskas, R. Peripheral blood Th9 cells and
eosinophil apoptosis in asthma patients. Medicina 2015,51, 10–17. [CrossRef]
39.
Moretti, S.; Renga, G.; Oikonomou, V.; Galosi, C.; Pariano, M.; Iannitti, R.G.; Borghi, M.; Puccetti, M.; De Zuani, M.;
Pucillo, C.E.; et al
. A mast cell-ILC2-Th9 pathway promotes lung inflammation in cystic fibrosis. Nat. Commun.
2017
,8, 14017.
[CrossRef]
40.
Arras, M.; Louahed, J.; Simoen, V.; Barbarin, V.; Misson, P.; van den Brûle, S.; Delos, M.; Knoops, L.; Renauld, J.-C.; Lison, D.; et al.
B Lymphocytes Are Critical for Lung Fibrosis Control and Prostaglandin E2 Regulation in IL-9 Transgenic Mice. Am. J. Respir.
Cell Mol. Biol. 2006,34, 573–580. [CrossRef]
41.
Arras, M.; Louahed, J.; Heilier, J.F.; Delos, M.; Brombacher, F.; Renauld, J.C.; Lison, D.; Huaux, F. IL-9 protects against bleomycin-
induced lung injury: Involvement of prostaglandins. Am. J. Pathol. 2005,166, 107–115. [CrossRef]
42.
Frankenstein, Z.; Alon, U.; Cohen, I.R. The immune-body cytokine network defines a social architecture of cell interactions. Biol.
Direct. 2006,1, 32. [CrossRef] [PubMed]
43. Hoyle, G.W.; Brody, A.R. IL-9 and lung fibrosis: A Th2 good guy? Am. J. Respir. Cell Mol. Biol. 2001,24, 365–367. [CrossRef]
44. Schmitt, E.; Germann, T.; Goedert, S.; Hoehn, P.; Huels, C.; Koelsch, S.; Kühn, R.; Müller, W.; Palm, N.; Rüde, E. IL-9 production
of naive CD4
+
T cells depends on IL-2, is synergistically enhanced by a combination of TGF-beta and IL-4, and is inhibited by
IFN-gamma. J. Immunol. 1994,153, 3989–3996. [PubMed]
45.
Veldhoen, M.; Uyttenhove, C.; van Snick, J.; Helmby, H.; Westendorf, A.; Buer, J.; Martin, B.; Wilhelm, C.; Stockinger, B.
Transforming growth factor-beta ’reprograms’ the differentiation of T helper 2 cells and promotes an interleukin 9-producing
subset. Nat. Immunol. 2008,9, 1341–1346. [CrossRef] [PubMed]
46.
Mosmann, T.R.; Cherwinski, H.; Bond, M.W.; Giedlin, M.A.; Coffman, R.L. Two types of murine helper T cell clone. I. Definition
according to profiles of lymphokine activities and secreted proteins. J. Immunol. 1986,136, 2348–2357. [PubMed]
47.
Machino, T.; Hashimoto, S.; Gon, Y.; Kujime, K.; Maruoka, S.; Horie, T. Interleukin-4 and interleukin-13 induce fibronectin
production by human lung fibroblasts. Allergol. Int. 2001,50, 197–202. [CrossRef]
48.
Arendse, B.; Van Snick, J.; Brombacher, F. IL-9 is a susceptibility factor in Leishmania major infection by promoting detrimental
Th2/type 2 responses. J. Immunol. 2005,174, 2205–2211. [CrossRef] [PubMed]
49. Munitz, A.; Foster, P.S. T(H)9 cells: In front and beyond T(H). J. Allergy Clin. Immunol. 2012,129, 1011–1013. [CrossRef]
50.
Cai, L.; Zhang, Y.; Zhang, Y.; Chen, H.; Hu, J. Effect of Th9/IL-9 on the growth of gastric cancer in nude mice. Onco Targets Ther.
2019,12, 2225–2234. [CrossRef]
Cells 2021,10, 3209 30 of 30
51.
Chakraborty, D.; Šumová, B.; Mallano, T.; Chen, C.W.; Distler, A.; Bergmann, C.; Ludolph, I.; Horch, R.E.; Gelse, K.;
Ramming, A.; et al.
Activation of STAT3 integrates common profibrotic pathways to promote fibroblast activation and tissue
fibrosis. Nat. Commun. 2017,8, 1130. [CrossRef]
52.
Pedroza, M.; Le, T.T.; Lewis, K.; Karmouty-Quintana, H.; To, S.; George, A.T.; Blackburn, M.R.; Tweardy, D.J.; Agarwal, S.K.
STAT-3 contributes to pulmonary fibrosis through epithelial injury and fibroblast-myofibroblast differentiation. FASEB J.
2016
,30,
129–140. [CrossRef] [PubMed]
53. Derynck, R.; Zhang, Y.; Feng, X.H. Smads: Transcriptional activators of TGF-beta responses. Cell 1998,95, 737–740. [CrossRef]
54.
Motzer, R.J.; Tannir, N.M.; McDermott, D.F.; Arén Frontera, O.; Melichar, B.; Choueiri, T.K.; Plimack, E.R.; Barthélémy, P.;
Porta, C.
;
George, S.; et al. Nivolumab plus Ipilimumab versus Sunitinib in Advanced Renal-Cell Carcinoma. N. Engl. J. Med.
2018
,378,
1277–1290. [CrossRef]
55.
Esfahani, K.; Buhlaiga, N.; Thébault, P.; Lapointe, R.; Johnson, N.A.; Miller, W.H., Jr. Alemtuzumab for Immune-Related
Myocarditis Due to PD-1 Therapy. N. Engl. J. Med. 2019,380, 2375–2376. [CrossRef] [PubMed]
56.
University of Alabama at Birmingham; National Institutes of Health (NIH). Autoantibody Reduction Therapy in Patients with
Idiopathic Pulmonary Fibrosis (ART-IPF); National Library of Medicine (US): Bethesda, MD, USA, 2018. Available online: https:
//clinicaltrials.gov/ct2/show/NCT01969409 (accessed on 5 November 2021).
57.
Khalil, N.; Manganas, H.; Ryerson, C.J.; Shapera, S.; Cantin, A.M.; Hernandez, P.; Turcotte, E.E.; Parker, J.M.; Moran, J.E.; Albert,
G.R.; et al. Phase 2 clinical trial of PBI-4050 in patients with idiopathic pulmonary fibrosis. Eur. Respir. J.
2018
,53, 1800663.
[CrossRef] [PubMed]
58.
MediciNova. A Randomized, Placebo-Controlled, Double-Blind Six Month Study Followed by an Open-Label Extension Phase to
Evaluate the Efficacy, Safety and Tolerability of MN-001 in Subjects with Idiopathic Pulmonary Fibrosis (IPF); National Library of
Medicine (US): Bethesda, MD, USA, 2020. Available online: https://www.clinicaltrials.gov/ct2/show/NCT02503657 (accessed
on 5 November 2021).
59.
Ng, B.; Dong, J.; D’Agostino, G.; Viswanathan, S.; Widjaja, A.A.; Lim, W.-W.; Ko, N.S.J.; Tan, J.; Chothani, S.P.; Huang, B.; et al.
Interleukin-11 is a therapeutic target in idiopathic pulmonary fibrosis. Sci. Transl. Med.
2019
,11, eaaw1237. [CrossRef] [PubMed]
60.
Oh, K.; Park, H.-B.; Byoun, O.-J.; Shin, D.-M.; Jeong, E.M.; Kim, Y.W.; Kim, Y.S.; Melino, G.; Kim, I.-G.; Lee, D.-S. Epithelial
transglutaminase 2 is needed for T cell interleukin-17 production and subsequent pulmonary inflammation and fibrosis in
bleomycin-treated mice. J. Exp. Med. 2011,208, 1707–1719. [CrossRef] [PubMed]
61.
Hubner, R.H.; Gitter, W.; El Mokhtari, N.E.; Mathiak, M.; Both, M.; Bolte, H.; Freitag-Wolf,S.; Bewig, B. Standardized quantification
of pulmonary fibrosis in histological samples. Biotechniques 2008,44, 507–511,514–517. [CrossRef] [PubMed]
62.
Szapiel, S.V.; Elson, N.A.; Fulmer, J.D.; Hunninghake, G.W.; Crystal, R.G. Bleomycin-induced interstitial pulmonary disease in the
nude, athymic mouse. Am. Rev. Respir. Dis. 1979,120, 893–899. [PubMed]
63.
Seluanov, A.; Vaidya, A.; Gorbunova, V. Establishing Primary Adult Fibroblast Cultures From Rodents. J. Vis. Exp.
2010
,44, 2033.
[CrossRef] [PubMed]
