Eurotium Cristatum Postfermentation of Fireweed and Apple Tree Leaf Herbal Teas

Abstract

Fungi Eurotium spp. are the main biological agents that ferment the leaves of the Camellia sinensis tea bush to form a popular food product, postfermented tea. The fungus E. cristatum, stored in the collection of the Gause Institute of New Antibiotics under the number INA 01267, was isolated and identified from a briquette of Fujian Chinese tea. The species identification was carried out based on morphocultural characteristics and DNA sequencing. This study is aimed at determining the feasibility of making postfermented herbal teas using E. cristatum and to evaluate their quality. Autofermented herbal teas from Chamaenerion angustifolium (fireweed) and Malus domestica (apple tree) served as the starting material for this study. The change in the concentration of phenolic compounds, organic acids, sugars, and free amino acids was observed for herbal teas subjected to postfermentation with E. cristatum INA 01267. It was found that the E. cristatum INA 01267 strain does not have antimicrobial activity and does not form mycotoxins, which is an indicator of food safety.

Full text

Research Article
Eurotium Cristatum Postfermentation of Fireweed and Apple
Tree Leaf Herbal Teas
Tatiana A. Efimenko ,
1
Elena F. Shanenko,
2
Tatiana G. Mukhamedzhanova,
2
Olga V. Efremenkova ,
1
Yuriy A. Nikolayev ,
3
Elena N. Bilanenko,
4
Marina V. Gernet,
5
Artem G. Grishin,
2
Ivan N. Serykh ,
2,6
Sergey V. Shevelev,
7
Byazilya F. Vasilyeva ,
1
Svetlana N. Filippova ,
3
and Galina I. El-Registan
3
1
Gause Institute of New Antibiotics, Moscow 119021, Russia
2
Moscow State University of Food Production, Moscow 125080, Russia
3
Research Center of Biotechnology RAS, Winogradsky Institute of Microbiology, Moscow 117312, Russia
4
Lomonosov Moscow State University, Faculty of Biology, Moscow 119991, Russia
5
V.M. Gorbatov Federal Research Center of Food Systems RAS, All-Russian Research Institute of Brewing, Nonalcoholic and
Wine Industry, Moscow 109316, Russia
6
LLC “Sistema”, Moscow 115230, Russia
7
Company “MOYCHAY.RU”, Moscow 101000, Russia
Correspondence should be addressed to Tatiana A. Efimenko; efimen@inbox.ru
Received 9 December 2020; Revised 11 August 2021; Accepted 28 August 2021; Published 23 September 2021
Academic Editor: Dimitrios Tsaltas
Copyright © 2021 Tatiana A. Efimenko et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is
properly cited.
Fungi Eurotium spp. are the main biological agents that ferment the leaves of the Camellia sinensis tea bush to form a popular food
product, postfermented tea. The fungus E. cristatum, stored in the collection of the Gause Institute of New Antibiotics under the
number INA 01267, was isolated and identified from a briquette of Fujian Chinese tea. The species identification was
carried out based on morphocultural characteristics and DNA sequencing. This study is aimed at determining the
feasibility of making postfermented herbal teas using E. cristatum and to evaluate their quality. Autofermented herbal teas
from Chamaenerion angustifolium (fireweed) and Malus domestica (apple tree) served as the starting material for this
study. The change in the concentration of phenolic compounds, organic acids, sugars, and free amino acids was observed
for herbal teas subjected to postfermentation with E. cristatum INA 01267. It was found that the E. cristatum INA 01267
strain does not have antimicrobial activity and does not form mycotoxins, which is an indicator of food safety.
1. Introduction
It is generally accepted that tea is one of the most popular
drinks in the world today, and China is recognized as a
major tea producer and exporter. In the classic version, tea
is obtained from the processed leaves of the tea bush Camel-
lia sinensis or C. assamica. The properties of tea largely
depend on the processes of enzymatic oxidation of the leaves
of the tea bush. All teas are divided into fermented (or auto-
fermented) and postfermented teas. Autofermented teas are
produced by biochemical processes in plant cells. Depending
on the degree of oxidation, autofermented teas are divided
into green teas, which are fermented for a short time, and
black teas, which are fermented for several weeks. Postfer-
mented teas, extra to autofermentation, are additionally fer-
mented by microorganisms; therefore, they are the most
enriched with biologically active substances, since they con-
tain not only the products of tea components autofermenta-
tion, but also the products of their transformation by
microorganisms, as well as microbial metabolites [1–3].
Hindawi
International Journal of Food Science
Volume 2021, Article ID 6691428, 14 pages
https://doi.org/10.1155/2021/6691428

During postfermentation in wet conditions, such popular
teas and tea drinks as Kombucha drink of Chinese origin
and traditional Japanese Ishizuchi-kurocha tea are obtained.
In the presence of water, during natural postfermentation,
the bacteria of the family Acetobacteriaceae (mainly of the
genus Komagataeibacter spp. for Kombucha) and Lactoba-
cillaceae (namely, Lactiplantibacillus plantarum and L. pen-
tosus for Ishizuchi-kurocha) predominate. In addition, but
in significantly smaller quantities, there are bacteria of the
families Paenibacillaceae,Staphylococcaceae,Streptococca-
ceae,Lachnospiraceae,Bacteroidaceae, and Bifidobacteria-
ceae. About 30 species of fungi have been described, but
yeasts of the Saccharomycetaceae (with a predominance
Zygosaccharomyces spp. or Candida spp.), Schizosaccharo-
mycetaceae (Schizosaccharomyces spp.), and Pichiaceae
(Brettanomyces spp.) families prevail [4–9].
During postfermentation of dry plant mass, xerophytic
fungi predominate, mainly ascomycetes of the genera Aspergil-
lus,Penicillium,Saccharomyces,andEurotium (Aspergillus ana-
morph). One of the most popular postfermented teas in China
is black brick tea named “Fujian”tea or “Fu Tea”(Fujian Prov-
ince Guang Fu Tea Co., Ltd., China). The study of the microbial
community of Fujian postfermented tea revealed mainly fungi
of the genera Eurotium (more than 15 species, primarily E. cris-
tatum) [2, 10]. The presence of golden-brown spots of this fun-
gus on tea briquettes, called “golden flowers,”is an indicator of
the high tea quality [10–12].
During postfermentation, the biochemical composition
of tea changes. Currently, about 2000 biologically active
compounds found in teas have been shown. Among them,
there are catechins, organic acids, flavonols, theaflavins, tea-
gallins, alkaloids, sugars, amino acids, vitamins, etc. [3].
Such a large number of active compounds explain the rich
variety of teas, differences in their organoleptic properties,
and effect on the organism. Postfermented teas are not only
popular drinks, but also have medicinal properties: they nor-
malize lipid metabolism, and they have antimicrobial, anti-
diabetic, antioxidant, and antimutagenic effects [10,
13–15]. In addition to useful substances, fungi form undesir-
able or even harmful substances from the point of food
microbiology view. Special attention is paid to fungi, which
are associated not only with the fact that they affect the com-
position and give products useful properties, but also with
the ability of many of them to produce antibiotics or toxins
that cause serious food poisoning. However, on plant food
with low water activity (aw=0:6–0:0), nontoxigenic strains
of fungi, including those from the genus Eurotium, develop
effectively. The best studied are the isolates of E. cristatum
that develop on dry leaves of C. sinensis. These xerophytic
fungi are an important factor in the formation of tea proper-
ties and are actively used in industrial technologies in China
for the production of postfermented teas [2, 10, 16].
In addition to teas made from the leaves of C. sinensis,
there are other drinks produced from leaves and herbs of var-
ious plants.These drinks are called herbal teas. The most stud-
ied of this group are teas made from mate (Ilex
paraguariensis), hibiscus (Hibiscus sabdariffa), mint (Mentha
piperita), and chamomile (Matricaria recutita). These drinks
are used for medicinal purposes as well as to quench thirst
and pleasure. Most of these plants are characterized by a fairly
high content of phenolic compounds, antioxidants, and other
compounds that affect the psychoemotional state [17].
In Russia, along with the culture of consumption of
traditional tea from C. sinensis leaves, herbal teas have
been popular since ancient times [18, 19]. The most pop-
ular is the one made from Chamaenerion angustifolium
(Figure 1). It is a perennial herb with narrow leaves that
resemble willow leaves. It is widespread in the northern
hemisphere, often found in forest clearings and burned-
out areas. Hence, the names of this plant are fireweed,
firetop, great willowherb, and rosebay willowherb. Ch.
angustifolium in Russia has many names depending on
the region, but the most common is Ivan-tea. In addition
to fireweed tea, drinks with good organoleptic characteris-
tics and high antioxidant activity are obtained from other
plants, in particular, from the leaves of fruit and berry
crops [19]. Technologies for microbial postfermentation
of herbal teas have not been developed in Russia, and they
are not industrially produced.
This study is generally aimed at examining the possi-
bility of using E. cristatum for postfermentation of two
herbal teas. The experimental data in this publication rep-
resent the first step towards the development of technol-
ogy to produce postfermented herbal teas in Russia. The
specific objectives of this study were as follows: to isolate
a strain of E. cristatum from a Fujian postfermented tea
briquette and describe it; to analyze its growth on fermen-
ted herbal teas from Chamaenerion angustifolium (fire-
weed) and Malus domestica (apple tree); to determine
the composition of phenolic compounds, sugars, organic
acids, and free amino acids in fermented and postfermen-
ted teas; to compare the compositions of two herbal teas
with each other and with the literature data; to determine
the potential antimicrobial activity on the panel of test
strains; and to establish the absence/presence of fungal
mycotoxins.
Figure 1: Chamaenerion angustifolium (fireweed).
2 International Journal of Food Science

2. Materials and Methods
2.1. Sample Collection. The fungus was isolated from postfer-
mented black brick tea named either “Fujian”tea or “Fu
Tea”(Fujian Province Guang Fu Tea Co., Ltd., Hunan Prov-
ince, China). Upon visual inspection of the Fujian postfer-
mented tea briquettes, yellow patches of fungus growth
were clearly visible. From these places, the material was
taken to prepare the suspension. When sowing a suspension
of briquetted tea on agar media, the growth of fungal
colonies of the same morphological type was observed. The
microbiological purity of the isolates was confirmed by at
least five consecutive passages on various agar media.
2.2. Cultural Media and Cultural Conditions for the Fungus
E. Cristatum INA 01267. The isolated fungus was incubated
on autofermented herbal teas from the plants Ch. angustifo-
lium (fireweed) and M. domestica (apple tree leaves) (MOY-
CHAY.RU, Moscow, Russia).
Four agar media were used (%): (1) Czapek medium:
sucrose—3, NaNO
3
—0.3, KH
2
PO
4
—0.1, MgSO
4
•
7H
2
О—0.05, KCl—0.05, FeSO
4
•7H
2
O—0.001, and
agar—1.5; tap water; (2) Sabouraud agar medium: glu-
cose—4, peptone—0.7, soy bean flour—0.3, yeast
extract—0.4, and agar—1.5, tap water; (3) modified agar
medium #2 Gause: glucose—1, peptone—0.5, tryptone—0.3,
NaCl—0.5, and agar—2, tap water, pH 7.2–7.4; and (4) min-
eral agar medium #1 Gause: soluble starch—2,
K
2
HPO
4
—0.05, MgSO
4
•7H
2
О—0.05, KNO
3
—0.1,
NaCl—0.05, FeSO
4
•7H
2
O—0.001, and agar—2, distillate
water, pH 7.2–7.4.
The fungus was incubated at 28
°
C.
Medium 1 was used for storage and maintenance of fun-
gus; the duration of cultivation was 7 days. Media 1-4 were
used for morphological study; the duration of cultivation
was 2-21 days.
Media 1-3 without agar were used for submerged culti-
vation. Submerged cultivation was carried out in 750 mL
Erlenmeyer flasks with 150 mL of medium on a rotary
shaker (200 rpm).
2.3. Fungus Identification. The species of the isolated strain
was determined based on morphological and cultural char-
acteristics, as well as analysis of gene sequences.
Morphological and cultural features of the fungus were
considered with growth on different media over 2-21 days.
The preparations were examined with 150x, 600x, and
1500x magnifications using a Mikmed-6 light microscope
(LOMO-Microanalysis, Russia). The nucleotide sequences
of ribosomal RNA genes and some other regions were also
identified (Table 1).
Extraction of total DNA from fungal biomass was per-
formed using DNeasy PowerSoil Kit (Qiagen Inc., USA).
Polymerase chain reaction (PCR) was carried out using a
set of PCR Master Mix reagents (Thermo Scientific, USA).
The final volume of th e 50 μL PCR mix included 25 μL2X
PCR Master Mix, 0.5 μmol of each of the primers, 1-100 ng
of isolated DNA and nuclease-free water. Fungal primer sets
and thermocycling programs are described in Table 1. PCR
was performed on a Thermal Cycler 2720 device (Applied
Biosystems, USA).
The amplification products were purified by DNA repreci-
pitation under mild conditions using 0.125 M ammonium ace-
tate in 70% aqueous ethanol and visualized on a 1% agarose gel
(using TBE Tris-borate buffer) at an electric field strength of
7.6 V/cm. The same PCR primers for sequencing regions
ITS-D1/D2, LSU, and RPB2 and only forward primers (EF-
595F, βt2a, and gpd1) for regions TEF1-α,β-tub, and GAPDH
were used. The nucleotide sequences were determined by the
Sanger method on automatic sequencer Genetic Analyzer
3500 (Applied Biosystems, USA). The DNAStar Lasergene
SeqMan v.7.1.0 (DNASTAR Inc., Madison, WI, USA) and
Mega 7 [20] were used to view, edit, and align the obtained
raw sequence data. Reference nucleotide sequences were
obtained from GenBank databases [21] and CBS [22].
2.4. Determination of Biochemical Parameters of Herbal Teas
as a Result of Postfermentation with E. Cristatum INA 01267.
Into a 500 mL Erlenmeyer flask, 20 g of autofermented herbal
teas was added, sterilized by autoclaving (1 atm, 40 min) and
inoculated with an aqueous suspension, containing ascospores
and mycelium fragments to a concentration of 10
3
CFU/g of
tea. The humidity of the environment was 20%. Postfermenta-
tion of herbal teas with the fungus E. cristatum INA 01267 was
carried out stationary for 14 days at 28
°
C. The obtained samples
of postfermented biomass were dried at 50
°
Ctoamoisturecon-
tent of 5%. Aqueous extracts were prepared from the obtained
dried biomass, for which 1 g of biomass was added to 20 mL
of water and extracted with stirring for 20 min at 80
°
C, followed
by centrifugation at 3000 ×g for 15 min. The following com-
pounds were determined in aqueous extracts by HPLC: pheno-
lic compounds and organic acids were determined on an
Agilent 1200 chromatograph (Agilent Technologies, USA) with
a diode array detector (DAD), a Hypersit ODS C18 250 × 4:6
mm 5 μm chromatographic column (Thermo Fisher Scientific,
USA); the solvent system was a phosphate buffer with pH 2.5
with acetonitrile in the ratio 13 : 87 [23, 24]; sugars were deter-
mined on an Agilent 1200 chromatograph (Agilent Technolo-
gies, USA) with a refractive index detector (RID),
chromatographic column Luna NH2 100A 250 × 4:6mm5μ
m(Phenomenex, USA), the solvent system was a mixture of
acetonitrile with water in a ratio of 75 : 25, and temperature of
themobilephasewas40
°
C [23, 24]; free amino acids were deter-
mined on an Agilent 1200 chromatograph (Agilent Technolo-
gies, USA) with a diode array detector (DAD), a
chromatographic column Luna C18 (2) 150 × 4:4mm 5 μm
(Phenomenex, USA) with a guard column; the solvent system
was 0.1 M sodium acetate pH 6.4-acetonitrile in a ratio of 9 : 1
[23, 25].
After analyzing the extracts, the content of compounds
was recalculated and expressed in micrograms per gram of
tea dry weight of (μg/g d.w.).
2.5. Elucidation of the Possibility of Mycotoxin Formation by
E. Cristatum INA 01267. The E. cristatum INA 01267 strain
was grown under submerged cultivation on medium 1 for 7
days. The grown culture was centrifuged at 5000 ×g for
20 min.
3International Journal of Food Science

Table 1: Studied DNA regions of the fungus and primers and PCR annealing temperature.
DNA regions/genes Symbols Thermocycling programs Primers (5′→3′)
Symbols Sequences
Entire ITS rDNA and fragment of 28S rDNA ITS-D1/D2
(1) 94
°
C–5 min
(2) 33 cycles with temperature interval
94
°
C–1 min, 51
°
C–1 min, 72
°
C–1 min
(3) 72
°
C–7 min
ITS1f TCCGTAGGTGAACTTGCG
NL4 GGTCCGTGTTTCAAGG
Large subunit 28S of ribosomal DNA LSU
(1) 94
°
C–5 min
(2) 33 cycles with temperature interval
94
°
C–1 min, 49
°
C–1 min, 72
°
C–2 min
(3) 72
°
C–7 min
LR0R ACCCGCTGAACTTAAGC
LR5 TCCTGAGGGAAACTTCG
RNA polymerase II gene RPB2
(1) 94
°
C–5 min
(2) 9 cycles 94
°
C–1 min, at 60
°
Cto50
°
C–1 min
(with 1 degree decrement each cycle), 72
°
C–1.5 min
(3) 32 cycles 94
°
C–1 min, 50
°
C–1.5 min, 72
°
C–1.5 min
(4) 72
°
C–7 min
fRPB2-5F GAYGAYMGWGATCAYTTYGG
fRPB2-7cR CCAT(AG)GCTTG(CT)TT(AG)CCCAT
Translation elongation factor 1-αgene TEF1-α
(1) 94
°
C–5 min
(2) 9 cycles 94
°
C–1 min, at 66
°
Cto56
°
C–1 min
(with 1 degree decrement each cycle), 72
°
C–1.5 min
(3) 32 cycles 94
°
C–1 min, 56
°
C–1.5 min, 72
°
C–1.5 min
(4) 72
°
C–7 min
EF-595F CGTGACTTCATCAAGAACATG
EF-1567R ACHGTRCCRATACCACCRATCTT
β-tubulin gene β-tub
(1) 94
°
C–5 min
(2) 9 cycles 94
°
C–1 min, at 64
°
Cto54
°
C–1 min
(with 1 degree decrement each cycle), 72
°
C–1.5 min
(3) 32 cycles 94
°
C–1 min, 54
°
C–1.5 min, 72
°
C–1.5 min
(4) 72
°
C–7 min
βt2a GGTAACCAAATCGGTGCTGCTTTC
βt2b ACCCTCAGTGTAGTGACCCTTGGC
Glycerol 3-phosphate dehydrogenase gene GAPDH
(1) 94
°
C–5 min
(2) 9 cycles 94
°
C–1 min, at 65
°
Cto55
°
C–1 min
(with 1 degree decrement each cycle), 72
°
C–1.5 min
(3) 32 cycles 94
°
C–1 min, 55
°
C–1.5 min, 72
°
C–1.5 min
(4) 72
°
C–7 min
gpd1 CAACGGCTTCGGTCGCA TTG
gpd2 GCCAAGCAGTTGGTTGTGC
4 International Journal of Food Science

The presence of mycotoxins in the culture broth super-
natant was determined by HPLC on a TermoFinnigan chro-
matograph with a diode array detector, chromatographic
column Hypersil™BDS C18 200 × 4:6mm 5 μm (Thermo
Fisher Scientific, USA); the solvent systems were as follows:
for aflatoxin B1, toluene-ethyl acetate-formic acid in a vol-
ume ratio 80 : 40 : 95; for patulin and zearalenone, buffer
solution of potassium dihydrogen phosphate pH 3.0-aceto-
nitrile in a volume ratio of 95 : 5; and for deoxynivalenol,
methanol-water in a volume ratio of 95 : 5 [23, 26].
HPLC detection limits for mycotoxins were 0.003 mg/kg
for aflatoxin, 0.2 mg/kg for deoxynivalenol, 0.2 mg/kg for
zearalenone, and 0.01 mg/kg for patulin.
2.6. E. Cristatum INA 01267: Determination of the Possibility
to Produce Antimicrobial Substances. To determine the anti-
microbial activity, the E. cristatumINA 01267 was cultured
under submersion conditions in the described above media
1-3. The samples of the culture liquid were taken on the 2,
4, 7, 10, 14, and 21 days of growth. The presence of antibiotic
activity in the culture liquid was determined by diffusion
into agar medium. For this, the studied samples of the cul-
ture liquid were introduced into the wells of Petri dishes
with agar medium 3 infected with the test strain. After incu-
bation, the level of antimicrobial activity was judged by pres-
ence or absence of zones of growth inhibition of test cultures
around the wells. Discs with some antibacterial and antifun-
gal antibiotics served as control (levofloxacin (LVX5), novo-
biocin (NB5), chloramphenicol (C30), amikacin (AN30),
cefotaxime (CTX30), and ciprofloxacin (CIP5); Becton,
Dickinson and Company, USA).
The following microorganisms were used as test strains
to determine the antibiotic activity of E. cristatum INA
01267: Gram-positive bacteria Bacillus subtilis АТСС 6633,
B. pumilus NCTC 8241, B. mycoides 537, Micrococcus luteus
NCTC 8340, Leuconostoc mesenteroides VKPM B-4177,
Staphylococcus aureus FDA 209P, and S. aureus INA
00761, as well as mycobacteria Mycobacterium smegmatis
VKPM Ac 1339 and M. smegmatis mc
2
155; Gram-
negative bacteria Escherichia coli ATCC 25922, Pseudomo-
nas aeruginosa ATCC 27853, and Comamonas terrigena
VKPM B-7571; and fungi Aspergillus niger INA 00760 and
Saccharomyces cerevisiae RIA 259.
L. mesenteroides VKPM B-4177, A. niger INA 00760,
and Sac. cerevisiae RIA 259 were incubated at 28
°
C, and
the rest of the test strains were at 37
°
C.
2.7. Data Processing. The data were analyzed using MS Excel
2016 and presented as mean ± SD of three replicates.
3. Results
3.1. Fungus Identification. The strain grew approximately
equally well on organic media Czapek, Sabouraud, and mod-
ified agar medium #2 Gause, but grew poorly on mineral
agar medium #1 Gause (Figures 2(a)–2(d)). On Czapek’s
medium, the fungus had an olive-beige, later olive-brown
colony coloration, and a characteristic red-brown exopig-
ment coloration (Figure 2(a)); the growth rate was
5.2 mm/day. On the fourth day of growth, large amounts
of cleistothecia formed on all agar media (Figures 2(e) and
2(g)). The sizes of cleistothecia were from 45 to 108 μmin
diameter. Each ascospore contained 8 ascospores with a pro-
nounced equatorial crest and a prickly uneven surface; the
spore size was 3:6×4:5μm (Figures 2(g) and 2(i)). Conidial
sporulation was observed only when grown on Czapek’s
medium with 40% glucose. Conidiophores with spores were
located in the upper layer of colonies above the mycelium
with cleistothecia (Figure 2(f)). The heads of the conidio-
phores were covered with one layer of phialides, from which
the chains of conidia extend. Conidia were spherical to ellip-
tical in shape, smooth surface, and 2.6 to 2.9 μm in diameter
along the long axis (Figures 2(h) and 2(j)). By the totality of
the described characteristics, the fungi corresponded to the
description of the species Eurotium cristatum (Raper et Fen-
nell) Malloch et Cain, teleomorph, or Aspergillus cristatus
Raper et Fennell, anamorph [27, 28].
To confirm the identified species, the sequences of six
DNA regions were determined (Table 2). In four cases out
of six (for genes ITS-D1/D2, RPB2, TEF1-α, and β-tub),
the coincidence is 99.67-100% with the sequences of Asper-
gillus cristatus genes in the database, which confirmed the
species affiliation of the strain identified by morphological-
cultural characteristics. The fungus strain was deposited in
the collection of the Gause Institute of New Antibiotics as
Eurotium cristatum (anamorph of Aspergillus cristatus)
INA 01267.
3.2. Changes in Biochemical Parameters as a Result of
Postfermentation with E. Cristatum INA 01267. The trans-
formation of initial plant materials by the fungus E. crista-
tum INA 01267 was judged by the change in the content
of phenolic compounds, organic acids, sugars, and amino
acids in the extracts of postfermented herbal teas.
Comparative analysis of the composition of herbal teas
showed that the total content of phenolic compounds as a
result of postfermentation in fireweed tea was significantly
higher than in the apple tree leaf tea (5626.44 and
251.12 μg/g, respectively). The results showed that the post-
fermentation of the fireweed tea biomass led to an approxi-
mately twofold increase in the content of sinapic acid and
syringaldehyde and to the complete disappearance of coni-
feryl and synaptic aldehydes. The postfermentation of tea
biomass from the apple tree leaves led to the appearance of
gallic acid in an amount of 126 μg/g and to the disappear-
ance of such components as syringaldehyde and vanillin.
It was noted that the total content of low molecular
weight phenolic compounds before and after their postfer-
mentation practically did not change in the case of the fire-
weed tea biomass and slightly increased (by 18%) in the
case of the apple tree leaf tea, which indicated the activity
of redox processes during postfermentation (Figure 3 and
Table S1).
The analysis of the sugar content in the extracts of post-
fermented teas showed that during the postfermentation of
fireweed tea, the fungus completely utilized the sucrose,
while the fructose content slightly decreased (by 12%). Dur-
ing the postfermentation of the apple tree leaf tea, the
5International Journal of Food Science

(a) (b)
(c) (d)
(e) (f)
(g) (h)
Figure 2: Continued.
6 International Journal of Food Science

sucrose and fructose were completely utilized. The glucose
level in both cases remained practically constant (Figure 4
and Table S2).
After Eurotium cristatum INA 01267 growth, the malic
and tartaric acids were utilized in both samples and in the
case of apple tree leaf tea, completely. The oxalic acid con-
tent in both samples changed insignificantly. The hanging
content of the succinic acid (up to 345% and 150%) was also
typical for both samples. The difference between the samples
consisted in a sharp change, as a result of the postfermenta-
tion, in the concentrations of citric and lactic acids: an
increase in the fireweed tea sample (up to 157% and 488%,
respectively) and a decrease in the apple tree leaf tea (down
to 34% and 0%, respectively) (Figure 5 and Table S3).
The analysis of free amino acids in extracts of the fire-
weed tea and the apple tree leaf tea before and after cultiva-
tion of E. cristatum INA 01267 showed that as a result of
fungi growth, the content of amino acids asparagine, gluta-
mine, glycine, and valine significantly increased in both sam-
ples (in the range of 23-305%). In addition, in the fireweed
tea sample, the content of arginine, glutamic acid, methio-
nine, and serine also increased (by 26-58%), and in the sam-
ple of the apple tree leaf tea, the content of aspartic acid
increased (up to 127%). In both extracts, before and after
cultivation of E. cristatum INA 01267, all 9 free essential
amino acids were present, and the content of essential amino
acids such as histidine, leucine, lysine, methionine, phenylal-
anine, tyrosine, and valine had increased in the fireweed tea.
In the biomass of apple tree leaf tea, the content of valine sig-
nificantly increased (up to 129%) and the content of glycine
increased slightly (up to 114%). In both biomasses, the con-
tent of individual amino acids changed, but the total content
remained practically unchanged (Figure 6 and Table S4).
3.3. Determination of Toxic and Antibiotic Activity of E.
Cristatum INA 01267 under Submerged Cultivation. In bio-
technological tea production, a special place is given to the
safety issues, since some species of Aspergillus fungi during
the growth can synthesize mycotoxins and antibiotics, the
presence of which is harmful and undesirable for food
20μm
(i)
20 μm
(j)
Figure 2: Seven-day fungal growth on media (a) Czapek, (b) Sabouraud, (c) modified agar medium #2 Gause, and (d) mineral agar medium
#1 Gause; (e) cleistothecia on Sabouraud medium after 4 days of growth; (f) conidiophores on Sabouraud medium with 40% of glucose after
21 days of growth, upper part of the colony; (g) destroyed cleistothecia and asci; (h) conidiophore with single-row phialides covering the
conidiophore’s head and chains of conidia; (i) asci and ascospores; (j) chains of conidia separated by disjunctors.
Table 2: Alignment of gene sequences of the strain Eurotium cristatum (anam. Aspergillus cristatus) INA 01267 with DNA sequences from
GenBank.
DNA regions/genes Species Alignment (%) Sequence length (b.p.) Sequence number in GenBank
ITS-D1/D2
Aspergillus amstelodami
Aspergillus cristatus
Eurotium heterocaryoticum
Aspergillus hollandicus
Aspergillus montevidensis
100 1079 MN966538
RPB2 Aspergillus cristatus 100 997 MT326207
TEF1-α
Aspergillus chevalieri
Aspergillus cristatus 99.67 302 MT326208
Aspergillus niger 99.34
β-tub Aspergillus cristatus 100 355 MT319133
LSU
Aspergillus amstelodami
Aspergillus glaucus
Aspergillus montevidensis
Aspergillus proliferans
Eurotium herbariorum
Eurotium rubrum
Eurotium spiculosum
100 848 MN966539
GAPDH Aspergillus glaucus 94.72 437 MT326209
7International Journal of Food Science

products. The culture liquid after incubation of the E. crista-
tum INA 01267 strain in Czapek’s liquid medium was ana-
lyzed by HPLC for the content of mycotoxins: aflatoxin B1,
deoxynivalenol, zearalenoene, and patulin. The results
showed that E. cristatum INA 01267 did not form these
mycotoxins. The analysis of the antibiotic activity of the cul-
ture liquid of the E. cristatum INA 01267 strain at the age of
2 to 21 days against 12 test strains of bacteria and fungi also
showed no activity.
4. Discussion
In accordance with the aim of this study—to create technol-
ogy of postfermented Russian herbal teas production, we
isolated the fungus from postfermented black brick tea
Fujian. The isolated strain was identified as E. cristatum
and deposited in the Gause Institute collection as INA
01267. It confirms the previously published data that E. cris-
tatum is most often found in Fujian tea briquette. The ability
Vanillin
Vanillic acid
Syringic acid
Syringaldehyde
Synaptic aldehyde
Sinapic acid
Coniferyl aldehyde
Gallic acid
0 1000 2000 3000 4000 5000 6000
μg/g
(a)
040
20 60 80 100 120 140
μg/
g
Vanillin
Vanillic acid
Syringic acid
Syringaldehyde
Synaptic aldehyde
Sinapic acid
Coniferyl aldehyde
Gallic acid
Before postfermentation
Postfermentation result
(b)
Figure 3: Impact of Eurotium cristatum INA 01267 postfermentation on the composition of phenolic compounds in herbal teas (μg/g). (a)
Fireweed tea. (b) Apple tree leaf tea. Presented data of phenolic compound content are mean values from 3 independent extractions ±
standard deviation ðSDÞ.
0 20 40 60 80 100
Fructose
Glucose
Sucrose
μg/
g
(a)
Fructose
Glucose
Sucrose
0 20406080100
μg/
g
Before postfermentation
Postfermentation result
(b)
Figure 4: Impact of Eurotium cristatum INA 01267 postfermentation on the composition of sugars in herbal teas (μg/g). (a) Fireweed tea.
(b) Apple tree leaf tea. Presented data of sugar content are mean values from 3 independent extractions ± standard deviation ðSDÞ.
8 International Journal of Food Science

of E. cristatum, for which the main substrates are soil and
plant leaves, to develop not only on the leaves of the C.
sinensis tea bush, but also on other plant material, was quite
obvious and confirmed in our studies for two autofermented
herbal teas commercially produced in Russia.
Like all fungi, E. cristatum INA 01267 has a pronounced
hydrolase activity, which ensures its growth on plant mate-
rial due to low molecular weight compounds formed from
plant biopolymers. We analyzed the content of low molecu-
lar weight carbohydrates (phenolic compounds, organic
acids, and sugars) and free amino acids in the herbal tea
extracts before and after E. cristatum INA 01267 growth.
The effect of microbial fermentation (postfermentation)
on the composition of phenolic compounds has been well
studied for the leaves of the tea bush C. sinensis. The oxida-
tion of gallocatechin gallate (GCG) and epigalocatechin gal-
late (EGCG) contained in tea leaves leads to the formation of
their condensation products—theaflavins and theorubigins.
When fermented by fungi of the genus Aspergillus, carried
out in the technology of Pu-erh tea, the content of complex
phenolic compounds, such as EGCG and GCG, decreases
and the amount of both simple catechins not associated with
gallic acid, free gallic acid, and its conversion products
increases [29].
It was previously established that tannins (enotein) pre-
dominated in the composition of phenolic compounds of
fireweed herb, whereas flavonoids (quercetin, mericitin,
quercitrin, kaempferol, and quercitrin-galloyl-galactoside)
and phenols such as gallic acid and ellagic acid which were
present in smaller quantities [19]. In the process of autofer-
mentation, the composition of phenolic compounds under-
went significant changes, and the content of phenolic acids
and flavonoids, which had high antioxidant activity,
increased. Particularly, the active antioxidants were the com-
pounds having hydroxyl groups in the orthoposition, such as
quercetin. The oxidized phenolic compounds could con-
dense to form tannin or be reduced by interaction with other
antioxidants present. According to our data, the similar pro-
cesses occurred during the postfermentation by the E. crista-
tum INA 01267 strain of herbal teas from the fireweed and
the apple tree leaves. The redox reactions led to a change
in the ratio of aldehydes and acids (Figure 3 and Table S1).
In the postfermented fireweed tea, the amount of syringic
acid decreased (by 1.5 times) and the amount of
syringaldehyde increased with a constant content of
vanillin; the synaptic aldehyde disappeared completely,
while the content of sinapic acid doubled; also, the
coniferyl aldehyde completely disappeared. The phenolic
composition and transformation of phenols in the apple
tree leaves were much less studied than in the fireweed
herb, but the direction of the processes was of a general
nature [18].
According to our data, during the postfermentation, the
concentration of gallic acid in fireweed tea increased slightly
(about 1%), while in apple tree leaf tea, it increased dramat-
ically, namely, by 550 times. However, in absolute terms, the
content of gallic acid in fireweed tea is about 40 times higher
than in apple tree leaf tea. The gallic acid is found in many
plants, and it is part of the complex of tannins. It is an anti-
oxidant and, like salicylic acid, suppresses the accumulation
of white blood cells in extravascular areas of the tissue and
inhibits chronic inflammation. It has also been shown that
gallic acid affects the immune system by stimulating the for-
mation of immunoglobulins G [30]. Accordingly, the accu-
mulation of gallic acid in teas is a useful property. As an
impact of Eurotium cristatum INA 01267 growth, vanillin
and syringaldehyde disappeared, the amount of coniferyl
and synaptic aldehydes increased slightly, and the content
of syringic acid decreased slightly. These data indicated
hydrolysis of complex phenols and ongoing oxidative pro-
cesses (Figure 3 and Table S1). The results obtained
correspond to the data on the decomposition of the
complex phenols of leaves of the tea bush Camellia by
fungi of the genus Eurotium [31]. According to the
literature data, the number of phenolic compounds
gradually decreases with prolonged fermentation. Thus,
during postfermentation of teas, complex phenolic
compounds are decomposed, as a result of which their
decay products accumulate, which are later partially
assimilated by the fungus [31].
0 50 100 150 200 250
Citric acid
Lactic acid
Malic acid
Oxalic acid
Succinic acid
Tartaric acid
μg/
g
(a)
Citric acid
Lactic acid
Malic acid
Oxalic acid
Succinic acid
Tartaric acid
0 50 100 150 200
μg/
g
Before postfermentation
Postfermentation result
(b)
Figure 5: Impact of Eurotium cristatum INA 01267 postfermentation on the composition of organic acids in herbal teas (μg/g). (a) Fireweed
tea. (b) Apple tree leaf tea. The presented data of the organic acid content were mean values from 3 independent extractions ± standard
deviation ðSDÞ.
9International Journal of Food Science

The content of sugars (sucrose and fructose) decreased
until the complete disappearance of sucrose in both teas, as
well as fructose in the apple tree leaf tea and a decrease in
its level in the fireweed tea. The glucose, called the “energy
currency of the cell,”was maintained at a constant level
(Figure 4 and Table S2).
0 20 40 60 80 100 140 160 180 200120
μg/
g
Alanine
Arginine
Asparagine
Aspartic acid
Glutamic acid
Glutamine
Glycine
Histidine⁎
Lysine⁎
Serine
reonine⁎
Tryptophan⁎
Valine⁎
Tyrosine
Isoleucine⁎
Leucine⁎
Methionine⁎
Phenylalanine⁎
(a)
0 5 10 15 20 30 35 40 4525
μg/
g
Alanine
Arginine
Asparagine
Aspartic acid
Glutamic acid
Glutamine
Glycine
Histidine⁎
Lysine⁎
Serine
reonine⁎
Tryptophan⁎
Valine⁎
Tyrosine
Isoleucine⁎
Leucine⁎
Methionine⁎
Phenylalanine⁎
Before postfermentation
Postfermentation result
(b)
Figure 6: (a) Impact of Eurotium cristatum INA 01267 postfermentation on the composition of amino acids in herbal teas (μg/g). Fireweed
tea. Presented data of free amino acid content are mean values from 3 independent extractions ± standard deviation ðSDÞ.∗Essential amino
acids. (b) Impact of Eurotium cristatum INA 01267 postfermentation on the composition of amino acids in herbal teas (μg/g). Apple tree
leaf tea. Presented data of free amino acid content are mean values from 3 independent extractions ± standard deviation ðSDÞ.∗Essential
amino acids.
Table 3: Impact of Eurotium cristatum INA 01267 postfermentation on the composition of biologically active compounds from four
different groups (μg/g).
Total∗Fireweed tea Apple tree leaf tea
Before postfermentation Postfermentation result Before postfermentation Postfermentation result
Phenolic compounds 5546.27 5626.44 213.33 251.12
Sugars 144.99 129.2 145.44 55.7
Organic acids 404.56 476.94 559.31 184.54
Amino acids 556.04 533.80 351.52 357.58
∗The sum of the total average values for the three experiments.
10 International Journal of Food Science

Table 4: Comparison of the effect of Eurotium cristatum postfermentation on the composition of amino acids in various teas.
Amino acids
Fireweed tea Apple tree
leaf tea
Pingwu
Fuzhuan
brick tea [33]
Before
postfermentation
Postfermentation
result
Before
postfermentation
Postfermentation
result
Before
postfermentation
Postfermentation
result
Postfermentation
result
Duration of postfermentation (day) 0 14 0 14 0 12 16
μg/g % μg/g % μg/g % μg/g % μg/g % μg/g % μg/g %
TEAAs (His, Ile, Leu, Lys,
Met, Phe, Thr, Trp, Val) 170.32 100 164.76 97 155.65 100 145.62 94 335.65
a
100 278.9
a
83 285.6
a
85
TNEAAs (Ala, Arg, Asn,
Asp, Cys, Glu, Gln, Gly,
Pro, Ser, Tyr)
385.72
b
100 369.04
b
96 195.87
b
100 211.96
b
108 1937.2
c
100 585.05
c
30 521.7
c
27
Total 556.04 100 533.8 96 351.52 100 357.58 102 2272.85 100 863.95 38 807.3 36
TEAAs: total essential amino acids; TNEAAs: total nonessential amino acids;
a
excluding Met and Ile;
b
excluding Cys and Pro;
c
excluding Asn and Gln.
11International Journal of Food Science

The accumulation of succinic and oxalic acids, as well as
the decrease in the content of tartaric and malic acids, was
common to both teas; the difference consisted an increase
in the content of lactic and citric acids in the fireweed tea
and the decrease in them in the tea from apple leaves
(Figure 5 and Table S3). Succinic acid, a desirable
component of tea, is an antioxidant with a wide spectrum
of biological activity: it increases the body’s immune status,
has an antitoxic effect, and improves the state of the
cardiovascular system [32].
When analyzing the amino acid composition of both
herbal teas, a higher content of free amino acids (including
all essential amino acids) was noted, and the concentrations
of which were mainly in the range of 4-38 μg/g. The expec-
tation was the dominance of aspartic acid and alanine in
the fireweed tea (91.63 and 146.97 μg/g, respectively), as well
as a high content of threonine, valine, and glutamine, while
in the apple tree leaf tea was aspartic acid and alanine
(Figure 6 and Table S4). The concentration of amino acids
before and after fungal fermentation did not change as
much as in the case of carbohydrates (Figures 3–5 and
Table S1-3).
In general, as a result of postfermentation, the fireweed
tea had a higher content of phenolic compounds, sugars,
organic acids, and amino acids compared to the apple tree
leaf tea (Table 3). The popularity of herbal tea from fireweed
in Russia has developed historically, and, apparently, it was
developed based on taste and benefits, and now it is con-
firmed by laboratory data. In this study, we did not plan to
study the composition of teas in dynamics, but we are plan-
ning such a task in order to develop production technology,
optimize the composition of teas, and increase their useful
properties. The composition of tea varies depending not
only on the raw material, strain, but also on the duration
of postfermentation. Therefore, knowing the composition
of the listed substances in dynamics, it is possible to influ-
ence, for example, the sweetness or acidity of the drink.
The results obtained by us cannot be accurately com-
pared with the published data of other authors due to differ-
ent research conditions. It is possible to note a high general
trend associated with the hydrolysis of high-molecular com-
pounds on the one hand and the consumption of the
obtained products by the fungus on the other. The closest
experimental conditions are given in the publication Xiao
et al. by amino acids. Table 4 shows a comparison of the
results obtained, although in our study, the duration of
fermentation was 14 days, and in the cited work is 12 and
16 days [33].
Table 4 shows that postfermented tea from the leaves of
the tea bush C. sinensis is about 4 times richer in free amino
acids than tea from Ch. angustifolium (fireweed) and M.
domestica (apple tree leaves). It is also shown that postfer-
mentation with a duration of 12 days reduces the total con-
tent of amino acids to 38%, while postfermentation Ch.
angustifolium and M. domestica decreases only by 3-4%. It
once again underlines the importance of postfermentation
conditions, in particular its duration.
A necessary characteristic of fungal strains for use in
food industry technologies is the absence of toxicity. The
safety of the E. cristatum INA 01267 strain was confirmed
by HPLC analysis of the culture broth due to the absence
of common toxins aflatoxin B1, patulin, deoxynivalenol,
and zearalenone produced by toxigenic fungi [34]. It was
previously found that the expression of aflatoxin
biosynthesis-related genes (aflD, aflQ, and aflS) in E. crista-
tum was downregulated [35].
Many publications have noted the antimicrobial effect of
postfermented teas. This activity can be explained by the
composition of the tea leaf or the hydrolysis products of
the components of the tea leaves under the action of E. cris-
tatum,as well as by the biosynthesis products of the fungus
grown in a microbiological medium without tea leaves. The
antimicrobial activity of teas has been repeatedly proven
against pathogenic Gram-positive and Gram-negative bacte-
ria [36, 37]. The authors considered plant polyphenols as the
main antimicrobial agents in teas, presumably affecting the
activity of various enzymes and the stability of the
membranes of pathogenic bacteria [38]. The proposed
mechanism of the antimicrobial activity of Chinese teas is
a characteristic of phenolic compounds, in particular, alkyl-
resorcinols [39–41].
A detailed description of the antimicrobial properties of
teas and their composition was presented in the literature [3,
38]. There were few proven antimicrobial products pro-
duced by E. cristatum. When fermented under submerged
conditions, an endophytic fungus E. cristatum EN-220, iso-
lated from the marine alga Sargassum thunbergii, produced
previously unknown indole alkaloids, namely, cristatumins
A-D, along with nine known congeners. Interestingly, these
compounds differed in their antibiotic activity: antibacterial,
insecticidal, anthelmintic, and fungicidal. However, the MIC
of these compounds was high and amounted to tens and
hundreds of micrograms per milliliter [11, 42]. The probi-
otic strain E. cristatum was isolated by the Chinese brick
tea Fuzhuan and was tested for its in vitro activity against
aflatoxigenic Aspergillus flavus. It was established by GC/MS
that there were many antifungal substances present in the E.
cristatum HNYYWX.21 culture filtrate. In addition, this
strain inhibited the production of aflatoxins in A. flavus.
The chemical structure of active compounds had not yet
been established [35].
The described E. cristatum INA 01267 strain did not
show antibacterial or antifungal activity when tested against
14 test cultures. Antimicrobial activity was absent in the cul-
ture liquid obtained during the growth of the fungus in three
nutrient media of different composition. We regarded this as
a desirable characteristic for the strain that can be used in
the food industry for postfermentation in herbal teas.
5. Conclusions
The growth of E. cristatum INA 01267 strain was efficient on
autofermented herbal teas from fireweed and apple tree
leaves. As a result of postfermentation, the plant material
was hydrolyzed and some useful low molecular weight
metabolites, such as succinic acid, essential amino acids,
and phenols, accumulated. The E. cristatum INA 01267
strain did not produce toxins and antimicrobial substances,
12 International Journal of Food Science

which is desirable in the food industry. Postfermented tea
made from apple tree leaves is somewhat inferior to tea
made from fireweed (“Ivan-tea”), a traditional drink in Rus-
sia, in terms of the content of nutrients.
Data Availability
The data of Figures 3–6 used to support the findings of this
study are included within the supplementary information
files (Table S1-S4). The data used to support the findings
of this study are included within the article.
Conflicts of Interest
The authors declare that there is no conflict of interest
regarding the publication of this paper.
Supplementary Materials
Table S1: impact of Eurotium cristatum INA 01267 postfer-
mentation on the composition of phenolic compounds in
herbal teas (μg/g). Table S2: impact of Eurotium cristatum
INA 01267 postfermentation on the composition of sugars
in herbal teas (μg/g). Table S3: impact of Eurotium cristatum
INA 01267 postfermentation on the composition of organic
acids in herbal teas (μg/g). Table S4: impact of Eurotium cris-
tatum INA 01267 postfermentation on the composition of
amino acids in herbal teas (μg/g). (Supplementary Materials)
References
[1] Y. H. Hui, L. Meunier-Goddik, J. Josephsen, W.-K. Nip, and
P. S. Stanfield, Handbook of Food and Beverage Fermentation
Technology, Marcel Dekker, Inc., New York, USA, 2004.
[2] A. Xu, Y. Wang, J. Wen, P. Liu, Z. Liu, and Z. Li, “Fungal com-
munity associated with fermentation and storage of Fuzhuan
brick- tea,”International Journal of Food Microbiology,
vol. 146, no. 1, pp. 14–22, 2011.
[3] A. Y. Yashin, B. V. Nemzer, E. Combet, and Y. I. Yashin,
“Determination of the chemical composition of tea by chro-
matographic methods: a review,”Journal of Food Research,
vol. 4, no. 3, pp. 56–87, 2015.
[4] R. R. Cardoso, R. O. Neto, C. T. dos Santos D'Almeida et al.,
“Kombuchas from green and black teas have different phenolic
profile, which impacts their antioxidant capacities, antibacte-
rial and antiproliferative activities,”Food Research Interna-
tional, vol. 128, article 108782, 2020.
[5] R. Jayabalan, R. V. Malbaša, E. S. Lončar, J. S. Vitas, and
M. Sathishkumar, “A review on Kombucha tea-microbiology,
composition, fermentation, beneficial effects, toxicity, and tea
fungus,”Comprehensive Reviews in Food Science and Food
Safety, vol. 13, no. 4, pp. 538–550, 2014.
[6] F. Gaggìa, L. Baffoni, M. Galiano et al., “Kombucha beverage
from green, black and rooibos teas: a comparative study look-
ing at microbiology, chemistry and antioxidant activity,”
Nutrients, vol. 11, no. 1, p. 1, 2019.
[7] S. Chakravorty, S. Bhattacharya, A. Chatzinotas,
W. Chakraborty, D. Bhattacharya, and R. Gachhui, “Kombu-
cha tea fermentation: microbial and biochemical dynamics,”
International Journal of Food Microbiology, vol. 220, pp. 63–
72, 2016.
[8] R. Niwa, Y. Syaputri, M. Horie, and H. Iwahashi, “Draft
genome sequence of Lactobacillus plantarum IYO1511, iso-
lated from Ishizuchi-kurocha,”Microbiology Resource
Announcements, vol. 9, no. 18, article e00143-20, 2020.
[9] M. Horie, H. Sato, A. Tada et al., “Regional characteristics of
Lactobacillus plantarum group strains isolated from two kinds
of Japanese post-fermented teas, Ishizuchi-kurocha and Awa-
bancha,”Bioscience of Microbiota, Food and Health, vol. 38,
no. 1, pp. 11–22, 2019.
[10] L. Zhang, Z.-Z. Zhang, Y.-B. Zhou, T.-J. Ling, and X.-C. Wan,
“Chinese dark teas: postfermentation, chemistry and biological
activities,”Food Research International, vol. 53, no. 2, pp. 600–
607, 2013.
[11] F.-Y. Du, X.-M. Li, C.-S. Li, Z. Shang, and B.-G. Wang, “Cris-
tatumins A-D, new indole alkaloids from the marine-derived
endophytic fungus Eurotium cristatum EN-220,”Bioorganic
& Medicinal Chemistry Letters, vol. 22, no. 14, pp. 4650–
4653, 2012.
[12] Y. Peng, Z. Xiong, J. Li et al., “Water extract of the fungi from
Fuzhuan brick tea improves the beneficial function on inhibit-
ing fat deposition,”International Journal of Food Sciences and
Nutrition, vol. 65, no. 5, pp. 610–614, 2014.
[13] T.-J. Ling, X.-C. Wan, W.-W. Ling et al., “New triterpenoids
and other constituents from a special microbial-fermented
tea—Fuzhuan Brick tea,”Journal of Agricultural and Food
Chemistry, vol. 58, no. 8, pp. 4945–4950, 2010.
[14] H. Mo, Y. Zhu, and Z. Chen, “Microbial fermented tea - a
potential source of natural food preservatives,”Trends in Food
Science & Technology, vol. 19, no. 3, pp. 124–130, 2008.
[15] L. Cao, X. Guo, G. Liu et al., “A comparative analysis for the
volatile compounds of various Chinese dark teas using combi-
natory metabolomics and fungal solid-state fermentation,”
Journal of Food and Drug Analysis, vol. 26, no. 1, pp. 112–
123, 2018.
[16] J. I. Pitt and A. D. Hocking, “The Ecology of Fungal Food
Spoilage,”in Fungi and Food Spoilage, Springer, Boston, MA,
2009.
[17] D. A. Muravyova, “Pharmacognosy (with the basics of bio-
chemistry of medicinal plants),”in Books on Demand, Russia,
Moscow, 20122020, https://www.bookvoed.ru/book?id=
1523911#tdescription.
[18] V. L. Zakharov and T. A. Soldatova, “Organoleptic and chem-
ical characteristics of teas from fermented leaves of various
plants of the Lipetsk region,”International Journal of Human-
ities and Natural Sciences, vol. 5, pp. 259–263, 2016.
[19] N. V. Zavorokhina, O. V. Chugunova, and V. V. Fozilova,
“Antioxidant tea drinks based on narrow-leaved fireweed,”
Food industry. Beer and drinks, 2013, 2020, https://
cyberleninka.ru/article/n/chaynye-napitki-antioksidantnoy-
napravlennosti-na-osnove-kipreya-uzkolistnogo.
[20] S. Kumar, G. Stecher, and K. Tamura, “MEGA7: molecular
evolutionary genetics analysis version 7.0 for bigger datasets,”
Molecular Biology and Evolution (MBE), vol. 33, no. 7,
pp. 1870–1874, 2016.
[21] “The Basic Local Alignment Search Tool (BLAST),”2020,
https://www.blast.ncbi.nlm.nih.gov/Blast.cgi.
[22] “Westerdijk Fungal Biodiversity Institute,”2021, http://www
.westerdijkinstitute.nl/Collections/.
[23] I. M. Skurikhin and V. A. Tutelyan, Guide to methods of anal-
ysis of food quality and safety, Russian academy of med. sci-
ences, Nutrition Institute, Medicine, Moscow, Russia, 1998.
13International Journal of Food Science

[24] V. A. Tutelyan, Guidelines for quality and safety control of bio-
logically active food additives, Federal Center for State Sanitary
and Epidemiological Supervision of the Ministry of Health of
Russia, Russia, Moscow, 2004.
[25] I. Gandolfi, G. Palla, R. Marchelli, A. Dossena, S. Puelli, and
C. Salvadori, “D-alanine in fruit juices: a molecular marker
of bacterial activity, heat treatments and shelf-life,”Journal of
Food Science, vol. 59, no. 1, pp. 152–154, 1994.
[26] H. Egan, L. Stoloff, P. Scott, M. Castegnaro, I. K. O'Neill, and
H. Bartsch, “Environmental carcinogens: selected methods of
analysis,”in Some mycotoxins,vol.5,IARC,Lion,France,
1982, 2020, https://publications.iarc.fr/Book-And-Report-
Series/Iarc-Scientific-Publications/Environmental-
Carcinogens-Selected-Methods-Of-Analysis-Volume-5-
Some-Mycotoxins-1982.
[27] D. Malloch and R. F. Cain, “New species and combinations of
cleistothecial ascomycetes,”Canadian Journal of Botany (CAN
J BOT), vol. 50, no. 1, pp. 61–72, 1972.
[28] R. A. Samson and J. I. Pitt, “Advances in Penicillium and
Aspergillus systematics,”in Proceedings of the First Interna-
tional Penicillium and Aspergillus Workshop, Amsterdam,
The Netherlands, 1985.
[29] Z.-M. Luo, T. Ling, L.-X. Li et al., “A new norisoprenoid and
other compounds from Fuzhuan brick tea,”Molecules,
vol. 17, no. 3, pp. 3539–3546, 2012.
[30] J. Alanko, A. Riutta, P. Holm, I. Mucha, H. Vapaatalo, and
T. Metsä-Ketelä, “Modulation of arachidonic acid metabolism
by phenols: relation to their structure and antioxidant/proox-
idant properties,”Free Radical Biology & Medicine, vol. 26,
no. 1-2, pp. 193–201, 1999.
[31] J.-H. Qin, N. Li, P.-F. Tu, Z.-Z. Ma, and L. Zhang, “Change in
tea polyphenol and purine alkaloid composition during solid-
state fungal fermentation of post-fermented tea,”Journal of
Agricultural and Food Chemistry, vol. 60, no. 5, pp. 1213–
1217, 2012.
[32] A. V. Smirnov, O. B. Nesterova, and R. V. Golubev, “Succinic
acid and its use in medicine. Part I. succinic acid: metabolite
and regulator of the metabolism of the human body,”Nephrol-
ogy, vol. 18, no. 2, pp. 33–41, 2014, 2020, https://cyberleninka
.ru/article/n/yantarnaya-kislota-i-ee-primenenie-v-meditsine-
chast-i-yantarnaya-kislota-metabolit-i-regulyator-
metabolizma-organizma-cheloveka/viewer.
[33] Y. Xiao, K. Zhong, J.-R. Bai, Y.-P. Wu, and H. Gao, “Insight
into effects of isolated Eurotium cristatum from Pingwu Fuz-
huan brick tea on the fermentation process and quality charac-
teristics of Fuzhuan brick tea,”Journal of the Science of Food
and Agriculture, vol. 100, no. 9, pp. 3598–3607, 2020.
[34] C. W. Blackburn, Food Spoilage Microorganisms, Woodhead
Publishing, CRC Press, Boca Raton, Cambridge, England,
2006.
[35] Q. Zhao, Y. Qiu, X. Wang et al., “Inhibitory effects of Eurotium
cristatum on growth and aflatoxin B
1
biosynthesis in Aspergil-
lus flavus,”Frontiers in Microbiology, vol. 11, pp. 1–13, 2020.
[36] S. C. Wu, G. C. Yen, B. S. Wang et al., “Antimutagenic and
antimicrobial activities of pu-erh tea,”LWT- Food Science
and Technology, vol. 40, no. 3, pp. 506–512, 2007.
[37] Y. J. Hu, J. J. Jia, J. L. Qiao, C. G. Ge, and Z. H. Cao, “Antimi-
crobial activity of pu-erh tea extractsin vitroand its effects on
the preservation of cooled mutton,”Journal of Food Safety,
vol. 30, no. 1, pp. 177–195, 2010.
[38] J. M. Hamilton-Miller, “Antimicrobial properties of tea
(Camellia sinensis L.),”Antimicrobial Agents and Chemother-
apy, vol. 39, no. 11, pp. 2375–2377, 1995.
[39] M. Stasiuk and A. Kozubek, “Biological activity of phenolic
lipids,”Cellular and Molecular Life Sciences, vol. 67, no. 6,
pp. 841–860, 2010.
[40] G. I. El-Registan, A. L. Mulyukin, Y. A. Nikolaev, N. E. Suzina,
V. F. Gal’chenko, and V. I. Duda, “Adaptogenic functions of
extracellular autoregulators of microorganisms,”Microbiology,
vol. 75, no. 4, pp. 380–389, 2006.
[41] Y. A. Nikolaev, I. A. Borzenkov, M. V. Kalinin et al., “Antimi-
crobic features of phenolic lipids,”Applied Biochemistry and
Microbiology, vol. 46, no. 2, pp. 159–165, 2010.
[42] F.-U. Du, X. Li, X.-M. Li, L.-W. Zhu, and B.-G. Wang, “Indo-
lediketopiperazine alkaloids from Eurotium cristatum EN-220,
an endophytic fungus isolated from the marine alga Sargassum
thunbergii,”Marine Drugs, vol. 15, no. 2, p. 24, 2017.
14 International Journal of Food Science