First detection of Colletotrichum fructicola (Ascomycota) on horsehair worms (Nematomorpha)

Abstract

Fungal members of Colletotrichum (Ascomycota) were found to be associated with Chordodes formosanus , one of the three currently known horsehair worm (Nematomorpha) species in Taiwan. The fungi were identified as Colletotrichum fructicola , which is mostly known as a plant pathogen, through the use of the nuclear ribosomal internal transcribed spacer and partial large subunit (nrITS + nrLSU) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) DNA sequences. To our knowledge, this report represents both the first records for Colletotrichum associated with hairworms and for fungi on Nematomorpha. These findings expand the knowledge on the ecological relationships of both clades.

Full text

Biodiversity Data Journal 9: e72798
doi: 10.3897/BDJ.9.e72798
Short Communication
First detection of Colletotrichum fructicola
(Ascomycota) on horsehair worms
(Nematomorpha)
Mattia De Vivo , Wen-Hong Wang , Ko-Hsuan Chen , Jen-Pan Huang
‡ Biodiversity Research Center, Academia Sinica, Taipei, Taiwan
§ Department of Life Science, National Taiwan Normal University, Taipei, Taiwan
| Biodiversity Program, Taiwan International Graduate Program, Academia Sinica and National Taiwan Normal University,
Taipei, Taiwan
Corresponding author: Mattia De Vivo (mattiadevivopatalano@gmail.com), Ko-Hsuan Chen (kohsuanchen@gat
e.sinica.edu.tw)
Academic editor: Ning Jiang
Received: 10 Aug 2021 | Accepted: 06 Sep 2021 | Published: 23 Sep 2021
Citation: De Vivo M, Wang W-H, Chen K-H, Huang J-P (2021) First detection of Colletotrichum fructicola
(Ascomycota) on horsehair worms (Nematomorpha). Biodiversity Data Journal 9: e72798.
https://doi.org/10.3897/BDJ.9.e72798
Abstract
Fungal members of Colletotrichum (Ascomycota) were found to be associated with
Chordodes formosanus, one of the three currently known horsehair worm (Nematomorpha)
species in Taiwan. The fungi were identified as Colletotrichum fructicola, which is mostly
known as a plant pathogen, through the use of the nuclear ribosomal internal transcribed
spacer and partial large subunit (nrITS + nrLSU) and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) DNA sequences. To our knowledge, this report represents both
the first records for Colletotrichum associated with hairworms and for fungi on
Nematomorpha. These findings expand the knowledge on the ecological relationships of
both clades.
Keywords
Nematomorpha, Taiwan, Colletotrichum, horsehair worms, Chordodes formosanus, fungi
‡,§,| ‡ ‡ ‡
© De Vivo M et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY
4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are
credited.

Introduction
The phylum Nematomorpha (which includes animals commonly known as “horsehair
worms” or “hairworms”) is regarded as one of the most understudied animal groups, both
from taxonomic and ecological perspectives (Schmidt-Rhaesa 2012). Most species have a
complex life cycle that involves a larva encysting inside a freshwater intermediate host (i.e.
usually an insect larva), a juvenile phase in which they parasitise terrestrial arthropods and
a free-living adult freshwater stage (Schmidt-Rhaesa 2012, Bolek et al. 2015). However,
some species have only freshwater hosts and a free-living freshwater adult stage
(Schmidt-Rhaesa 2012). In addition to the freshwater ones, there are marine horsehair
worms (all belonging to the genus Nectonema) that parasitise crustaceans as juveniles and
live in surface seawater as adults (Schmidt-Rhaesa 2012, Kakui et al. 2021). Moreover,
two recently-described Nematomorpha live in terrestrial wet environments in the adult
phase (Anaya et al. 2019, Chiu et al. 2020).
Although we have some knowledge on Nematomorpha’s life history, there are very few
studies on commensals, symbionts and parasites of hairworms. In addition, there are no
reports of potential horsehair worm pathogens, both prokaryotic and eukaryotic, in
literature (Schmidt-Rhaesa 2012, Bolek et al. 2015). The lack of data stems from two
factors that make hairworms hard to observe: their generally reclusive behaviour
(freshwater species tend to hide under rocks, fallen leaves and branches) and the absence
of standardised protocols for sampling them. Moreover, few researchers study
Nematomorpha due to their low medical and economical importance (Schmidt-Rhaesa
2012, Bolek et al. 2015).
Here we provide morphological and molecular evidence for the presence of fungi
resembling Colletotrichum species (Ascomycota) living on and inside the body of
Chordodes formosanus, one of the three described Taiwanese hairworm species (Chiu et
al. 2020). The genus Colletotrichum mostly includes plant-associated (i.e. pathogen or
endophytes) taxa with a broad host range. Some species also parasitise commercially-
valuable crops (Cannon et al. 2012, Weir et al. 2012). However, species infecting sea
turtles (Manire et al. 2002), cats (Winter et al. 2010), scale insects (Marcelino et al. 2008,
Wynns et al. 2020) and humans (Cano et al. 2004, Lin et al. 2015) were described
occasionally.
Materials and Methods
Four free-living adults of C. formosanus were collected in Wufengqi Waterfall area in Yilan
County, Taiwan (24°49'59.6"N, 121°44'47.3"E) on 11 August 2020 (Suppl. material 1). After
10 days in a tank with a mixture of tap water and water collected from the collection site,
fungi visibly started to develop on the hairworms. After one month and ten days, with the
water replaced with tap water only, the fungi were widespread all over the worms’ cuticles
(Fig. 1A and D). Despite this, three worms were alive at the time of fungal investigation.
2De Vivo M et al

The worms were investigated and two fungal structures (i.e. acervulus and perithecium)
were dissected for further microscopic and molecular assessment (Fig. 1, Fig. 2 and Suppl.
material 2). The investigation was performed with a dissecting microscope (Leica S9D) and
a compound microscope (Nikon Eclipse N1). In addition, the regions of the worm with
obvious fungal infection were sectioned with a tissue dissector (Leica CM3050 S Cryostat).
Fungal perithecia were on and beneath the worm cuticle (Fig. 2). Asexual sporulating
structures bearing conidia were found on the surface of the cuticle (Fig. 1D-F). Two of the
hairworm specimens were deposited at the Biodiversity Research Museum, Academia
Sinica, Taipei (collection IDs: ASIZ01000033 and ASIZ01000034).
The aforementioned fungal structures were selected for DNA extraction and amplified with
several universal primer sets for amplyfing four genes: ITS1F 5’ CTTGG
TCATTTAGAGGAAGTAA 3’ and LR3 5’ CCGTGTTTCAAGACGGG 3’ or ITS4 5’
TCCTCCGCTTATTGATATGC 3’ ( White et al. 1990, Vilgalys and Hester 1990), which
targeted nuclear ribosomal internal transcribed spacer and partial large subunit (nrITS +
nrLSU); GDF3 5’ GCCGTCAACGACCCCTTCATTGA 3’ and GDR3 5’ TTCTCGTT
GACACCCATCACGTACATG 3’ (Chung et al. 2020) for targeting glyceraldehyde 3-
phosphate dehydrogenase (GAPDH); CHS-79F 5’ TGGGGCAAGGATGCTTGGAAGAAG
3’ and CHS-345R 5’ TGGAAGAACCATCTGTGAGAGTTG 3’ (Carbone and Kohn 1999) for
chitin synthase (CHS-1); CL1C 5’ GAATTCAAGGAGGCCTTCTC 3’ and CL2C 5’
CTTCTGCATCATGAGCTGGAC 3’ (Weir et al. 2012) for calmodulin (CAL). For DNA
extraction, we placed tissues in Tris-EDTA (TE) buffer (50 µl) and stored them at -20°C.
Figure 1.
Microscopic investigation of Chordodes formosanus infected with Colletotrichum fructicola. A
Multiple perithecia of C. fructicola on the cuticle of hairworm; B Perithecium on the cuticle; C
Ascospores in an ascus, dyed with Lugol’s Solution; D White acervuli on the hairworm cuticle;
E Conidia and sporulating structures; F Conidia (shown with arrows) and sporulating
structures on the cuticle. A-C correspond to E6 (sexual state), which is also respresented in
Fig. 2 and D-F correspond to E5 (asexual state).
First detection of Colletotrichum fructicola (Ascomycota) on horsehair ... 3

Then, the frozen tubes were placed into an ultrasonic bath for 30 sec and in a thermal
cycler at 95°C for 10 min to break the cell wall.
PCR was undertaken by using Illustra™puReTaq Ready-To-Go PCR Beads (GE
Healthcare, United Kingdom) with 1 µl of forward and reverse primers (for a total of 2 µl), 2
µl of DNA and 21 µl of ddH O. The thermal cycler was set with an initial cycle at 94°C for 5
min, then 35 cycles with 94°C for 30 s, 52°C (ITS)/58 °C (other genes) for 1 min and 72°C
for 90 sec. Extension was done at 72°C for 10 min. The amplicons were sequenced by
both the forward and reverse primers.
The sequences derived from both directions were manually trimmed of the poor-quality
reads with MEGA X 10.1.8 (Kumar et al. 2018) and a consensus sequence was saved. The
sequences were submitted to NCBI GenBank with the following accession numbers: E5 =
MW714777, E6 = MW714778 for the ITS sequences; E5=MZ965243, E6=MZ965244 for
the GAPDH ones. CHS-1 and CAL were successfully amplified only for E6 and their
sequences have the following accession numbers: MZ965245 for CHS-1, MZ965246 for
CAL.
We then conducted a BLASTn search (Altschul et al. 1990) with default settings for finding
similar sequences in GenBank. After identifying a genus with high degree of sequence
similarity through BLASTn, we retrieved sequences of species inside that clade from
GenBank (Suppl. material 3) and we reconstructed a phylogenetic tree. Specifically,
sequences alignment was performed using the L-INS-i algorithm in MAFFT 7.471 (Katoh
2
Figure 2.
Dissection of Chordodes formosanus infected with Colletotrichum fructicola (sexual state) A
Cross section of the hairworm showing perithecia lined up underneath the cuticle. Stained with
Trypan blue. Abbreviations of hairworm structures: cuticle (cut), epidermis (epi) and
longitudinal muscles (lm). The muscles detached from the epidermis due to dehydration of the
tissues. Arrow = perithecia. Further cross-sections are present in Suppl. material 2; B Cross
section of a perithecium with asci and ascospores inside (enlarged fromFig. 2A); C Cross
section of the hairworm showing a perithecium protruding the cuticle layer.
4De Vivo M et al

and Standley 2013) and Maximum Likelihood phylogenies for concatened genes were
subsequently reconstructed using ModelTest and RAxML-NG implemented in raxmlGUI
(Edler et al. 2021). Gene concatenation was undertaken by using SequenceMatrix (Vaidya
et al. 2011). The trees were visualised with FigTree 1.4.4 (Rambaut 2018).
Results and Discussion
The fungus E6 (Fig. 3) had obpyriform perithecia, with colours ranging from black to brown,
paler towards the ostiolar neck, without hairs (Fig. 1A-C). Asci were unitunicate with
nonamyloid apex, with hyaline and unicellular ascospores, around 15 μm long (Fig. 1C).
These features represent the sexual reproductive structures of the fungal genus
Glomerella which is regarded as the sexual state of genus Colletotrichum (Cannon et al.
2012). The other fungus E5 appeared to be at its asexual stage and produced white
acervuli bearing hyaline conidia (Fig. 1D-F). The phylogenetic results of the concateneted
ITS and GAPDH tree showed that these fungi were Colletotrichum fructicola individuals
(Fig. 3; Suppl. material 4), which is a taxon belonging to the Colletotrichum gloeosporioides
species complex (Weir et al. 2012).
In Taiwan, Colletotrichum species are mostly known for causing anthracnose in different
kind of plantations (Sun et al. 2019, Damm et al. 2020, Wu et al. 2020, Chung et al. 2020).
There is also a reported cutaneous infection on a human caused by C. gloeosporioides
(Lin et al. 2015). From what concerns C. fructicola, it has been recognised as a pathogen
of strawberry, mango and tea in the Island (Wu et al. 2020, Chung et al. 2020, Lin et al.
2021), but it has also been reported on other crops worldwide (Weir et al. 2012).
Figure 3.
Maximum Likelihood phylogenetic tree built by using concatenated ITS and GAPDH
sequences. Specimens E5 and E6 were collected for this study and are emphasised in bold
and red font. Bootstrap values ≥ 70 are shown. The names of species complexes are shown
on the right. Strain number for sequences taken from GenBank are shown. Strains with the *
mark are the ex-type strains. Accession numbers for the gene sequences used are available in
Suppl. material 3. A picture of the species tree made with concatenated ITS, GAPDH, CHS-1
and CAL genes with specimen E6 is present in Suppl. material 4.
First detection of Colletotrichum fructicola (Ascomycota) on horsehair ... 5

Fungi in the phylum Ascomycota are known to be resilient and they can pass from soil
to
aquatic environments (Jessup et al. 2004, Rypien et al. 2008, Sarmiento-Ramírez et al.
2010, Fisher et al. 2012); this trait is also present in Colletotrichum species, which have
been reported both from seawater and freshwater organisms (Smith et al. 1989, Manire et
al. 2002). In addition to this, all the horsehair worms are known not to feed in the adult
stage (Schmidt-Rhaesa 2012). Non-feeding may make the hairworm hosts weaker as time
goes by and allow the opportunistic fungi to grow on their cuticle. Further studies will be
needed to determine the prevalence of Colletotrichum in the wild, apparently healthy
Nematomorpha populations and if hairworms can contribute to the spread of the
ascomycetous fungi to other organisms, as happens with other related fungal clades
(Fisher et al. 2012). Given the possible arising of new diseases from opportunistic
pathogens due to environmental change (Nnadi and Carter 2021) and to further
understand the chronological order of infection and the pathogenicity of Colletotrichum on
hairworms, inoculation experiments (for proving Koch’s postulate) combined with
histological examination will be required. Besides these considerations, to our knowledge,
this is the first report of fungi on horsehair worms. In addition, our report increases the
already broad host range of the genus Colletotrichum.
Acknowledgements
We thank the DNA Sequencing Core Facility of the Institute of Biomedical Sciences of
Academia Sinica for providing DNA sequencing services. We also thank Brett Morgan,
Guan Jie Phang, Yao-De Sang, Wei-Zhe Tseng, Hsiang-Yun Lin and Ming-Chung Chiu for
sampling assistance.
Mattia De Vivo was supported by Taiwan International Graduate Program (TIGP)
fellowship. The study was supported by grants from the Ministry of Science and
Technology, Taiwan (MOST 108-2621-B-001-001-MY3 to Jen-Pan Huang and 109-2621-
B-001-006-MY3 to Ko-Hsuan Chen).
Funding program
TIGP Biodiversity Program
Author contributions
Mattia De Vivo (MDV) collected the animals and performed PCR on fungineal DNA. MDV
and Ko-Hsuan Chen (KHC) analysed the data and wrote the manuscript. KHC, Wen-Hong
Wang (WHW) and Jen-Pan Huang (JPH) designed the methodology. WHW extracted the
fungi and their DNA and performed worms’ dissections. MDV, KHC and JPH conceived and
coordinated the study. All authors contributed critically to the drafts and gave final approval
for publication.
6De Vivo M et al

Conflicts of interest
The authors declare that they have no conflict of interest.
References
• Altschul S, Gish W, Miller W, Myers E, Lipman D (1990) Basic local alignment search
tool. Journal of Molecular Biology 215 (3): 403‑410. https://doi.org/10.1016/
S0022-2836(05)80360-2
• Anaya C, Schmidt-Rhaesa A, Hanelt B, Bolek M (2019) A new species of Gordius
(Phylum Nematomorpha) from terrestrial habitats in North America. ZooKeys 892:
59‑75. https://doi.org/10.3897/zookeys.892.38868
• Bolek M, Schmidt-Rhaesa A, De Villalobos LC, Hanelt B (2015) Phylum
Nematomorpha. In: Thorp J, Rogers DC (Eds) Thorp and Covich's Freshwater
Invertebrates. URL: https://linkinghub.elsevier.com/retrieve/pii/B9780123850263000152
[ISBN 978-0-12-385026-3].
• Cannon PF, Damm U, Johnston PR, Weir BS (2012) Colletotrichum – current status and
future directions. Studies in Mycology 73: 181‑213. https://doi.org/10.3114/sim0014
• Cano J, Guarro J, Gené J (2004) Molecular and morphological identification of
Colletotrichum species of clinical interest. Journal of Clinical Microbiology 42 (6):
2450‑2454. https://doi.org/10.1128/JCM.42.6.2450-2454.2004
• Carbone I, Kohn L (1999) A method for designing primer sets for speciation studies in
filamentous ascomycetes. Mycologia 91 (3): 553‑556. https://doi.org/
10.1080/00275514.1999.12061051
• Chiu M, Huang C, Wu W, Lin Z, Chen H, Shiao S (2020) A new millipede-parasitizing
horsehair worm, Gordius chiashanus sp. nov., at medium altitudes in Taiwan
(Nematomorpha, Gordiida). ZooKeys 941: 25‑48. https://doi.org/10.3897/zookeys.
941.49100
• Chung P, Wu H, Wang Y, Ariyawansa H, Hu H, Hung T, Tzean S, Chung C (2020)
Diversity and pathogenicity of Colletotrichum species causing strawberry anthracnose in
Taiwan and description of a new species, Colletotrichum miaoliense sp. nov. Scientific
Reports 10 (1). https://doi.org/10.1038/s41598-020-70878-2
• Damm U, Sun Y, Huang C (2020) Colletotrichum eriobotryae sp. nov. and C.
nymphaeae, the anthracnose pathogens of loquat fruit in central Taiwan, and their
sensitivity to azoxystrobin. Mycological Progress 19 (4): 367‑380. https://doi.org/
10.1007/s11557-020-01565-9
• Edler D, Klein J, Antonelli A, Silvestro D (2021) raxmlGUI 2.0: A graphical interface and
toolkit for phylogenetic analyses using RAxML. Methods in Ecology and Evolution 12
(2): 373‑377. https://doi.org/10.1111/2041-210X.13512
• Fisher M, Henk DA, Briggs C, Brownstein J, Madoff L, McCraw S, Gurr S (2012)
Emerging fungal threats to animal, plant and ecosystem health. Nature 484 (7393):
186‑194. https://doi.org/10.1038/nature10947
• Jessup D, Miller M, Ames J, Harris M, Kreuder C, Conrad P, Mazet JK (2004) Southern
sea otter as a sentinel of marine ecosystem health. EcoHealth 1 (3). https://doi.org/
10.1007/s10393-004-0093-7
First detection of Colletotrichum fructicola (Ascomycota) on horsehair ... 7

• Kakui K, Fukuchi J, Shimada D (2021) First report of marine horsehair worms
(Nematomorpha: Nectonema) parasitic in isopod crustaceans. Parasitology Research
120 (7): 2357‑2362. https://doi.org/10.1007/s00436-021-07213-9
• Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Molecular Biology and Evolution 30 (4):
772‑780. https://doi.org/10.1093/molbev/mst010
• Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: molecular evolutionary
genetics analysis across computing platforms. Molecular Biology and Evolution 35 (6):
1547‑1549. https://doi.org/10.1093/molbev/msy096
• Lin L, Yang C, Wan J, Chang TC, Lee JY (2015) Cutaneous Infection Caused by Plant
Pathogen Colletotrichum gloeosporioides. JAMA Dermatology 151 (12): 1383‑1384.
https://doi.org/10.1001/jamadermatol.2015.2102
• Lin SR, Yu SY, Chang TD, Lin YJ, Wen CJ, Lin YH (2021) First Report of Anthracnose
Caused by Colletotrichum fructicola on Tea in Taiwan. Plant Disease 105 (3): 710‑710.
https://doi.org/10.1094/PDIS-06-20-1288-PDN
• Manire C, Rhinehart H, Sutton D, Thompson E, Rinaldi M, Buck J, Jacobson E (2002)
Disseminated mycotic infection caused by Colletotrichum acutatum in a Kemp's ridley
sea turtle (Lepidochelys kempi). Journal of Clinical Microbiology 40 (11): 4273‑4280.
https://doi.org/10.1128/JCM.40.11.4273-4280.2002
• Marcelino J, Giordano R, Gouli S, Gouli V, Parker B, Skinner M, TeBeest D, Cesnik R
(2008) Colletotrichum acutatum var. fioriniae (Teleomorph: Glomerella acutata var.
fioriniae var. Nov.) infection of a scale insect. Mycologia 100 (3): 353‑374. https://
doi.org/10.3852/07-174R
• Nnadi NE, Carter D (2021) Climate change and the emergence of fungal pathogens.
PLOS Pathogens 17 (4). https://doi.org/10.1371/journal.ppat.1009503
• Rambaut A (2018) FigTree, version 1.4.4. URL: http://tree.bio.ed.ac.uk/software/figtree/
• Rypien KL, Andras JP, Harvell CD (2008) Globally panmictic population structure in the
opportunistic fungal pathogen Aspergillus sydowii. Molecular Ecology 17 (18):
4068‑4078. https://doi.org/10.1111/j.1365-294X.2008.03894.x
• Sarmiento-Ramírez J, Abella E, Martín M, Tellería M, López-Jurado L, Marco A,
Diéguez-Uribeondo J (2010) Fusarium solani is responsible for mass mortalities in
nests of loggerhead sea turtle, Caretta caretta, in Boavista, Cape Verde. FEMS
Microbiology Letters 312 (2): 192‑200. https://doi.org/10.1111/j.1574-6968.2010.02116.x
• Schmidt-Rhaesa A (2012) Nematomorpha. In: Schmidt-Rhaesa A (Ed.) Nematomorpha,
Priapulida, Kinorhyncha, Loricifera. URL: https://www.degruyter.com/document/doi/
10.1515/9783110272536.29/html [ISBN 978-3-11-027253-6 978-3-11-021938-8].
• Smith C, Slade S, Andrews J, Harris R (1989) Pathogenicity of the fungus,
Colletotrichum gloeosporioides (Penz.) Sacc., to Eurasian watermilfoil (Myriophyllum
spicatum L.). Aquatic Botany 33 (1-2): 1‑12. https://doi.org/
10.1016/0304-3770(89)90016-8
• Sun YC, Damm U, Huang CJ (2019) Colletotrichum plurivorum, the causal agent of
anthracnose fruit rot of papaya in taiwan. Plant Disease 103 (5). https://doi.org/10.1094/
PDIS-08-18-1423-PDN
• Vaidya G, Lohman D, Meier R (2011) SequenceMatrix: concatenation software for the
fast assembly of multi-gene datasets with character set and codon information.
Cladistics 27 (2): 171‑180. https://doi.org/10.1111/j.1096-0031.2010.00329.x
8De Vivo M et al

• Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically
amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology
172 (8): 4238‑4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
• Weir BS, Johnston PR, Damm U (2012) The Colletotrichum gloeosporioides species
complex. Studies in Mycology 73: 115‑180. https://doi.org/10.3114/sim0011
• White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White
TJ (Eds) PCR Protocols. URL: https://linkinghub.elsevier.com/retrieve/pii/
B9780123721808500421 [ISBN 978-0-12-372180-8].
• Winter R, Lawhon S, Halbert N, Levine G, Wilson H, Daly M (2010) Subcutaneous
infection of a cat by Colletotrichum species. Journal of Feline Medicine and Surgery 12
(10): 828‑830. https://doi.org/10.1016/j.jfms.2010.07.005
• Wu C, Chen H, Ni H (2020) Identification and characterization of Colletotrichum species
associated with mango anthracnose in Taiwan. European Journal of Plant Pathology
157 (1): 1‑15. https://doi.org/10.1007/s10658-020-01964-4
• Wynns AA, Jensen AB, Eilenberg J, Delalibera Júnior I (2020) Colletotrichum
nymphaeae var. entomophilum var. nov. a natural enemy of the citrus scale insect,
Praelongorthezia praelonga (Hemiptera: Ortheziidae). Scientia Agricola 77 (5). https://
doi.org/10.1590/1678-992x-2018-0269
Supplementary materials
Suppl. material 1: Free living specimens
Authors: Mattia De Vivo
Data type: Image
Brief description: Free living specimens of Chordodes formosanus, before the fungi started to
be visible
Download file (3.51 MB)
Suppl. material 2: Further cross sections
Authors: Wen-Hong Wang and Ko-Hsuan Chen
Data type: Multimedia (PDF)
Brief description: Additional cross sections of the worms
Download file (126.78 kb)
Suppl. material 3: Accession list of the sequences used in this study
Authors: Mattia De Vivo
Data type: GenBank accession numbers (csv file)
Brief description: Accession numbers of the sequences used for this study
Download file (882.00 bytes)
First detection of Colletotrichum fructicola (Ascomycota) on horsehair ... 9

Suppl. material 4: 4 genes tree
Authors: Mattia De Vivo
Data type: Tree (image)
Brief description: Picture of the concatenated phylogenetic tree based on all the sequenced
genes (ITS, GAPDH, CHS-1 and CAL). Bootstrap values ≥ 70 are shown.
Download file (16.63 kb)
10 De Vivo M et al