Fusarium: more than a node or a foot-shaped basal cell

Abstract

Recent publications have argued that there are potentially serious consequences for researchers in recognising distinct genera in the terminal fusarioid clade of the family Nectriaceae. Thus, an alternate hypothesis, namely a very broad concept of the genus Fusarium was proposed. In doing so, however, a significant body of data that supports distinct genera in Nectriaceae based on morphology, biology, and phylogeny is disregarded. A DNA phylogeny based on 19 orthologous protein-coding genes was presented to support a very broad concept of Fusarium at the F1 node in Nectriaceae. Here, we demonstrate that re-analyses of this dataset show that all 19 genes support the F3 node that represents Fusarium sensu stricto as defined by F. sambucinum (sexual morph synonym Gibberella pulicaris). The backbone of the phylogeny is resolved by the concatenated alignment, but only six of the 19 genes fully support the F1 node, representing the broad circumscription of Fusarium. Furthermore, a re-analysis of the concatenated dataset revealed alternate topologies in different phylogenetic algorithms, highlighting the deep divergence and unresolved placement of various Nectriaceae lineages proposed as members of Fusarium. Species of Fusarium s. str. are characterised by Gibberella sexual morphs, asexual morphs with thin- or thick-walled macroconidia that have variously shaped apical and basal cells, and trichothecene mycotoxin production, which separates them from other fusarioid genera. Here we show that the Wollenweber concept of Fusarium presently accounts for 20 segregate genera with clear-cut synapomorphic traits, and that fusarioid macroconidia represent a character that has been gained or lost multiple times throughout Nectriaceae. Thus, the very broad circumscription of Fusarium is blurry and without apparent synapomorphies, and does not include all genera with fusarium-like macroconidia, which are spread throughout Nectriaceae (e.g., Cosmosporella, Macroconia, Microcera). In this study four new genera are introduced, along with 18 new species and 16 new combinations. These names convey information about relationships, morphology, and ecological preference that would otherwise be lost in a broader definition of Fusarium. To assist users to correctly identify fusarioid genera and species, we introduce a new online identification database, Fusarioid-ID, accessible at www.fusarium.org. The database comprises partial sequences from multiple genes commonly used to identify fusarioid taxa (act1, CaM, his3, rpb1, rpb2, tef1, tub2, ITS, and LSU). In this paper, we also present a nomenclator of names that have been introduced in Fusarium up to January 2021 as well as their current status, types, and diagnostic DNA barcode data. In this study, researchers from 46 countries, representing taxonomists, plant pathologists, medical mycologists, quarantine officials, regulatory agencies, and students, strongly support the application and use of a more precisely delimited Fusarium (= Gibberella) concept to accommodate taxa from the robust monophyletic node F3 on the basis of a well-defined and unique combination of morphological and biochemical features. This F3 node includes, among others, species of the F. fujikuroi, F. incarnatum-equiseti, F. oxysporum, and F. sambucinum species complexes, but not species of Bisifusarium [F. dimerum species complex (SC)], Cyanonectria (F. buxicola SC), Geejayessia (F. staphyleae SC), Neocosmospora (F. solani SC) or Rectifusarium (F. ventricosum SC). The present study represents the first step to generating a new online monograph of Fusarium and allied fusarioid genera (www.fusarium.org).

Full text

Fusarium: more than a node or a foot-shaped basal cell
P.W. Crous
1
,
2
, L. Lombard
1*
, M. Sandoval-Denis
1
,
3*
, K.A. Seifert
4
, H.-J. Schroers
5
, P. Chaverri
6
,
7
, J. Gen
e
8
, J. Guarro
8
, Y. Hirooka
9
,
K. Bensch
1
, G.H.J. Kema
2
, S.C. Lamprecht
10
, L. Cai
11
,
12
, A.Y. Rossman
13
, M. Stadler
14
, R.C. Summerbell
15
,
16
, J.W. Taylor
17
,
S. Ploch
18
, C.M. Visagie
19
, N. Yilmaz
19
, J.C. Frisvad
20
, A.M. Abdel-Azeem
21
, J. Abdollahzadeh
22
, A. Abdolrasouli
23
,
24
, A. Akulov
25
,
J.F. Alberts
26
, J.P.M. Araújo
27
, H.A. Ariyawansa
28
, M. Bakhshi
29
, M. Bendiksby
30
,
31
, A. Ben Hadj Amor
1
, J.D.P. Bezerra
32
, T. Boekhout
1
,
M.P.S. C^
amara
33
, M. Carbia
34
, G. Cardinali
35
, R.F. Casta~
neda-Ruiz
36
, A. Celis
37
, V. Chaturvedi
38
, J. Collemare
1
, D. Croll
39
,
U. Damm
40
, C.A. Decock
41
, R.P. de Vries
1
, C.N. Ezekiel
42
, X.L. Fan
43
, N.B. Fern
andez
44
,
45
, E. Gaya
46
, C.D. Gonz
alez
47
, D. Gramaje
48
,
J.Z. Groenewald
1
, M. Grube
49
, M. Guevara-Suarez
50
, V.K. Gupta
51
,
52
, V. Guarnaccia
53
, A. Haddaji
54
, F. Hagen
1
, D. Haelewaters
55
,
56
,
K. Hansen
57
, A. Hashimoto
58
, M. Hern
andez-Restrepo
1
, J. Houbraken
1
, V. Hubka
59
, K.D. Hyde
60
, T. Iturriaga
61
, R. Jeewon
62
,
P.R. Johnston
63
,
Z. Jurjevi
c
64
,_
I. Karalti
65
, L. Korsten
66
, E.E. Kuramae
3
,
67
,I.Ku

san
68
, R. Labuda
69
, D.P. Lawrence
70
, H.B. Lee
71
,
C. Lechat
72
, H.Y. Li
73
, Y.A. Litovka
74
,
75
, S.S.N. Maharachchikumbura
76
, Y. Marin-Felix
14
, B. Matio Kemkuignou
14
, N. Mato
cec
68
,
A.R. McTaggart
77
,P.Ml

coch
78
, L. Mugnai
79
, C. Nakashima
80
, R.H. Nilsson
81
, S.R. Noumeur
82
, I.N. Pavlov
74
,
75
, M.P. Peralta
83
,
A.J.L. Phillips
84
, J.I. Pitt
85
, G. Polizzi
86
, W. Quaedvlieg
87
, K.C. Rajeshkumar
88
, S. Restrepo
89
, A. Rhaiem
90
, J. Robert
54
, V. Robert
1
,
A.M. Rodrigues
91
, C. Salgado-Salazar
92
, R.A. Samson
1
, A.C.S. Santos
93
, R.G. Shivas
94
, C.M. Souza-Motta
93
, G.Y. Sun
95
,
W.J. Swart
96
, S. Szoke
54
,Y.P.Tan
94
,
97
, J.E. Taylor
98
, P.W.J. Taylor
99
, P.V. Tiago
93
, K.Z. V
aczy
100
, N. van de Wiele
54
,
N.A. van der Merwe
19
, G.J.M. Verkley
1
, W.A.S. Vieira
33
, A. Vizzini
101
, B.S. Weir
63
, N.N. Wijayawardene
102
, J.W. Xia
103
,
M.J. Y
a~
nez-Morales
104
, A. Yurkov
105
, J.C. Zamora
106
, R. Zare
29
, C.L. Zhang
107
, and M. Thines
18
,
108
,
109
1
Westerdijk Fungal Biodiversity Institute, 3508 AD, Utrecht, the Netherlands;
2
Wageningen University and Research Centre (WUR), Laboratory of Phytopathology,
Droevendaalsesteeg 1, 6708 PB, Wageningen, the Netherlands;
3
Netherlands Institute of Ecology (NIOO-KNAW), Department of Microbial Ecology,
Droevendaalsesteeg 10, 6708 PB, Wageningen, the Netherlands;
4
Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, Ontario, K1S 5B6,
Canada;
5
Plant Protection Department, Agricultural Institute of Slovenia, Hacquetova ulica 17, 1000, Ljubljana, Slovenia;
6
Department of Plant Science and
Landscape Architecture, University of Maryland, College Park, MD, USA;
7
Escuela de Biología and Centro de Investigaciones en Productos Naturales, Universidad
de Costa Rica, San Pedro, Costa Rica;
8
Unitat de Micologia, Facultat de Medicina i Ci
encies de la Salut i Institut d’Investigaci
o Sanit
aria Pere Virgili (IISPV),
Universitat Rovira i Virgili, 43201, Reus, Spain;
9
Department of Clinical Plant Science, Faculty of Bioscience, Hosei University, 3-7-2 Kajino-cho, Koganei, Tokyo,
184-8584, Japan;
10
ARC-Plant Health and Protection, Private Bag X5017, Stellenbosch, 7599, Western Cape, South Africa;
11
State Key Laboratory of Mycology,
Institute of Microbiology, Chinese Academy of Sciences, Beijing, 100101, China;
12
University of Chinese Academy of Sciences, Beijing, 100049, China;
13
Department of Botany & Plant Pathology, Oregon State University, Corvallis, OR, 97330, USA;
14
Department of Microbial Drugs, Helmholtz Centre for Infection
Research GmbH (HZI), Inhoffenstrasse 7, 38124 Braunschweig, Germany;
15
Sporometrics, Toronto, ON, Canada;
16
Dalla Lana School of Public Health, University
of Toronto, Toronto, ON, Canada;
17
Plant and Microbial Biology, 111 Koshland Hall, University of California, Berkeley, CA, 94720-3102, USA;
18
Senckenberg
Biodiversity and Climate Research Center, Senckenberganlage 25, D-60325, Frankfurt am Main, Germany;
19
Department of Biochemistry, Genetics and
Microbiology, Forestry and Agricultural Biotechnology Institute (FABI), Faculty of Natural and Agricultural Sciences, University of Pretoria, P. Bag X20, Hatfield,
0028, Pretoria, South Africa;
20
Department of Biotechnology and Biomedicine, DTU-Bioengineering, Technical University of Denmark, 2800, Kongens Lyngby,
Denmark;
21
Systematic Mycology Lab., Botany and Microbiology Department, Faculty of Science, Suez Canal University, Ismailia, 41522, Egypt;
22
Department of
Plant Protection, Faculty of Agriculture, University of Kurdistan, P.O. Box 416, Sanandaj, Iran;
23
Department of Medical Microbiology, King's College Hospital,
London, UK;
24
Department of Infectious Diseases, Imperial College London, London, UK;
25
Department of Mycology and Plant Resistance, V. N. Karazin Kharkiv
National University, Maidan Svobody 4, 61022, Kharkiv, Ukraine;
26
Department of Food Science and Technology, Cape Peninsula University of Technology, P.O.
Box 1906, Bellville, 7535, South Africa;
27
School of Forest Resources and Conservation, University of Florida, Gainesville, FL, USA;
28
Department of Plant
Pathology and Microbiology, College of Bio-Resources and Agriculture, National Taiwan University, No.1, Sec.4, Roosevelt Road, Taipei, 106, Taiwan, ROC;
29
Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (AREEO), P.O. Box 19395-1454, Tehran, Iran;
30
Natural History Museum, University of Oslo, Norway;
31
Department of Natural History, NTNU University Museum, Trondheim, Norway;
32
Setor de Micologia/
Departamento de Bioci^
encias e Tecnologia, Instituto de Patologia Tropical e Saúde Pública, Rua 235 - s/n –Setor Universit
ario - CEP: 74605-050, Universidade
Federal de Goi
as/Federal University of Goi
as, Goi^
ania, Brazil;
33
Departamento de Agronomia, Universidade Federal Rural de Pernambuco, Recife, 52171-900, PE,
Brazil;
34
Departamento de Parasitología y Micología, Instituto de Higiene, Facultad de Medicina –Universidad de la República, Av. A. Navarro 3051, Montevideo,
Uruguay;
35
Department of Pharmaceutical Science, University of Perugia, Via Borgo 20 Giugno, 74 Perugia, Italy;
36
Instituto de Investigaciones Fundamentales en
Agricultura Tropical Alejandro de Humboldt (INIFAT), Acad
emico Titular de la Academia de Ciencias de, Cuba;
37
Grupo de Investigaci
on Celular y Molecular de
Microorganismos Pat
ogenos (CeMoP), Departamento de Ciencias Biol
ogicas, Universidad de Los Andes, Bogot
a, 111711, Colombia;
38
Mycology Laboratory, New
York State Department of Health Wadsworth Center, Albany, NY, USA;
39
Laboratory of Evolutionary Genetics, Institute of Biology, University of Neuchatel, CH-2000,
Neuchatel, Switzerland;
40
Senckenberg Museum of Natural History Görlitz, PF 300 154, 02806, Görlitz, Germany;
41
Mycoth
eque de l'Universit
e catholique de
Louvain (MUCL, BCCMTM), Earth and Life Institute –ELIM –Mycology, Universit
e catholique de Louvain, Croix du Sud 2 bte L7.05.06, B-1348, Louvain-la-
Neuve, Belgium;
42
Department of Microbiology, Babcock University, Ilishan Remo, Ogun State, Nigeria;
43
The Key Laboratory for Silviculture and Conservation of
Ministry of Education, Beijing Forestry University, Beijing, 100083, China;
44
Laboratorio de Micología Clínica, Hospital de Clínicas, Universidad de Buenos Aires,
Buenos Aires, Argentina;
45
Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Buenos Aires, Argentina;
46
Royal Botanic Gardens, Kew, Richmond,
Surrey, TW9 3DS, UK;
47
Laboratorio de Salud de Bosques y Ecosistemas, Instituto de Conservaci
on, Biodiversidad y Territorio, Facultad de Ciencias Forestales y
Recursos Naturales, Universidad Austral de Chile, casilla 567, Valdivia, Chile;
48
Institute of Grapevine and Wine Sciences (ICVV), Spanish National Research
Council (CSIC)-University of La Rioja-Government of La Rioja, Logro~
no, 26007, Spain;
49
Institut für Biologie, Karl-Franzens-Universit€
at Graz, Holteigasse 6, 8010,
Graz, Austria;
50
Applied genomics research group, Universidad de los Andes, Cr 1 # 18 a 12, Bogot
a, Colombia;
51
Center for Safe and Improved Food, Scotland's
Rural College (SRUC), Kings Buildings, West Mains Road, Edinburgh, EH9 3JG, UK;
52
Biorefining and Advanced Materials Research Center, Scotland's Rural
College (SRUC), Kings Buildings, West Mains Road, Edinburgh, EH9 3JG, UK;
53
Department of Agricultural, Forestry and Food Sciences (DISAFA), University of
Torino, Largo P. Braccini 2, 10095, Grugliasco, TO, Italy;
54
BioAware, Hannut, Belgium;
55
Research Group Mycology, Department of Biology, Ghent University, 35
K.L. Ledeganckstraat, 9000, Ghent, Belgium;
56
Faculty of Science, University of South Bohemia, Brani
sovsk
a 31, 370 05,

Cesk
e Bud
ejovice, Czech Republic;
57
Department of Botany, Swedish Museum of Natural History, P.O. Box 50007, SE-104 05, Stockholm, Sweden;
58
Microbe Division/Japan Collection of
Microorganisms RIKEN BioResource Research Center, 3-1-1 Koyadai, Tsukuba, Ibaraki, 305-0074, Japan;
59
Department of Botany, Charles University in Prague,
Peer review under responsibility of Westerdijk Fungal Biodiversity Institute.
© 2021 Westerdijk Fungal Biodiversity Institute. Production and hosting by ELSEVIER B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
available online at www.studiesinmycology.org STUDIES IN MYCOLOGY 98: 100116 (2021).
1
Studies in Mycology

Prague, Czech Republic;
60
Center of Excellence in Fungal Research, Mae Fah Luang University, Chaing Rai, 57100, Thailand;
61
Cornell University, 334 Plant Science
Building, Ithaca, NY, 14850, USA;
62
Department of Health Sciences, Faculty of Medicine and Health Sciences, University of Mauritius, Reduit, Mauritius;
63
Manaaki
Whenua Landcare Research, Private Bag 92170, Auckland, 1142, New Zealand;
64
EMSL Analytical, Inc., 200 Route 130 North, Cinnaminson, NJ, 08077, USA;
65
Department of Nutrition and Dietetics, Faculty of Health Sciences, Yeditepe University, Turkey;
66
Department of Plant and Soil Sciences, University of Pretoria, P.
Bag X20 Hatfield, Pretoria, 0002, South Africa;
67
Institute of Environmental Biology, Ecology and Biodiversity, Utrecht University, 3584 CH, Utrecht, the Netherlands;
68
Laboratory for Biological Diversity, Ru
C
er Bo
skovi
c Institute, Bijeni
cka cesta 54, HR-10000, Zagreb, Croatia;
69
University of Veterinary Medicine, Vienna (VetMed),
Institute of Food Safety, Food Technology and Veterinary Public Health, Veterinaerplatz 1, 1210 Vienna and BiMM –Bioactive Microbial Metabolites group, 3430
Tulln a.d. Donau, Austria;
70
University of California, Davis, One Shields Ave., Davis, CA, 95616, USA;
71
Department of Agricultural Biological Chemistry, College of
Agriculture & Life Sciences, Chonnam National University, Yongbong-Dong 300, Buk-Gu, Gwangju, 61186, South Korea;
72
Ascofrance, 64 route de Chiz
e, 79360,
Villiers-en-Bois, France;
73
The Key Laboratory of Molecular Biology of Crop Pathogens and Insects of Ministry of Agriculture, The Key Laboratory of Biology of
Crop Pathogens and Insects of Zhejiang Province, Institute of Biotechnology, Zhejiang University, 866 Yuhangtang Road, Hangzhou, 310058, China;
74
V.N.
Sukachev Institute of Forest SB RAS, Laboratory of Reforestation, Mycology and Plant Pathology, Krasnoyarsk, 660036, Russia;
75
Reshetnev Siberian State
University of Science and Technology, Department of Chemical Technology of Wood and Biotechnology, Krasnoyarsk, 660037, Russia;
76
School of Life Science and
Technology, University of Electronic Science and Technology of China, Chengdu, 611731, China;
77
Queensland Alliance for Agriculture and Food Innovation, The
University of Queensland, Ecosciences Precinct, G.P.O. Box 267, Brisbane, 4001, Australia;
78
Department of Botany, Faculty of Science, Palacký University
Olomouc,

Slechtitelů27, CZ-783 71, Olomouc, Czech Republic;
79
Department of Agricultural, Food, Environmental and Forestry Science and Technology (DAGRI),
Plant Pathology and Entomology section, University of Florence, P.le delle Cascine 28, 50144, Firenze, Italy;
80
Graduate school of Bioresources, Mie University,
Kurima-machiya 1577, Tsu, Mie, 514-8507, Japan;
81
Gothenburg Global Biodiversity Center at the Department of Biological and Environmental Sciences, University
of Gothenburg, Box 461, 405 30, Gothenburg, Sweden;
82
Department of Microbiology and Biochemistry, Faculty of Natural and Life Sciences, University of Batna
2, Batna, 05000, Algeria;
83
Laboratorio de Micodiversidad y Micoprospecci
on, PROIMI-CONICET, Av. Belgrano y Pje. Caseros, Argentina;
84
Universidade de
Lisboa, Faculdade de Ci^
encias, Biosystems and Integrative Sciences Institute (BioISI), Campo Grande, 1749-016, Lisbon, Portugal;
85
Microbial Screening
Technologies, 28 Percival Rd, Smithfield, NSW, 2164, Australia;
86
Dipartimento di Agricoltura, Alimentazione e Ambiente, sez. Patologia vegetale, University of
Catania, Via S. Sofia 100, 95123 Catania, Italy;
87
Phytopathology, Van Zanten Breeding B.V., Lavendelweg 15, 1435 EW, Rijsenhout, the Netherlands;
88
National
Fungal Culture Collection of India (NFCCI), Biodiversity and Palaeobiology (Fungi) Group, Agharkar Research Institute, Pune, Maharashtra, 411 004, India;
89
Laboratory of Mycology and Phytopathology –(LAMFU), Department of Chemical and Food Engineering, Universidad de los Andes, Cr 1 # 18 a 12, Bogot
a,
Colombia;
90
Plant Pathology and Population Genetics, Laboratory of Microorganisms, National Gene Bank, Tunisia;
91
Laboratory of Emerging Fungal Pathogens,
Department of Microbiology, Immunology, and Parasitology, Discipline of Cellular Biology, Federal University of S~
ao Paulo (UNIFESP), S~
ao Paulo, 04023062, Brazil;
92
USDA-ARS Mycology & Nematology Genetic Diversity & Biology Laboratory, Bldg. 010A, Rm. 212, BARC-West, 10300 Baltimore Ave, Beltsville, MD, 20705,
USA;
93
Departamento de Micologia Prof. Chaves Batista, Universidade Federal de Pernambuco, Centro de Bioci^
encias, Cidade Universit
aria, Av. Prof. Moraes
Rego, s/n, Recife, PE, CEP: 50670-901, Brazil;
94
Centre for Crop Health, University of Southern Queensland, Toowoomba, 4350, Queensland, Australia;
95
College
of Plant Protection, Northwest A&F University, Yangling, Shaanxi, China;
96
Faculty of Natural and Agricultural Sciences, Department of Plant Sciences, University of
the Free State, P.O. Box 339, Bloemfontein, 9300, South Africa;
97
Queensland Plant Pathology Herbarium, Department of Agriculture and Fisheries, Dutton Park,
Queensland, 4102, Australia;
98
Royal Botanic Garden Edinburgh, 20A Inverleith Row, Edinburgh, EH3 5LR, United Kingdom;
99
Faculty of Veterinary and Agricultural
Sciences, The University of Melbourne, Parkville, VIC, 3010, Australia;
100
Food and Wine Research Institute, Eszterh
azy K
aroly University, 6 Le
anyka Street, H-
3300, Eger, Hungary;
101
Department of Life Sciences and Systems Biology, University of Torino and Institute for Sustainable Plant Protection (IPSP-SS Turin),
C.N.R, Viale P.A. Mattioli, 25, I-10125, Torino, Italy;
102
Center for Yunnan Plateau Biological Resources Protection and Utilization, College of Biological Resource
and Food Engineering, Qujing Normal University, Qujing, Yunnan, 655011, China;
103
Shandong Provincial Key Laboratory for Biology of Vegetable Diseases and
Insect Pests, College of Plant Protection, Shandong Agricultural University, Taian, 271018, China;
104
Fitosanidad, Colegio de Postgraduados-Campus Montecillo,
Montecillo-Texcoco, 56230 Edo. de Mexico, Mexico;
105
Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures GmbH, Inhoffenstrasse 7 B,
38124, Braunschweig, Germany;
106
Museum of Evolution, Uppsala University, Norbyv€
agen 16, SE-752 36, Uppsala, Sweden;
107
Ministry of Agriculture Key
Laboratory of Molecular Biology of Crop Pathogens and Insects, Institute of Biotechnology, College of Agriculture and Biotechnology, Zhejiang University, No. 866
Yuhangtang Road, Hangzhou, 310058, China;
108
Goethe-University Frankfurt am Main, Department of Biological Sciences, Institute of Ecology, Evolution and
Diversity, Max-von-Laue Str. 13, D-60438, Frankfurt am Main, Germany;
109
LOEWE Centre for Translational Biodiversity Genomics, Georg-Voigt-Str. 14-16, D-
60325, Frankfurt am Main, Germany
*Correspondence: L. Lombard,
l.lombard@wi.knaw.nl
; M. Sandoval-Denis,
m.sandoval@wi.knaw.nl
Abstract: Recent publications have argued that there are potentially serious consequences for researchers in recognising distinct genera in the terminal fusarioid clade
of the family Nectriaceae. Thus, an alternate hypothesis, namely a very broad concept of the genus Fusarium was proposed. In doing so, however, a significant body of
data that supports distinct genera in Nectriaceae based on morphology, biology, and phylogeny is disregarded. A DNA phylogeny based on 19 orthologous protein-coding
genes was presented to support a very broad concept of Fusarium at the F1 node in Nectriaceae. Here, we demonstrate that re-analyses of this dataset show that all 19
genes support the F3 node that represents Fusarium sensu stricto as defined by F. sambucinum (sexual morph synonym Gibberella pulicaris). The backbone of the
phylogeny is resolved by the concatenated alignment, but only six of the 19 genes fully support the F1 node, representing the broad circumscription of Fusarium.
Furthermore, a re-analysis of the concatenated dataset revealed alternate topologies in different phylogenetic algorithms, highlighting the deep divergence and unre-
solved placement of various Nectriaceae lineages proposed as members of Fusarium. Species of Fusarium s. str. are characterised by Gibberella sexual morphs,
asexual morphs with thin- or thick-walled macroconidia that have variously shaped apical and basal cells, and trichothecene mycotoxin production, which separates them
from other fusarioid genera. Here we show that the Wollenweber concept of Fusarium presently accounts for 20 segregate genera with clear-cut synapomorphic traits,
and that fusarioid macroconidia represent a character that has been gained or lost multiple times throughout Nectriaceae. Thus, the very broad circumscription of
Fusarium is blurry and without apparent synapomorphies, and does not include all genera with fusarium-like macroconidia, which are spread throughout Nectriaceae
(e.g.,Cosmosporella,Macroconia,Microcera). In this study four new genera are introduced, along with 18 new species and 16 new combinations. These names convey
information about relationships, morphology, and ecological preference that would otherwise be lost in a broader definition of Fusarium. To assist users to correctly
identify fusarioid genera and species, we introduce a new online identification database, Fusarioid-ID, accessible at www.fusarium.org. The database comprises partial
sequences from multiple genes commonly used to identify fusarioid taxa (act1,CaM,his3,rpb1,rpb2,tef1,tub2, ITS, and LSU). In this paper, we also present a
nomenclator of names that have been introduced in Fusarium up to January 2021 as well as their current status, types, and diagnostic DNA barcode data. In this study,
researchers from 46 countries, representing taxonomists, plant pathologists, medical mycologists, quarantine officials, regulatory agencies, and students, strongly support
the application and use of a more precisely delimited Fusarium (= Gibberella) concept to accommodate taxa from the robust monophyletic node F3 on the basis of a well-
defined and unique combination of morphological and biochemical features. This F3 node includes, among others, species of the F. fujikuroi, F. incarnatum-equiseti, F.
oxysporum, and F. sambucinum species complexes, but not species of Bisifusarium [F. dimerum species complex (SC)], Cyanonectria (F. buxicola SC), Geejayessia
(F. staphyleae SC), Neocosmospora (F. solani SC) or Rectifusarium (F. ventricosum SC). The present study represents the first step to generating a new online
monograph of Fusarium and allied fusarioid genera (www.fusarium.org).
Key words: Multi-gene phylogeny, Mycotoxins, Nectriaceae,Neocosmospora, Novel taxa, Pathogen, Taxonomy.
CROUS ET AL.
2

Taxonomic novelties: New genera: Luteonectria Sand.-Den., L. Lombard, Schroers & Rossman, Nothofusarium Crous, Sand.-Den. & L. Lombard, Scolecofusarium L.
Lombard, Sand.-Den. & Crous, Setofusarium (Nirenberg & Samuels) Crous & Sand.-Den.; New species: Fusarium echinatum Sand.-Den. & G.J. Marais, Fusarium
lyarnte J.L. Walsh, Sangal., L.W. Burgess, E.C.Y. Liew & Summerell, Fusarium palustre W.H. Elmer & Marra, Fusarium prieskaense G.J. Marais & Sand.-Den.,
Fusarium werrikimbe J.L. Walsh, L.W. Burgess, E.C.Y. Liew & B.A. Summerell, Fusicolla quarantenae J.D.P. Bezerra, Sand.-Den., Crous & Souza-Motta, Fusicolla
meniscoidea L. Lombard & Sand.-Den., Fusicolla sporellula Sand.-Den. & L. Lombard, Macroconia bulbipes Crous & Sand.-Den., Macroconia phlogioides Sand.-
Den. & Crous, Neocosmospora epipeda Quaedvl. & Sand.-Den., Neocosmospora merkxiana Quaedvl. & Sand.-Den., Neocosmospora neerlandica Crous & Sand.-
Den., Neocosmospora nelsonii Crous & Sand.-Den., Neocosmospora pseudopisi Sand.-Den. & L. Lombard, Nothofusarium devonianum L. Lombard, Crous &
Sand.-Den., Stylonectria corniculata Gr€
afenhan, Crous & Sand.-Den., Stylonectria hetmanica Akulov, Crous & Sand.-Den.; New combinations: Apiognomonia
platani (L
ev.) L. Lombard, Calloria tremelloides (Grev.) L. Lombard, Cosmosporella cavisperma (Corda) Sand.-Den., L. Lombard & Crous, Cylindrodendrum
orthosporum (Sacc. & P. Syd.) L. Lombard, Dialonectria volutella (Ellis & Everh.) L. Lombard & Sand.-Den., Fusarium armeniacum (G.A. Forbes et al.) L.W.
Burgess & Summerell, Hymenella aurea (Corda) L. Lombard, Hymenella spermogoniopsis (Jul. Müll.) L. Lombard & Sand.-Den., Luteonectria albida (Rossman)
Sand.-Den. & L. Lombard, Luteonectria nematophila (Nirenberg & Hagedorn) Sand.-Den. & L. Lombard, Neocosmospora floridana (T. Aoki et al.) L. Lombard &
Sand.-Den., Neocosmospora obliquiseptata (T. Aoki et al.) L. Lombard & Sand.-Den., Neocosmospora rekana (Lynn & Marinc.) L. Lombard & Sand.-Den.,
Neocosmospora tuaranensis (T. Aoki et al.) L. Lombard & Sand.-Den., Scolecofusarium ciliatum (Link) L. Lombard, Sand.-Den. & Crous, Setofusarium setosum
(Samuels & Nirenberg) Sand.-Den. & Crous.; Epitypes (basionyms): Fusarium buharicum Jacz. ex Babajan & Teterevn.-Babajan, Fusarium cavispermum Corda,
Fusarium flocciferum Corda, Fusarium graminearum Schwabe, Fusarium heterosporum Nees & T. Nees, Fusarium redolens Wollenw., Fusarium reticulatum Mont.,
Fusarium scirpi Lambotte & Fautrey, Fusarium stilboides Wollenw., Fusarium xylarioides Steyaert, Fusisporium culmorum Wm.G. Sm., Fusisporium incarnatum
Roberge ex Desm., Selenosporium equiseti Corda, Sphaeria sanguinea var. cicatricum Berk., Sporotrichum poae Peck.; Lectotypes (basionyms): Atractium
pallidum Bonord., Cephalosporium sacchari E.J. Butler, Fusarium aeruginosum Delacr., Fusarium agaricorum Sarrazin, Fusarium albidoviolaceum Dasz., Fusarium
aleyrodis Petch, Fusarium amentorum Lacroix, Fusarium annuum Leonian, Fusarium arcuatum Berk. & M.A. Curtis, Fusarium aridum O.A. Pratt, Fusarium
arthrosporioides Sherb., Fusarium asparagi Delacr., Fusarium batatas Wollenw., Fusarium biforme Sherb., Fusarium cactacearum Pasin. & Buzz.-Trav., Fusarium
cacti-maxonii Pasin. & Buzz.-Trav., Fusarium caudatum Wollenw., Fusarium cavispermum Corda, Fusarium cepae Hanzawa, Fusarium cesatii Rabenh., Fusarium
citriforme Jamal., Fusarium citrinum Wollenw., Fusarium citrulli Taubenh., Fusarium clavatum Sherb., Fusarium coccinellum Kalchbr., Fusarium cromyophthoron
Sideris, Fusarium cucurbitae Taubenh., Fusarium cuneiforme Sherb., Fusarium delacroixii Sacc., Fusarium dimerum var. nectrioides Wollenw., Fusarium epicoccum
McAlpine, Fusarium eucheliae Sartory, R. Sartory & J. Mey., Fusarium fissum Peyl, Fusarium flocciferum Corda, Fusarium gemmiperda Aderh., Fusarium
genevense Dasz., Fusarium graminearum Schwabe, Fusarium graminum Corda, Fusarium heterosporioides Fautrey, Fusarium heterosporum Nees & T. Nees,
Fusarium idahoanum O.A. Pratt, Fusarium juruanum Henn., Fusarium lanceolatum O.A. Pratt, Fusarium lateritium Nees, Fusarium loncheceras Sideris, Fusarium
malvacearum Taubenh., Fusarium martii f. phaseoli Burkh., Fusarium muentzii Delacr., Fusarium nigrum O.A. Pratt, Fusarium oxysporum var. asclerotium Sherb.,
Fusarium palczewskii Jacz., Fusarium polymorphum Matr., Fusarium poolense Taubenh., Fusarium prunorum McAlpine, Fusarium pusillum Wollenw., Fusarium
putrefaciens Osterw., Fusarium redolens Wollenw., Fusarium reticulatum Mont., Fusarium rhizochromatistes Sideris, Fusarium rhizophilum Corda, Fusarium
rhodellum McAlpine, Fusarium roesleri Thüm., Fusarium rostratum Appel & Wollenw., Fusarium rubiginosum Appel & Wollenw., Fusarium rubrum Parav., Fusarium
samoense Gehrm., Fusarium scirpi Lambotte & Fautrey, Fusarium secalis Jacz., Fusarium spinaciae Hungerf., Fusarium sporotrichioides Sherb., Fusarium stercoris
Fuckel, Fusarium stilboides Wollenw., Fusarium stillatum De Not. ex Sacc., Fusarium sublunatum Reinking, Fusarium succisae Schröt. ex Sacc., Fusarium
tabacivorum Delacr., Fusarium trichothecioides Wollenw., Fusarium tritici Liebman, Fusarium tuberivorum Wilcox & G.K. Link, Fusarium tumidum var. humi Reinking,
Fusarium ustilaginis Kellerm. & Swingle, Fusarium viticola Thüm., Fusarium willkommii Lindau, Fusarium xylarioides Steyaert, Fusarium zygopetali Delacr.,
Fusisporium andropogonis Cooke ex Thüm., Fusisporium anthophilum A. Braun, Fusisporium arundinis Corda, Fusisporium clypeaster Corda, Fusisporium
culmorum Wm.G. Sm., Fusisporium didymum Harting, Fusisporium elasticae Thüm., Fusisporium episphaericum Cooke & Ellis, Fusisporium flavidum Bonord.,
Fusisporium hordei Wm.G. Sm., Fusisporium incarnatum Roberge ex Desm., Fusisporium lolii Wm.G. Sm., Fusisporium pandani Corda, Gibberella
phyllostachydicola W. Yamam., Menispora penicillata Harz, Selenosporium equiseti Corda, Selenosporium hippocastani Corda, Selenosporium urticearum Corda.,
Sphaeria sanguinea var. cicatricum Berk.; Neotypes (basionyms): Atractium ciliatum Link, Fusarium longipes Wollenw. & Reinking, Fusisporium avenaceum Fr.,
Selenosporium sarcochroum Desm.
Published online xxx; https://doi.org/10.1016/j.simyco.2021.100116.
INTRODUCTION
The relevance and impact of Fusarium (Ascomycota,Hypo-
creales,Nectriaceae) to humankind is substantial. Over the past
100 years, it has attracted considerable attention from scientists
as the extent of species diversity and the impact on agriculture
and human health became clear. After an initial period of dis-
covery and cataloguing by 19
th
century naturalists, its taxonomy
became the target of research from a broad range of scientists,
that resulted in the emergence of distinct “schools”that promoted
different taxonomic approaches to fusarium-like organisms. With
the advent of an objective and reproducible framework for
phylogenetic relationships inferred from molecular phylogenetics,
it might have been expected that controversies would melt away,
and a stable, universally accepted taxonomy of Fusarium and its
species would emerge, but this does not yet appear to be the
case (Fig. 1). However, all scientists working with Fusarium
desire a stable taxonomic system, and all agree that taxonomic
changes should be made with the aim of promoting stability.
Recently, Geiser et al. (2021), largely in response to papers
published by Gr€
afenhan et al. (2011),Schroers et al. (2011),
Lombard et al. (2015), and Sandoval-Denis et al. (2019), pro-
posed a cladistic solution to redelimit a generic concept for
Fusarium. The generic treatment of Fusarium by Geiser et al.
(2013,2021), produced an ill-delimited genus without clear
synapomorphies, as fusarium-like macroconidia are strongly
polyphyletic within Nectriaceae and also occur outside their very
broadly circumscribed Fusarium concept. We argue that a nar-
rower concept of genera with a clear, unique combination of
features is needed for the majority of fusarioid species.
Dual nomenclature and consensus on the use
of the generic name Fusarium
In accordance with the single-name system for fungi, that was
adopted at the International Botanical Congress, Melbourne
(IBCM) in 2011, we are in full agreement with Geiser et al. (2013,
2021) and O'Donnell et al. (2020) that the name Fusarium ap-
plies to any genus with a delimitation that includes the conserved
lectotype of the type species, F. sambucinum (sexual morph
synonym Gibberella pulicaris), as stated by Rossman et al.
(2013). Unfortunately, a single joint paper explaining the choice
of this name supported by the entire Fusarium community was
planned but failed because of the insistence of a subset of au-
thors to adopt a broad generic concept.
FUSARIUM REDELIMITED
www.studiesinmycology.org 3

Taxonomy and nomenclature are different concepts, although
they are frequently confused, leading to misinterpretations.
Support for dual nomenclature ended at the IBCM in August
2011. The significance of 1 January 2013 was to ensure the
formal nomenclatural validity of newly proposed dual names
(new species or new combinations) that were in press or part of
studies about to be submitted for publication. These dates have
no significance for names proposed in a single name system,
which can be done at any time. Despite these technicalities,
virtually all members of the Fusarium community accept that
Fusarium must be used over the sexually-typified name Gib-
berella in the single name system, a recommendation included in
the proposed list of Protected Names submitted to the Nomen-
clature Committee for Fungi, the body with the authority to
recommend its formal acceptance (Kirk et al. 2013). However,
statements in Geiser et al. (2013) seem to reflect a confusion
about how the nomenclatural decision affected taxonomic
concepts.
The name Fusarium has never been at risk during the
nomenclatural transition, and the community support for its use in
a single name system is unanimous. We fully agree with Geiser
et al. (2013,2021) and Rossman et al. (2013) that Fusarium
equals Gibberella.Fusarium will always be applied to the clade
that includes the type species of Fusarium, F. sambucinum,
which is the same fungus that also typifies Gibberella. In this
study, we show that the clade defined as Fusarium s. str.
(O'Donnell et al. 2013,as Gibberella; Geiser et al. 2013,as
Clade B) combines monophyly, morphology of sexual and
asexual morphs, and biochemical data in a coherent way that
can logically be recognised at the generic rank. Expanding the
concept of Fusarium to node F1 sensu Geiser et al. (2013,2021)
results in the combination of several distinct genera and does not
resolve the issue of fusarium-like macroconidia in genera outside
their broad circumscription of Fusarium.
Phylogenetic structure and distribution of
fusarioid asexual morphs in Nectriaceae
(Hypocreales)
Gr€
afenhan et al. (2011) and Schroers et al. (2011) presented a
phylogenetic overview of selected Nectriaceae based on com-
bined analyses of two different genes, namely the commonly
employed and phylogenetically informative RNA polymerase II
second largest subunit (rpb2) and exon regions of the larger
subunit of ATP citrate lyase (acl1). The two papers were the first
to apply a single name system to fusarioid fungi (i.e., genera with
fusarium-like macroconidia), and were written along with others
(see Rossman & Seifert 2011) to promote discussions that
eventually led to changes to the International Code of Nomen-
clature for algae, fungi, and plants (ICNafp) (Turland et al. 2018).
The main focus of the Gr€
afenhan et al. (2011) paper was to
deal with extraneous elements that had long been included in
Fusarium. These fungi had distinct phenotypic characters, such
as thin, collapsing perithecial walls, slow growing agar colonies
lacking aerial mycelium, or sparsely septate macroconidia. Users
of the Gerlach & Nirenberg (1982) and Nelson et al. (1983)
identification manuals may be familiar with some of these spe-
cies, then called Fusarium aquaeductuum, F. coccophilum and
F. merismoides. There was evidence in the first papers on the
molecular phylogeny of Fusarium that these species did not
belong to Fusarium (e.g., see O'Donnell 1993). It was not until
Fig. 1. Timeline summarising important events in the taxonomy and nomenclature of Fusarium and related taxa.
CROUS ET AL.
4

the study by Gr€
afenhan et al. (2011) that other genera in the
family, such as members of the Cylindrocarpon generic complex
(Chaverri et al. 2011), Calonectria (Liu et al. 2020), Tubercularia
(Hirooka et al. 2012), and minor genera such as Mariannaea,
Pseudonectria, and Volutella (also see Lombard et al. 2015)
were adequately sampled to yield generic-level resolution.The
phylograms showed the division of fusarioid taxa into two large
groups, which Gr€
afenhan et al. (2011) called the Terminal
Fusarium Clade (abbreviated TFC by Geiser et al. 2013) and the
ill-delineated Basal Fusarium Clade (BFC) that contained several
of the genera noted above. A single-genus recognition for the
BFC was not feasible because of the great morphological, ge-
netic, and ecological divergence among the sampled species.
The BFC included seven genera, each with their monophyly
strongly supported and more or less ecologically coherent.
Species with fusarioid conidia were reclassified in the phyloge-
netically redefined but previously described genera Atractium,
Cosmospora,Dialonectria,Fusicolla,Macroconia,Microcera,
and Stylonectria (Gr€
afenhan et al. 2011,Schroers et al. 2011).
Geiser et al. (2013) accepted these segregate genera in the BFC
as distinct from the TFC, while correctly pointing out the
weak support values obtained for the phylogenetic backbone
of the tree. One consequence of the widespread occurrence of
macroconidia in the taxon sampling (fusarioid genera, cylin-
drocarpon-like genera, and Calonectria) was the suggestion that
especially the fusarioid macroconidium is a plesiomorphic
character (that is, an ancestral character) and had been lost in
some lineages in Nectriaceae (Gr€
afenhan et al. 2011).
The second paper by Schroers et al. (2011) recovered similar
phylogenies as Gr€
afenhan et al. (2011), but focused on the TFC,
supplementing this with a five-gene analysis of a particular
subclade within the TFC intended to delimit phylogenetic genera
and a few species. This demonstrated the monophyly of the
treated genera and resulted in the acceptance of the previously
described Cyanonectria (Samuels et al. 2009), as well as the
description of the genus Geejayessia. Again, Geiser et al. (2013)
correctly criticised the weakness of the backbone of the tree,
especially in the BFC. About 75 % of the phylogenetic signal in
the analysis came from one gene, rpb2.Schroers et al. (2011)
did not discuss the taxonomic fate of Neocosmospora (the
Fusarium solani species complex, FSSC), which was repre-
sented by only two species in their analysis, but was excluded
from Fusarium s. str.
The call for more genetic markers and even genome analysis
by Geiser et al. (2013), to better resolve the phylogenetic
backbone of the TFC was justified, but the increased number of
markers should have been matched by increased taxon sam-
pling of all known genera of Nectriaceae, as taxon sampling is
equally important for inferring robust and meaningful phylogenies
(Zwickl & Hillis 2002,Heath et al. 2008).
Lombard et al. (2015) greatly expanded both the number of
genetic markers and the taxon sampling in order to explore the
generic boundaries across the Nectriaceae, including all genera
known from culture and many genera for which no DNA data was
previously available. A 10-gene phylogeny was inferred including
all the markers previously used by Gr€
afenhan et al. (2011),
Schroers et al. (2011),Geiser et al. (2013), and O'Donnell et al.
(2013), plus nrDNA sequences and other markers of known
phylogenetic utility, namely actin (act1), beta-tubulin (tub2),
calmodulin (CaM), histone (his3), and the translation elongation
factor 1-α(tef1). From this, a phylogeny of the TFC overall
congruent to that presented by Gr€
afenhan et al. (2011) and
Geiser et al. (2013) was obtained. Importantly, the monophyly of
Albonectria, Cyanonectria, Geejayessia, Fusarium, and Neo-
cosmospora was reaffirmed and a few early diverging lineages
previously included in the TFC were segregated into new
fusarioid genera i.e., Bisifusarium (formerly the F. dimerum
species complex) and Rectifusarium (formerly the F. ventricosum
species complex) (Lombard et al. 2015).
After nearly a hundred years of quandary, a modern revision
was published for Neocosmospora (Sandoval-Denis et al. 2019),
In this study, many unnamed phylogenetic species were
morphologically characterised and given Latin binomials, while
old names were resurrected, epitypified, and linked to DNA
barcodes.
Two recent publications by O'Donnell et al. (2020) and Geiser
et al. (2021) argued for the broad Fusarium concept of Geiser
et al. (2013). Both papers present very similar phylogenetic
analyses, relying on 19 genes, including 12 newly sampled
markers, namely: cytochrome P450 reductase (cpr1), ATP-
dependent DNA helicase II (ku70), sphinganine palmitoyl
transferase subunit 2 (lcb2), DNA replication licensing factor
(mcm7), phosphoglycerate kinase (pgk1), topoisomerase (top1),
two subunits each of the DNA polymerase (dpa1 and dpe1), the
fatty acid synthase (fas1, fas2), alpha-tubulin (tub1), and tub2.
The previously employed marker his3 was not included, nor were
nrDNA markers. The results are in essence the same as those of
the previously published phylogenies, but with stronger support
for the backbone in the combined analyses (see Cummings &
Meyer 2005). Geiser et al. (2021) claimed that the F1 node
was supported by 12, and the F2 node by 14 of the individual
genes, but did not mention that all 19 genes supported the F3
node (Fusarium s. str. = the Gibberella clade).
In this study we re-investigated the Geiser et al. (2021)
dataset using several different high-resolution phylogenetic ap-
proaches, and we found that their evaluations of concordance
were based on an inadequate interpretation of Ultra-Fast boot-
strap results (only values 95 % are to be deemed significant,
see Minh et al. 2013,Hoang et al. 2018). In addition to the to-
pological incongruences among six genes (act1,CaM, DNA
polymerase epsilon subunit dpe1,ku70,pgk1,tef1, and tub2),
only six and 11 genes actually support the F1 and F2 nodes,
respectively, while all 19 genes support the F3 node. The low
internode certainty (IC) and IC All (ICA) values obtained for F1
(0.19 and 0.33, respectively) were misinterpreted by Geiser et al.
(2021) as IC values close to 0 indicate conflict between the
partitions (Salichos et al. 2014). The F3 node was well supported
with IC and ICA values at 1 (Geiser et al. 2021,Supplementary
Table. S1), which indicates the absence of conflict.
While the effort by O'Donnell et al. (2020) and Geiser et al.
(2021) to include a high diversity of DNA markers is
commendable, it is undermined by an imbalanced selection of
taxa for their analyses. Specifically, there is a marked over-
representation of node F1 species, while sampling and taxon
selection across the Nectriaceae is almost absent. Excluding any
of the major genus-level clades, especially those relevant to the
recognition of Bisifusarium,Neocosmospora and Rectifusarium,
introduces taxon sampling biases in a way that reduce the reli-
ability of phylogenetic inferences and support values with respect
to the backbone of the Nectriaceae. Furthermore, neither
O'Donnell et al. (2020) nor Geiser et al. (2021) give full
consideration to morphological and ecological evidence. In
principle, a genus should always be delimited as monophyletic,
supported by derived traits. In addition, its circumscription should
FUSARIUM REDELIMITED
www.studiesinmycology.org 5

depend on the systematic (phylogenetic and biological) structure
of the family it belongs to, in this case, the Nectriaceae.
Phylogenetics has rapidly advanced from a powerful adjunct
tool for understanding evolutionary relationships to the dominant
principle for classification, especially for delimitation of taxa at all
ranks. However, the resulting analyses and phylogenies are
compromised if they are not reconciled with other biological data.
The call for additional genomic data in the Fusarium clade (Geiser
et al. 2013,Aoki et al. 2019) may improve backbone node support
values, but the phylogenetic structure is unlikely to change; it is the
translation of that data into practicable taxonomy. The broad
Fusarium concept of Aoki et al. (2019),O'Donnell et al. (2020) and
Geiser et al. (2021) is phylogenetically possible, but it does not
offer a generic definition based on a combination of available
genetic, morphological, biochemical and ecological data. It is,
thus, impractical in that it is so broad that the genus would not have
any synapomorphies when compared to other genera of the
Nectriaceae outside their broad circumscription of Fusarium.
The arguments presented by Aoki et al. (2019),O'Donnell
et al. (2020) and Geiser et al. (2021) are centred around the
phylogenetic support of some nodes, which have never been a
key subject of the discussion, as the made observations
generally match the interpretations made by many authors. While
the very broad circumscription of Fusarium reflects as a mono-
phyletic group in DNA phylogenetic analyses, the TFC is a
conglomerate of several monophyletic genera that has a com-
mon ancestor (node F1 in Geiser et al. 2013). Each of these
genera has a distinctive combination of morphological features.
An analogous situation was observed in the monophyletic sister
clade that was originally classified as Cylindrocarpon s. lat., but
that is currently viewed as composed of several monophyletic
genera i.e., Cinnamomeonectria,Corinectria,Cylindrodendrum,
Dactylonectria,Ilyonectria,Macronectria,Neonectria,Plei-
ocarpon,Rugonectria,Thelonectria and Tumenectria (Chaverri
et al. 2011,Gr€
afenhan et al. 2011,Lombard et al. 2014,
Salgado-Salazar et al. 2016,Gonz
alez & Chaverri 2017).
What is a genus?
Taxonomically, a genus is a group that is defined by a type
species, and that often includes additional species considered to
belong to the same group (Vellinga et al. 2015). The observa-
tions or category of data involved in delineating genera have
varied over time, and in many cases, the characters used to
delimit well accepted genera have proven to be homoplasious
and the genera polyphyletic (Crous et al. 2009). However, it is a
fundamental principle that taxonomic entities should reflect
evolutionary relationships.
This has led to inevitable splitting of well-known fungal taxa,
both genera and species, into smaller groups, but sometimes
also genera were merged with others based on the reappraisal or
discovery of derived characters (e.g.,Voglmayr & Thines 2007).
This proceeds with each technological revolution providing ever
deeper insight into the biological/evolutionary relationships of
organisms, and has accelerated again since molecular phylo-
genetics came into widespread use. There is a prevailing notion
that nature made species, but that humans made all other
taxonomic ranks for their own convenience. However, it is
increasingly recognised that all taxonomic ranks, including the
species level, do not have solid boundaries but are more like a
steam cloud with fuzzy margins. At the genus level, these
boundaries are often even more obscure, but is a genus just an
arbitrary (but statistically well-supported) monophyletic conve-
nience, a consensus accepted by a self-appointed committee?
Or is a genus a meaningful, definable unit resulting from
evolutionary processes, which can be recognised by patterns of
biological structure, biochemistry, behaviour, and adaptation to
specific niches? We believe that the latter should be the case.
While we recognise that generic delimitations will always depend
on a subjective choice, we believe that generic concepts should
always be guided in a phylogenetic context by morphological,
biochemical, or ecological characters that can both be used for
practical recognition and convey evolutionary information.
The generic concept for Fusarium proposed by Geiser et al.
(2013,2021) is a rejection of this concept, as it merges lineages
with divergent characters that were accepted and applied not
only throughout the family Nectriaceae for the delimitation of
genera but also in other fungal families and orders. The very
broad genus Fusarium that it gives rise to does not have clear-
cut features, as the diversity of characters shared with the rest of
the Nectriaceae is so high that it could be extended almost
arbitrarily to the entire family. It would, in fact be as if the concept
of cryptic species was expanded to genera, that is, genera that
can only be recognised as a well-supported node on a phylo-
gram, which is, in our view, in disagreement with fundamental
principles of practical classification. The node F1 selected by
Geiser et al. (2013,2021) for defining Fusarium is devoid of
phenotypic support and includes several genera with distinct
evolutionary traits. Indeed, the Geiser et al. (2013,2021) concept
of Fusarium is strictly phylogenetically defined and essentially
amounts to a list of the species bound within a selected clade.
Their morphological circumscription does not admit the existence
of synapomorphies (i.e., unique diagnostic characters possessed
by all included species), and it extends beyond their chosen node
to other groups in Nectriaceae. In this very wide definition of
Fusarium, phenotypic characters and ecological patterns that
correlate with well-supported monophyletic groups within the
larger, poorly supported TFC are disregarded as basis for
generic delineation.
Admittedly, phenotypic characters in the TFC are tricky to
interpret. The fusarioid macroconidium with or without a well-
developed foot-shaped basal cell (i.e., basal conidial cell
showing an asymmetrical papillum, delimited from the rest of the
cell and forming a distinct notch) occurs in the majority but not all
of the species in the traditional generic concept, but is also a
feature present in a significant proportion of other members of
the Nectriaceae, or even of the unrelated genus Microdochium
(Amphisphaeriaceae). It is, therefore, not a unique feature for
generic delineation (Gr€
afenhan et al. 2011).
Perithecial pigmentation has been used to delimit genera in
Nectriaceae. The orange/red perithecium is an ancestral char-
acter in the family and common also to members of the BFC and
early diverging lineages of the TFC, including all Neo-
cosmospora species known to reproduce sexually, Setofusarium,
and some species of Cyanonectria and Geejayessia. These
structures are easily distinguished from the homogeneously
bluish/black perithecia of true Fusarium s. str. species in the
Gibberella clade sensu O'Donnell et al. (2013). Contrary to what
was suggested by Geiser et al. (2021), it is not Neocosmospora
which represents an interesting but morphologically aberrant
lineage,since neither its type nor the members of its modern
morphological circumscription (Nalim et al. 2011) exhibit aberrant
characteristics. It is the dark-coloured perithecia typical of
CROUS ET AL.
6

Fusarium s. str. (= Gibberella clade) that are aberrant and un-
usual within Nectriaceae.
The dark purple to black perithecium formerly used to char-
acterise Fusarium s. str.(=Gibberella), represents a synapo-
morphic state. Ascomata with similar colours have evolved
independently in some, but not all, species of Geejayessia, while
heterogeneously coloured bluish black or bicoloured perithecia
can be observed in several species of Cyanonectria, which often
appears as a sister genus to Fusarium. However, Cyanonectria
and Geejayessia differ from Fusarium and Neocosmospora by
their typically well-developed stromata as well as their thinner
and smooth perithecial walls. Notably, pale yellowish perithecia
occur in several clades and are a derived character as well, and
one genus that we accept, Albonectria, was initially defined by
white perithecia (Rossman et al. 1999). Also, in terms of its
ascospores, Fusarium shows a derived state. With the exception
of Albonectria, which includes species with hyaline, ellipsoidal to
fusoid, 3-septate, smooth to finely striated ascospores, the
genera mentioned above present mostly pale yellow-brown as-
cospores. Ascospores of Fusarium s. str. are more often sub-
hyaline, ellipsoidal to fusoid, 1–3-septate, and smooth-walled
when viewed with light microscopy. Ascospores of Neo-
cosmospora are easily distinguished from those of Fusarium by
being ovoid to ellipsoidal, (0–)1-septate, pigmented, conspicu-
ously striate or more rarely cerebriform or spinulose. It is worth
noting that most of the above-mentioned characters and differ-
ences are the same applied to define genera across the whole
Nectriaceae (Rossman et al. 1999,Lombard et al. 2015), where
they correlate well with phylogenetic inferences. Ascospores
showing similarly many septa as in Fusarium s. str. have inde-
pendently evolved in Nectria diploa (now Microcera), as well as
in N. glabra, and N. decora (now Flammocladiella). The fact that
none of these species is a member of the TFC supports the
interpretation that multiseptate ascospores might be apomorphic
for Fusarium s. str., separating it clearly from other phylogenet-
ically related genera.
Behaviour and other adaptations, determine how an organism
operates and survives in nature and are the ultimate de-
terminants and products of natural selection. They may be
difficult to translate into nodes and other results of phylogenetic
analyses such as phylogenetic distance. Despite this, similarities
in adaptive traits are frequently used to calibrate phylogenetic
delimitations of genera. For example, all known species of
Microcera are pathogens of scale insects. It is easy to under-
stand the hypothesis that the ancestor of this clade jumped to
these hosts, followed by subsequent radiation and speciation
(Thines 2019). This resulted in considerable micromorphological
diversity, while a core of adaptation resulting from the parasitic
life style remained conserved. Similarly, several of the genus-
level clades include mostly mycoparasitic species or pathogens
of plants. If we apply this kind of thinking to the well-supported
clades of the TFC, as noted by Schroers et al. (2011), species of
Cyanonectria and Geejayessia occur only on woody hosts
(mostly species of Buxus, Celtis and Staphylea) and would
typically not occur as soil-borne plant pathogens or pathogens of
grasses. They are also not known to produce trichothecene
mycotoxins. This is in stark contrast with the prevailing ecological
concept of Fusarium s. str. as a genus of primarily soil-borne
fungi, of which many are in a firm biological association with
grasses and herbs. Importantly, the vast majority of Fusarium s.
str. species produce trichothecene mycotoxins as a chemical
synapomorphy. Most of the strongly supported clades within the
TFC can be supported by these kinds of morphological, chem-
ical, and biological traits, allowing the possibility of non-arbitrary
recognition of biologically meaningful genera. One such clade is
Neocosmospora.
Arguments for and the practicality of
recognising Neocosmospora (the F. solani
species complex) as a genus
In the days of dual nomenclature, the distinction between the red
perithecia of Neocosmospora, as amended by Nalim et al.
(2011), and the typically purple or blackish perithecia of the
trichothecene-producing Gibberella species was generally
accepted by Fusarium taxonomists. The ecological distinctive-
ness of Neocosmospora as a group of soil fungi, often associ-
ated with roots and causing root rot and vascular wilt diseases,
was also generally acknowledged. In addition to the dissimilar
sexual characters mentioned above, the asexual morphs of this
group are also distinctive. The macroconidia are usually thick-
walled, with blunt, rounded apical cells, and they usually have
inconspicuous foot-shaped basal cells. Microconidia are pro-
duced on very long, narrow phialides. Cultures of a vast majority
of species of this group can easily be recognised morphologi-
cally, even with a dissecting microscope.
The ecological similarities of the members of Neocosmospora
with F. oxysporum have to be acknowledged, as noted by Geiser
et al. (2013,2021). However, these two groups of species are
morphologically distinct, even as asexual morphs. Fusarium
oxysporum produces macroconidia with acutely pointed apical
cells, and microconidia from phialides that are usually 5–10
times shorter than those of Neocosmospora species.
Geiser et al. (2013,2021) have pointed out that micro-
chromosomes or conditionally dispensable chromosomes occur
in Neocosmospora and members of their F3 clade, namely
F. oxysporum. Microchromosomes have been observed, how-
ever, also in phylogenetically distinct taxa such as Magnaporthe
oryzae (Yoshida et al. 2009, now Pyricularia oryzae), Mycos-
phaerella graminicola (Stukenbrock et al. 2010, now Zymo-
septoria tritici), and Alternaria arborescens (Hu et al. 2012) and
might occur sporadically as a result of horizontal gene transfer.
They are thought to increase the ability of a pathogen to adapt to
the host's defence mechanisms. The ability to acquire condi-
tionally dispensable chromosomes might thus be seen as a
general genetic tool allowing organisms to gain ecologically
advantageous genes. Similarly, they could present a general
driving force in co-evolutionary processes, but the per se
occurrence of conditionally dispensable chromosomes in two
taxa can hardly be used as a criterion for drawing conclusions on
or imply generic relatedness.
In the Nelson et al. (1983) manual and in one of the last
vestiges of the ultra-reductionist Snyder & Hansen (1941) sys-
tem, F. solani was recognised as the only species of section
Martiella, even though the existence of several distinct mating
populations was known. The European system (exemplified by
Gerlach & Nirenberg 1982) accepted several more species,
derived from the classic Wollenweber & Reinking (1935) treat-
ment. When molecular phylogenetic studies of this group began
in earnest, Neocosmospora included three major clades and
many species (O'Donnell 1993,2000,O'Donnell et al. 2008a). To
date, 86 species are formally described in this group (Aoki et al.
2019,Sandoval-Denis et al. 2019,Guarnaccia et al. 2021), but
FUSARIUM REDELIMITED
www.studiesinmycology.org 7

additional novel phylogenetic lineages are recognised and await
formal description.
Thus, in Neocosmospora we have a group of species that can
easily be recognised morphologically by both sexual and asexual
morphs, exhibit generally consistent ecological behaviour, lack
trichothecene mycotoxins, and form a strongly supported
monophyletic group. This sounds like a biologically meaningful
calibration of a genus, but what about the practicality of doing
this? Presently, the data supporting the recognition of Neo-
cosmospora (and equally, also Fusarium s. str., the F3 clade) is
stronger than the data supporting either of the nodes favoured for
designating a broader concept of Fusarium. If there are 100 plus
species in Neocosmospora, and hundreds of species in the
trichothecene-producing, Poaceae-loving Fusarium s. str. clade,
it will be useful for students, plant pathologists, clinical microbi-
ologists, and other scientists to have different generic names for
each group. Those names will convey information about re-
lationships and behaviour that are lost in a broader definition of
Fusarium with much greater diversity of ecological and
biochemical behaviours. Geiser et al. (2013) raised concerns
that grant evaluators, government regulators and medical prac-
titioners who now believe they know what Fusarium means will
be confused by the segregation of these fusarioid fungi into
different genera, and that confusion could lead to unpredictable
consequences. However, in our experience these end users
continuously familiarise themselves with up-to-date, informative
taxonomic and nomenclatural concepts for socio-economically
important fungal groups, thus allowing them to predict the
possible real-world effects of reliably identified fungi with
increased precision. To them, the segregation of a heteroge-
neous concept of Fusarium into biologically and biochemically
predictive genera will be helpful.
With Neocosmospora accepted as a different genus, Albo-
nectria, Cyanonectria, and Geejayessia, as defined by Schroers
et al. (2011), as well as Bisifusarium and Rectifusarium as
defined in Lombard et al. (2015) must also be accepted as
separate genera. As previously said, these are all monophyletic
groups, also characterised by distinctive ecological and
morphological traits.
The end consequence of our strategy is a series of phylo-
genetically well-supported genera, each with a recognisable
suite of morphological characters, and ecological, pathological,
and biochemical behaviour. Indeed, the results of such splitting
activities applied to what we called the Wollenweber concept of
Fusarium s. lat. accounts for 20 segregate genera. Most
importantly, both Fusarium and Neocosmospora will have
generic names to indicate their important but distinct signifi-
cance. The extraneous species, with different ecology and
generally much lower economic or agricultural significance can
now justifiably be classified elsewhere, where they can be
appreciated for their own features without the need for the un-
certainty inherent in a broad concept of the generic name
Fusarium.
The generic concept of Fusarium proposed by Geiser et al.
(2013,2021) functions well as a phylogenetic concept only if
taxonomists turn their eyes away from all other kinds of data and
observations applied to the family Nectriaceae. It is a political
generic concept, meant to assuage the concerns of plant pa-
thologists and other applied scientists, many of whom are
already upset by the proliferation of cryptic phylogenetic species.
Ironically, this late-blooming alleged pragmatism seems to betray
the cladistic ideals that many of its authors profess to adhere to
(Taylor 2014).
All authors agree on the use of the single name Fusarium,
have a common understanding of a phylogenetic structure of the
family Nectriaceae, and agree that removing Neocosmospora
from the main Fusarium core is the critical point of discussion.
Sequencing additional markers may lead to increased phyloge-
netic support, but it is a false comfort if the taxon sampling does
not include as many genera of Nectriaceae as possible.
Expanded representation of the TFC in the dataset will not solve
the controversy, and the resulting phylogenies will remain un-
balanced. The segregation of Neocosmospora from Fusarium
certainly needs to be done efficiently by those who have the most
comprehensive expertise on the relevant species, which include
several of the co-authors of the Geiser et al. (2013,2021) and
O'Donnell et al. (2020) papers as well as the present one.
Fusarium taxonomy has long been confused because of
the nine-species system of Snyder & Hansen (1940,1941),
the misleading overlaps caused by convergent evolution and
character loss, the difficulty in characterising perithecia, the
phenomenon of cultural degeneration, and rigid opinions of
the taxonomists and plant pathologists who have worked on
them. To arrive at a stable taxonomy for Fusarium, the generic
concept needs to be fixed in a practical and evolutionary
reasonable manner so that future technologies and applications
will not disrupt it.
SECONDARY METABOLITES OF FUSARIOID
GENERA
The phylogenetic distribution of the fusarioid genera presented
here is further corroborated by their ability to produce genus-
specific secondary metabolites. The commercial database Dic-
tionary of Natural Products (DNP; http://dnp.chemnetbase.com),
was used to search for secondary metabolites produced by the
genera and species treated here. The database contained (as of
March 6, 2021) over 720 entries on metabolites from Fusarium s.
lat., even though some plant metabolites, discovered during
studies on the elicitation of phytoalexins by challenging plant
cells with a Fusarium strain, are included. The number of me-
tabolites from Fusarium s. lat. is therefore estimated to be around
680, which is still behind Aspergillus s. lat. (over 3 000 entries)
and Penicillium s. lat. (over 2 700 entries). Hits that were
retrieved were confirmed by consulting the original literature. The
reported structures were corroborated, with a selection of these
compounds presented here (Figs 2–4).
It remains uncertain if the reported taxonomy is reliable, since
the producer strains may have been misidentified or determined
using one of many outdated taxonomic concepts. However,
several compound classes have been encountered multiple
times from the same species or species complex, and in some
instances, the strains were identified by experts and/or
sequenced later in phylogenetic studies (O'Donnell et al. 2018).
The situation is further complicated by the fact that certain
secondary metabolites have been given similar names, but
represent different molecules. The name solaniol has been given
to both a trichothecene (Fusarium s. str.) and a naphthoquinone
(Neocosmospora), and the fusariumins represent four different
secondary metabolites.
CROUS ET AL.
8

Typical metabolites of Fusarium s. str.
Fusarium sambucinum, the type species of the genus, has not
been studied in much detail, but among the 20 metabolites
known from this species, several metabolites are ranked in the
classes trichothecenes and enniatins. The trichothecenes rep-
resents a well-known and notoriously dangerous class of my-
cotoxins belonging to the scirpene terpenoid type. These
compounds are widely distributed within the genus Fusarium s.
str., including familiar plant pathogenic species such as,
F. culmorum,F. graminearum,F. sporotrichioides and
F. tricinctum (Bamburg et al. 1968,Tatsuno et al. 1968,
Yoshizawa & Morooka, 1973,Jim
enez et al. 1997). The ennia-
tins, known from 17 Fusarium s. str. species (Munkvold 2017,
O'Donnell et al. 2018), are cyclic depsipeptides that have strong
antibiotic activities (Plattner et al. 1948,German-Fattal 2001,
Fig. 2. Secondary metabolites from Fusarium spp. / Neocosmospora spp.
FUSARIUM REDELIMITED
www.studiesinmycology.org 9

Bills & Gloer 2017). Similar to trichothecenes, they are only
known from Fusarium s. str. in the current taxonomic concept,
although Trichoderma and Beauveria, which belong to different
families of the Hypocreales, also produce trichothecenes or
enniatin-like beauvericins, respectively. However, trichothecenes
have not been reported from Neocosmospora or “F. solani”
except from two isolates misidentified as “F. solani”(Ueno et al.
1972,Sugimoto et al. 2002)(Supplementary Table S2)
Two other well-known classes of mycotoxins, the fumonisins
(Bezuidenhout et al. 1988) and zearalenone (Urry et al. 1966),
are also found frequently among species of Fusarium s. str.
Similarly, equisetin, also considered a “mycotoxin”and originally
found from a Fusarium sp. strain (NRRL 5537) in the FIESC
(Vesonder et al. 1979,Xia et al. 2019) is actually a strong
antibiotic. A more complex derivative known as fusarisetin A was
reported from an unidentified Fusarium sp. (Jang et al. 2011).
Some rather unique compounds only known from Fusarium s.
str., include wortmannin (Abbas & Mirocha, 1988) and oxy-
sporizoline (Nenkep et al. 2016), which have interesting biolog-
ical activities and may be species or even strain-specific.
Among the compounds that are not regarded as mycotoxins,
the antimicrobial sesquiterpenes of the fusarielin type (Sørensen
et al. 2013) and the antiparasitic and cytostatic cyclopeptides of
the apicidin type (Jiang etal. 2002,Von Bargen et al. 2013)have
been respectively isolated from Fusarium s. str. Additionally,
aurofusarin (Munkvold 2017,O'Donnell et al. 2018), chlamydo-
sporol (Munkvold 2017,O'Donnell et al. 2018), fusapyrone
(Evidente et al. 1994), fusaric acid (Munkvold 2017,O'Donnell
et al. 2018), fusoxysporone (Abraham & Hannsen 1992),
fusaproliferin, moniliformin (Munkvold 2017,O'Donnell et al.
2018) and the terpestacins (Liu et al. 2013) are other exam-
ples of secondary metabolites found only in Fusarium s. str. Thus
far, only one report has indicated that a Neocosmospora species
can produce fusaric acid (Zhou et al. 2019). Both aurofusarin and
bikaverin produced by Fusarium s. str. and other bis-naph-
thoquinone and bis-naphthopyrone pigments protect fungi from
predation (Xu et al., 2019), while Neocosmospora species pro-
duce other naphthoquinones such as javanicin (Arnstein & Cook
1947,Kimura et al. 1981) as potential predator protectors. Some
unique compounds have been reported from marine strains of
certain Fusarium species, which include the mangicols, rare
sesterterpenes produced by a strain tentatively classified as
F. heterosporum (Renner et al. 2000).
Typical metabolites of Neocosmospora and
other fusarioid genera
Neocosmospora species and other fusarioid genera apparently
have a different secondary metabolism, or have not been
intensively studied in the past. A striking example are the
cyclosporins, which are immunosuppressive peptides. Originally,
these were obtained from Tolypocladium inflatum, but later also
found to be produced by species of Neocosmospora (Sawai et al.
1981,Nakajima et al. 1989). However, they have not been re-
ported from Fusarium s. str. Other unique compounds only
known from Neocosmospora species, include dihydrofusarin
(Kurobane et al. 1980,Kyekyeku et al. 2017), the polyketides
neovasipyrones (Furumoto et al. 1995,Nakajima et al. 1995) and
vasinfectin A (Furumoto et al. 1997). The rare cyclopeptides of
the neosansalvamide type (Lee & Lee 2012) and the resorcylic
acid lactones of the monorden/monocillin type (Cutler et al. 1987,
Gao et al. 2013) are also known from Neocosmospora and other
fungi, but not from Fusarium s. str., even though the latter
compounds bear a high structural resemblance to zearalenone.
Several Neoscomospora species produce a range of naph-
thoquinones that are members of a widespread class of poly-
ketides (Roos 1977).
The fusarioid genus Bisifusarium is known to produce the
PKS/NRPS hybrid siderophore, dimerumic acid (= dimerum acid)
(Diekmann 1970), and indole acetic acid (Reddy & Reddy 1992,
Kulkarni et al. 2011,2013). The parnafungins, which are under
development as antimycotics, are only known from Microcera
larvarum (Parish et al. 2008).Additionally, Microcera larvarum is
also known to produce monocerin and fusarentins, which are not
known from any other fungi (Grove & Pople 1979), except a
Colletotrichum species (Tianpanich et al. 2011). The anticancer
agent balanol (azepinostatin) (Ohshima et al. 1994) is known to
be produced by two Fusicolla species, which might be applied as
a taxonomic marker for this genus, although it has also been
Fig. 3. Some of the most important mycotoxins from Fusarium spp.
CROUS ET AL.
10

found in species of the Ophiocordycipitaceae. Unfortunately,
there is no available information on secondary metabolites for the
other fusarioid genera treated here. However, secondary
metabolite studies of these missing genera will facilitate for the
discovery of novel molecules and help to elucidate the functional
biodiversity of these fungi.
Fig. 4. Secondary metabolites from fusarioid Hypocreales.
FUSARIUM REDELIMITED
www.studiesinmycology.org 11

RECOMMENDED METHODS FOR THE
IDENTIFICATION AND CHARACTERISATION OF
FUSARIUM AND ALLIED GENERA
The following part of this study presents an overview of the
morphological and phylogenetic characters of Fusarium and
related genera as well as an account of recommended methods
for the identification and characterisation of these taxa. In
addition, novel genera and species are described and, in view of
the recent taxonomic data, a list of names that are applied to the
genus Fusarium s. lat. with their current scientific names is
presented.
Morphology
Current Fusarium taxonomy is dominated by molecular phylo-
genetic studies. Nonetheless, morphology is a fundamental
component of the generic and species concepts of fungi and
must not be overlooked. Key morphological features for generic
circumscription include characteristics of sexual morphs such as
perithecial colour, wall thickness and anatomy,surface structures
and the presence and nature of a basal stroma, ascospore
shape, septation, colour and surface ornamentation (Rossman
et al. 1999). Classification of taxa solely based on their
asexual morphs can be trickier than integrated systems using
sexual and asexual characters. However, the general shapes,
different types and combinations of conidiogenous structures and
conidia present in culture can be sufficient to allow a preliminary
identification (Fig. 5), especially if host data are also available
(Leslie & Summerell 2006). For species-level characterisation, a
number of morphological traits must be carefully studied,
particularly those of the asexual morph, while sexual morphs are
generally less suitable, especially as they are typically not pro-
duced in culture. Diagnostic characters for species identification
include colony characters such as colony morphology, pigmen-
tation, and type of aerial mycelium. Also included are the di-
mensions and characteristics of aerial conidiophores and
conidiogenous cells (mono- vs polyphialides), presence/absence
and characteristics of sporodochia, the types of conidia pro-
duced, e.g., aerial microconidia, mesoconidia, and aerial and
sporodochial macroconidia. In examining conidia themselves,
consideration is given to the overall shape, septation and cur-
vature of the macroconidia, as well as characteristics of their
apical and basal cells; with aerial microconidia, their dimensions,
shape, septation and spatial organisation (forming slimy heads,
chains or a combination of both) are noted. Finally, the presence
or absence of chlamydospores may be important.
Culture media and incubation
Vigorous growth, sporulation, and pigment production of fusarioid
fungi can be achieved on numerous agar formulations. The
morphology of fungal structures will vary dramatically depending
on the selection of media and growth conditions which may
compromise the identification process. In addition, it is also
common for fusaria to degenerate and lose viability in culture,
particularly when they are grown on nutrient-rich media (Nelson
et al. 1983,Nirenberg 1990,Summerell et al. 2003,Leslie &
Summerell 2006). Culture conditions and media have been
extensively summarised in the literature (Booth 1971,Nirenberg
1990,Nelson et al. 1994,Summerell et al. 2003,Leslie &
Summerell 2006). Consequently, we recommend the agar for-
mulations listed in Table 1 to be employed for the isolation and
description of fusaria. A summary of the procedures and con-
ditions suitable for work with fusarioid fungi is shown in Fig. 6.
An important condition that must be stressed is that the
identification must always be made on the basis of a monosporic
culture (a culture produced from a single sporulating conidium,
ascospore, or hyphal tip), as multiple species are commonly
found to co-occur in the same substrate tissue. A freshly isolated
fusarioid strain should be sub-cultured onto at least two different
culture media, a relatively rich one suitable for examination of
gross morphology, and a nutrient-poor one for micromorpho-
logical examination and for further culture propagation. The
standard culture setup for initial assessment of growth rates and
colony characters i.e., colony pigmentation, diffusible pigments,
and colour of sporodochia, is to use potato dextrose agar (PDA)
incubated for 1–2 wk. Fusarium and related genera will also
grow and sporulate well on malt extract agar (MEA, recipe in
Crous et al. 2019a), which can be a suitable alternative for initial
isolation and monosporic cultivation. However, MEA should not
be used to assess colony or morphological characters. Standard
incubation is commonly made in total darkness; however,
exposure to light will normally result in a faster and more intense
pigmentation. We have observed better colour formation using
in-house prepared media rather than commercial formulae.
While colony colour cannot be employed as a primary criterion
for species identification, it can provide useful means to grossly
distinguish related groups and to direct the identification process
towards determining genera or species complexes. The high
nutrient content of these agar media strongly affects sporulation,
commonly resulting in the development of atypical structures.
Therefore, we strongly discourage the use of PDA for micro-
morphological assessment or culture propagation of Fusarium
spp. (Nelson et al. 1994,Summerell et al. 2003). Oatmeal agar
(OA) is a suitable alternative for strain sub-culturing, allowing for
good sporulation with reduced strain degeneration; however, it is
not recommended for micromorphological studies.
Carnation leaf agar (CLA), synthetic nutrient-poor agar (SNA),
and water agar (WA) are the standard culture media for micro-
morphological analyses. Also, by reducing culture degeneration,
they allow for prolonged storage of actively growing cultures
(Nirenberg 1976,Nelson et al. 1983,Leslie & Summerell 2006).
Subcultures on CLA will normally produce abundant sporodochia
and macroconidia on the surface or around the carnation leaf
pieces with consistent morphological features. Incubation at
room temperature (20–25 °C) for 1–2 wk under a 12/12 h near-
UV light (wavelength 320–400 nm)/dark or near-UV light/cool
fluorescent light cycles results in stronger sporulation and good
development of sporodochial pigmentation (Nirenberg 1990,
Seifert 1996,Summerell et al. 2003,Leslie & Summerell 2006).
The use of continuous near-UV light (also commonly termed
"blacklight" or UV-A light) is also suitable although it often results
in the formation of unusually long macroconidia (Nirenberg
1990), and it can suppress the development of useful morpho-
logical characters such as the globose microconidia of Fusarium
globosum. Nevertheless, incubation under near-UV light is
fundamental since isolates of some species such as Fusarium
poae and F. sacchari are known to lack macroconidia or to
produce them in only small quantities unless they are stimulated
by incubation under a near-UV light source (Leslie et al. 2005,
Leslie & Summerell 2006). Fusarium cultures also need
CROUS ET AL.
12

Fig. 5. Basic morphological features offusarioid fungi. A. Macroconidial shapes. A1. Slender with no significant curvature. A2. Curved with parallel walls. A3. Unequally curved. A4.
Widest at the middle portion. A5. Widest at the apical third, wedge-shaped. A6. Widest at the basal portion. A7. Irregularly clavate and swollen. A8. Elongate, whip-like. A9. Distinctly
curved.B. Macroconidial apex.B1. Curved. B2. Longand tapered. B3. Pointed. B4. Blunt.B5. Hooked. B6. Elongated. C. Macroconidial base. C1.Obtuse, non foot-shaped. C2. Papillate,
non foot-shaped. C3. Poorly developed, foot-shaped. C4. Well-developed, foot-shaped.C5. Elongate, foot-shaped. D. Aerial phialidesand microconidial organization. D1. Monophialide.
D2–D5. Polyphialides. D2. Simple polyphialide. D3 –D4. Polyphialides with multiple conidiogenous loci. D5. Sympodially proliferating polyphialides. D6, D7. Microconidia forming false
heads. D8,D9. Microconidia inchains (D8. Dry chain.D9. Palisade). E. Sporodochial conidiophore and conidiogenous cells. F. Aerial conidiophorebearing mesoconidia.G. Mesoconidia.
H. Microconidial shapes. H1. Fusiform. H2. Oval. H3. Obovoid. H4. Reniform. H5. Allantoid. H6. Clavate. H7. Napiform. H8. Pyriform. H9. Limoniform.
FUSARIUM REDELIMITED
www.studiesinmycology.org 13

Table 1. Recommended agar media formulations for the isolation and cultivation of fusaria.
Agar media Components
1
Preparation
2
Incubation
3
Application Reference
Carnation leaf agar (CLA) Sterilised carnation leaves Carnation leaves are cut into
approximately 5 × 5 mm pieces and
dried at 60 °C for 24 h; sterilise by
gamma radiation or autoclave; place
3–5 pieces on nearly solid 2 % WA
surface.
25 °C; Micro-
morphological
characterisation:
formation of
sporodochia;
sporodochial
macroconidia
Fisher et al. (1982),
Crous et al. (2019a)WA 7–14 d under 12 h
near-UV-light/dark
cycle; 7–14 d under
24 h near-UV-light
Selective Fusarium Agar (SFA) Glucose (Dextrose) 20 g Add all components, except antibiotics,
to water and autoclave; cool to
45–50 °C and add antibiotics. Dichloran
can be replaced by PCNB (0.75 g).
25 °C; 7–14 d in
dark
Selective isolation
of fusaria from soil
Tio et al. (1977),
Leslie & Summerell (2006)KH
2
PO
4
1g
NaNO
3
2g
MgSO
4
$7H
2
O 0.5 g
Yeast Extract 1 g
1 % FeSO
4
$7H
2
O (aquous) 1 ml
Streptomycin (5 % w/v) 20 mL
Neomycin (1 % w/v) 12 mL
Dichloran (50 % w/v in ethanol) 13 mL
Agar 20 g
Water 1 000 mL
Komada's Medium D-Galactose 20 g Add all components, except antibiotics,
oxgall and borax; to water and
autoclave; cool to 45–50 °C and add the
reamining components. Adjust pH to 3.8
± 0.2 prior to autoclaving.
25 °C; 7–14 d in
dark
Selective isolation
of fusaria from soil,
particularly those
belonging to the
Fusarium
oxysporum species
complex. Other
fusaria can be
inhibited by this
medium
Komada (1975),
Leslie & Summerell (2006)L-Asparagine 2 g
KH
2
PO
4
1g
KCl 0.5 g
MgSO
4
$7H
2
O 0.5 g
PCNB 0.75 g
Fe3Na EDTA 0.01 g
Streptomycin (5 % w/v) 6 mL
Oxgall stock solution 0.5 g
Na
2
B
4
O
7
$10H
2
O (borax) 0.5 g
Agar 15–20 g
Water 1 000 mL
Malachite Green Agar (MGA) Peptone 15 g Add all components, except antibiotics,
to water and autoclave; cool to
45–50 °C and add antibiotics. Penicillin
can be also replaced by
chloramphenicol (5 % w/v) or neomycin
(1 % w/v).
25 °C; 7–14 d in
dark
Selective isolation
of fusaria from soil
and plant material,
with improved
inhibition of non-
fusarioid
contaminants
Castell
aet al. (1997),Leslie &
Summerell (2006)KH
2
PO
4
1g
MgSO
4
$7H
2
O 0.5 g
Malachite green oxalate 2.5 mg
Streptomycin (5 % w/v) 20 mL
Penicillin (5 % w/v) 20 mL
Agar 20 g
Water 1 000 mL
Oatmeal agar (OA) Oatmeal extract 1 000 mL Oatmeal flakes (30 g/L) are wrapped in
cloth and simmered in water for 2 h;
liquid is squeezed and filtered through
cloth.
25 °C; 7–14 d in
dark
Macro-
morphological
characterisation,
colony
characteristics
Crous et al. (2019a)
Agar 15–20 g
CROUS ET AL.
14

Table 1. (Continued).
Agar media Components
1
Preparation
2
Incubation
3
Application Reference
Potato dextrose agar (PDA) Potato extract 230 mL Potatoes (5 kg; peeled and sliced) are
minced; soak in water (300 mL/100 g
potato) overnight at 4 °C; filter through
cloth; adjust pH to 6.6.
25 °C; 7–14 d in
dark; 5–40 °C
(5 °C increments for
growth curves)
Inoculum
preparation, macro-
morphological
characterisation:
colony
characteristics;
growth curve
Crous et al. (2019a)
Agar 15–20 g
Water 770 mL
Peptone Pentachloronitrobenzene
(PCNB) agar (PPA)
Peptone 15 g Add all components, except antibiotics,
to water and autoclave; cool to
45–50 °C and add antibiotics. Penicillin
can be also replaced by
chloramphenicol (5 % w/v) or neomycin
(1 % w/v).
25 °C; 7–14 d in
dark
Selective isolation
of fusaria from soil
and plant material
Nash & Snyder (1962),Booth (1971),
Leslie & Summerell (2006)KH
2
PO
4
1g
MgSO
4
$7H
2
O 0.5 g
PCNB 0.75 g
Streptomycin (5 % w/v) 20 mL
Penicillin (5 % w/v) 20 mL
Agar 20 g
Water 1 000 mL
Rose Bengal-Glycerine-Urea Medium
(RbGU)
Glycerol 10 g Add all components, except antibiotics,
to water and autoclave; cool to
45–50 °C and add antibiotics.
25 °C; 7–14 d in
dark
Isolation of fusaria
from soil and plant
material
van Wyk et al. (1986),Leslie &
Summerell (2006)Urea 1 g
L-Alaninw 0.5 g
PCNB 1 g
Rose Bengal 0.5 g
Streptomycin (5 % w/v) 20 mL
Agar 15 g
Water 1 000 mL
Synthetic nutrient-poor agar (SNA) KH
2
PO
4
1 g Add all components to water and
autoclave.
25 °C; 7–14 d
under 12 h near-
UV-light/dark cycle
Inoculum
preparation, micro-
morphological
characterisation:
aerial conidiophores
and micro- &
macroconidia;
chlamydospore
formation
Nirenberg (1976),Crous et al. (2019a)
KNO
3
1g
MgSO
4
$7H
2
O 0.5 g
KCl 0.5 g
Glucose 0.2 g
Saccharose 0.2 g
Water 1 000 mL
Water agar (WA) Agar 15–20 g 25 °C; 7–14 d in
dark
Inoculum
preparation, base
agar for CLA
Crous et al. (2019a)
Water 1 000 mL
1
Unless specified differently, antibiotic stock solutions are prepared in distilled water.
2
Water refers to distilled water; autoclave = 121 °C for 15 min.
3
Near-UV = near ultraviolet spectrum (wavelength 320–400 nm).
FUSARIUM REDELIMITED
www.studiesinmycology.org 15

adequate aeration to produce conidia reliably and to attain stable
growth rates, and hence we discourage the incubation of sealed
plates. Carnation leaf agar, SNA, and WA are also suitable for
the observation of conidiophore disposition and microconidial
arrangements such as the formation of false heads, chains or
both. These structures can easily be examined under a dis-
secting microscope or at low magnification under a compound
light microscope (Leslie & Summerell 2006). Examination of
micromorphological characters must be carried out using slide
preparations mounted in water. Lactic acid, lactophenol and
Shear's mounting media can cause considerable shrinking of the
structures and can alter the appearance of the cell surface;
hence we advise against the use of these mountants for ex-
amination of morphological characters in Fusarium and related
genera.
Additional culture media, incubation conditions, and protocols
are available for induction of sexual characters in Fusarium and
related genera (Klittich & Leslie 1988,Leslie & Summerell 2006,
Guo et al. 2018,Kim et al. 2019,Santos et al. 2019). Carrot agar
(CA) and half-strength CA are the most commonly used media.
The crossing procedures are often variations from the protocol of
Klittich & Leslie (1988), in which strains of opposite mating types
are paired in all possible combinations as male and female par-
ents, together with crosses made against tester strains from
known mating populations (Leslie & Summerell 2006). The pro-
cess can be shortened by reducing the number of combinations to
be crossed by first determining the MAT gene alleles carried by
each strain by means of specific mating type idiomorph PCR
primers (Ker
enyi et al. 1999,2004,Steenkamp et al. 2000).
Molecular studies
Several genes, primer combinations and PCR conditions have
been listed in the Fusarium literature (O'Donnell et al. 1998a,b,
2000a,b,2007, 2010, 2013,Gr€
afenhan et al. 2011,Lombard
et al. 2015,2019a,b), including whole-genome sequencing to
mine for the desired genes (O'Donnell et al. 2020,Geiser et al.
2021). Here we detail those DNA markers that have shown the
best results in routine diagnosis (Table 2,Fig. 6).
Fig. 6. Flow diagram summarising recommended methods for the preservation, identification, and characterisation of fusarioid fungi.
CROUS ET AL.
16

Nuclear ribosomal DNA (nrDNA), including the internal tran-
scribed spacer region cistron (ITS) and the 28S large subunit
nrDNA (LSU), are nearly useless for species recognition in
Fusarium and related genera. Nevertheless, given the ease
of amplification and the extensive data available for comparison in
public databases (Schoch et al. 2012), these markers are useful in
the discrimination between the multiple species complexes of
Fusarium, and for obtaining a confident genus-level identification
for Fusarium and related genera, allowing further DNA markers to
be incorporated in the analyses. The ITS region can still provide
valuable information at species level for related genera containing
species formerly included in Fusarium (Bisifusarium,Cosmo-
sporella,Fusicolla,Macroconia,Microcera, and Stylonectria).
Many protein-coding genes have been explored for identifi-
cation and taxonomic purposes in Fusarium and fusarioid fungi.
The two main genes used for identification are tef1 and rpb2.
Both offer high discriminatory power and are well represented in
public databases. Translation elongation factor 1-αis commonly
the first-choice identification marker as it has very good resolu-
tion power for most species in all the genera treated here, while
rpb2 allows for enhanced discrimination between closely related
species. For example, some species in the Fusarium fujikuroi
species complex (FFSC) and in Neocosmospora that are not
easily separated by using tef1 alone (O'Donnell 2000,Nalim
et al. 2011,Herron et al. 2015), can be resolved with rpb2. On
the other hand, PCR amplification and sequencing success are
often better for tef1 than for rpb2. When used for phylogenetic
analyses, sequence alignments of rpb2 sequences are much
more robust and less ambiguous than tef1 data, given the former
gene's advantageously low proportion of introns. An analogous
situation has been shown in Aspergillus (Samson et al. 2014)
and Penicillium (Visagie et al. 2014).
Additional genetic markers, often employed in association
with the previously mentioned genes in multigene phylogenetic
analyses include acl1,tub2,CaM, and rpb1. These markers have
variable resolution or applicability depending on the genus or
species complex. For example, use of CaM data may yield
conflicting clade resolutions in the FFSC (O'Donnell 2000,Al-
Hatmi et al. 2019), while paralogous or xenologous gene
copies have been demonstrated for tub2 in the
F. chlamydosporum and F. incarnatum-equiseti species com-
plexes (O'Donnell et al. 2009) as well as in Neocosmospora
(O'Donnell 2000,O'Donnell et al. 2008a).
The most widely used algorithm for fungal identification by
means of DNA markers is the Basic Local Alignment Search Tool
(BLAST), available at the NCBI's GenBank website. This is a
quick and useful method that can convey a great deal of infor-
mation, but its results must be analysed with care given the
presence of a high proportion of misidentified strains and low-
quality sequences that must be filtered out (Vilgalys 2003,Nilsson
et al. 2012). Sequences from type material are present in the
GenBank nucleotide database for most fusarioid species known
from culture, especially for rpb2 and tef1 barcodes, but the ex-type
status of these sequences is not always explicitly mentioned. In
many cases the names listed do not reflect the current
taxonomy, even for sequences derived from ex-type cultures.
Table 2. Recommended PCR primers for DNA amplification of Fusarium and related genera.
Gene/DNA region Primer
Name Abbreviation Name Direction Sequence (5'/3') Reference
28S large subunit of the nrDNA LSU LR0R Forward ACCCGCTGAACTTAAGC Vilgalys & Sun (1994)
LR5 Reverse ATCCTGAGGGAAACTTC Vilgalys & Hester (1990)
NL4
2
Reverse GGTCCGTGTTTCAAGACGG Kurtzman & Robnett (1997)
ATP citrate lyase acl1 230up Forward AGCCCGATCAGCTCATCAAG Gr€
afenhan et al. (2011)
1220low Reverse CCTGGCAGCAAGATCVAGGAAGT Gr€
afenhan et al. (2011)
Beta-tubulin tub2 T1 Forward AACATGCGTGAGATTGTAAGT O'Donnell & Cigelnik (1997)
TUB-2Fd
2
Forward GTBCACCTYCARACCGGYCARTG Woudenberg et al. (2009)
TUB4RD Reverse CCRGAYTGRCCRAARACRAAGTTGTC Woudenberg et al. (2009)
Calmodulin CaM CAL-228f Forward GAGTTCAAGGAGGCCTTCTCCC Carbone & Kohn (1999)
CAL-CL1
2
Forward GARTWCAAGGAGGCCTTCTC O'Donnell et al. (2000b)
CAL-CL2A
2
Reverse TTTTTGCATCATGAGTTGGAC O'Donnell et al. (2000b)
CAL-2Rd Reverse TGRTCNGCCTCDCGGATCATCTC Quaedvlieg et al. (2011)
Internal transcribed spacer
region of the nrDNA
ITS ITS5 Forward GGAAGTAAAAGTCGTAACAAGG White et al. (1990)
V9G
2
Forward TTACGTCCCTGCCCTTTGTA de Hoog & van den Ende (1998)
ITS4 Reverse TCCTCCGCTTATTGATATGC White et al. (1990)
RNA polymerase largest subunit rpb1 Fa Forward CAYAARGARTCYATGATGGGWC O'Donnell et al. (2010)
F7 Forward CRACACAGAAGAGTTTGAAGG O'Donnell et al. (2010)
F8
1
Forward TTCTTCCACGCCATGGCTGGTCG O'Donnell et al. (2010)
F6
1
Forward CTGCTGGTGGTATCATTCACG O'Donnell et al. (2010)
R8 Reverse CAATGAGACCTTCTCGACCAGC O'Donnell et al. (2010)
R9 Reverse TCARGCCCATGCGAGAGTTGTC O'Donnell et al. (2010)
G2R
1
Reverse GTCATYTGDGTDGCDGGYTCDCC O'Donnell et al. (2010)
RNA polymerase second
largest subunit
rpb2 RPB2-5f2 Forward GGGGWGAYCAGAAGAAGGC Reeb et al. (2004)
fRPB2-7cf Forward ATGGGYAARCAAGCYATGGG Liu et al. (1999)
fRPB2-7cr Reverse CCCATRGCTTGYTTRCCCAT Liu et al. (1999)
RPB2-11ar Reverse GCRTGGATCTTRTCRTCSACC Liu et al. (1999)
Translation elongation factor 1-alpha tef1 EF-1 Forward ATGGGTAAGGARGACAAGAC O'Donnell et al. (1998b)
EF-2 Reverse GGARGTACCAGTSATCATG O'Donnell et al. (1998b)
1
Used only for sequencing reactions.
2
Alternative primer, not used in this study.
FUSARIUM REDELIMITED
www.studiesinmycology.org 17

Some sequences used in past phylogenetic analyses
of O'Donnell et al. (2020) and Geiser et al. (2021) appear to
be linked to incorrect Fusarium names, likely due to errors in
the database used. For this reason, we recommend the use of
our curated database: Fusarioid-ID (https://www.fusarium.org). It
can also be used for sequence similarity-based analysis of
routine isolations and for identifications within several related
genera.
MALDI-TOF
A number of studies have thus far demonstrated the utility of
mass spectrometry (MS) for species determination of subgroups
of Fusarium, particularly members of the FFSC (Al-Hatmi et al.
2015,2016,Wigmann et al. 2019). It is also useful for clini-
cally relevant subgroups within several Fusarium species com-
plexes (Marinach-Patrice et al. 2009,Triest et al. 2015,Sleiman
et al. 2016,Paziani et al. 2020) and clinically relevant Bisifusa-
rium (Triest et al. 2015,Paziani et al. 2020) and Neocosmospora
species (Marinach-Patrice et al. 2009,Triest et al. 2015,Sleiman
et al. 2016,Paziani et al. 2020). These techniques show highly
accurate discriminative power, comparable to what has been
shown with bacteria and yeasts. Only a limited number of taxa
have thus far been evaluated, and a genus-wide evaluation of
applicability of MALDI-TOF to Fusarium and related taxa is
pending. The main limiting factor is, as usual, the current lack of
representation of these taxa in commercial spectrum databases,
a matter that can be resolved by constructing in-house, curated
reference databases of spectra. Online availability and com-
parison of MS spectra of Fusarium has been proposed by Triest
et al. (2015).
MATERIALS AND METHODS
Isolates and fungarium specimens
Fungal strains were obtained from the Westerdijk Fungal
Biodiversity Institute (WI) collection (CBS), the Belgian Coordi-
nated Collections of Microorganisms (IHEM), the International
Mycological Institute (IMI), and the personal collection of Pedro
W. Crous (CPC) housed at WI. For the list of names applied to
the genus Fusarium and related fungarium specimens, the
following fungaria were approached for holotype specimens: B,
BM, BO, BP, BPI, BR, BRA, C, CBS, CO, DAOM, E, FH, H, HAL,
IMI, K(M), L, LEP, M, MASS, MPA, NY, PC, PAD, PARMA, PAV,
PH, PRM, ROVP, SIENA, STR, UPS, VPRI, W, and WIR.
DNA amplification and phylogeny
Total genomic DNA was extracted from isolates grown for 7 d on
PDA or MEA (recipes in Crous et al. 2019a;Table 1) incubated at
24 °C under a 12/12 h photoperiod using the Wizard® Genomic
DNA purification Kit (Promega Corporation, Madison, WI, USA),
following the manufacturer's instructions. Partial gene sequences
were determined for eight DNA markers, i.e., acl1,CaM, ITS,
LSU, rpb1, rpb2,tef1, and tub2 using PCR protocols described
elsewhere (O'Donnell et al. 1998b,2007,2010,Lombard et al.
2015). Primer pairs used for amplification and sequencing of
the respective gene regions are summarised in Table 2.
Consensus sequences for each marker were assembled in
Geneious R11 (Kearse et al. 2012) or SeqMan Pro v. 15.3.0
(DNASTAR, Madison, WI, USA). All sequences generated in this
study were deposited in GenBank (Table 3; also see Diagnostic
DNA Barcodes in list of Fusarium names). The multiple
sequence alignments and phylogenetic trees were deposited in
TreeBASE (study ID 28093).
Sequences of the individual markers, including introns, were
aligned using MAFFT v. 7.110 (Katoh et al. 2019) using default
parameters and manually corrected where necessary. Seven
multimarker datasets (Table 4) were assembled and analysed
using Maximum Likelihood (ML) and Bayesian Inference (BI).
For the ML analyses, concatenated phylogenies, where each
marker was treated as a separate partition, were determined
using IQ-TREE v. 2.1.2 (Nguyen et al. 2015,Minh et al. 2020b)
with ultrafast bootstrapping (UFBoot2; Hoang et al. 2018) for
estimation of branch support. The most suitable evolutionary
model for each partition was estimated using ModelFinder
(Kalyaanamoorthy et al. 2017;Minh et al. 2020b) as imple-
mented in IQ-TREE. To assess whether the individual markers
were compatible, genealogical concordance factors (gCF) were
calculated using IQ-TREE (Minh et al. 2020a,b). Additional ML
analyses were performed using RAxML v. 8.2.12 (randomised
accelerated (sic) maximum likelihood for high performance
computing; Stamatakis 2014) with the system's default modelling
options. The robustness of the analysis was evaluated by
bootstrap support (BS) with the number of bootstrap replicates
automatically determined by the software. The BI analyses were
carried out through the CIPRES website (http://www.phylo.org)
using MrBayes v. 3.2.7a (Ronquist & Huelsenbeck 2003)
incorporating the best evolutionary models for each marker as
determined by MrModeltest v. 2.3 (Nylander 2004). Two parallel
Markov Chain Monte Carlo (MCMC) runs of four incrementally
heated chains (temp parameter = 0.2) were run starting from a
random tree topology. The MCMC analyses lasted for 5M gen-
erations, and convergence of the runs was checked by average
standard deviation of split frequencies below 0.01. Trees were
saved every 1 000 generations and the first 25 % of saved trees
were discarded as the “burn-in”phase. Posterior probabilities
(PP) were determined from the remaining trees. Proper mixing of
the MCMC runs was further confirmed by checking that all chains
converged (minimum and average Estimated Sampled Size
[ESS >200], Potential Scale Reduction Factor [PSRF = 1.0]) and
by plotting and analysing trace file results using Tracer v.1.7.1
(Rambaut et al. 2018).
The phylogenetic re-analysis of the dataset presented by
Geiser et al. (2021) was first made according to the original
exons-only alignment file and procedures as indicated in
Geiser et al. (2021) (Supplementary Table S1). Additionally, the
dataset was split into the 19 genes according to the original
partitioning file, and every gene was realigned using the
MAFFT webserver (v. 7, Katoh et al. 2019) applying the G-INS-
i algorithm. All other parameters were set to default. Six of the
19 genes exhibited a diverging alignment length. No subse-
quent changes were done to the alignments. The sequences
were merged using BioEdit (v. 7.2.5, Hall 1999), and the
phylogenetic trees were calculated using Minimum evolution
(ME) and ML algorithms, and BI. The ME tree was calculated
using FastTree 2 (Price et al. 2010) using standard settings
and 1 000 bootstraps (Felsenstein 1985). The ML analysis was
done using RAxML (v. 8.2.12, Stamatakis 2014) with the
CROUS ET AL.
18

Table 3. Details of strains included in the phylogenetic analyses.
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
Albonectria albosuccinea NRRL 20459 Unidentified tree Venezuela ——JAADYS010000048.1* JAADYS010000048.1* JX171471 JX171585 JAADYS010002360.1* —
A. rigidiuscula CBS 133754 Bauhinia longicupsis French Guiana ——MW827602 MW827641 MW834177 MW833995 MW834269 —
Atractium crassum CBS 180.31
T
= NRRL 20894 Water tap Germany ——KM231790 MH866623 MW834178 HQ897722 KM231919 —
At. stilbaster DAOM 215627 Cut stump Canada ——— HQ843769 —HQ897748 ——
Bisifusarium delphinoides CBS 110140 = FRC E-0073 = NRRL 36160 Human eye USA ——MW827603 MW827642 JX171535 HM347219 EU926302 —
B. dimerum CBS 108944
ET
= NRRL 36140 Human blood Netherlands ——JQ434586 JQ434514 —HM347218 KR673912 —
B. nectrioides CBS 176.31
T
= NRRL 20689 Humus Honduras ——EU926245 EU926245 JX171477 JX171591 EU926312 —
B. penzigii CBS 116508 = ATCC 15621 = NRRL 20711 Human eye Sri Lanka ——EU926256 EU926256 JX171482 HM347217 EU926323 —
Corinectria fuckeliana CBS 239.29 = IMI 039700 Picea sitchensis Scotland ——MW827604 MW827643 MW834179 MW833996 DQ789728 —
Co. tsugae CBS 788.69
T
Tsuga heterophylla Canada ——KM231763 KM231763 —KM231763 MW834270 —
Cosmospora butyri CBS 301.38
T
= MUCL 9950 Butter Denmark ——MW827605 MW827644 MW834180 HQ897729 ——
Cs. coccinea CBS 341.70 Inonotus nodulosus on Fagus sylvatica Germany ——MH859703 KM231692 MW834181 HQ897777 KM231947 —
Cs. khandalensis CBS 356.65
IT
= ATCC 16091 = IMI 112790 = MUCL
7974
Bambusa sp. India ——MH858608 NG_069711 —MW833997 ——
Cs. lavitskiae CBS 530.68
T
= ATCC 18666 = IMI 133984 Plant debris Ukraine ——KU563624 HQ231997 —MW833998 MW834271 —
Cs. viridescens CBS 102433 Tilia sp. Czech Republic ——KJ676148 KJ676185 MW834182 MW833999 KJ676343 —
Cosmosporella cavisperma CBS 172.31
ET
= NRRL 13996 Pinus sylvestris Norway ——MW827606 MW827645 JX171465 MW834000 ——
Cyanonectria buxi CBS 125551
ET
Dead terminal branches connected
with alive Buxus sempervirens
var. elegantissima
Slovenia ——NR_145049 MH875034 MW834183 MW834001 KM231939 —
C. cyanostoma CBS 101734
ET
= CBS 115512 = GJS 98-127 Buxus sempervirens France ——FJ474076 MH874353 MW834184 MW834002 HM626647 —
Dialonectria episphaeria CBS 125494 Old ascomycete ascomata Canada ——MH863609 MH875085 MW834185 HQ897756 KM231953 —
D. ullevolea CBS 125493 Ascomycete on Fagus americana USA ——KM231821 KM231696 —HQ897782 KM231952 —
Fusarium acutatum CBS 402.97
T
= BBA 69580 = FRC O-1117 = NRRL
13309
Unknown India —MW402459 ——MW402653 MW402768 MW402125 MW402323
F. agapanthi NRRL 54463
T
Agapanthus sp. Australia —KU900611 ——KU900620 KU900625 KU900630 KU900635
F. ananatum CBS 118516
T
= CMW 18685 = MRC 8165 Ananas comosus fruit South Africa —LT996175 ——LT996188 LT996137 LT996091 LT996112
F. andiyazi CBS 119857
T
= NRRL 31727 Sorghum bicolor soil debris South Africa —LT996176 ——LT996189 LT996138 LT996092 LT996113
F. anthophilum CBS 737.97 = DAOM 225119 = FRC M-1355 = IMI
375325 = NRRL 13602
Hippeastrum sp. Germany —LT996177 ——LT996190 LT996139 LT996093 LT996114
F. bactridioides NRRL 20476 Cronartium conigenum USA —AF158343 ——Not public Not public AF160290 U34434
F. begoniae CBS 403.97
T
= BBA 67781 = DAOM 225116 = IMI
375315 = NRRL 25300
Begonia elatior hybrid Germany —AF158346 ——LT996191 LT996140 AF160293 U61543
F. beomiforme CBS 740.97 = BBA 65829 = DAOM 225123 = IMI
375328 = NRRL 25174
Soil New Caledonia ——U61674 U61648 JX171506 JX171619 PVQB02000800* —
(continued on next page)
FUSARIUM REDELIMITED
www.studiesinmycology.org 19

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
F. brevicatenulatum CBS 404.97
T
= BBA 69197 = DAOM 225122 = IMI
375329 = NRRL 25446
Striga asiatica Madagascar —MW834108 ———MN534295 MN533995 MN534063
F. buharicum CBS 796.70 = ATCC 24135 = BBA 11122 = DSM
62165 = FRC R-4955 = IMI 141195 = NRRL 13371
Hibiscus cannabinus Iran ——U34581 U34552 JX171449 JX171563 ——
F. bulbicola CBS 220.76
T
= BBA 12293 = BBA 63628 = DAOM
225114 = IMI 202877 = IMI 375322 = NRRL 13618
Nerine bowdenii Germany —KF466327 ——KF466394 KF466404 KF466415 KF466437
F. circinatum CBS 405.97
T
= BBA 69720 = DAOM 225113 = IMI
375321 = MRC 7541 = NRRL 25331
Pinus radiata USA —KM231393 ——JX171510 HM068354 KM231943 KM232080
F. coicis NRRL 66233
T
= RBG 5368 Coix gasteenii Australia —LT996178 ——KP083269 KP083274 KP083251 LT996115
F. compactum NRRL 13829 River sediments Japan ——— — JX171460 JX171574 ——
F. concentricum CBS 450.97
T
= BBA 64354 = CBS 833.85 = DAOM
225146 = IMI 375352 = NRRL 25181
Musa sapientum Costa Rica —AF158335 ——LT996192 JF741086 AF160282 U61548
F. cugenangense CBS 130308 = NRRL 25387 = ATCC 26225 Human toe nail New Zealand ——MW827607 MW827646 JX171512 JX171625 MH485011 —
F. curvatum CBS 744.97 = IMI 375335 = NRRL 22902 Pseudotsuga menziesii USA —AF158365 ——LT996203 LT575065 AF160312 U34424
F. denticulatum CBS 735.97 = NRRL 25302 Ipomoea batatas USA —AF158322 ——LT996195 LT996143 AF160269 U61550
F. dlaminii CBS 119860
T
= BBA 69859 = FRC M-1637 = MRC
3032 = NRRL 13164
Soil debris in cornfield South Africa —AF158330 ——KU171681 KU171701 AF160277 U34430
F. echinatum CBS 146496 = CPC 30814 Unidentified tree South Africa —MW834109 ——MW834186 MW834003 MW834272 MW834300
CBS 146497
T
= CPC 30815 Unidentified tree South Africa —MW834110 ——MW834187 MW834004 MW834273 MW834301
F. equiseti CBS 245.61 = NRRL 20697 Beta vulgaris Chile ——MH858038 MH869603 JX171481 JX171595 ——
F. flocciferum CBS 831.85 = BBA 64346 = NRRL 25473 Triticum aestivum Germany ——— MW827647 JX171514 JX171627 ——
F. fracticaudum CBS 137234
PT
= CMW 25237 Pinus maximonoii Colombia —LT996179 ——LT996196 LT996144 KJ541059 KJ541051
F fractiflexum NRRL 28852
T
Cymbidium sp. Japan —AF158341 ——Not public LT575064 AF160288 AF160315
F. fredkrugeri CBS 144209
T
= CPC 33747 Melhania acuminata rhizosphere South Africa —LT996181 ——LT996199 LT996147 LT996097 LT996117
F. fujikuroi CBS 221.76
T
= BBA 12428 = BBA 63630 = IHEM
3821 = IMI 196086 = IMI 202879 = NRRL
13620 = NRRL 13998 = NRRL 22174
Oryza sativa Taiwan ——MW827608 MW827648 MW834188 MW834005 AF160279 —
NRRL 13566 = ATCC 38941 = DAOM 225143 = IMI
300793 = IMI 375349 = NRRL 5538 = NRRL A-26483
Oryza sativa China —AF158332 ——JX171456 JX171570 AF160279 U34415
F. globosum CBS 428.97
T
= DAOM 214966 = FRC M-8014 = IMI
375330 = MRC 6647 = NRRL 26131 = PREM 51878
Zea mays South Africa —KF466329 ——KF466396 KF466406 KF466417 KF466439
F. graminearum CBS 123657 = NRRL 31084 Zea mays USA ——DQ459823 DQ459823 JX171531 JX171644 AY452957 —
F. heterosporum CBS 720.79 = NRRL 20693 Claviceps purpurea on Lolium perenne Netherlands ——MW827609 MW827649 JX171480 JX171594 JAAGWP010000622.1* —
F. inflexum Vicia faba Germany —AF158366 ——JX171469 JX171583 AF008479 U34435
CROUS ET AL.
20

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
CBS 716.74
T
= ATCC 32213 = BBA 63203 = DAOM
225130 = DSM 63203 = IMI 375336 = NRRL 20433
F. konzum CBS 119849
T
= MRC 8427 Sorghastrum nuttans USA —LT996182 ——LT996200 LT996148 LT996098 LT996118
F. lactis CBS 411.97
ET
= BBA 68590 = DAOM 225145 = IMI
375351 = NRRL 25200
Ficus carica USA —AF158325 ——LT996201 LT996149 AF160272 U61551
F. lateritium NRRL 13622 = NRRL A-26433 Ulmus sp. USA ——— — JX171457 JX171571 ——
F. longipes NRRL 20723 = IMI 265540 Unknown England ——— — JX171483 JX171596 ——
F. mangiferae NRRL 25226 = BBA 69662 = DAOM 225155 = IMI
304063 = IMI 375361
Mangifera indica Israel —AF158334 ——JX171509 HM068353 AF160281 U61561
"F." melanochlorum CBS 202.65 = ATCC 16069 = BBA 9831 = DSM
62248 = NRRL 36353
Fagus sylvatica Austria ——MH858541 MH870179 JX171537 JX171649 ——
F. mexicanum NRRL 47473 Mangifera indica Mexico —GU737389 ——LR792579 LR792615 GU737416 GU737308
F. napiforme CBS 748.97
T
= BBA 69861 = DAOM 225147 = FRC
M-3563 = IMI 375353 = MRC 4144 = NRRL 13604
Pennisetum typhoides Namibia —AF158319 ——HM347136 EF470117 AF160266 U34428
F. nurragi CBS 392.96 = NRRL 36452 Soil Australia ——MW827610 MW827650 JX171538 JX171650 JAALXI010000436.1* —
F. nygamai CBS 749.97
T
= ATCC 58555 = BBA 69862 = DAOM
225148 = FRC M-1375 = IMI 375354 = NRRL 13448
Sorghum bicolor Australia —AF158326 ——LT996202 EF470114 AF160273 U34426
F. parvisorum CBS 137236
T
Pinus patula Colombia —LT996183 ———LT996150 KJ541060 KJ541055
F. phyllophilum CBS 216.76
T
= BBA 11730 = BBA 63625 = DAOM
225132 = IMI 202874 = IMI 375338 = NRRL 13617
Dracaena deremensis Italy —KF466333 ——KF466399 KF466410 KF466421 KF466443
F. poae NRRL 13714 = FRC T-503 = MRC 2181 Overwintered wheat Canada ——— — JX171458 JX171572 ——
F. prieskaense CPC 30825 Aloidendron dichotomum South Africa —MW834111 ——MW834189 MW834006 MW834274 MW834302
CBS 146498
T
= CPC 30826 Prunus spinosa South Africa —MW834112 ——MW834190 MW834007 MW834275 MW834303
CBS 146499 = CPC 30827 Prunus spinosa South Africa —MW834113 ——MW834191 MW834008 MW834276 MW834304
F. phyllophilum CBS 217.76 = BBA 11341 = BBA 63624 = DAOM
225133 = IMI 202873 = IMI 375339 = NRRL 22944
Cattleya sp. Germany —KF466333 U34558 U34529 JX171504 JX171617 AF160280 KF466443
F. pseudocircinatum CBS 449.97
T
= ATCC 24379 = BBA 69636 = CBS
126.73 = IMI 105384 = NRRL 22946
Solanum sp. Ghana —AF158324 ——LT996204 LT996151 AF160271 U34427
F. pseudograminearum CBS 109956
T
= NRRL 28062 Hordeum vulgare Australia ——DQ459871 DQ459871 JX171524 JX171637 AF212468 —
F. pseudonygamai CBS 417.97
T
= BBA 69552 = FRC M-1166 = IMI
375342 = NRRL 13592
Pennisetum typhoides Nigeria —AF158316 ——LT996205 LT996152 AF160263 U34421
F. ramigenum CBS 418.98
T
= BBA 68592 = DAOM 225137 = IMI
375343 = NRRL 25208
Ficus carica USA —KF466335 ——KF466401 KF466412 KF466423 KF466445
F. redolens CBS 743.97 = DAOM 225128 = IMI 375334 = NRRL
22901
Pseudotsuga menziesii Canada ——U34565 U34536 JX171503 JX171616 MT409452 —
(continued on next page)
FUSARIUM REDELIMITED
www.studiesinmycology.org 21

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
F. sacchari CBS 223.76
ET
= BBA 63340 = DAOM 225138 = IMI
202881 = NRRL 13999
Saccharum officinarum India —AF158331 ——JX171466 JX171580 AF160278 U34414
F. sambucinum CBS 146.95 = BBA 64226 = NRRL 22187 = NRRL
20727
Solanum tuberosum England ——— — JX171493 JX171606 MW834277 —
F. sarcochroum CBS 745.79 = BBA 63714 = NRRL 20472 Viscum album Switzerland ——MW827611 MW827651 JX171472 JX171586 MW834278 —
F. scirpi NRRL 13402 Soil Australia ——GQ505681 GQ505681 JX171452 JX171566 GQ505592 —
F. sororula CBS 137242
T
= CMW 40578 Pinus patula Colombia —LT996184 ——LT996206 LT996153 KJ541067 KJ541057
Fusarium sp. CBS 102163 = GJS 84-426 Bamboo Venezuela ——KM231812 KM231681 MW834193 MW834009 KM231940 —
F. sterilihyposum NRRL 25623 Mango South Africa —AF158353 ——MW402713 MN193897 AF160300 AF160316
F. stilboides NRRL 20429 = ATCC 15662 Coffea sp. Nyasaland ——— — JX171468 JX171582 ——
F. subglutinans CBS 747.97
ET
= BBA 62451 = DAOM 225141 = FRC
M-36 = MRC 8554 = NRRL 22016 = NRRL 22114
Zea mays USA —AF158342 ——JX171486 JX171599 AF160289 U34417
F. sublunatum CBS 189.34
T
= BBA 62431 = DSM 62431 = NRRL
20840 = NRRL 13384
Soil Costa Rica ——HQ897830 KM231680 JX171451 JX171565 ——
F. succisae CBS 219.76
ET
= BBA 12287 = BBA 63627 = DAOM
225142 = IMI 202876 = IMI 375347 = NRRL 13613
Succisa pratensis Germany —AF158344 ——LT996207 LT996154 AF160291 U34419
F. sudanense CBS 454.97
T
= BBA 65862 = NRRL 25451 = NRRL
26793
Striga hermonthica Sudan —LT996185 ——LT996208 LT996155 KU711697 KU603909
F. temperatum NRRL 25622 = NRRL 26616 Zea mays South Africa —AF158354 ——Not public Not public AF160301 AF160317
F. terricola CBS 483.94
T
= FRC M-1650 Soil Australia —KU603951 ——LT996209 LT996156 KU711698 KU603908
F. thapsinum CBS 733.97 = DAOM 225109 = IMI 375317 = MRC
6002 = NRRL 22045
Sorghum bicolor South Africa —LT996186 ——JX171487 JX171600 AF160270 U34418
F. tjaetaba CBS 144400
T
= NRRL 66243 = RBG 5361 Sorghum interjectum Australia —LT996187 ——MW834192 KP083275 KP083263 GU737296
F. torreyae CBS 133858
T
= NRRL 54151 Torreya sp. USA ——HM068344 MW827652 JX171548 JX171660 HM068337 —
F. tricinctum CBS 393.93
ET
= BBA 64485 = NRRL 25481 Winter wheat culm base Germany ——HM068317 HM068317 JX171516 JX171629 AB674263 —
F. tupiense NRRL 53984 Mangifera indica Brazil —GU737377 ——LR792583 LR792619 GU737404 GU737296
F. udum CBS 178.32 = BBA 1813 = DAOM 225111 = IMI
375319 = NRRL 22949
Lactarius pubescens Germany —AF158328 ——LT996220 LT996172 AF160275 U34433
F. venenatum NRRL 22196 = BBA 65031 Zea mays Germany ——— — JX171494 JX171607 ——
F. verticillioides CBS 734.97 = BBA 62264 = IMI 375318 = NRRL
22172
Zea mays Germany —AF158315 ——LT996221 EF470122 AF160262 U34413
F. xylarioides CBS 258.52
ET
= NRRL 25486 Coffea sp. Ivory Coast ——— — JX171517 HM068355 AY707136 AY707118
Fusicolla acetilerea Polluted soil Japan ——HQ897790 U88108 —HQ897701 ——
CROUS ET AL.
22

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
BBA 63789
T
= IMI 181488 = NRRL
20827
BBA 63789 = IMI 181488 = NRRL 20827 Polluted soil Japan HQ897839 —HQ897790 U88108 —HQ897701 ——
Fu. aquaeductuum CBS 734.79 = BBA 63669 = NRRL 20686 Drinking water Germany ——MW827612 MW827653 JX171476 HQ897742 MW847905 —
CBS 268.53 Rubber tubing Netherlands ——MH857190 MH868728 —— — —
CBS 837.85
ET
=BBA 64559 = NRRL 20865 = NRRL
37595
Plug in water tap Germany ——KM231823 KM231699 —— — KM232094
Fu. betae BBA 64317
ET
Triticum aestivum Germany HQ897917 —MH855265 MH866717 —HQ897781 ——
Fu. bharatavarshae NFCCI 4423
T
Avicennia marina India ——MK152510 MK152511 —MK157022 —MK376462
Fu. cassiae-fistulae MFLUCC 19-0318
T
Cassia fistula Thailand ——MT215497 MT215549 —— — —
Fu. epistroma BBA 62201
ET
= ATCC 24369 = IMI 85601 = NRRL
20439 = NRRL 20461
Diatrypella sp., on Betula sp. England HQ897901 —— AF228352 —HQ897765 ——
Fu. gigantispora HKAS 101990 Bruguiera sp. Thailand ——MN047106 MN017870 —— — —
MFLU 161206
T
Avicennia marina Thailand ——MN047105 MN017876 —— — —
Fu. matuoi CBS 581.78 = ATCC 18694 = MAFF 238445 = NRRL
20427
Albizzia julibrissin Japan HQ897858 —KM231822 KM231698 MW834194 HQ897720 KM231954 KM232093
Fu. melogrammae CBS 141092
T
Melogramma campylosporum on Carpinus sp. England ——KX897140 KY092489 —HQ897720 —MW834305
Fu. meniscoidea CBS 110189 = FRC E-0086 Soil Australia MW834043 —MW827613 MW827654 —MW834010 MW834279 MW834306
Fu. merismoides CBS 186.34 = BBA 1867a = NRRL 20895 Acer sp. Germany ——MH855482 MH866963 —— — —
Fu. ossicola CBS 140161
T
Bone of wild boar Belgium ——MF628022 MF628021 —MW834011 MW834280 MW834307
Fu. quarantenae URM 8367
T
= CBS 141541 Melocactus zehntneri Brazil ——MW553789 MW553788 —MW556626 MW556625 MW556624
Fu. septimanifiniscientiae CBS 144935
T
Soil Netherlands ——MK069422 MK069418 —— MK077808 MK069408
Fu. siamensis MFLUCC 17-2577
T
Cassia fistula Thailand ——MT215498 MT215550 —— — —
Fu. sporellula CBS 110191 = FRC E-0139 Soil South Africa MW834044 —MW827614 MW827655 —MW834012 MW834281 MW834308
Fu. violacea CBS 634.76
T
= BBA 62461 = NRRL 20896 Quadraspidiotus perniciosus Iran ——KM231824 U88112 MW834195 HQ897696 KM231956 KM232095
Geejayessia atrofusca CBS 125482 = DAOM 238117 Staphylea trifolia Canada ——MH863592 MH875066 MW834196 HQ897775 MW834282 —
NRRL 22316 Staphylea trifolia USA ——AF178423 AF178392 JX171496 EU329502 AF178361 —
G. celtidicola CBS 125502
T
Celtis occidentalis Canada HM626625 —HM626657 HM626669 MW834197 MW834013 HM626638 KM232074
G. cicatricum CBS 125550 Dead twig connected with alive Buxus sempervirens
var. elegantissima
Slovenia ——HM626654 HM626666 MW834198 HQ897697 HM626642 —
CBS 125552 Dead twig Slovenia HQ728171 —HQ728145 MH875038 —HQ728153 HM626644 —
Ilyonectria capensis CBS 132815
T
Protea sp. South Africa ——NR_152887 NG_070049 MW834199 MW834014 JX231119 —
I. destructans CBS 264.65 Cyclamen persicum Sweden ——MH858563 KM515927 —MW834015 JF735695 —
Luteonectria albida CBS 102683 = GJS 99-73 = GJS 8522A Tree bark Costa Rica ——MW827615 MH874402 MW834200 MW834016 MW834283 —
(continued on next page)
FUSARIUM REDELIMITED
www.studiesinmycology.org 23

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
NRRL 22152
T
= NRRL 13950 Woody stem bark Jamaica ——JABFEP010000142.1* JABFEP010000142.1* JX171492 JX171605 JABFEP010002685.1* —
L. nematophila NRRL 54600 Unknown Germany ——JABFFA010000104.1* JABFFA010000104.1* JX171552 JX171664 JABFFA010003988.1* —
Macroconia bulbipes CBS 146678 = CPC 37137 Erica sp. associated with Dimerosporiopsis engleriana South Africa MW834045 MW834114 MW827616 MW827656 MW834201 MW834017 —MW834309
CBS 146679
T
= CPC 37138 Erica sp. associated with Dimerosporiopsis engleriana South Africa MW834046 MW834115 MW827617 MW827657 MW834202 MW834018 —MW834310
Ma. cupularis HMAS 173240
T
Stylodothis sp. on unidentified tree China ——EF121864 EF121870 —— — —
Ma. gigas HMAS 173239
T
Rotten stem of bamboo associated with other fungi China ——EF121853 EF121869 —— — —
Ma. leptosphaeriae CBS 100001 Leptosphaeria on dead stem of Urtica dioica Netherlands HQ897891 MW834116 HQ897810 HQ897755 MW834203 HQ728164 KM231959 KM232097
Ma. papillionacearum CBS 125495 Ascomycete on Fabaceae USA HQ897912 MW834117 HQ897826 MH875086 MW834204 HQ897776 —KM232096
Ma. phlogioides CBS 125496 Quercus sp., branch in stream USA HQ897868 MW834118 MW827618 MW827658 MW834205 HQ897732 MW834284 MW834311
CBS 146500 = CPC 35388 Encephalartos sp. leaf South Africa MW834047 MW834119 MW827619 MW827659 MW834206 MW834019 —MW834312
CBS 146501
T
= CPC 35389 Encephalartos sp. leaf South Africa MW834048 MW834120 MW827620 MW827660 MW834207 MW834020 —MW834313
Ma. sphaeriae CBS 717.74 Pyrenomycete on Coronilla emerus France MW834049 MW834121 MW827621 MW827661 —KM232390 —KM232099
CBS 112770 Cucurbitaria laburni on Laburnum anagyroides Austria KM231061 KM231413 MW827622 MW827662 MW834208 MW834021 —KM232098
Mariannaea elegans DAOM 226709 Betula sp. Canada ——— HQ843768 —HQ897747 ——
M. samuelsii CBS 125515
T
= DAOM 235814 Soil Guatemala ——NR_137767 NG_060269 —HQ897752 ——
Microcera coccophila CBS 310.34 = NRRL 13962 Scale insect Italy ——MH855540 KM231703 JX171462 JX171576 ——
Mi. diploa CBS 735.79 = BBA 61173 = NRRL 36545 Quadraspidiotus perniciosus Iran ——MW827623 MW827663 JX171463 JX171577 ——
Mi. larvarum CBS 738.79 = BBA 62239 = DSM 62239 = MUCL
19033 = NRRL 20473
Quadraspidiotus perniciosus Iran ——KM231825 KM231701 JX171473 JX171587 KM231957 —
Mi. rubra CBS 638.76
IT
= BBA 62460 = NRRL 20475; NRRL
22111; NRRL 22170
Quadraspidiotus perniciosus on Prunus domestica Iran HQ897903 KM231409 MH861019 MH872790 —HQ897767 —MW834314
Microcera sp. NRRL 26790 Parmelia rudecta USA ——— — JX171523 JX171636 ——
Nectria cinnabarina CBS 125165
ET
Aesculus sp. France KM231074 —HM484548 HM484562 —KM232402 HM484527 —
"Nt." flavoviridis CBS 124353 = BBA 65542 = NRRL 22093 Decorticated wood USA ——HQ897791 MW827664 MW834209 HQ897702 ——
Neocosmospora acutispora CBS 145461
T
= NRRL 22574 = BBA 62213 Coffea arabica Guatemala MW834050 MW834122 LR583700 LR583908 MW834210 LR583814 LR583593 —
N. addoensis CBS 146509 = CPC 37127 Citrus sinensis South Africa MW218004 MW218051 MW173041 MW173032 MW218097 MW446574 MW248740 —
CBS 146510
T
= CPC 37128 Citrus sinensis South Africa MW218005 MW218052 MW173042 MW173033 MW218098 MW446575 MW248741 —
N. ambrosia CBS 571.94
ET
= NRRL 22346 = BBA 65390 = MAFF
246287
Euwallacea fornicatus India —— EU329669 EU329669 MW834211 EU329503 FJ240350 —
NRRL 20438 = IMI 296597 Xyleborus fornicatus India —— AF178397 AF178366 JX171470 JX171584 NIZV01000014.1* —
N. ampla CBS 202.32
T
= BBA 4170 Coffea sp. German East Africa MW834051 MW834123 LR583701 LR583909 MW834212 LR583815 LR583594 —
N. bataticola CBS 144397 = NRRL 22400 = BBA 64683 Ipomoea batatas USA MW218006 MW218053 AF178407 AF178376 MW218099 EU329509 AF178343 —
CBS 144398
T
= NRRL 22402 = BBA 64954 = FRC S-
0567
Ipomoea batatas USA MW218007 MW218054 AF178408 AF178377 MW218100 FJ240381 AF178344 —
CROUS ET AL.
24

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
N. borneensis CBS 145462
ET
= NRRL 22579 = BBA 65095 = GJS
85-197
Bark or recently dead tree Indonesia MW834052 MW834124 AF178415 AF178384 MW834213 EU329515 AF178352 —
N. bostrycoides CBS 144.25
NT
Soil Honduras MW218008 MW218055 LR583704 LR583912 MW218101 LR583818 LR583597 —
CBS 392.66 = NRRL 25325 = BBA 69595 Bertholletia excelsa Unknown MW218009 MW218056 LR583705 LR583913 MW218102 LR583819 LR583598 —
N. brevicona CBS 204.31
ET
= NRRL 22659 = BBA 2123 Gladiolus sp. Indonesia MW218010 MW218057 LR583707 LR583915 MW218103 LR583821 LR583600 —
N. brevis CBS 130326 = NRRL 28009 = CDC B-5543 Human eye USA MW834053 MW834125 DQ094351 DQ236393 MW834214 EF470136 DQ246869 —
N. catenata CBS 143228 = NRRL 54992 = UTHSC 09-1008 Stegostoma fasciatum USA MW218011 MW218058 KC808255 KC808255 MW218104 KC808354 KC808213 —
CBS 143229
T
= NRRL 54993 = UTHSC 09-1009 Stegostoma fasciatum USA MW218012 MW218059 KC808256 KC808256 MW218105 KC808355 KC808214 —
N. citricola CBS 146512 = CPC 37130 Citrus sinensis South Africa MW218014 MW218061 MW173047 MW173035 MW218107 MW446580 MW248746 —
CBS 146513
T
= CPC 37131 Citrus sinensis South Africa MW218015 MW218062 MW173048 MW173036 MW218108 MW446581 MW248747 —
N. crassa CBS 144386
T
= MUCL 11420 Unknown France MW218016 MW218063 LR583709 LR583917 MW218109 LR583823 LR583604 —
N. cryptoseptata CBS 145463
T
= NRRL 22412 = BBA 65024 Bark French Guiana MW834054 MW834126 AF178414 AF178383 MW834215 EU329510 AF178351 —
N. cucurbitae CBS 410.62 = NRRL 22658 = CECT 2864 Cucurbita viciifolia Netherlands MW834055 MW834127 LR583710 LR583918 MW834216 LR583824 DQ247640 —
CBS 616.66
T
= NRRL 22399 = BBA 64411 Cucurbita viciifolia Netherlands MW834056 MW834128 LR583711 LR583919 MW834217 LR583825 DQ247592 —
N. cyanescens CBS 518.82
T
Human foot Netherlands MW218017 MW218064 AB190389 LR583920 MW218110 LR583826 LR583605 —
CBS 637.82 Human foot Netherlands MW218018 MW218065 LR583712 LR583921 MW218111 LR583827 LR583606 —
N. diminuta CBS 144390
T
= MUCL 18798 Coelocaryon preusii Unknown MW834057 MW834129 LR583713 LR583922 MW834218 LR583828 LR583607 —
N. elegans CBS 144395 = NRRL 22163 = MAFF 238540 = ATCC
18690
Xanthoxylum piperitum Japan MW218019 MW218066 AF178394 AF178363 MW218112 EU329496 AF178328 —
CBS 144396
ET
= NRRL 22277 = MAFF
238541 = ATCC 42366
Xanthoxylum piperitum Japan MW218020 MW218067 AF178401 AF178370 MW218113 FJ240380 AF178336 —
N. epipeda CBS 146523
T
= CPC 38310 Bouvardia sp. imported from Uganda Netherlands MW834058 MW834130 MW827624 MW827665 MW834219 MW834022 MW834285 —
CBS 146524 = CPC 38311 Bouvardia sp. imported from Uganda Netherlands MW834059 MW834131 MW827625 MW827666 MW834220 MW834023 MW834286 —
N. euwallaceae CBS 135854
T
= NRRL 54722 Euwallacea sp. Israel ——JQ038014 JQ038014 JQ038021 JQ038028 JQ038007 —
N. falciformis CBS 475.67
T
= IMI 268681 Human mycetoma Puerto Rico MW218021 MW218068 MG189935 MG189915 MW218114 LT960558 LT906669 —
CBS 121450 Declined grape vine Syria MW218022 MW218069 JX435211 JX435211 MW218115 JX435261 JX435161 —
NRRL 43529 = CDC 2006743575 Human cornea USA ——EF453117 EF453117 JX171541 JX171653 EF452965 —
N. ferruginea CBS 109028
T
= NRRL 32437 Human subcutaneous nodule Switzerland MW834060 MW834132 DQ094446 DQ236488 MW834221 EU329581 DQ246979 —
CPC 28194 Citrus sinensis Italy MW834061 MW834133 LT746276 LT746276 MW834222 LT746341 LR583602 —
N. floridana NRRL 62628
T
= MAFF 246849 Euwallacea interjectus USA ——KC691563 KC691563 KC691593 KC691624, KC691653 KC691535 —
N. gamsii CBS 143207
T
= NRRL 32323 = UTHSC 99-205 Human bronchoalveolar lavage fluid USA MW834062 MW834134 DQ094420 DQ236462 MW834223 EU329622 DQ247103 —
CBS 143211 = NRRL 32794 = FRC S-1152 Humidifier coolant USA MW834063 MW834135 DQ094563 DQ236605 MW834224 EU329576 DQ246951 —
N. gamtoosensis CBS 146502
T
= VG16 = CPC 37120 Citrus sinensis South Africa MW218023 MW218070 MW173063 MW173038 MW218116 MW446611 MW248762 —
N. haematococca CBS 119600
ET
= FRC S-1832 Dying tree Sri Lanka MW834064 MW834136 KM231797 KM231664 —LT960561 DQ247510 —
(continued on next page)
FUSARIUM REDELIMITED
www.studiesinmycology.org 25

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
N. hypothenemi CBS 145464
T
= NRRL 52782 = ARSEF 5878 Hypothenemus hampei Benin MW218024 —LR583715 LR583923 MW218117 JF741176 JF740850 —
CBS 145466 = NRRL 52783 = ARSEF 5879 Hypothenemus hampei Uganda MW218025 MW218071 MW827626 MW827667 MW218118 MW834024 MW834287 —
N. illudens CBS 147303 = NRRL 22090 = BBA 67606 = GJS 82-
98
Beilschmiedia tawa New Zealand MW834065 MW834137 AF178393 AF178362 JX171488 JX171601 AF178326 —
N. ipomoeae CBS 353.87 = NRRL 22657 Gerbera sp. Netherlands MW218026 MW218072 LR583717 LR583925 MW218119 LR583831 DQ247639 —
CBS 833.97 Rosa sp. Netherlands MW218027 MW218073 LR583719 LR583927 MW218120 LR583833 LR583611 —
N. keleraja CBS 125720
PT
= FRC S-1837 = GJS 02-114 Branch of unidentified tree Sri Lanka MW834066 MW834138 LR583720 LR583928 MW834225 LR583834 LR583612 —
CBS 125722
PT
= FRC S-1836 = GJS 02-114 Branch of unidentified tree Sri Lanka MW834067 MW834139 JF433039 JF433039 MW834226 LR583835 DQ247515 —
N. keratoplastica CBS 490.63
T
Human Japan MW218028 MW218074 LR583721 LR583929 MW218121 LT960562 LT906670 —
CBS 144389 = MUCL 18301 Greenhouse humic soil Belgium MW218029 MW218075 LR583722 LR583930 MW218122 LR583836 LR583613 —
N. kuroshio CBS 142642
T
Euwallacea sp. USA MW834068 MW834140 LR583723 LR583931 MW834227 LR583837 KX262216 —
N. kurunegalensis CBS 119599
T
= GJS 02-94 Recently cut tree Sri Lanka MW834069 MW834141 JF433036 JF433036 MW834228 LR583838 DQ247511 —
N. lerouxii CBS 146514
T
= CPC 37132 Citrus sinensis South Africa MW218030 MW218076 MW173069 MW173039 MW218123 MW446617 MW248768 —
N. lichenicola CBS 509.63 = MUCL 8050 = IMUR 410 Air Brazil MW834070 MW834142 LR583728 LR583936 MW834229 LR583843 LR583618 —
CBS 623.92
ET
Human Germany MW834071 MW834143 LR583730 LR583938 —LR583845 LR583620 —
N. liriodendri CBS 117481
T
= NRRL 22389 = BBA 67587 = GJS 91-
148
Liriodendron tulipifera USA MW218031 MW218077 AF178404 AF178373 MW218124 EU329506 AF178340 —
N. longissima CBS 126407
T
= GJS 85-72 Tree bark New Zealand MW834072 MW834144 LR583731 LR583939 MW834230 LR583846 LR583621 —
N. macrospora CBS 142424
T
= CPC 28191 Citrus sinensis Italy MW218032 MW218078 LT746266 LT746281 MW218125 LT746331 LT746218 —
CPC 28193 Citrus sinensis Italy MW218033 MW218079 LT746268 LT746283 MW218126 LT746333 LT746220 —
N. mahasenii CBS 119594
T
Dead branch on live tree Sri Lanka MW834073 MW834145 JF433045 JF433045 MW834231 LT960563 DQ247513 —
N. martii CBS 115659
ET
= FRC S-0679 = MRC 2198 Solanum tuberosum Germany MW834074 MW834146 JX435206 JX435206 MW834232 JX435256 JX435156 —
N. merkxiana CBS 146525
T
Chrysanthemum sp. imported from Uganda Netherlands MW834075 MW834147 MW827627 MW827668 MW834233 MW834025 MW834288 —
CBS 146526 Chrysanthemum sp. imported from Uganda Netherlands MW834076 MW834148 MW827628 MW827669 MW834234 MW834026 MW834289 —
N. metavorans CBS 135789
T
Human pleural effusion Greece MW218034 MW218080 LR583738 LR583946 MW218127 LR583849 LR583627 —
CBS 143219 = NRRL 46708 = FMR 8634 Human foot Spain MW218035 MW218081 LR583744 LR583948 MW218128 LR583851 LR583629 —
N. mori CBS 145467
T
= NRRL 22230 = MAFF 238539 Morus alba Japan MW834077 MW834149 DQ094305 DQ236347 MW834235 EU329499 AF178358 —
CBS 145468 = NRRL 22157 = MAFF 238538 Morus alba Japan MW834078 MW834150 DQ094306 DQ236348 MW834236 EU329493 AF178359 —
N. neerlandica CBS 232.34
T
Pisum sativum Netherlands MW834079 MW834151 MW827629 MW827670 MW834237 MW847903 MW847906 —
N. nelsonii CBS 309.75
T
Pisum sativum Unknown MW834080 MW834152 MW827630 MW827671 MW834238 MW847904 MW847907 —
N. nirenbergiana CBS 145469
T
= NRRL 22387 = BBA 65023 = GJS 87-
127
Bark French Guiana MW834081 MW834153 AF178403 AF178372 —EU329505 AF178339 —
N. noneumartii CBS 115658
T
= FRC S-0661 Solanum tuberosum Israel MW218036 MW218082 LR583745 LR583949 MW218129 MW446618 LR583630 —
N. obliquiseptata NRRL 62611 = MAFF 246845 Euwallacea sp. Australia ——KC691576 KC691576 KC691606 KC691637, KC691666 KC691548 —
CROUS ET AL.
26

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
N. oblonga CBS 130325
T
= NRRL 28008 = CDC B-4701 Human eye USA MW834082 MW834154 LR583746 LR583950 MW834239 LR583853 LR583631 —
N. oligoseptata CBS 143241
T
= NRRL 62579 = FRC
S-2581 = MAFF 246283
Euwallacea validus USA MW834083 MW834155 KC691566 KC691566 KC691596 LR583854 KC691538 —
N. paraeumartii CBS 487.76
T
= NRRL 13997 = BBA 62215 Solanum tuberosum Argentina MW834084 MW834156 LR583747 LR583951 MW834240 LR583855 DQ247549 —
N. parceramosa CBS 115695
T
Soil South Africa MW218037 MW218083 JX435199 JX435199 —JX435249 JX435149 —
N. perseae CBS 144142
T
= CPC 26829 Persea americana Italy MW218038 MW218084 LT991940 LT991947 MW218130 LT991909 LT991902 —
N. petroliphila CBS 203.32 = NRRL 13952 Pelargonium sp. South Africa MW218039 MW218085 DQ094320 DQ236362 MW218131 LR583857 DQ246835 —
CBS 224.34 = NRRL 28579 Human toenail Cuba MW218040 MW218086 DQ094383 DQ236425 MW218132 LR583858 DQ246910 —
N. phaseoli CBS 265.50 Phaseolus sp. USA MW834085 MW834157 LR583750 LR583954 —KJ511278 FJ919464 —
NRRL 22276 = ATCC 38466 Phaseolus vulgaris USA ——EU329668 EU329668 JX171495 JX171608 AY220186 —
N. piperis CBS 145470
T
= NRRL 22570 = GJS
89-14 = CML 1888
Piper nigrum Brazil MW834086 MW834158 AF178422 AF178391 MW834241 EU329513 AF178360 —
N. pisi CBS 123669
ET
= NRRL 45880 = ATCC MYA-4622 Progeny of parentals from Pisum sativum and soil USA MW834087 MW834159 LR583753 LR583957 MW834242 LR583862 LR583636 —
CBS 142372 Trifolium subterraneum Germany MW834088 MW834160 LR583755 LR583959 MW834243 LR583864 KY556454 —
N. plagianthi NRRL 22632 = GJS 83-146 Hoheria glabrata New Zealand ——AF178417 AF178386 JX171501 JX171614 AF178354 —
N. protoensiformis CBS 145471
T
= NRRL 22178 = GJS 90-168 Dicot tree Venezuela MW834089 MW834161 AF178399 AF178368 MW834244 EU329498 AF178334 —
N. pseudensiformis CBS 130.78 = NRRL 22575 = NRRL 22653 Cocos nucifera Indonesia MW834090 MW834162 LR583759 LR583963 MW834245 LR583868 DQ247635 —
N. pseudopisi CBS 266.50 Pisum sativum Unknown MW834091 MW834163 MW827631 MW827672 MW834246 MW834027 MW834290 —
N. pseudoradicicola CBS 145472
T
= NRRL 25137 = ARSEF 2313 Diseased cocoa pods Papua New Guinea MW218041 MW218087 JF740899 JF740899 MW218133 JF741084 JF740757 —
N. quercicola CBS 141.90
T
= NRRL 22652 Quercus cerris Italy MW834092 MW834164 LR583760 LR583964 MW834247 LR583869 DQ247634 —
N. rectiphora CBS 125726 = FRC S-1842 Dead tree Sri Lanka MW834093 MW834165 JF433043 JF433043 MW834248 MW834028 JF433026 —
CBS 125727
T
= GJS 02-89 = FRC S-1831 Dead tree Sri Lanka MW834094 MW834166 JF433034 JF433034 MW834249 LR583871 DQ247509 —
N. regularis CBS 190.35 Phaseolus sp. USA MW834095 MW834167 LR583762 LR583966 MW834250 LR583872 LR583642 —
CBS 230.34
T
Pisum sativum Netherlands MW834096 MW834168 LR583763 LR583967 —MW834029 LR583643 —
N. rekana CMW 52862
T
Euwallacea perbrevis Indonesia ——MN249094 ——MN249137, MN249108 MN249151 —
N. robusta CBS 145473
T
= NRRL 22395 = BBA 65682 Bark Venezuela —MW834169 AF178405 LR583968 MW834251 EU329507 AF178341 —
N. samuelsii CBS 114067
T
= GJS 89-70 Bark Guyana MW834097 MW834170 LR583764 LR583969 MW834252 LR583874 LR583644 —
N. silvicola CBS 119601 = GJS 98-135 Populus nigra France MW834098 MW834171 LR583765 LR583970 MW834253 LR583875 LR583645 —
CBS 123846
T
= GJS 04-147 Liriodendron tulipifera USA MW834099 MW834172 LR583766 LR583971 MW834254 LR583876 LR583646 —
N. solani CBS 140079
ET
= NRRL 66304 = GJS
09-1466 = FRC S-2364
Solanum tuberosum Slovenia MW218042 MW218088 KT313633 KT313633 MW218134 KT313623 KT313611 —
N. spathulata CBS 145474
T
= NRRL 28541 = UTHSC 98-1305 Human synovial fluid USA MW218045 MW218091 EU329674 EU329674 MW218137 EU329542 DQ246882 —
N. stercicola CBS 142481
T
= DSM 106211 Compost yard debris Germany MW834100 MW834173 LR583779 LR583984 MW834255 LR583887 LR583658 —
(continued on next page)
FUSARIUM REDELIMITED
www.studiesinmycology.org 27

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
CBS 144388 = MUCL 18299 Greenhouse humic soil Belgium MW834101 MW834174 LR583780 LR583985 MW834256 LR583888 LR583659 —
N. suttoniana CBS 143214
T
= NRRL 32858 Human wound USA MW218046 MW218092 DQ094617 DQ236659 MW218138 EU329630 DQ247163 —
CBS 143224 = NRRL 54972 Equine eye USA MW218047 MW218093 MG189940 MG189925 MW218139 KC808336 KC808197 —
N. tonkinensis CBS 115.40
T
Musa sapientum Vietnam MW218048 MW218094 MG189941 MG189926 MW218140 LT960564 LT906672 —
CBS 118931 Solanum lycopersicum UK MW218049 MW218095 LR583784 LR583989 MW218141 LR583891 LR583662 —
N. tuaranensis NRRL 22231
T
= ATCC 16563 = MAFF 246842 Hevea brasiliensis damaged by unknown ambrosia
beetle
Malaysia ——KC691570 KC691570 KC691600 KC691631, KC691660 KC691542 —
N. vasinfecta CBS 325.54 = ATCC 16238 = IFO 7591 = IMI
251386 = NRRL 22436
Soil South Africa ——AF178412 AF178381 JX171497 JX171610 AF178348 —
CBS 446.93 = IMI 316967 = NHL 2919 Soil Japan MW834102 MW834175 LR583791 LR583996 MW834257 LR583898 LR583670 —
CBS 533.65 = IMI 302625 Unknown India MW834103 MW834176 LR583792 LR583997 MW834258 LR583899 LR583671 —
Neonectria coccinea CBS 125484 Fagus sylvatica Germany ——HQ897832 MH875068 MW834259 HQ897785 ——
Ne. ditissima CBS 125486 Fagus americana Canada ——HQ897824 MH877864 —HQ897774 ——
Nothofusarium devonianum CBS 147304
T
= NRRL 22134 Ruscus aculeatus United Kingdom ——MW827632 MW827673 JX171490 JX171603 MW834291 —
Pseudofusicolla belgica CBS 147300 = IHEM 5322 Recycled water from air-conditioning humidifier Belgium ——KJ125590 KJ126478 —KP835473 KJ126182 —
CBS 147301
T
= IHEM 2413 Recycled water, spray humidifier in air-conditioned
building
Belgium ——KJ125588 KJ126476 —KP835474 KJ126180 —
CBS 147302 = IHEM 2440 Humidifier water from air-conditioning Belgium ——KJ125589 KJ126477 —KP835475 KJ126181 —
IHEM 2105 Recycled humidifier water from airconditioning Belgium ——KP835478 KP835480 —KP835476 KP835484 —
Rectifusarium robinianum CBS 430.91
T
= NRRL 25729 Robinia pseudoacacia Germany ——KM231794 NG_058096 JX171520 JX171633 KM231923 —
R. ventricosum CBS 748.79
T
= BBA 62452 = NRRL 20846 = NRRL
22113
Wheat field soil Germany ——HQ897816 KM231658 JX171484 JX171597 KM231924 —
Rugonectria castaneicola CBS 128360 Bark China ——MH864901 MH876352 MW834260 MW834030 MW834292 —
Ru. neobalansae CBS 125120 = GJS 85-219 Dead tree Indonesia ——KM231750 HM364322 —MW834031 KM231874 —
Ru. rugulosa CBS 126565 = GJS 09-1245 Dead wood Venezuela ——KM231749 MH877897 MW834261 MW834032 KM231873 —
Setofusarium setosum CBS 574.94 = BBA 65063 Unknown French Guiana ——MW827633 MW827674 MW834262 MW834033 MW834293 —
CBS 635.92
ET
= GJS 88-12 = NRRL 36526 Tree bark French Guiana ——MW827634 MW827675 JX171539 JX171651 MW834294 —
Scolecofusarium ciliatum CBS 155.86 = NRRL 22284 Hordeum vulgare mouldy grain, associated with scale
insects
Denmark ——MW827635 MW827676 MW834263 MW834034 MW834295 —
CBS 191.65
NT
= ATCC 16068 = ATCC 24137 = BBA
9661 = DSM 62172 = IMI 112499 = NRRL 20431
Fagus sylvatica Germany ——MW827636 MW827677 MW834264 MW834035 MW834296 —
CBS 144385 = IHEM 2989 Fagus sylvatica Belgium ——KJ125591 KJ126479 MW834265 KP835472 MW834297 —
Stylonectria applanata CBS 125489 Unidentified ascomycete on Betula sp. Canada HQ897875 —HQ897805 KM231689 —HQ897739 KM231944 —
St. carpini DAOM 235819 Melanconis spodiaea on Carpinus betulus Austria HQ897909 —HQ897823 ——HQ897773 ——
St. corniculata CBS 125491
T
Unidentified ascomycete on Carpinus sp. Germany HQ897915 —HQ897829 KM231691 —HQ897779 KM231946 —
St. hetmanica CBS 147305
T
= CPC 38725 Diaporthe sp. on Frangula alnus Ukraine MW834104 —MW827637 ——MW834036 ——
CROUS ET AL.
28

Table 3. (Continued).
Species name Strain
1
Substrate Country GenBank accession number
2
acl1 CaM ITS LSU rpb1 rpb2 tef1 tub2
CBS 147306 = CPC 38848 Dothiorella sarmentorum on Acer platanoides Ukraine MW834105 —MW827638 ——MW834037 ——
St. norvegica CBS 139239
T
Dead sporodochia of fusarium state on pyrenomycete
(presumably Amphiporthe sp.)
Norway MW834106 —KR605485 ——MW834038 ——
CBS 139242 On sporodochia of fusarium-like on unidentified
pyrenomycete
Norway MW834107 —MW827639 ——MW834039 ——
St. purtonii DAOM 235818 Picea abies Germany HQ897919 —HQ897831 ——HQ897783 ——
St. qilianshanensis HMAS 255803
T
Unknown ascomycete on Picea asperata China MT087289 ————MT087288 ——
St. wegelianiana CBS 125490 Hapalycystis bicaudata on Ulmus glabra Austria HQ897890 —KM231817 KM231690 —HQ897754 KM231945 —
Thelonectria discophora CBS 125487 Aesculus hippocastanum Germany ——HQ897789 MW827678 MW834266 HQ897700 MW834298 —
T. olida CBS 215.67
NT
= ATCC 16548 = DSM 62520 = IMI
116873
Asparagus officinalis Germany ——MW827640 MW827679 MW834267 MW834040 MW834299 —
Tumenectria laetidisca CBS 100284 Bamboo Japan ——KJ022017 KJ022066 —MW834041 KJ022400 —
CBS 101909
ET
Bamboo Jamaica ——KJ022018 KJ022067 MW834268 MW834042 KJ022401 —
1
ARSEF: Collection of entomopathogenic fungal cultures, US Department of Agriculture (USDA), Agricultural Research Service (ARS), Ithaca, NY, USA; ATCC: American Type Culture Collection, Manassas, VA, USA; BBA: Biologische Bundesanstalt
für Land- und Forstwirtschaft, Institut für Mikrobiologie, Berlin, Germany; CBS: Westerdijk Fungal Biodiverity Institute (WI), Utrecht, The Netherlands; CDC: Centers for Disease Control and Prevention, Atlanta, GA, USA; CECT: Spanish Type Culture
Collection, Universidad de Valencia, Burjassot, Spain; CML: Coleç~
ao Micol
ogica de Lavras, Universidade Federal de Lavras, Minas Gerais, Brazil; CMW: Culture collection at the FABI, University of Pretoria, South Africa; CPC: Collection of P.W. Crous,
held at WI; DAOM: Canadian National Mycological Herbarium and Culture Collection, AAFC, Ottawa, Ontario, Canada; DSM: DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany; FMR: Facultat de
Medicina i Ci
encies de la Salut, Reus, Spain; FRC: Fusarium Research Center, Pennsylvannia State University, PA, USA; GJS: Collection of G.J. Samuels, USDA-ARS, USA; HKAS: Herbarium of Cryptogams, Kunming Institute of Botany, Kunming,
China; HMAS: Herbarium Mycologicum Academiae Sinicae, Chinese Academy of Sciences, Beijing, China; IFO: Institute for Fermentation, Osaka, Yodogawa-ku, Osaka, Japan; IHEM: Biomedical Fungi and Yeasts Collection, Scientific Institute of
Public Health, Belgium; IMI: CABI Bioscience, Egham, UK; IMUR: Institute of Mycology, University of Recife, Recife, Brazil; MAFF: Ministry of Agriculture, Forestry and Fisheries, Tsukuba, Ibaraki, Japan; MFLU: Mae Fah Luang University herbarium,
Chiang Rai, Thailand; MRC: Microbial Culture Collection, South African Medical Research Council, Tygerberg, South Africa; MUCL: Mycoth
eque de
lUniversit
e Catholique de Louvain, Louvain-la-Neuve, Belgium; NHL: National Institute of Hygienic
Sciences, Tokyo, Japan; NRRL: Agricultural Research Service Culture Collection, National Center for Agricultural Utilization Research, USDA, Peoria, IL, USA; RBG: Royal Botanic Gardens Trust, Sydney, New South Wales, Australia; URM: Micoteca
do Departmento de Micologia, Universidade Federal de Pernambuco, Recife, Brazil; UTHSC: Fungus Testing Laboratory, Department of Pathology, University of Texas Health Science Center, San Antonio, USA. ET:Ex-epitype; IT: Ex-isotype; NT: Ex-
neotype; PT: Ex-paratype; T: Ex-type.
2
acl1 = ATP citrate lyase; CaM = Calmodulin; ITS = Internal transcribed spacer region of the nrDNA; LSU = 28S large subunit of the nrDNA; rpb1 = RNA polymerase largest subunit; rpb2 = RNA polymerase second largest subunit; tef1 = translation
elongation factor 1-alpha; tub2 = Beta-tubulin. Sequences generated in this study are shown in bold; Not public = sequences not available at GenBank, obtained from K. O’Donnell's alignment datasets; * = Whole genome sequence contig accession
numbers.
FUSARIUM REDELIMITED
www.studiesinmycology.org 29

generalized time-reversible (GTR) model and applying the
partitioning option, which estimates the Gamma-shape
parameter and the proportion of invariable sites for every gene
separately. Again 1000 bootstraps were calculated to estimate
branch support. Bayesian inference was conducted using
MrBayes v. 3.2.7 (Ronquist & Huelsenbeck 2003) with the
partitioned dataset. The Gamma-shape parameter and pro-
portion of invariable sites were estimated independently for
each partition. MrBayes was run for 5 M generations with
every 500
th
tree sampled and a burn-in of 30 % of the sampled
trees to ensure sampling from the stationary phase. All other
parameters were set to default.
Morphology
Morphological characterisation followed standard procedures
as described by Leslie & Summerell (2006) using PDA, SNA
(Nirenberg 1976), and CLA (Fisher et al. 1982). Colony
morphology and pigmentation were evaluated on PDA after 7
to 14 d at 25 °C in darkness. Colour notation was based on
the colour charts of Rayner (1970). Fungarium specimens were
rehydrated in 3 % aqueous KOH for a few minutes and then
rinsed by replacing the KOH solution with sterile distilled water
or 100 % lactic acid (Samuels 1976a,b,Samuels et al. 1990).
Unless otherwise mentioned, micromorphological characters
Table 4. Summary of phylogenetic information generated in this study.
Analysis Nuclear
region
Length + gap PI Var. BI unique
site patterns
Model (AIC) Model (BIC) ML -InL (IQ)
Generic delimitation ITS 626 249 310 378 GTR+I+G TIMe+I+G4 -3099.276
LSU 435 90 109 118 GTR+I+G TIM2+F+I+G4 -15223.682
rpb1 1 371 705 755 823 GTR+I+G TIM3e+I+G4 -27263.487
rpb2 1 761 834 892 989 GTR+I+G GTR+F+I+G4 -8493.378
tef1 699 448 489 551 GTR+I+G TIM2e+I+G4 -40875.16
Combined 4 892 2 326 2 555 2 859 n/d n/d -94954.982
Ex-type strains rpb1 1 724 980 550 1 358 GTR+I+G TIM3e+R4 -37377.092
rpb2 1 789 788 916 1 056 GTR+I+G TIM2e+R6 -44286.314
tef1 859 463 301 700 GTR+I+G GTR+F+I+G4 -25546.628
Combined 4 372 2 231 1 767 3 114 n/d n/d -113450.62
Fusarium fujikuroi
species complex
CaM 545 76 131 150 SYM+G G4TNe+G4 -4032.663
rpb1 1 534 201 340 344 SYM+G TIM2e+G4 -5669.761
rpb2 1 541 241 362 365 GTR+I+G TNe+G4 -7415.729
tef1 676 137 243 305 GTR+I+G TNe+I+G4 -2062.906
tub2 488 76 150 182 SYM+G TNe+G4 -1930.688
Combined 4 794 731 1 226 1 346 n/d n/d -22043.423
Fusicolla acl1 908 153 346 241 GTR+G TNe+I -3238.214
ITS 518 54 111 128 GTR+I+G TIM2e+I+G4 -1704.698
LSU 476 34 69 72 K80+I K80+R2 -1229.69
rpb2 1 702 258 447 359 SYM+I+G TIM2e+G4 -5692.247
tef1 476 109 216 202 SYM+I TIM2+F+G4 -2051.471
tub2 484 83 162 159 GTR+G K80+G4 -1780.157
Combined 4 564 691 1 351 1 161 n/d n/d -16092.82
Macroconia acl1 801 207 332 205 SYM+I K80+I -1241.031
CaM 551 150 223 159 K80+I K80+I -2092.487
ITS 540 36 64 94 GTR+I TNe+G4 -2259.518
LSU 694 21 37 3 GTR+I TNe+I -3097.338
rpb1 814 116 182 96 SYM+G TNe+G4 -2620.526
rpb2 778 160 618 151 SYM+I TNe+G4 -1784.381
tub2 519 101 168 142 SYM+G TNe+G4 -1205.535
Combined 4 697 791 1 624 850 n/d n/d -14388.257
Neocosmospora acl1 630 173 271 297 K80+I+G TIM3e+I+G4 -13572.514
CaM 586 171 231 280 HKY+I+G TIM2e+R3 -5595.928
ITS 476 119 357 211 GTR+I+G TNe+G4 -4164.678
LSU 482 36 63 76 GTR+I+G TIM3e+I+G4 -10056.777
rpb1 1 492 390 506 636 GTR+I+G TIM2e+R3 -2888.743
rpb2 1 613 449 564 621 GTR+I+G TIM2e+I+G4 -1496.116
tef1 688 230 323 370 GTR+I+G K80+G4 -4087.046
Combined 5 967 1 568 2 315 2 491 n/d n/d -46528.083
Stylonectria acl1 897 254 426 416 GTR+G K80+I -1022.317
ITS 544 21 39 47 HKY+I TNe+G4 -5181.494
rpb2 1 631 183 442 299 GTR+G TNe+G4 -4061.543
Combined 3 072 458 907 762 n/d n/d -10441.718
PI = parsimony informative characters; Var. = variable characters; BI = Bayesian inference; Model (AIC) = evolutionary model selected by MrModeltest; Model
(BIC) = evolutionary model selected by ModelFinder in IQ-TREE; ML -InL (R) = best tree score determined using RAxML; ML -InL(IQ) = best tree score determined in IQ-
TREE. F = Empirical base frequencies; G = Rate of discrete Gamma categories; GTR = General time reversible model; HKY = Unequal transition/transversion rates and
unequal base frequencies; I = Proportion of invariable sites; K80 = Unequal transition/transversion rates and equal base frequencies; R = FreeRate model;
SYM = Symmetric model; TIM2 = Transition model, AC = AT, CG = GT and unequal base frequencies; TIM2e = TIM2 with equal base frequencies; TIM3e = Transition
model, AC = CG, AT = GT with equal base frequencies; TNe = Unequal transition/transversion rates with unequal purine/pyrimidine rates and equal base frequencies;
TPM2 = AC = AT, AG = CT, CG = GT and equal base frequencies.
CROUS ET AL.
30

were examined using water as mounting medium on a Zeiss
Axioskop 2 plus or a Nikon Eclipse 80i, both equipped with
Differential Interference Contrast (DIC) optics and a Nikon
AZ100 dissecting microscope all fitted with Nikon DS-Ri2 high-
definition colour digital cameras to photo-document fungal
structures. Measurements were taken using the Nikon software
NIS-elements D v. 4.50. The dimensions of at least 30
randomly selected elements were recorded for every fungal
structure. Average, standard deviation, and maximum–
minimum values were determined for elements using five or
more individual measurements. To facilitate the comparison of
relevant micro- and macroconidial features, composite photo
plates were assembled from separate photo micrographs using
Adobe Photoshop CC.
RESULTS
DNA phylogeny
The results of DNA evolutionary model selection, alignment
length, and composition as well as tree statistics for all the
multimarker datasets included in this study are summarised in
Table 4.
Re-analysis of the dataset of Geiser et al. (2021):A re-
analysis of the dataset of Geiser et al. (2021) revealed no major
differences in the ML analysis. However, in ME analysis
(Supplementary Fig. S3), we found that the backbone architec-
ture is less solid than previously thought and a large mono-
phyletic clade containing Neocosmospora,Albonectria, and
several other genera formed as sister group to Fusarium s. str.
with strong support.
Generic delimitation of fusarioid taxa in Nectriaceae: The an-
alyses included nectriaceous taxa historically ascribed to Fusa-
rium s. lat., including several recently segregated fusarioid genera
(Gr€
afenhan et al. 2011,Schroers et al. 2011,Lombard et al. 2015),
cylindrocarpon-like taxa (Chaverri et al. 2011), and the closely
related –although morphologically distinct –phylogenetic rela-
tives Cosmospora and Mariannaea. Analyses using ML and BI of
the individual genes and combined datasets resulted in phylog-
enies with congruent topologies. Therefore, only IQ-TREE-ML
topologies are presented with RAxML-BS, UFboot2-BS, BI-PP
and gCF support values superimposed (Fig. 7).
The combined alignment of ITS, LSU, rpb1,rpb2 and tef1
comprised 100 strains representing 92 species, including the
outgroup Nectria cinnabarina (CBS 125165). Phylogenetic ana-
lyses resolved 27 monophyletic genera, of which 19 contain taxa
with fusarioid asexual morphs and nectria- or cosmospora-like
sexual morphs. Of these, 15 clades represent currently
described genera, namely Albonectria,Atractium,Bisifusarium,
Cosmosporella,Cyanonectria,Dialonectria,Fusarium,Fusicolla,
Geejayessia,Macroconia,Microcera,Neocosmospora,Pseu-
dofusicolla,Rectifusarium,and Stylonectria. The fusarioid
genera Cosmosporella and Dialonectria, both of which have
cosmospora-like sexual morphs, clustered as sister clades to
Cosmospora; the latter, however, differ by having acremonium-
like asexual morphs. The remaining four clades with fusarioid
morphology represent undescribed taxa, formally described
here as the new genera Luteonectria,Nothofusarium,Scoleco-
fusarium, and Setofusarium. A strongly supported clade
comprising six cylindrocarpon-like genera (Corinectria,Ilyonec-
tria,Neonectria,Rugonectria,Thelonectria, and Tumenectria)
and the genus Mariannaea resolved as successive sister groups
to the F1 node.
Twenty-four out of the 27 genera included in the analysis
resolved as fully supported clades, including all but one
(Nothofusarium with RAxML-BS = 99 % / UFboot-BS = 92 % /
PP = 1) of the fusarioid genera (Fig. 7). The two remaining
clades (Cosmospora and Neonectria), however, received high
statistical support (RAxML-BS = 99 % / UFboot-BS = 100 % /
PP = 1 and RAxML-BS = 92 % / UFboot-BS = 95 % / PP = 1,
respectively). Similarly, the combined phylogeny resolved most
of the internal nodes with high to full bootstrap and Bayesian PP
support including the nodes F1, F2, and F3 sensu Geiser et al.
(2013,2021) and O'Donnell et al. (2013,2020). Nevertheless,
only F3 was resolved with confidence by all the individual marker
phylogenies (Supplementary Fig. S4). Node F2 was resolved
with high statistical support in the ITS, rpb1, and tef1 phylog-
enies, but unsupported in the LSU and rpb2 trees, while node F1
resolved without bootstrap and PP support in the ITS, rpb1,rpb2,
and tef1 phylogenies and was not recovered in the LSU tree.
To illustrate shared and differential morphological characters
among the different genera recognised here, a tree was con-
structed based on the phylogeny presented in Fig. 7, and the main
morphological features were plotted for each clade/genus (Fig. 8).
In addition to the genera recognised above, the recently
described aquatic fusarioid genus Varicosporella (Lechat &
Fournier 2015) is not included in the phylogenetic analyses due
to lack of available sequences; however, is accepted here based
on its distinct morphology. Non-molecular character variation
supports the phylogenetic relationship of fusarioid taxa in Nec-
triaceae. The 20 fusarioid genera in Nectriaceae are charac-
terised by phialidic asexual morphs with variously septate, falcate
conidia with diverse degrees of foot-shaped basal cell develop-
ment, formed on aerial or sporodochial conidiophores, with or
without additional production of microconidia. Characteristic
macroconidial foot-shaped basal cells are found most of the time,
but not always (e.g., Fusarium caeruleum) in clade F1, i.e.,
Albonectria,Bisifusarium,Cyanonectria,Fusarium,Geejayessia,
Luteonectria,Neocosmospora,Nothofusarium,Rectifusarium,
and Setofusarium, but are also present in distantly related genera
such as Cosmosporella,Dialonectria,Macroconia, and Micro-
cera.Setofusarium is clearly recognisable by the formation of
thick-walled, slightly rugose setae on its sporodochia.
With the exception of Atractium,Bisifusarium,Nothofusarium,
and Pseudofusicolla, most fusarioid genera have sexual morphs,
usually seen as nectria-like or cosmospora-like perithecial
ascomata. The ascomata show various colour reactions or no
reaction in KOH; the colour reaction correlates with the phylo-
genetic distribution. Apart from Albonectria, with white to pale
yellow perithecia, Luteonectria, with white to buff coloured peri-
thecia and Fusarium, with dark blue-violet to black perithecia,
Fusicolla, with yellow-orange perithecia and Varicosporella, with
yellow perithecia, the rest of fusarioid genera all present orange
to red perithecial ascomata. Going beyond this prototypical
group, perithecia of Cyanonectria species are often unequally
red to dark blue, while those of Geejayessia can be bright red or
black. Anatomically, two types of perithecial walls can be
distinguished among the known fusarioid genera, based on wall
thickness: thin-walled perithecia, in which a single region can be
identified, and thick-walled perithecia, on which distinctive inner
and outer regions can be recognised (but see Schroers et al.
2011 for differing interpretations). The former is seen in Cos-
mosporella,Cyanonectria,Dialonectria,Fusicolla,Geejayessia,
FUSARIUM REDELIMITED
www.studiesinmycology.org 31

CROUS ET AL.
32

Luteonectria,Macroconia,Microcera,Scolecofusarium, and
Varicosporella; and the latter is found in Albonectria,Fusarium,
Neocosmospora,Rectifusarium,Setofusarium and Stylonectria.
With the exception of Rectifusarium and Stylonectria, the peri-
thecial surface of the thick-walled genera is typically warted;
nevertheless, those of Setofusarium often present additional
scaly protrusions, while smooth perithecia can be rarely found in
Neocosmospora (i.e.,N. vasinfecta). Additionally, both Cyano-
nectria and Geejayessia most commonly have smooth perithe-
cial walls. The remaining genera, that is Cosmosporella,
Dialonectria,Fusicolla,Luteonectria,Macroconia,Microcera,
Rectifusarium,Scolecofusarium,Stylonectria, and Varicospor-
ella, all form smooth-walled perithecia.
Significant variation also exists among fusarioid genera
regarding ascospore characteristics. Most genera consistently
form 1-septate ascospores. These are seen in Cosmosporella,
Cyanonectria,Dialonectria,Fusicolla,Geejayessia,Macroconia,
Microcera,Rectifusarium,Scolecofusarium,Setofusarium,Sty-
lonectria, and Varicosporella. Except for Cyanonectria, in which
the ascospores remain hyaline and smooth; Setofusarium,in
which the ascospores surface is finely striated, and Varicospor-
ella,in which the ascospore surface is ribbed, ascospores of the
above-mentioned genera are often pale yellow to pale brown and
smooth at first, becoming finely spinulose or tuberculate. The
genus Neocosmospora forms (0–)1-septate, yellow-brown as-
cospores, which are often markedly striate, or more rarely cere-
briform (i.e., N. vasinfecta) or spiny (i.e., N. spinulosa). Albonectria
and Luteonectria form characteristic 3-septate, pale yellow-brown,
faintly striate ascospores, while Fusarium produces 1–3-septate,
hyaline to pale yellow-brown and smooth ascospores.
Based on the morphological variation observed in these taxa,
an identification scheme is presented for fusarioid genera of the
Nectriaceae (Fig. 9).
Ex-type strain phylogeny: The analyses included partial rpb1,
rpb2 and tef1 sequences of only the ex-, epi- and neotype strains
as indicated in the nomenclator list of all the names that have been
introduced in Fusarium. The analyses used both ML inferences
and BI of the individual genes and combined datasets, and they
resulted in phylogenies with congruent topologies. Therefore, the
RAxML topology is presented with RAxML-BS, UFboot2-BS, BI-
PP and gCF support values superimposed (Fig. 10).
The combined alignment comprised 325 strains from 309
species of 14 fusarioid genera including Atractium stilbaster
(CBS 410.67) as the outgroup. A total of 14 fusarioid genera
were resolved of which six (Cosmosporella,Microcera,Notho-
fusarium,Rectifusarium,Scolecofusarium, and Setofusarium)
were represented by single lineages, mostly due to a lack of
living isolates directly linked to type material available for other
species recognised within these genera at present. The genera
Fusarium (224 strains; 220 accepted species) and Neo-
cosmospora (83 strains; 71 accepted species) both represented
the largest sampling of living isolates directly linked to type
material available. The remaining five genera were represented
by two or more strains and include Bisifusarium (five species and
strains), Cyanonectria (two species and strains), Fusicolla (three
species and strains), Geejayessia (two species and strains), and
Luteonectria (two species and strains).
In order to describe novel species found for the genera
treated in this study, additional phylogenies were constructed for
the Fusarium fujikuroi species complex (FFSC), Fusicolla,
Macroconia,Neocosmospora,and Stylonectria.
Fusarium fujikuroi SC phylogeny: The analyses included
partial sequences of five genes (CaM,rpb1,rpb2,tef1 and tub2)
from 52 strains representing 46 species of the FFSC, and two
outgroup taxa (F. curvatum CBS 744.97 and F. i n flexum CBS
716.74) (Fig. 11). The analysis of the combined dataset fully
supported five main clades corresponding to the African,
American and Asian clades sensu O'Donnell et al. (2000b), plus
the African B-clade (Sandoval-Denis et al. 2018b,Yilmaz et al.
2021) and a fifth, monotypic clade, which formed the sister
clade to the joint American and African B clades and which is
here termed African C. The latter clade included two strains
showing a clear genealogical and morphological separation from
their closest phylogenetic relatives; both came from an unknown
tree species in South Africa. This clade is here described as the
novel species F. echinatum. Another fully supported novel
monophyletic group was found within the main African clade,
related to but distinct from F. brevicatenulatum and
F. pseudonygamai. This novel group, represented by isolates of
South African origin isolated from Prunus spinosa and from the
South African indigenous species Aloidendron dichotomum,is
here recognised as the novel species F. prieskaense.
Fusicolla phylogeny: The alignment consisted of partial acl1,
ITS, LSU, rpb2,tef1, and tub2 sequences from 20 type or
reference strains, representing 17 species of Fusicolla (Fu.) plus
one outgroup taxon (Macroconia leptosphaeriae CBS 100001).
The analysis confidently resolved 11 ingroup taxa (Fig. 12),
including three novel monotypic lineages, represented by strains
URM 8367, CBS 110189, and CBS 110191, described here as
the new species Fu. quarantenae,Fu. meniscoidea and Fu.
sporellula. Due to a partial lack of sequence data, six species
could not be clearly resolved. Fusicolla cassiae-fistulae and Fu.
siamensis did not receive statistical support in the combined
analysis but are well-resolved using nrDNA sequence data (data
not shown). Fusicolla acetilerea and Fu. bharatavarshae, while
well-delimited in the individual ITS, LSU and rpb2 analyses (data
not shown), were ill-supported in the 6-marker combined anal-
ysis. Similarly, Fu. epistroma and Fu. ossicola were not differ-
entiated in either the multimarker analysis, or in the individual
rpb2 analysis. The lack of sequences available to allow com-
parison with Fu. epistroma, for which only LSU and rpb2 se-
quences are available, prevented further analysis, as did a
similar problem with Fu. bharatavarshae, for which only nrDNA
and rpb2 are available.
Macroconia phylogeny: The analysis consisted of partial acl1,
CaM, ITS, LSU, rpb1,rpb2, and tub2 sequences from 12 strains
representing seven lineages of Macroconia (Ma.) plus one out-
group taxon (Microcera rubra CBS 638.76) (Fig. 13). Four out of
Fig. 7. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined ITS, LSU, rpb1,rpb2 and tef1 multiple sequence alignment of members of Nectriaceae.
Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP / gCF) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS /
UFboot2-BS / gCF = 100 %; BI-PP = 1). The scale bar indicates expected changes per site. The tree is rooted to Nectria cinnabarina (CBS 125165). Arrows “F1”,“F2”and “F3”
indicate the three alternative Fusarium hypotheses sensu Geiser et al. (2013). Ex-epitype, ex-isotype, ex-neotype and ex-type strains are indicated with ET, IT, NT, and T,
respectively.
FUSARIUM REDELIMITED
www.studiesinmycology.org 33

CROUS ET AL.
34

Fig. 8. (Continued).
FUSARIUM REDELIMITED
www.studiesinmycology.org 35

Fig. 8. (Continued).
CROUS ET AL.
36

the five Macroconia spp. previously known from culture, Ma.
gigas,Ma. leptosphaeriae,Ma. papilionacearum, and Ma.
sphaeriae, resolved as highly to fully-supported lineages. The
poorly resolved position of the ex-type isolate of Ma. cupularis
(HMAS 173240) should be interpreted in light of the fact that only
nrDNA sequences were available for analysis. However, sepa-
rate ITS and LSU comparisons demonstrated it as distinct (data
not shown). Two distinct and highly supported novel lineages of
South African origin were determined and are described here as
the novel species, Ma. bulbipes and Ma. phlogioides.
Neocosmospora phylogeny: The alignment consisted of
partial acl1,CaM, ITS, LSU, rpb1,rpb2, and tef1 sequences of
107 ex-type and reference strains, including two outgroup taxa
(Geejayessia atrofusca NRRL 22316 and G. cicatricum CBS
125552). The analysis resolved 76 terminal clades, of which 71
correspond to known species of Neocosmospora (Fig. 14).
Seventy of these clades resolved with high support from two or
more independent algorithms (RAxML, IQ-TREE-ML, and BI).
The position of the ex-type of N. crassa (CBS 144386) is poorly
resolved and only partially supported by BI. Similarly, except for
the types of N. ambrosia (CBS 571.94), N. obliquiseptata (NRRL
62611), N. rekana (CMW 52862), and the reference strain of
N. pseudensiformis (CBS 130.78), the position of most members
of the well-delimited Ambrosia-clade of Neocosmospora were
only partially supported by the individual analyses (only BI in
N. kuroshio,N. oligoseptata, and N. tuaranensis, and only IQ-
TREE-ML-BS for N. euwallaceae and N. floridana). All these
lineages were represented by single isolates in these analyses.
Of the five unnamed phylogenetic clades, one corresponded to a
species previously known from phylogenetic analyses (FSSC 41,
Cardoso 2015), for which a Latin binomial is lacking; this species
is here formally described as N. merkxiana. The four additional
Fig. 8. Morphological features and phylogenetic affinities of fusarioid genera of Nectriaceae and close relatives. The tree was delineated based on the phylogeny presented in
Fig. 7 and does not indicate phylogenetic distances. Fully supported branches are indicated in bold. The genus Fusarium is indicated in blue. Arrows “F1”,“F2”and “F3”
indicate the three alternative Fusarium hypotheses sensu Geiser et al. (2013).Fusarium.A, B. Ascomata. C–E. Ascospores. F, G. Conidiogenous cells. H–J. Macroconidia.
(B. Adapted from Schroers et al. 2011). Cyanonectria.A, B. Ascomata. C–E. Ascospores. F. Conidiogenous cells. G. Macroconidia. Neocosmospora.A, B. Ascomata. C–E.
Ascospores. F, G. Conidiogenous cells. H, I. Macroconidia. [A. Adapted from Sandoval-Denis & Crous (2018). G. Adapted from Sandoval-Denis et al. (2019)]. Albonectria.A,
B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells. H. Macroconidia. Setofusarium.A, B. Ascomata. C–E. Ascospores. F–H. Setae formed on
sporodochia. I. Conidiophore. J. Conidia. Geejayessia.A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells. H, I. Macroconidia. [A. Adapted from
Schroers et al. (2011)]. Nothofusarium.A–D. Conidiophores and conidiogenous cells. E. Conidia. Luteonectria.A, B. Ascomata. C–D. Ascospores. F, G. Conidiophores and
conidiogenous cells. H. Conidia. Rectifusarium.A–D. Conidiophores and conidiogenous cells. E, F. Conidia. Bisifusarium.A–D. Conidiophores and conidiogenous cells.
E, F. Conidia. Mariannaea.A, B. Conidiophores. C, D. Conidiogenous cells. E. Conidia. Tumenectria.A, B. Ascomata. C. Ascospores. D, E. Conidiophores and conidiogenous
cells. F. Conidia. [A–C. Adapted from Salgado-Salazar et al. (2016)]. Rugonectria.A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and conidiogenous cells.
H. Conidia. Thelonectria.A, B. Ascomata. C, D. Ascospores. E, F. Conidiophores and conidiogenous cells. G. Conidia. Corinectria.A, B. Ascomata. C–E. Ascospores.
F, G. Conidiophores and conidiogenous cells. H. Conidia. (H. Picture by C. Gonz
alez). Neonectria.A, B. Ascomata. C, D. Ascospores. E, F. Conidiophores and conidiogenous
cells. G, H. Conidia. [A. Adapted from Chaverri et al. (2011)]. Ilyonectria.A, B. Ascomata. C, D. Ascospores. E, F. Conidiophores and conidiogenous cells. G, H. Conidia.
Atractium.A, B. Conidiophores. C, D. Conidiogenous cells. E, F. Conidia. Fusicolla.A, B. Ascomata. C. Ascospores. D, E. Conidiogenous cells. F, G. Conidia. (A–C. Pictures
by C. Lechat). Scolecofusarium.A. Ascomata. B, C. Ascospores. D, E. Conidiophores and conidiogenous cells. F. Conidia. Microcera.A. Ascomata. B. Ascospores.
C, D. Conidiogenous cells. E, F. Conidia. (A, B. Pictures by N. Aplin, Fungi of Great Britain and Ireland). Macroconia.A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores
and conidiogenous cells. H, I. Conidia. (B. Picture by P. Ml
coch). Pseudofusicolla.A, B. Conidiophores and conidiogenous cells. C, D. Conidia. [A–D. Adapted from Triest et al.
(2016)]. Cosmospora.A, B. Ascomata. C, D. Ascospores. E, F. Conidiophores and conidiogenous cells. G. Conidia. Dialonectria.A, B. Ascomata. C–E. Ascospores.
F, G. Conidiophores and conidiogenous cells. H. Conidia. (A. Picture by P. Ml
coch). Cosmosporella.A, B. Ascomata. C–E. Ascospores. F, G. Conidiophores and con-
idiogenous cells. H, I. Conidia. (A–E. Pictures by P. Ml
coch). Stylonectria.A, B. Ascomata. C–E. Ascospores. F –I. Conidiophores and conidiogenous cells. J. Conidia.
(A–C, E. Pictures by B. Wergen).
FUSARIUM REDELIMITED
www.studiesinmycology.org 37

novel lineages discovered here are proposed as the novel
species N. neerlandica,N. nelsonii,N. pseudopisi, and
N. epipeda.
Stylonectria phylogeny: The alignment consisted of partial
acl1, ITS and rpb2 sequences of 11 strains, including the out-
group (Nectria cinnabarina CBS 125165). The analyses (Fig. 15)
identified eight species-level clades, of which six represented
previously known species of the genus: St. applanata,St. carpini,
St. norvegica,St. purtonii,St. qilianshanensis, and St. wege-
liniana. One strain, CBS 125491, isolated from an unknown
ascomycetous host, corresponded to a previously known un-
named and fully supported monophyletic lineage, which is
formally described here as St. corniculata. In addition, a fully
supported clade formed by two strains, CBS 147305 from Dia-
porthe sp. and CBS 147306 from Dothiorella sarmentorum,is
here recognised as the novel species St. hetmanica.
Taxonomy
Albonectria Rossman & Samuels, Stud. Mycol. 42: 105. 1999.
Figs 8,16.
Type species:Albonectria rigidiuscula (Berk. & Broome) Ross-
man & Samuels, Stud. Mycol. 42: 105. 1999.
(See F. colorans in List section for synonyms)
Ascomata perithecial, solitary or gregarious, superficial on a
sparse to well-developed, pseudoparenchymatous stroma,
globose to subglobose to ellipsoidal or ovoid to obovoid, not
collapsing or laterally pinched when dry, off-white to pale yellow to
pale ochraceous, not changing in KOH, strongly tuberculate and
thick-walled, with or without a small, pointed papilla, lacking hairs
or appendages. Ascomatal wall of three regions: outer region of
thick-walled, textura angularis to textura globulosa; middle region
of elongate thick-walled cells; inner region with thin-walled, hy-
aline elongated cells. Asci narrowly to broadly clavate or ellip-
soidal, 4–8-spored, ascospores obliquely uniseriate or biseriate.
Ascospores ellipsoidal to long-ellipsoidal or fusoid to long-fusoid,
3- to multiseptate, hyaline to yellow-brown, smooth to striate, not
to slightly constricted at the septum. Conidiophores mono-
nematous (aerial conidiophores) or grouped on sporodochia;
aerial conidiophores unbranched or irregularly branched, bearing
terminal or lateral phialides, often reduced to single phialides;
conidiogenouhs cells monophialidic, cylindrical to subcylindrical,
smooth- and thin-walled, with periclinal thickening inconspicuous
or absent, producing arial micro- and macroconidia. Microconidia
hyaline, thin-walled, 0- or 1-septate, ovoid to obovoid, with or
without a flattened basal papilla, borne in dry chains or small
slimy heads. Macroconidia falcate, multiseptate, thick-walled,
with a blunt to hooked apical cell and well-developed foot-shaped
basal cell or distinctly beaked at both ends. Sporodochia cream to
yellow; sporodochial conidiophores verticillately branched and
densely packed, consisting of short, smooth- and thin-walled
stipes bearing apical whorls of 2–4 monophialides; sporodochial
conidiogenous cells monophialidic, cylindrical to subulate,
smooth- and thin-walled, with reduced or flared collarette.
Sporodochial macroconidia formed in off-white or creamy slimy
masses, falcate, 5–9-septate, thick-walled, gently curved to
straight, with a blunt to hooked apical cell and distinct well-
developed foot-shaped basal cell. Chlamydospores absent.
[Description adapted from Rossman et al. (1999),Booth (1971)
and Lombard et al. (2015)].
Diagnostic features: Off-white to pale yellow to pale ochraceous
perithecia producing narrowly or broadly clavate to ellipsoidal
asci containing (long) ellipsoidal to fusoid, 3- to multiseptate
ascospores; fusarioid asexual morph characterised by mono-
phialides producing distinctly long, robust, slightly curved to
straight multiseptate macroconidia and dry chains or small slimy
heads of ovoid microconidia. Chlamydospores absent.
Atractium Link, Mag. Ges. Naturf. Freunde Berlin 3: 10. 1809
(Fries, Syst. Mycol. 1: XLI. 1821, nom. sanct.). Figs 8,17.
Type species:Atractium stilbaster Link, Mag. Ges. Naturf.
Freunde Berlin 3: 10. 1809.
Ascomata unknown. Conidiophores aggregated into sporodochia
or synnemata, non-stromatic; synnemata determinate, pale
brown, composed of a stipe of parallel hyphae and a divergent
capitulum of conidiophores giving rise to a slimy conidial mass;
conidiophore branching once or twice monochasial, 2-level
verticillate, monoverticillate or irregularly biverticillate. Con-
idiogenous cells monophialidic, hyaline, subulate with conspic-
uous periclinal thickening, producing micro- and macroconidia.
Microconidia hyaline, thin-walled, 0- or 1-septate, ellipsoidal,
allantoid, broadly lunate to reniform, straight or slightly curved,
tapering towards both apices with rounded base. Macroconidia
3–5-septate, falcate, gently curved, with a rounded to blunt
apical cell, and obtuse, non foot-shaped basal cell, forming
yellow to orange masses.
[Description adapted from Gr€
afenhan et al. (2011)].
Diagnostic features: Synnematous asexual morph characterised
by fusarioidal macroconidia lacking foot-shaped basal cells.
Bisifusarium L. Lombard et al., Stud. Mycol. 80: 223. 2015. Figs
8,18.
Type species:Bisifusarium dimerum (Penz.) L. Lombard &
Crous, Stud. Mycol. 80: 225. 2015.
(See F. dimerum in List section for synonyms)
Ascomata unknown. Conidiophores mononematous (aerial co-
nidiophores) or grouped on sporodochia; aerial conidiophores
simple, unbranched or irregularly branched, mostly reduced to
terminal or single lateral conidiogenous cells. Conidiogenous
cells often formed as (i) lateral phialidic pegs arising from su-
perficial or submerged intercalary hyphal cells or, (ii) cylindrical
and slightly tapering towards apex or ampulliform, smooth- and
thin-walled monophialides, rarely polyphialides, with inconspic-
uous or absent periclinal thickening, solitary or aggregated to
represent a poorly developed pionnotal sporodochial-like struc-
ture, producing micro- and macroconidia. Microconidia hyaline,
thin-walled, 0- or 1-septate, ellipsoidal, allantoid, broadly lunate
to reniform, straight or curved, tapering towards both ends.
Macroconidia falcate, (0–)1–2(–3)-septate, thick-walled, curved
to lunate, with a blunt to hooked apical cell and obtuse to poorly
developed, foot-shaped basal cell, typically formed on spor-
odochia. Sporodochia pale yellow to orange; sporodochial co-
nidiophores verticillately branched and densely packed,
consisting of short, smooth- and thin-walled stipes bearing an
apical whorl of 2–3 monophialides; sporodochial conidiogenous
cells monophialidic, cylindrical to subulate, smooth- and thin-
walled, with reduced or flared collarette. Chlamydospores,if
present, globose to subglobose to ellipsoidal, solitary or in
chains, sometimes aggregated in sclerotia.
CROUS ET AL.
38

[Description adapted from Schroers et al. (2009) and Lombard
et al. (2015)].
Diagnostic features: Fusarioid asexual morph characterised by
lateral phialidic pegs arising from superficial or submerged
intercalary hyphal cells or solitarily formed monophialides pro-
ducing microconidia; distinctly short (< 30 μm long), curved to
lunate, (0–)1–2(–3)-septate macroconidia typically formed on
sporodochia on plant tissue such as carnation leaf pieces.
Corinectria C. Gonz
alez & P. Chaverri, Mycol. Progr. 16: 1021.
2017. Fig. 8.
Type species:Corinectria fuckeliana (C. Booth) C. Gonz
alez & P.
Chaverri, Mycol. Progr. 16: 1023. 2017.
Basionym:Nectria fuckeliana C. Booth, Mycol. Pap. 73: 56. 1959.
Synonym:Neonectria fuckeliana (C. Booth) Castl. & Rossman,
Canad. J. Bot. 84: 1428. 2006.
Ascomata perithecial, gregarious, seated on an erumpent
stroma, superficial, globose to subglobose, orange, red to dark
red darkening around ostiolar region, turning black in KOH,
pigment dissolving in lactic acid, not collapsing when dry, slightly
papillate to papillate, smooth-walled, lacking hairs or append-
ages. Ascomatal wall of 2–3 regions: outer region of thick-wal-
led, pigmented cells forming a textura epidermoidea; middle and
inner regions of globose to elongate, hyaline, thin-walled cells,
becoming thinner toward the centrum. Asci cylindrical, 8-spored,
with an apical ring, uniseriate. Ascospores ellipsoidal to fusoid, 1-
Fig. 9. Characters for morphological identification of fusarioid genera in Nectriaceae. The rings show, from inside to outside: conidial morphology; ascospore morphology,
septation and surface; colour reaction of ascomata in 3 % KOH/lactic acid (nr = no reaction); ascomata wall thickness; and general colour, appearance and wall surface of
ascomata.
FUSARIUM REDELIMITED
www.studiesinmycology.org 39

CROUS ET AL.
40

Fig. 10. (Continued).
FUSARIUM REDELIMITED
www.studiesinmycology.org 41

CROUS ET AL.
42

septate, hyaline, smooth. Conidiophores mononematous, hya-
line, septate, unbranched or sparsely branched, terminating in
1–2 phialides or reduced to lateral phialides. Conidiogenous
cells monophialidic, cylindrical, tapering towards the apex, with
inconspicuous periclinal thickening and collarettes. Sporodochia
not formed. Microconidia ellipsoidal to obovoid, hyaline, asep-
tate, sometimes forming false heads on phialides. Macroconidia
cylindrical, mostly straight, (3–)5–7-septate, with rounded ends.
Chlamydospores unknown.
[Description adapted from Gonz
alez & Chaverri (2017)].
Diagnostic features: Orange to dark red, smooth-walled peri-
thecia with papilla producing cylindrical asci bearing ellipsoidal to
fusoid, 1-septate ascospores and cylindrocarpon-like asexual
morph characterised by (3–)5–7-septate macroconidia.
Cosmospora Rabenh., Hedwigia 2: 59. 1862. Fig. 8.
Synonyms:Crysogluten Briosi & Farneti, Atti Ist. Bot. Univ. Lab.
Crittog. Pavia 8: 117. 1904.
Botryocrea Petr., Sydowia 3: 140. 1949.
Type species:Cosmospora coccinea Rabenh., Hedwigia 2: 59.
1862 [non Nectria coccinea (Pers.) Fr. 1849].
Synonyms:Nectria cosmariospora Ces. & De Not., Comment.
Soc. Crittog. Ital. 1: 195. 1863.
Dialonectria cosmariospora (Ces. & De Not.) Cooke, Grevillea
12: 110. 1884.
Cucurbitaria cosmariospora (Ces. & De Not.) Kuntze, Revis.
Gen. Pl. 3: 461. 1898.
Dialonectria cosmariospora (Ces. & De Not.) Z. Moravec, Cesk
a
Mykol. 8: 92. 1954, an isonym, Art. 6.3, Note 2.
Verticillium olivaceum W. Gams, Cephalosporium-artige Schim-
melpilze: 129. 1971.
Ascomata perithecial, solitary or gregarious, with inconspicuous
or absent stroma, obpyriform with an acute or papillate apex,
orange red or bright red, turning dark red in KOH, smooth walled.
Asci narrowly clavate to cylindrical, with an apical ring, 8-
spored. Ascospores initially hyaline, becoming yellow brown to
reddish brown, 1-septate, becoming tuberculate when mature.
Conidiophores acremonium-like, consisting of lateral phialides on
somatic hyphae, or with one or two levels of monochasial
branching, or verticillate, hyaline. Conidiogenous cells mono-
phialidic, cylindrical to subulate to subclavate, hyaline. Micro-
conidia ellipsoidal, oblong or clavate or slightly allantoid,
aseptate, hyaline, forming slimy heads. Macroconidia absent or
rare, subcylindrical, curved, slightly narrowing towards each end,
apical cell often slightly hooked with a more or less pointed apex,
basal cell obtuse to poorly developed, foot-shaped, 3–5-septate,
hyaline.
[Description adapted from Rossman et al. (1999) and Gr€
afenhan
et al. (2011)].
Diagnostic features: Orange-red to bright red perithecia with an
acute or papillate apex producing cylindrical to narrowly clavate
asci, yellow brown to reddish brown, 1-septate, tuberculate as-
cospores and acremonium-like asexual morph.
Fig. 10. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined rpb1,rpb2 and tef1 sequence alignment of the living type strains as indicated in the
nomenclator list. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP) above 70 % / 0.95 with thickened branches indicating full support
(RAxML-BS / UFboot2-BS = 100 %; BI-PP = 1). The scale bar indicates expected changes per site. The tree is rooted to Atractium stilbaster (CBS 410.67). Names indicated in
bold are in current use. Subdivision of the Fusarium clade (blue block) represent the recognised species complexes.
FUSARIUM REDELIMITED
www.studiesinmycology.org 43

Cosmosporella S.K. Huang et al., Cryptog. Mycol. 39: 179.
2018. Figs 8,19.
Type species:Cosmosporella olivacea S.K. Huang et al., Cryp-
tog. Mycol. 39: 181. 2018.
Ascomata perithecial, solitary to gregarious, superficial, on
immersed to erumpent stroma, ovoid, globose to obpyriform,
collapsing laterally when dry, orange red, red to pale yellow, not
reacting in KOH, with a central ostiole, with hyaline periphyses.
Ascomatal wall membranous, composed of orange to hyaline
cells of textura angularis, with septate paraphyses. Asci
cylindrical to slightly clavate, apically rounded, with evanescent
wall, pedicel combined with paraphyses, 8-spored, unitunicate.
Ascospores hyaline to pale brown, ellipsoidal to ovoid, 0- or
1-septate. Conidiophores acremonium-like, mononematous,
hyaline, septate, consisting of lateral phialides on somatic
hyphae, or with one or two levels of monochasial branching, or
irregularly branched. Conidiogenous cells monophialidic, cylin-
drical, producing micro- and macroconidia. Microconidia ellip-
soidal to obovoid, 0- or 1-septate, hyaline, forming a false head
on phialides. Macroconidia falcate, almost straight to curved,
1–3-septate, with a blunt to hooked apical cell and poorly to well-
developed foot-shaped basal cell. Chlamydospores unknown.
[Description adapted from Huang et al. (2018)].
Diagnostic features: Pale yellow to orange-red perithecia lacking
a papilla producing cylindrical to narrowly clavate asci, pale
brown, 1-septate ascospores and fusarioid asexual morph
characterised by overly long, 1–3-septate macroconidia.
Cosmosporella cavisperma (Corda) Sand.-Den., L. Lombard &
Crous, comb. nov.MycoBank MB 838659.
Basionym:Fusarium cavispermum Corda, Icon. Fung. 1: 3. 1837.
Synonyms:Fusarium aquaeductuum var. cavispermum (Corda)
Raillo, Fungi of the Genus Fusarium: 280. 1950.
Fusarium oxydendri Ellis & Everh., Bull. Torrey Bot. Club 24: 477.
1897.
Fusarium cavispermum var. minus Wollenw., Fusaria Autogr.
Delin. 3: 848. 1930.
Lectotypus:Czech Republic, near Carlsstein, on pine resin,
A.K.J. Corda, Icon. Fung. 1: tab. I, fig. 58 (MBT 10001322 hic
designatus). Epitype of Fusarium cavispermum (CBS 172.31,
MBT 10000645 hic designatus, a metabolically inactive culture).
Norway, from Pinus sylvestris,1929, H.W. Wollenweber, culture
ex-epitype CBS 172.31 = NRRL 13996.
Notes: The genus Cosmosporella was erected by Huang et al.
(2018) to accommodate Cm. olivacea and the superfluous taxon
Cm. obscura, shown to cluster within a subset oftaxa pertaining to
Cosmospora s. lat.(Rossman et al. 1999), former members of the
Nectria episphaeria group sensu Booth (1959) and Nectria sub-
genus Dialonectria (Samuels et al. 1991) characterised by cos-
mospora-like sexual morphs and fusarioid asexual morphs. More
recently, this monophyletic clade had been ascribed to the Fusarium
cavispermum species complex (O'Donnell et al. 2013) and, sepa-
rated from any of the polyphyletic taxa formerly classified in
Fusarium section Eupionnotes (O'Donnell 1993,Schroers et al.
2009,Gr€
afenhan et al. 2011). “Fusarium”melanochlorum, its pur-
posed sexual morph “Nectria”flavoviridis (Gerlach & Nirenberg
1982), and “Fusarium”cavispermum have also been resolved as
members of this clade (Gr€
afenhan et al. 2011,O'Donnell et al. 2013,
Huang et al. 2018,andFig. 7 in this paper). Here, the new com-
bination Cm. cavisperma is proposed, lectotypified, and an epitype
is designated to stabilise the application of the name based on
material studied by Wollenweber [number 849 in Wollenweber
(1916–1935) and Gerlach & Nirenberg (1982)]. The suggested
conspecificity of “F”. melanochlorum and “N”.flavoviridis,however,
is questioned given the large phylogenetic distance between the
currently available strains. Fresh isolations and a thorough phylo-
genetic revision of the entire group including additionalCosmospora
s. lat. taxa having fusarioid asexual morphs are necessary.
Cyanonectria Samuels & Chaverri, Mycol. Progr. 8: 56. 2009.
Figs 8,20.
Type species:Cyanonectria cyanostoma (Sacc. & Flageolet)
Samuels & Chaverri, Mycol. Progr. 8: 56. 2009.
Basionym:Nectria cyanostoma Sacc. & Flageolet, Rendiconti
Congr. Bot. Palermo 1902: 53. 1902.
Synonym:Fusarium cyanostomum (Sacc. & Flageolet) O'Don-
nell & Geiser, Phytopathology 103: 404. 2013.
Ascomata perithecial, gregarious or caespitose, with a reduced
or well-developed prosenchymatous stroma, smooth- and thin-
walled, ampulliform to obpyriform to pyriform, apex dark bluish
purple to bluish black and body less intensely dark bluish or red
or reddish brown, turning darker in KOH, pigment dissolving in
lactic acid to become red to yellow, non-papillate, lacking hairs or
appendages. Ascomatal wall consisting of a single region,
comprising several layers of morphologically similar cells. Asci
cylindrical to narrowly clavate, with rounded to flattened thick-
ened apex, with or without refractive ring, 8-spored, ascospores
overlapping uniseriate or biseriate above and uniseriate below.
Ascospores ellipsoidal, 1-septate, not or slightly constricted at
septum, pale yellow-brown, smooth-walled or finely verrucose.
Conidiophores mononematous (aerial conidiophores) or grouped
on sporodochia; aerial conidiophores unbranched or rarely
branched, bearing terminal or lateral phialides, often reduced to
single phialides. Conidiogenous cells monophialidic, cylindrical
to subcylindrical, smooth- and thin-walled, with periclinal thick-
ening inconspicuous or absent. Sporodochia white to bluish;
sporodochial conidiophores verticillately branched and densely
packed, consisting of short, smooth- and thin-walled stipes
bearing apical whorls of 2–3 monophialides; sporodochial
conidiogenous cells monophialidic, cylindrical to subulate,
smooth- and thin-walled, with reduced or flared collarette.
Macroconidia formed in off-white or creamy or greyish blue slimy
masses, falcate, straight to gently curved, with inequilateral
fusoid or hooked apical cell and well-developed, foot-shaped
basal cell. Microconidia unknown. Chlamydospores absent or
rarely formed from cells of the macroconidia, subglobose.
[Description adapted from Samuels et al. (2009) and Schroers
et al. (2011)].
Diagnostic features: Bicoloured or dark bluish purple to bluish
black perithecia producing cylindrical to narrowly clavate asci
containing ellipsoidal, 1-septate ascospores and fusarioid
asexual morph characterised by monophialides producing long,
narrow, almost straight macroconidia, lacking microconidia and
hyphal-borne chlamydospores.
Dialonectria (Sacc.) Cooke, Grevillea 12: 77, 109. 1884. Figs 8,21.
Basionym:Nectria subgen. Dialonectria Sacc., Syll. Fung. 2:
490. 1883.
Type species:Dialonectria episphaeria (Tode) Cooke (as
“episphaerica”), Grevillea 12: 82. 1884.
CROUS ET AL.
44

Basionym:Sphaeria episphaeria Tode, Fung. mecklenb. sel. 2:
21. 1791.
Ascomata perithecial, solitary or gregarious, with inconspicuous
or absent stroma, obpyriform with an acute or round papilla,
orange red to carmine red, turning dark red in KOH, smooth-
walled. Asci narrowly clavate to cylindrical, with an apical ring, 8-
spored, uniseriate. Ascospores initially hyaline, becoming pale
brown, 1-septate, becoming tuberculate when mature. Co-
nidiophores mononematous, initially as lateral phialides on
Fig. 11. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined CaM,rpb1,rpb2,tef1, and tub2 sequence alignment of members of the Fusarium
fujikuroi species complex. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP) above 70 % / 0.95 with thickened branches indicating full
support (RAxML-BS / UFboot2-BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Fusarium
curvatum CBS 744.97 and Fusarium inflexum CBS 716.74. Ex-epitype, ex-neotype and ex-type strains are indicated with ET, NT, and T, respectively.
FUSARIUM REDELIMITED
www.studiesinmycology.org 45

somatic hyphae, sometimes verticillate, hyaline. Conidiogenous
cells monophialidic, subulate to subclavate, hyaline. Microconidia
ellipsoidal to clavate, aseptate, hyaline, abundant. Macroconidia
if present subcylindrical, moderately curved, slightly narrowing
towards each end, apical cell often slightly hooked with a more or
less pointed tip, basal cell obtuse to poorly developed, foot-
shaped, predominantly 3–5-septate, hyaline. Chlamydospores
unknown.
[Description adapted from Rossman et al. (1999) and Gr€
afenhan
et al. (2011)].
Diagnostic features: Orange-red to carmine-red perithecia with
an acute or round papilla producing cylindrical to narrowly
clavate asci, pale brown, 1-septate, tuberculate ascospores and
asexual morph that rarely produces macroconidia.
Fusarium Link, Mag. Ges. Naturf. Freunde Berlin 3: 10. 1809.
Figs 8,22.
Synonyms:Fusisporium Link, Mag. Ges. Naturf. Freunde Berlin
3: 19. 1809.
Selenosporium Corda, Icon. Fung. 1: 7. 1837.
Gibberella Sacc., Michelia 1: 43. 1877.
Lisea Sacc., Michelia 1: 43. 1877.
Sporotrichella P. Karst., Meddel. Soc. Fauna Fl. Fenn. 14: 96.
1887.
Gibberella subgen. Lisiella Cooke & Massee, Grevillea 16: 5.
1887.
Lisiella (Cooke & Massee) Sacc., Syll. Fung. 9: 945. 1891.
Septorella Allesch., Hedwigia 36: 241. 1897.
Ustilaginoidella Essed, Ann. Bot. 25: 351. 1911.
Rachisia Linder, Deutsche Essigind. 17: 467. 1913.
Stagonostroma Died., Krypt.-Fl. Mark Brandenb. 9: 561. 1914.
Fusidomus Grove, J. Bot. 67: 201. 1929.
Pseudofusarium Matsush., Microfungi Solomon Isl. Papua-New
Guinea: 46. 1971.
Type species:Fusarium sambucinum Fuckel, Fungi Rhen. Exs.,
Fasc. 3, no. 211. 1863, nom. cons.
(See List section for synonyms)
Ascomata perithecial, mostly gregarious, non-stromatic or on a thin
stroma erumpent through the epidermis, superficial, subglobose to
globose to broadly pyriform, not collapsing or laterally pinched
when dry, bluish purple to black, turning dark purple in KOH,
pigment dissolving in lactic acid, non-papillate, slightly rugose to
tuberculate, lacking hairs or appendages. Ascomatal wall of two
regions: outer region of thick-walled, pigmented cells forming a
textura angularis or textura globulosa; inner region of elongate,
hyaline, thin-walled cells, becoming thinner towards the centrum.
Asci clavate, apex simple, 8-spored often with an apical ring,
biseriate to pluriseriate. Ascospores ellipsoidal to cylindrical, 1–3-
septate, not or slightly constricted at the septa, pale tan, smooth-
walled. Conidiophores mononematous (aerial conidiophores) or
grouped on sporodochia; aerial conidiophores, if consistenly
Fig. 12. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined acl1, ITS, LSU, rpb2,tef1, and tub2 sequence alignment of members of the genus
Fusicolla. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS /
UFboot2-BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Macroconia leptosphaeriae CBS
100001. Ex-epitype and ex-type strains are indicated with ET, and T, respectively.
CROUS ET AL.
46

formed, unbranched, sympodial or irregularly branched, bearing
terminal or lateral phialides, often reduced to single phialides.
Conidiogenous cells mono- or polyphialidic, subulate to sub-
cylindrical, smooth- and thin-walled, sometimes proliferating per-
currently, with periclinal thickening inconspicuous or absent. Aerial
conidia hyaline, smooth- and thin-walled, of three types: micro-
conidia ellipsoidal to fusoid to ovoid to obovoid to reniform to
allantoid to clavate to napiform to pyriform to limoniform, 0–5-
septate, borne in false heads or chains on the phialides; meso-
conidia (occurring in some species or species complexes) falcate,
slender with no significant curvature to curved with parallel walls,
1–5-septate, tapering towards both ends, with a pointed to blunt
apical cell and obtuse to flattened basal cell; macroconidia,typi-
cally formed on sporodochia, falcate, slightly to strongly curved
dorsiventrally, 1-septate to multiseptate, with a curved, long and
tapering, pointed, blunt, hooked or elongated apical cell and
obtuse, poorly developed, well-developed, to elongate, foot-sha-
ped basal cell. Sporodochia cream to pale tan to orange to saffron
to blue; sporodochial conidiophores verticillately branched and
densely packed, consisting of short, smooth- and thin-walled stipes
bearing an apical whorl of 2–4 monophialides; sporodochial con-
idiogenous cells subulate to subcylindrical, smooth- and thin-wal-
led, with reduced or flared collarette; sporodochial (macro)conidia
falcate, smooth- and thin-walled, distinctly curved to curved with
parallel walls to unequally curved, tapering towards both ends, with
pointed, blunt, papillate, hooked, or elongate apical cell and obtuse,
poorly developed, well-developed, to elongate, foot-shaped basal
cell. Chlamydospores globose to subglobose to ovoid to obovoid,
hyaline to subhyaline, smooth-walled to slightly verrucose, terminal
or intercalary, solitary or in pairs or forming chains or aggregating to
form microsclerotia.
[Description adapted from Rossman et al. (1999) and Lombard
et al. (2015)].
Diagnostic features: Dark blue to black perithecia producing
clavate asci bearing ellipsoidal to cylindrical 1- to multiseptate
ascospores and asexual morphs producing micro- and macro-
conidia, and sometimes mesoconidia on aerial conidiophores
with mono- and/or polyphialides or only macroconidia in spor-
odochia. Chlamydospores form in hyphae, rarely in
macroconidia.
Fusarium echinatum Sand.-Den. & G.J. Marais, sp. nov.
MycoBank MB 838660. Fig. 23.
Etymology: From the Latin echinatus, prickly, referring to the
spiny appearance of its multiloculate, often swollen and rather
deformed conidiogenous cells.
Typus:South Africa, unidentified tree species, 2010, A. Lubben
(holotype CBS H-24658, culture ex-type CBS 146497 = CPC
30815 = CAMS 000733).
Conidiophores on aerial mycelium 10–120 μm tall, unbranched
or irregularly laterally branched, bearing lateral and terminal
single phialides; aerial conidiogenous cells polyphialidic, subu-
late, subcylindrical or more commonly irregularly shaped, curved,
swollen and distorted due to abundant conidiogenous loci,
smooth- and thin-walled, 6.5–36.5 × 2–3.5 μm, polyphialides
with 2–3 or more commonly 10–18 conidiogenous openings,
with inconspicuous to absent periclinal thickening and collarettes.
Aerial microconidia forming small false heads on tips of phia-
lides, hyaline, smooth, and thin-walled, commonly ovoid to
ellipsoidal, 0- or 1-septate, 4–11 ( –19) × 2–3.5(–4.5) μm (av.
7.5 × 2.7 μm), and more rarely napiform, smooth and thin-walled,
0-septate, (5–)5.5–7 × (3.5–)4.5–5.5 μm (av. 6.4 × 4.5 μm).
Sporodochial conidiophores 28.5–60(–68.5) μm tall, irregularly
branched, bearing terminal solitary monophialides or whorls
of up to three monophialides. Sporodochial conidiogenous
Fig. 13. Maximum-Likelihood (ML) consensus tree inferred from the combined acl1,CaM, ITS, LSU, rpb1,rpb2, and tub2 sequence alignment of members of the genus
Macroconia. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP / gCF) above 70 % / 0.95 with thickened branches indicating full support
(RAxML-BS / UFboot2-BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Microcera rubra CBS
638.76. Ex-type and ex-isotype strains are indicated with T, and IT, respectively.
FUSARIUM REDELIMITED
www.studiesinmycology.org 47

CROUS ET AL.
48

Fig. 14. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined acl1,CaM, ITS, LSU, rpb1,rpb2, and tef1 sequence alignment of members of the
genus Neocosmospora. Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / I-PP) above 70 % / 0.95 with thickened branches indicating full support
(RAxML-BS / UFboot2-BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Geejayessia
atrofusca NRRL 22316 and G. cicatricum CBS 125552. Ex-epitype, ex-neotype, ex-paratype and ex-type strains are indicated with ET, NT, PT, and T, respectively.
FUSARIUM REDELIMITED
www.studiesinmycology.org 49

cells monophialidic,subulate to subcylindrical, smooth- and thin-
walled, (8.5–)11.5–16( –17.5) × (1.5 –)2.5–3.5 μm. Sporodo-
chial macroconidia moderately curved to wedge-shaped,
slender, tapering towards the basal part, apical cell of equal size
than the adjacent cell, blunt to slightly hooked; basal cell poorly
to well-developed, foot-shaped, (1–)2–3(–4)-septate, hyaline,
thin- and smooth-walled: 1-septate conidia: (16.5–)
19.5–32.5(–36) × 2.5–3.5 μm (av. 26.1 × 2.9 μm); 2-septate
conidia: (19.5–)25–36(–37.5) × 2.5–3.5 μm (av. 30.5 × 3.1 μm);
3-septate conidia: (20.5–)28.5–36(–40) × (2.5–)
3–3.5(–4.5) μm (av. 32.5 × 3.2 μm); 4-septate conidia: (27–)
30.5–39(–40.5) × 3–4μm (av. 35.4 × 3.6 μm); overall: (19.5–)
28.6–36.5(–40.5) × (2.5–)3–3.5(–4.5) μm (av. 32.4 × 3.2 μm).
Chlamydospores not observed.
Culture characteristics: Colonies on PDA reaching
31–63 mm diam at 25 °C after 7 d. Surface white, pale luteus to
sulphur yellow, flat, woolly to cottony with radial patches of white
aerial mycelium, margin regular and filiform. Reverse white,
sulphur yellow to pure yellow at centre. On OA pale luteus to
sulphur yellow, flat, membranous at first, quickly becoming
velvety to dusty, margin regular. Reverse sulphur yellow.
Additional material examined:South Africa, unidentified tree species, 2010, A.
Lubben, culture CBS 146496 = CPC 30814 = CAMS 000730.
Notes: Yilmaz et al. (2021) recently revised the FFSC, including
formal descriptions for several species, while fixing the typifica-
tion of relevant plant pathogenic and toxigenic species. Species
in this complex have been traditionally organised according to
their biogeographic patterns, which roughly match their phylo-
genetic distribution. Apart from the monophyletic American and
Asian clades, the complex contains a non-monophyletic African
clade, which is currently known to cluster into two distinct clades:
the speciose core African clade and the African “B”clade
encompassing F. dlaminii and F. fredkrugeri (O'Donnell et al.
2000b,Herron et al. 2015,Sandoval-Denis et al. 2018b,Yilmaz
et al. 2021). The novel South African species F. echinatum,
however, formed a fully-supported single lineage that did not
belong to any of the currently known biogeographically defined
clades (Fig. 11). The most noticeable morphological feature that
distinguishes F. echinatum is the presence of well-developed
polyphialides bearing multiple conidiogenous openings that are
often concentrated in large numbers and that cause a deforma-
tion of the apical region. Somewhat similar, conspicuous poly-
phialides can be found in Fusarium chlamydosporum and
F. concolor (syn. F. polyphialidicum); however, these species are
not directly related, in that they belong to two different species
complexes, the F. chlamydosporum and F. concolor species
complexes, respectively (Fig. 10). The polyphialides formed by
these two species do not show as many conidiogenous loci as do
those of F. echinatum.
Fusarium prieskaense G.J. Marais & Sand.-Den., sp. nov.
MycoBank MB 838661. Fig. 24.
Etymology: Referring to Prieska, a town in Northern Cape
Province, South Africa, where the type was collected.
Typus:South Africa, Northern Cape Province, Prieska,
on Prunus spinosa, 2010, F.J.J. van der Walt & G.J. Marais
(holotype CBS H-24660, culture ex-type CBS 146498 = CPC
30826 = CAMS 001176).
Conidiophores on aerial mycelium 12.5–43.5 μm tall, un-
branched or rarely irregularly or sympodially branched and
proliferating, bearing terminal single phialides or whorls of 2–3
phialides, commonly reduced to solitary conidiogenous cells
borne laterally on hyphae; aerial conidiogenous cells mono- and
polyphialides, subulate to subcylindrical, smooth- and thin-wal-
led, 8–29.5 × 2–5μm, polyphialides often with 2–3 con-
idiogenous openings, periclinal thickening and collarettes often
inconspicuous or absent. Aerial microconidia forming small
false heads and short chains on phialide tips, hyaline, obovoid to
short clavate, smooth and thin-walled, 0-septate, (4.5–)
6–9(–13) × 2–3(–4) μm (av. 7.4 × 2.6 ìm). Sporodochial co-
nidiophores 24.5–39(–45) μm tall, irregularly branched, bearing
terminal solitary or whorls of 2–3 phialides. Sporodochial con-
idiogenous cells monophialidic, doliiform, subulate
to subcylindrical, smooth- and thin-walled, (8.5–)
10–14(–15) × 2–4.5 μm. Sporodochial conidia straight to
moderately curved and slender, tapering towards the basal part,
apical cell more or less equally sized as the adjacent cell, blunt to
slightly hooked; basal cell well-developed, foot-shaped, rarely
papillate, (1–)3–4-septate, hyaline, thin- and smooth-walled: 1-
septate conidia: 23.5 × 3.5 μm; 3-septate conidia: (33.5–)
44.5–58(–68.5) × (3–)3.5–4.5( –5) μm (av. 51.1 × 4 μm); 4-
septate conidia: (52.5–)55.5–67.5(–71) × 3.5 –4.5 μm (av.
61.3 × 4.1 μm); overall: (23–)44–59(–71) × 3–4(–5) μm (av.
51.3 × 4 μm). Chlamydospores not observed.
Culture characteristics: Colonies on PDA reaching
42–68 mm diam at 25 °C after 7 d. Surface pale luteous, luteous
to pale sienna, flat, velvety to felty, sometimes with small white
patches of aerial mycelium, margin filiform and regular. Reverse
sulphur yellow to amber, pale orange at centre. On OA, sienna to
pale umber, flat, membranous to dusty, margin entire and reg-
ular; reverse sienna to pale umber.
Additional material examined:South Africa, Northern Cape Province, Prieska,
on Prunus spinosa, 2010, F.J.J. van der Walt & G.J. Marais, culture CBS
146499 = CPC 30827 = CAMS 001177; on Aloidendron dichotomum, 2010, F.J.J.
van der Walt & G.J. Marais, culture CPC 30825 = CAMS 001175.
Notes: Fusarium prieskaense is nested within the core African
clade of the FFSC (Fig. 11). Similar to most members of this
clade, this species is characterised by forming mostly mono-
phialides and occasional to frequent polyphialides, sometimes
proliferating and producing aerial conidia typically organised in a
combination of false heads and short to long chains. Fusarium
prieskaense is morphologically and phylogenetically related to
Fusarium brevicatenulatum and F. pseudonygamai from which it
can be differentiated by its pale luteus to yellow colony pigmen-
tation on PDA, versus the orange to dark blue or violet pigments
produced by the two latter species (Leslie & Summerell 2006).
Additionally, sporodochia and macroconidia are commonly and
abundantly produced by F. prieskaense, whereas these structures
are relatively rare in the two aforementioned species. Moreover,
the obovoid to short clavate microconidia of F. prieskaense also
distinguishes this species from F. brevicatenulatum, which is
characterised by long oval to obovoid microconidia (Nirenberg
et al. 1998).
Fusicolla Bonord., Handb. Allg. Mykol.: 150. 1851. Figs 8,25.
Type species:Fusicolla betae (Desm.) Bonord., Handb. Allg.
Mykol.: 150. 1851.
CROUS ET AL.
50

Fig. 15. Maximum-Likelihood (IQ-TREE-ML) consensus tree inferred from the combined acl1, ITS, and rpb2 sequence alignment of members of the genus Stylonectria.
Numbers at the branches indicate support values (RAxML-BS / UFboot2-BS / BI-PP) above 70 % / 0.95 with thickened branches indicating full support (RAxML-BS / UFboot2-
BS = 100 %; BI-PP = 1). Novel taxa are indicated in bold. The scale bar indicates expected changes per site. The tree is rooted to Macroconia leptosphaeriae CBS 100001. Ex-
epitype and ex-type strains are indicated with ET and T, respectively.
Fig. 16. Albonectria spp. A–C. Ascomata on natural substrate. D. Surface view of perithecial wall in 2 % KOH. E–K. Asci and ascospores (J, K. Surface view). L–P. Conidiophores
and conidiogenous cells. Q, R. Microconidia. S. Macroconidia. A, C–F, H –J. Albonectria rigidiuscula (BPI 553050). B, G, K. Albonectria rigidiuscula (BPI 1104484). L, M, P–S.
Albonectria rigidiuscula (CBS 122570). N, O. Albonectria rigidiuscula (CBS 133.25). Scale bars: A–C = 100 μm; all others = 10 μm (G applies to H–K).
FUSARIUM REDELIMITED
www.studiesinmycology.org 51

(See F. betae in List section for synonyms)
Ascomata perithecial, solitary, rarely gregarious, with erumpent
stroma, fully or partially immersed in a slimy, pale orange sheet of
hyphae over the substrate, globose to pyriformwith a short acute or
disk-like papilla, not collapsing when dry, yellow, pale buff to orange,
not changing colour in KOH, smooth-walled, rarely tuberculate,
generally lacking hairs or with short, thick-walled hyphae-like
structures. Asci cylindrical to narrowly clavate, with an apical ring, 8-
spored. Ascospores broadly ellipsoidal, 1-septate, slightly con-
stricted at the septum, verrucose, hyaline to pale brown. Co-
nidiophores initially as lateral phialides on somatic hyphae,
sometimes monochasial, verticillate or penicillate, hyaline. Con-
idiogenous cells monophialidic, cylindrical to subulate, hyaline.
Microconidia absent or sparse, ellipsoidal to allantoid, aseptate,
hyaline. Macroconidia falcate,straight to curved, narrowing towards
the ends, apicalcell often hooked with a pointed tip, basal cell poorly
developed, foot-shaped, 1–3-septate or 3–5-septate or up to 10-
septate, hyaline. Chlamydospores absent to abundant, globose,
single, in pairs or chains, sometimes formed in macroconidia.
[Description adapted from Gerlach & Nirenberg (1982) and
Gr€
afenhan et al. (2011)].
Diagnostic features: Yellow to orange, mostly smooth-walled
perithecia with a short acute or disk-like papilla producing cy-
lindrical to narrowly clavate asci bearing broadly ellipsoidal, 1-
septate, verrucose ascospores and fusarioid asexual conidia.
Fusicolla quarantenae J.D.P. Bezerra, Sand.-Den., Crous &
Souza-Motta, sp. nov.MycoBank MB 838692. Fig. 26.
Etymology: The epithet refers to the quarantine period during the
2020–2021 coronavirus pandemic, which killed thousands of peo-
ple on five continents, and during which this species was described.
Fig. 17. Atractium spp. A, B. Synnemata. C–G. Conidiophores and conidiogenous cells. H. Microconidia. I. Macroconidia. A–D, H. Atractium stilbaster (CBS 410.67). E–G, I.
Atractium crassum (CBS 180.31). Scale bars: A = 100 μm; all others = 10 μm.
Fig. 18. Bisifusarium spp. A–D, F–J. Conidiophores and conidiogenous cells. K, L. Microconidia. E, M. Macroconidia. A –E. Bisifusarium dimerum (CBS 108944). F –M.
Bisifusarium delphinoides (CBS 120718). Scale bars: H, J = 5 μm; all others = 10 μm.
CROUS ET AL.
52

Typus:Brazil, Pernambuco state, Itaíba municipality, Curral
Velho Farm, 9º08.895 S 37º12.069 W, on cladodes of Melocactus
zehntneri, Sep. 2013, J.D.P. Bezerra (holotype URM 94407,
culture ex-type URM 8367 = CBS 141541).
Conidiophores arising laterally from somatic hyphae,
simple, straight, hyaline, thin- and smooth-walled, septate,
25–116 × 1.5–2.5 μm, or reduced to solitary conidiogenous
cells. Conidiogenous cells monophialidic, arising laterally from
hyphae, cylindrical to subulate, straight, hyaline, thin- and
smooth-walled, 1–22 × 0.5–2μm, or as short lateral pegs.
Macroconidia falcate, more or less straight, slightly narrowing
towards the ends, apical cell often hooked with a more or
less pointed tip, basal cell poorly developed, foot-shaped,
hyaline, thin- and smooth-walled, 3-septate, (21–)
27–35(–38.5) × 2–2.5(–3) μm (av. 29.5 × 2.5 μm, n = 30).
Microconidia,chlamydospores and sexual morph not observed.
Culture characteristics: Colonies on PDA reaching 15 mm diam
after at 25 °C after 7 d. Surface yellow to apricot in centre, peach
to brick in middle, and salmon at margin, flat, aerial mycelium
absent, slimy, with entire margin; reverse yellow to brick.
Notes:Fusicolla quarantenae, an endophyte of Melocactus
zehntneri, is morphologically reminiscent of Fu. betae,Fu. epis-
troma, and Fu. septimanifiniscientiae, all of which produce mainly
3-septate macroconidia. Fusicolla betae and Fu. epistroma differ
by having larger conidia (50–60 μm and 19–45 μm long,
Fig. 19. Cosmosporella spp. A–D. Ascomata on natural substrate. E. Surface view of perithecial wall. F. Asci. G–J. Ascospores. K, L. Conidiophores. M. Microconidia. N, O.
Macroconidia. A–J. “Cosmospora”flavoviridis (photos P. Ml
coch). K–N. “Cosmospora”flavoviridis (CBS 124353). O. Cosmosporella cavisperma (CBS 172.31). Scale bars:
A–D = 300 μm; E = 50 μm; G–J=5μm; all others = 10 μm.
Fig. 20. Cyanonectria spp. A–C. Ascomata on natural substrate. D. Longitudinal section through perithecium in Shears. E. Surface view of perithecial wall in 2 % KOH. F, G.
Asci. H–K. Ascospores (K. Surface view). L–O. Conidiogenous cells. P. Macroconidia. A–C, E–J. Cyanonectria buxi (CBS H-20380). D, K. Cyanonectria buxi (CBS H-20379).
L–N. Cyanonectria buxi (CBS 130.97). O, P. Cyanonectria buxi (CBS 125551). [A, D, L. adapted from Schroers et al. (2011).] Scale bars: A–D = 100 μm; H –K=5μm(H
applies to I and J); all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 53

Fig. 21. Dialonectria spp. A–D. Ascomata on natural substrate. E. Surface view of perithecial wall in 2 % KOH. F–H. Asci. I–M. Ascospores (L, M. Surface view). N, O.
Conidiophores and conidiogenous cells. P. Macroconidia. A, B. Dialonectria episphaeria (photos P. Ml
coch). C, D, F, M. Dialonectria episphaeria (CBS H-19716). E, G, K.
Dialonectria sanguinea (CBS H-2127). H–J, L. Dialonectria episphaeria (CBS H-2662). N–P. Dialonectria episphaeria (CBS 125494). Scale bars: A–D = 100 μm; I, L, M = 5 μm
(I applies to J and K); all others = 10 μm.
Fig. 22. Fusarium spp. A–D. Ascomata on natural substrate. E. Surface view of perithecial wall in 2 % KOH. F–H. Asci. I–M. Ascospores (M. Surface view). N–P. Co-
nidiophores and conidiogenous cells. Q–T. Microconidia. U–A2. Macroconidia. A. Fusarium graminearum (photo P. Cannon). B, C, F. Fusarium sambucinum [adapted from
Wergen (2018)]. D. Fusarium sp. (HPC 2244). E. Fusarium cf.tricinctum (CBS H-12819). G, I. Fusarium lateritium (photo P. Cannon). H, K. Fusarium equiseti (CBS H-12817). J.
Fusarium sambucinum (BPI 632307). L, M. Fusarium sambucinum (CBS H-12818). N. Fusarium avenaceum (CPC 30660). O, Q. Fusarium fredkrugerii (CBS 144209). P, W.
Fusarium prieskaense (CBS 146498). R. Fusarium madaense (CBS 146669). S. Fusarium globosum (CBS 428.97). T. Fusarium echinatum (CBS 146497). U. Fusarium
avenaceum (CBS 408.86). V. Fusarium caeruleum (CBS 146590). X. Fusarium longicaudatum [CBS 123.73, adapted from Xia et al. (2019)]. Y. Fusarium transvaalense [CBS
144211, adapted from Sandoval-Denis et al. (2018b)]. Z. Fusarium gamsii (CBS 143610). A1. Fusarium oxysporum [CBS 144134, adapted from Lombard et al. (2019b)]. A2.
Fusarium convolutans [CBS 144207, adapted from Sandoval-Denis et al. (2018b)]. Scale bars: A–D = 100 μm; I –M, Q–T=5μm; all others = 10 μm.
CROUS ET AL.
54

respectively, Gerlach & Nirenberg 1982). The absence of chla-
mydospores in Fu. quarantenae further differentiates this species
from Fu. epistroma and Fu. septimanifiniscientiae (Gerlach &
Nirenberg 1982,Crous et al. 2018).
Fusicolla meniscoidea L. Lombard & Sand.-Den., sp. nov.
MycoBank MB 838662. Fig. 27.
Etymology: From Greek m
eniskos, crescent, in reference to the
shape of its conidia.
Typus:Australia, from soil, unknown collection date (before
1978), unknown collector (holotype CBS H-24662, culture ex-
type CBS 110189 = FRC E-0086).1
Conidiophores arising laterally or terminally from somatic hyphae
50–70 μm long, simple or sparingly branched laterally, straight,
hyaline, smooth- and thin-walled, bearing terminal and lateral
conidiogenous cells, or more commonly reduced to single con-
idiogenous cells borne laterally on the substrate and aerialhyphae.
Conidiogenous cells monophialidic, subcylindrical, cylindrical to
slightly subulate, 10.5–35 × 2–3.5 μm, smooth- and thin-walled,
without noticeable periclinal thickening, a minute apical collarette
can be present. Macroconidia falcate, tapering gently towards both
ends, apical cell often hooked with a blunt to pointy apex, basal cell
obtuse to poorly developed, foot-shaped, 0–2(–3)-septate, pre-
dominantly 1-septate, hyaline, smooth- and thin-walled; 0-septate
(8–)9 –13(–15) × 2–3.5 μm (av. 11.1 × 2.9 μm); 1-septate, (9–)
11.5 –15(–17.5) × 2.5–3.5 μm (av. 13.1 × 2.9 μm); 2-septate,
13–17.5(–18) × 2.5–4μm(
av.15.4×3μm); 3-septate,
20–24.5(–25.5) × 3–3.5 μm (av. 22.6 × 3.3 μm). Microconidia,
chlamydospores and sexual morph not observed.
Fig. 23. Fusarium echinatum (CBS 146497). A–D. Aerial conidiophores. E–G. Conidiogenous cells on aerial conidiophores. H, I. Microconidia. J. Sporodochia formed on the
surface of carnation leaves. K. Sporodochial conidiophores and conidiogenous cells. L. Macroconidia. Scale bars: A = 20 μm; J = 100 μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 55

Culture characteristics: Colonies on PDA reaching
21–30 mm diam at 25 °C after 7 d. Surface white to pale luteus
at periphery, centre salmon to pale orange, flat to slightly radially
folded, membranous to slimy, margin entire to slightly undulate;
reverse luteous to pale salmon at centre. On OA, pale luteous to
pale salmon, flat, membranous, margin entire; reverse pale
luteous.
Notes:Fusicolla meniscoidea is here introduced based on an
isolate originally misidentified as Bisifusarium dimerum.
Despite the great genetic differences and phylogenetic dis-
tance, the two taxa share similar morphological traits, particu-
larly regarding macroscopic aspects of colonial growth, and the
shape and size of conidiophores and conidia. However, unlike
in B. dimerum, conidia of Fu. meniscoidea present a much
more pronounced curvature involving both conidial planes
(somewhat parallel walls), while foot-shaped basal cells are
less evident or absent. Fusicolla aqueductuum,Fu. betae,Fu.
quarantenae,andFu. violacea are all morphologically related to
Fu. meniscoidea by showing similar conidial septation ranges
and lacking chlamydospores. Conidial size in Fu. meniscoidea
is, however, markedly reduced and often closer to the lower
limits of the conidial size of all the aforementioned species.
Another species also described here, Fusicolla sporellula,lacks
chlamydospores but has similar, although smaller, conidia with
a reduced range of septa (0- or 1-septate). It furthermore differs
from Fu. meniscoidea by its shorter and doliiform con-
idiogenous cells.
Fusicolla sporellula Sand.-Den. & L. Lombard, sp. nov.
MycoBank MB 838663. Fig. 28.
Etymology: From Latin, very small spores, in reference to its very
small conidia.
Fig. 24. Fusarium prieskaense (CBS 146498). A–D. Aerial conidiophores. E–G. Conidiogenous cells on aerial conidiophores. H. Microconidia. I. Sporodochia formed on the
surface of carnation leaves. J–L. Sporodochial conidiophores and conidiogenous cells. M. Macroconidia. Scale bars: A, B = 20 μm; I = 100 μm; all others = 10 μm.
CROUS ET AL.
56

Typus:South Africa, Transkei, from soil, unknown collection
date (before 1983), unknown collector (holotype CBS H-24663,
culture ex-type CBS 110191 = FRC E-0139).
Conidiophores arising laterally from substrate and aerial
hyphae 14–35 μm long, simple or laterally and verticillately
branched, straight, hyaline, smooth- and thin-walled, or
reduced to single conidiogenous cells. Conidiogenous cells
monophialidic, doliiform, short lageniform to subulate
7.5–20 × 2.5–4μm, smooth- and thin-walled, with or without
inconspicuous periclinal thickening, collarettes absent; or
reduced to short phialidic pegs emerging laterally from hyphae,
1–5×1–2.5 μm, smooth- and thin-walled, with inconspicuous
periclinal thickening and an often conspicuously flared collar-
ette. Macroconidia lunate to falcate, moderately to strongly
dorsiventrally curved, slightly narrowing towards both ends,
apical cell blunt, more or less hooked, basal cell obtuse
to poorly developed, foot-shaped, hyaline, thin- and smooth-
walled, 0- or 1-septate, predominantly 1-septate, 0-septate:
(11–)12–14(–15) × 2–3( –3.5) μm (av. 13.2 × 2.7 μm),
1-septate: (11.5–)13–16.5(–20) × 2.5–3.5 μm(av.
14.6 × 2.8 μm). Microconidia, chlamydospores, and sexual
morph not observed.
Culture characteristics: Colonies on PDA reaching 24–31 mm
diam at 25 °C after 7 d. Surface white, luteous to orange, flat to
slightly radially folded, membranous to slimy, margin entire;
reverse pale luteous to saffron, peach at centre. On OA, pale
luteous to peach, flat, membranous with filiform to undulate
margins; reverse pale peach to saffron.
Fig. 25. Fusicolla spp. A. Slimy macroscopic growth on natural substrate. B–E. Ascomata on natural substrate. F. Ostiolar hairs. G. Asci. H. Ascospores. I–K. Conidiophores
and conidiogenous cells. L–N. Macroconidia. A. Fusicolla merismoides (photo J. Cunningham). B. Fusicolla melogrammae [CLL 16006, adapted from Crous et al. (2016)].
C–H. Fusicolla ossicola (photos N. Aplin and P. Cannon). I. Fusicolla merismoides (photo P. Cannon). J, K, M. Fusicolla aquaeductuum (CBS 734.79). L. Fusicolla violacea
(CPC 38810). N. Fusicolla matuoi (CBS 581.78). Scale bars: B–E = 100 μm; F, H. 5 μm; all others = 10 μm.
Fig. 26. Fusicolla quarantenae (URM 8367). A. Host. B–G. Conidiophores, conidiogenous cells and conidia. H. Macroconidia. Scale bars = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 57

Notes:Fusicolla sporellula presents the smallest conidia
described to date for any species in this genus. This taxon is
phylogenetically and morphologically related to Fu. meniscoidea,
from which it can be differentiated by its smaller and less septate
conidia, and by the characteristic doliiform shape of its con-
idiogenous cells.
Geejayessia Schroers et al., Stud. Mycol. 68: 124. 2011. Figs
8,29.
Type species:Geejayessia cicatricum (Berk.) Schroers, Stud.
Mycol. 68: 124. 2011.
(See F. cicatricum in List section for synonyms)
Ascomata perithecial, caespitose, with erumpent, byssoid or
densely prosenchymatous stroma, superficial, broadly ampulli-
form with short ostiolar neck to broadly ellipsoidal, not collapsing
when dry, pale orange, brownish to reddish orange, bright,
reddish black or black, changing colour in KOH if not black and
becoming purple in lactic acid, mostly smooth-walled, lacking
hairs or appendages. Ascomatal wall consists of a single region,
comprising several layers of morphologically similar cells. Asci
cylindrical to clavate, with a broadly rounded or flattened apex,
with or without a minute refractive ring, 8-spored, mostly over-
lapping, uniseriate or biseriate above and uniseriate below. As-
cospores broadly ellipsoidal to ellipsoidal, 1-septate, slightly
constricted at the septum, verrucose, hyaline to pale brown.
Conidiophores mononematous (aerial conidiophores) or grouped
on sporodochia. Aerial conidiophores unbranched, sympodial or
irregularly branched, bearing terminal or lateral phialides, often
reduced to single phialides. Conidiogenous cells monophialidic,
subcylindrical to cylindrical, smooth- and thin-walled, with peri-
clinal thickening inconspicuous or absent. Aerial conidia hyaline,
smooth- and thin-walled, of two types: microconidia, present in
some species, ellipsoidal to fusoid, 0- or 1-septate, with rounded
ends, straight to slightly curved; macroconidia typically formed on
sporodochia, falcate, straight to gently curved dorsiventrally,
Fig. 28. Fusicolla sporellula (CBS 110191). A–C. Conidiophores. D–F. Conidiogenous cells. G. Macroconidia. Scale bars = 10 μm.
Fig. 27. Fusicolla meniscoidea (CBS 110189). A–D. Conidiophores. E–H. Conidiogenous cells. I. Macroconidia. Scale bars: A–D, G–I=10μm; E, F = 5 μm.
CROUS ET AL.
58

3–8-septate, with a blunt apical cell and well-developed foot-
shaped basal cell. Sporodochia cream to pale yellow; sporodo-
chial conidiophores verticillately branched and densely packed,
consisting of short, smooth- and thin-walled stipes bearing an
apical whorl of 2–3 monophialides; sporodochial conidiogenous
cells monophialidic, cylindrical to subcylindrical, smooth- and
thin-walled, with reduced or flared collarette. Chlamydospores
unknown.
[Description adapted from Schroers et al. (2011) and Lombard
et al. (2015)].
Diagnostic features: Pale orange, brownish to reddish orange,
bright red, reddish black to black, mostly smooth-walled peri-
thecia with short ostiolar neck producing clavate to cylindrical
asci bearing ellipsoidal, 1-septate, verrucose ascospores and
asexual morphs producing only macroconidia on sporodochia or
micro- and macroconidia on elongate subulate to subcylindrical
aerial conidiophores with monophialides. Chlamydospores
absent.
Ilyonectria P. Chaverri & C. Salgado, Stud. Mycol. 68: 69. 2011.
Fig. 8.
Type species:Ilyonectria destructans (Zinssm.) Rossman et al.,
Stud. Mycol. 80: 217. 2015.
(See F. aderholdii in List section for synonyms)
Ascomata perithecial, solitary or gregarious, non-stromatic, su-
perficial, globose to subglobose or ovoid to obpyriform, red,
turning purple to dark purple in KOH, pigment dissolving in lactic
acid, not collapsing when dry, with broadly conical papilla or
flattened apex, smooth to slightly rugulose, lacking hairs or ap-
pendages. Ascomatal wall of two regions: outer region of thick-
walled, pigmented cells forming a textura globosa; inner region of
compressed, flattened cells, becoming thinner towards the
centrum. Asci narrowly clavate to cylindrical, 8-spored, apex
subtruncate, with inconspicuous apical ring, uniseriate. Asco-
spores ellipsoidal, 1-septate, hyaline, smooth. Conidiophores
simple or complex or sporodochial; simple conidiophores arising
laterally or terminally from aerial mycelium, solitary or loosely
aggregated, unbranched or sparsely branched, bearing up to
three phialides; complex conidiophores solitary or aggregated in
small sporodochia, repeatedly and irregularly branched. Con-
idiogenous cells monophialidic, cylindrical, tapering towards the
apex. Microconidia 0- or 1-septate, ovoid to fusoid to ellipsoidal,
with a minutely or clearly laterally displaced hilum, formed in
heads on solitary conidiophores or as masses on sporodochia.
Macroconidia straight, cylindrical, 1–3(–4)-septate, with both
ends obtusely rounded, base sometimes with a visible, centrally
located to laterally displaced hilum, forming flat domes of slimy
masses. Chlamydospores globose to subglobose, thick-walled,
intercalary or solitary, initially hyaline, becoming brown with age.
[Description adapted from Chaverri et al. (2011)].
Diagnostic features: Red, mostly smooth-walled perithecia with
conical papilla or flattened apex producing cylindrical asci
bearing ellipsoidal, 1-septate ascospores and cylindrocarpon-like
asexual morph characterised by 1–3(–4)-septate macroconidia
with centrally located to laterally displaced hilum.
Luteonectria Sand.-Den., L. Lombard, Schroers & Rossman,
gen. nov.MycoBank MB 838664. Figs 8,30.
Etymology: Name refers to the luteous coloured, nectria-like
ascomata characteristic of these fungi.
Type species:Luteonectria albida (Rossman) Sand.-Den. & L.
Lombard
Ascomata perithecial, gregarious on a well-developed stroma
composed of pseudoparenchymatous cells, covered with loose,
white hyphae, smooth and thin-walled, globose to pyriform, off-
white to pale luteous, becoming ochraceous when dry, with a
broadly rounded and papillate apical region, not changing colour
in KOH or lactic acid, short setae-like hairs sometimes emerging
from perithecial wall. Asci clavate with simple apex, 8-spored,
ascospores overlapping irregularly uniseriate to biseriate. As-
cospores fusiform with rounded ends, 3-septate, slightly con-
stricted at septum, hyaline, becoming pale yellow-brown,
smooth-walled to finely striate. Conidiophores mononematous,
Fig. 29. Geejayessia spp. A–E. Ascomata on natural substrate. F. Surface view of perithecial wall in 2 % KOH. G–I. Asci. J–M. Ascospores. N, O. Conidiophores and
conidiogenous cells. P, Q. Macroconidia. A, C. Geejayessia cicatricum [CBS H-20375, adapted from Schroers et al. (2011)]. C. Geejayessia cicatricum (CBS H-20374). D, H, K,
M. Geejayessia atrofusca (CBS H-20381). E–G, I, J, L. Geejayessia desmazieri (CBS H-20372). N, O, Q. Geejayessia atrofusca (CBS 502.94). P. Geejayessia cicatricum (CBS
125549). Scale bars: A = 500 μm; B, D, E = 200 μm; C = 100 μm; J –M=5μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 59

septate and irregularly branched, bearing terminal phialides.
Conidiogenous cells monophialidic, cylindrical to subcylindrical,
smooth- and thin-walled, with periclinal thickening inconspicuous
to absent. Macroconidia fusoid and multiseptate, 1–7-septate,
curved, hyaline, with a wide, blunt apical cell and a poorly- to
well-developed, foot-shaped basal cell. Micro- and mesoconidia
unknown. Chlamydospores unknown.
[Description adapted from Rossman (1983) and Schroers et al.
(2011)].
Diagnostic features: Off-white to pale luteous perithecia that do
not change colour on KOH or lactic acid, formed on well-
developed stroma producing clavate asci containing fusiform, 3-
septate, finely striate ascospores and fusarioid asexual morph
characterised by monophialides producing robust multiseptate
conidia from aerial conidiophores, lacking micro- and meso-
conidia, and chlamydospores.
Luteonectria albida (Rossman) Sand.-Den. & L. Lombard,
comb. nov. MycoBank MB 838665.
Basionym:Nectria albida Rossman, Mycol. Pap. 150: 79. 1983.
Synonyms:Albonectria albida (Rossman) Guu & Y.M. Ju, Bot.
Stud. (Taipei) 48: 189. 2007.
Fusarium albidum (Rossman) O'Donnell & Geiser, Phytopa-
thology 103: 404. 2013.
Typus:Jamaica, Hanover Parish, Dolphin Head Mt. near
Askenish, on bark of woody stem of unknown host, 22 Jan. 1971,
R.P. Korf et al. (holotype CUP-MJ 942, culture ex-type ATCC
44543 = CTR 71-110 = BBA 67603 = NRRL 13950 = NRRL
22152).
Description and illustration: Rossman (1983),Guu et al. (2007),
Schroers et al. (2011).
Additional material examined:Costa Rica, Lim
on, Central Distrito Valle, Valle del
Estrella, Selva Biologia Hitoi Caneri, 100 –150 m alt, on bark of living tree, 7 Jul.
1999, G.J. Samuels et al., BPI 746587, culture CBS 102683. Jamaica, New-
castle, Chesterville Youth Developmental Camp, on undetermined host, 8 Jan.
1971, A.Y. Rossman, BPI 550103. Venezuela, Los Venados, El Avila, along Trail
1–2 km above Los Venados, El Avila, on undetermined substrate, 24 Jul. 1972,
K.P. Dumont et al., BPI 1108875.
Luteonectria nematophila (Nirenberg & Hagedorn) Sand.-Den.
& L. Lombard, comb. nov. MycoBank MB 838666.
Basionym:Fusarium nematophilum Nirenberg & Hagedorn,
Nachrichtenbl. Deutsch. Pflanzenschutzdienstes 60: 214. 2008.
Typus:Germany, Berlin, from soil with roots of Hedera helix,
unknown date and collector (holotype BBA 72279 in B, culture
ex-type BBA 72279 = NRRL 54600).
Description and illustration:Nirenberg & Hagedorn (2008).
Macroconia (Wollenw.) Gr€
afenhan et al., Stud. Mycol. 68: 101.
2011. Figs 8,31.
Basionym:Nectria sect. Macroconia Wollenw., Angew. Bot. 8:
179. 1926.
Type species:Macroconia leptosphaeriae (Niessl) Gr€
afenhan &
Schroers, Stud. Mycol. 68: 102. 2011.
Synonyms:Nectria leptosphaeriae Niessl, in Krieger, Fungi
Saxon. Exs.: no. 165. 1886.
Cucurbitaria leptosphaeriae (Niessl) Kuntze, Revis. Gen. Pl. 3:
461. 1898.
Hypomyces leptosphaeriae (Niessl) Wollenw., Fusaria Autogr.
Delin. 1: 57. 1916.
Lasionectria leptosphaeriae (Niessl) Petch, Trans. Brit. Mycol.
Soc. 21: 268. 1938.
Cosmospora leptosphaeriae (Niessl) Rossman & Samuels, Stud.
Mycol. 42: 122. 1999.
Ascomata perithecial, solitary, with stroma inconspicuous or
absent, subglobose with or without a small apical papilla, orange
to carmine red, turning dark red to violet in KOH, sometimes with
Fig. 30. Luteonectria albida.A–C. Ascomata on natural substrate. D. Surface view of perithecial wall in lactic acid. E. Detail of ascomata hair. F. Asci. G–J. Ascospores (J.
Surface view). K, L. Conidiophores and conidiogenous cells. M. Macroconidia. A, C. BPI 550103. B. BPI 1108874. D–J. BPI 1108875. K–M. CBS 102683. Scale bars: A,
B = 100 μm; C = 50 μm; all others = 10 μm.
CROUS ET AL.
60

hyphal hairs arising from the outer wall. Asci cylindrical to
narrowly clavate, with a simple apex, 8-spored, uniseriate or
partially biseriate. Ascospores yellowish, 1-septate, smooth,
sometimes becoming striate when mature. Conidiophores initially
as lateral phialides on somatic hyphae, later monochasial to
verticillate, hyaline. Conidiogenous cells monophialidic, cylindri-
cal to subulate, hyaline. Microconidia rare or absent, ellipsoidal to
allantoid, hyaline. Macroconidia subcylindrical to curved, apical
cell conical or hooked, basal cell poorly- to well-developed, foot-
shaped, 3–7(–14)-septate, hyaline. Chlamydospores absent to
rare, globose, single, in pairs or chains in hyphae.
[Description adapted from Gr€
afenhan et al. (2011)].
Diagnostic features: Orange-red to carmine-red perithecia with or
without a small papilla producing cylindrical to narrowly clavate
asci bearing 1-septate ascospores that sometimes become
striate when mature, and asexual morphs characterised by
verticillate conidiophores producing large, multiseptate fusarioid
macroconidia.
Macroconia bulbipes Crous & Sand.-Den., sp. nov.MycoBank
MB 838667. Fig. 32.
Etymology: Named after the shape of the basal cell, which is
commonly swollen, bulbous.
Typus:South Africa, Western Cape Province, Swellendam,
Bontebok National Park, from Erica sp. associated with Dimer-
osporiopsis engleriana, 24 Sep. 2018, A.R. Wood (holotype
CBS H-24664, culture ex-type CBS 146679 = CPC 37138).
Conidiophores commonly aggregated into sporodochia, more
rarely simple (aerial). Aerial conidiophores borne laterally on hy-
phae and commonly reduced to single conidiogenous cells, hyaline,
thin- and smooth-walled, 23.5–39.6 μmlong;conidiogenous cells
monophialidic, subcylindrical to cylindrical, hyaline, (23–)
24–25(–26.5) × 3 –4μm, without discernible periclinal thickeningor
collarettes. Sporodochia abundantly formed on carnation leaves
and on the agar surface, pink to pink-brown coloured. Sporodochia
light orange-peach, turning dark brick coloured in old cultures;
sporodochial conidiophores irregularly or verticillately branched,
40–55.5 μm long, irregularly branched, bearing lateral and terminal
solitary monophialides. Sporodochial conidiogenous cells mono-
phialidic, cylindrical to subcylindrical to subulate, (8–)
14.5–26.5(–30.5) × 3.5–5.5 μm with inconspicuous periclinal
thickening, flared collarettes absent. Microconidia absent. Macro-
conidia straight to moderately dorsiventrally curved, tapering toward
the apex, apical cell conical or hooked, and slightly extended, basal
cell well-developed, foot shaped, commonly irregularly swollen
at bottom, (2–)3–5(–6)-septate, predominantly 4-septate,
hyaline, thick- and smooth-walled: 2-septate conidia:
43–45.5 × 5 –5.5 μm (av. 44.2 × 5.1 μm); 3-septate conidia: (38.5–)
41–53(–55) × 5–6μm (av. 48.1 × 5.4 μm); 4-septate conidia:
(45.5–)50–62(–67.5) × 5–6(–7) μm (av. 56.1 × 5.8 μm); 5-septate
conidia: (58–)61–77(–80.5) × 5–6.5 μm (av. 68.9 × 5.8 μm); 6-
septate conidia: (70–)71–74 × 5.5 –6.5(–7) μm (av. 72.1× 6.4 μm);
overall: (38.5–)48–68(–80.5) × 5–6(–7) μm(av. 58 × 5.7 μm).
Chlamydospores commonly formed in the substrate mycelium and
conidia, spherical to subspherical, 8.5–11( –12.5) μm diam, hyaline
and smooth-walled. Sexual morph not observed.
Culture characteristics: Colonies on PDA reaching
21–24 mm diam at 25 °C after 7 d. Surface salmon to buff, flat,
membranous to velvety, with scant aerial mycelium and pion-
notal, margin white and regular; reverse pale salmon with radial
white to pale yellow patches. On OA, salmon to buff, flat,
membranous and pionnotal, with regular margin; reverse pale
pink to salmon.
Additional material examined:South Africa, Western Cape Province,
Swellendam, Bontebok National Park, from Erica sp. associated with Dimer-
osporiopsis engleriana, 24 Sep. 2018, A.R. Wood, culture CBS 146678 = CPC
37137.
Notes:Macroconia bulbipes resolved as the closest phylogenetic
relative to Ma. gigas and Ma. papilionacearum (Fig. 13). The
former is, however, clearly distinguished morphologically by its
Fig. 31. Macroconia spp. A–D. Ascomata on natural substrate. E. Surface view of perithecial wall in 2 % KOH. F. Asci. G–J. Ascospores (J. Surface view). K–M. Co-
nidiophores and conidiogenous cells. N. Microconidia. O, P. Macroconidia. A. Macroconia cupularis [HMAS 97514, adapted from Luo & Zhuang (2008)]. B, C. Macroconia
leptosphaeriae (photo P. Ml
coch). D. Macroconia gigas [HMAS 99592, adapted from Luo & Zhuang (2008)]. E–J. Macroconia leptosphaeriae (CBS H-15051). K, L. Macroconia
phlogioides (CBS 125496). M, N. Macroconia leptosphaeriae (CBS 10001). O. Macroconia phlogioides (CBS 146500). P. Macroconia bulbipes (CBS 146679). Scale bars:
A–D = 100 μm; G–J=5μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 61

smaller and less septate conidia (rarely up to 80.5 μm long and
up to 6-septate vs longer than 100 μm and more than 10-septate
in the latter two species). On the contrary, the asexual morph of
Ma. bulbipes is closer to that of Ma. leptosphaeriae and Ma.
sphaeriae (recognised as two distinct species in Gr€
afenhan et al.
2011). The conidia of Ma. bulbipes, however, differ by having
commonly swollen basal cells.
Macroconia phlogioides Sand.-Den. & Crous, sp. nov.
MycoBank MB 838668. Fig. 33.
Etymology: From Greek fl
oga. Referring to the flame-like
macroscopic semblance of the sporodochia.
Typus:South Africa, Limpopo Province, Tzaneen, on leaf of
Encephalartos sp., 2019, P.W. Crous (holotype CBS H-24665,
culture ex-type CBS 146501 = CPC 35389).
Conidiophores simple (aerial) or aggregated into sporodochia.
Aerial conidiophores often borne laterally on hyphae and
reduced to single conidiogenous cells, rarely 1-septate, hyaline,
thin- and smooth-walled, 13–17 × 26–32 μm; conidiogenous
cells monophialidic, subcylindrical to cylindrical, hyaline, (13–)
16–24(–27.5) × (3.5–)4–5μm conidiogenous opening rather
wide, with inconspicuous periclinal thickening and no discernible
apical collarettes. Sporodochia orange-pink to pink-brown col-
oured, often acquiring a flame-like, somewhat pointy macro-
scopic appearance and later merging into pionnotal crusts;
sporodochial conidiophores irregularly or verticillately branched,
37.5–46 μm long, often bearing groups of 2–3 conidiogenous
cells; sporodochial conidiogenous cells monophialidic, sub-
cylindrical to subulate, (10–)18.5–26(–30) × (2.5 –)3.5 –5μm
with inconspicuous periclinal thickening, collarettes absent.
Microconidia absent. Macroconidia robust, often with a nearly
straight central portion and markedly curved and tapering to-
wards both ends, apical cell conical to hooked, basal cell well-
developed, foot-shaped, (1–)9–15(–19)-septate, predominantly
11-septate, hyaline, thick- and smooth-walled: 9-septate conidia:
(106.5–)119.5–140( –143.5) × 7.5 –8.5(–9) μm (av. 129 × 8 μm);
10-septate conidia: (116–)120 –144.5( –164) × (7–)7.5–9μm
(av. 132 × 8 μm); 11-septate conidia: (122–)127–140
(–153.5) × 7.5–9(–9.5) μm (av. 134 × 8.5 μm); 12-septate
conidia: (119–)127.5–146.5( –153) × 7.5 –9.5( –10) μm (av.
137 × 8.5 μm); 13-septate conidia: (128–)132–155
(–172) × (7–)8–9(–10) μm (av. 143.5 × 8.5 μm); 14-septate
conidia: (133.5–)136–157(–168) × 8–9.5 μm (av.
146.5 × 9 μm); 15-septate conidia: 147–163.5(–173.5) ×
8.5–9.5(–10) μm (av. 155 × 9 μm); overall: (86–)
123.5–150(–175) × (7–)8–9(–10) μm (av. 137 × 8.5 μm).
Chlamydospores and sexual morph not observed.
Culture characteristics: Colonies on PDA reaching
17–25 mm diam at 25 °C after 7 d. Surface salmon, buff to rosy
buff, flat to slightly raised at centre, glabrous or with central
patches of white, dense aerial mycelium; membranous to dusty
with regular margin; reverse pale luteous to sulphur yellow, with
salmon patches. On OA, salmon, flat, membranous, inconspic-
uously radially folded with regular margin; reverse pale pink to
luteous with more intense salmon-coloured patches.
Additional material examined:South Africa, Limpopo Province, Tzaneen, on leaf
of Encephalartos sp., 2019, P.W. Crous, culture CBS 146500 = CPC 35388. USA,
Arizona, Huachuca Mountains, Miller Canyon, on branch of Quercus sp. in
stream, 1 Oct. 2008, T. Gr€
afenhan, culture CBS 125496.
Notes: Macroconia phlogioides is morphologically related to Ma.
papilionacearum and Ma. gigas. These three species are char-
acterised by producing robust and large (often above 100 μm
Fig. 32. Macroconia bulbipes (CBS 146679). A–D. Conidiophores and conidiogenous cells. E, F. Sporodochia formed on the agar surface. G, H. Detail of macroconidia basal
cells. I. Macroconidia. Scale bars: E, F = 100 μm; G, H = 5 μm; all others = 10 μm.
CROUS ET AL.
62

long) macroconidia. Unlike the above-mentioned species, how-
ever, conidia of Ma. phlogioides tend to present a higher number
of septa (up to 19 vs up to 12 and 14, for Ma. papilionacearum
and Ma. gigas, respectively), with rounder and less tapered
apical cells, contrasting with the elongated conidial apices of Ma.
gigas. Conidia of Ma. phlogioides also differ by having a more
pronounced and continuous curvature compared to Ma. gigas
and Ma. papilionacearum. These three species are clearly
different phylogenetically, clustering in distant monophyletic lin-
eages of the genus (Fig. 13).
Mariannaea G. Arnaud ex Samson, Stud. Mycol. 6: 74. 1974.
Fig. 8.
Type species:Mariannaea elegans (Corda) Samson, Stud.
Mycol. 6: 75. 1974.
Basionym:Penicillium elegans Corda, Icon. Fung. 2: 17. 1838.
Synonyms:Hormodendron elegans (Corda) Bonorden, Handb.
Allg. Mykol.: 76. 1851.
Spicaria elegans (Corda) Harz., Bull. Soc. Imp. Naturalistes
Moscou 44: 238. 1871.
Paecilomyces elegans (Corda) Mason & Hughes, Mycol. Pap.
45: 27. 1951.
Ascomata perithecial, solitary, non-stromatic or on inconspicuous
stroma, superficial, globose with flat apex, not collapsing or
laterally pinched when dry, pale yellow, orange or brown, not
reacting in KOH, smooth-walled to slightly rugose, lacking hairs
or appendages. Asci cylindrical to narrowly clavate, 8-spored
sometimes with inconspicuous apical ring, uniseriate to apically
biseriate. Ascospores 1-septate, hyaline, smooth-walled to
spinulose. Conidiophores verticillate to penicillate, hyaline, with
phialides arising directly from the stipe or forming whorls of
metulae on lower parts of stipe; stipe hyaline, becoming yellow-
brown at the base. Conidiogenous cells monophialidic, ampulli-
form, hyaline, usually with obvious periclinal thickening and
inconspicuous collarettes. Conidia limoniform, aseptate, hyaline,
in chains that collapse to form slimy heads. Chlamydospores
globose to ellipsoidal, hyaline, formed in intercalary chains.
[Description adapted from Samson (1974),Gr€
afenhan et al.
(2011) and Lombard et al. (2015)].
Diagnostic features: Pale yellow, orange to brown perithecia with
flattened apex producing cylindrical to narrowly clavate asci bearing
1-septate ascospores and asexual morphs characterised by verti-
cillate to penicillate conidiophores producing small, aseptate,
limoniform conidia in chains that collapse into slimy heads.
Microcera Desm., Ann. Sci. Nat. Bot., s
er. 3, 10: 359. 1848. Figs
8,34.
Synonym:PseudomicroceraPetch, Trans. Brit. Mycol. Soc. 7:
164. 1921.
Type species:Microcera coccophila Desm., Ann. Sci. Nat. Bot.,
s
er. 3, 10: 359. 1848.
(See F. coccophilum in List section for synonyms)
Ascomata perithecial, solitary or gregarious, with stroma and/or
byssus covering host, globose, with a blunt papilla, orange to
dark red, turning dark red or violet in KOH, finely roughened. Asci
cylindrical to narrowly clavate, with an apical ring, 8-spored.
Ascospores hyaline to pale yellow-brown, 1(–3)-septate,
smooth, sometimes becoming tuberculate when mature. Co-
nidiophores as lateral phialides on somatic hyphae, becoming
monochasial, verticillate to penicillate, hyaline, forming discrete
sporodochia or synnemata on the host. Conidiogenous cells
monophialidic, cylindrical to subulate to subclavate, hyaline.
Macroconidia pale, orange, pink or bright red in mass, sub-
cylindrical, moderately or conspicuously curved, apical cell often
Fig. 33. Macroconia phlogioides (CBS 146501). A–C. Conidiophores. D, E. Conidiogenous cells. F, G. Sporodochia formed on the agar surface. H. Macroconidia. Scale bars:
B, C = 20 μm; F, G = 50 μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 63

slightly or conspicuously hooked, basal cell papillate to well-
developed, foot-shaped, (0–)3–5(–12)-septate, hyaline.
[Description adapted from Gr€
afenhan et al. (2011)].
Diagnostic features: Orange to dark red perithecia with a blunt
papilla producing cylindrical to narrowly clavate asci bearing
yellow-brown, 1(–3)-septate ascospores; asexual morphs char-
acterised by verticillate to penicillate conidiophores producing
small macroconidia; species typically associated with scale
insects.
Neocosmospora E.F. Sm., Bull. U.S.D.A. 17: 45. 1899. Figs
8,35.
Type species:Neocosmospora vasinfecta E.F. Sm., Bull.
U.S.D.A. 17: 45. 1899.
(See F. neocosmosporiellum in List section for synonyms)
Ascomata perithecial, solitary or gregarious, non-stromatic or
with reduced basal stroma, superficial, globose to pyriform, not
collapsing when dry, orange-brown to bright red, darkening or
becoming purple in KOH, papillate or with short ostiolar neck,
commonly tuberculate, rarely smooth-walled, lacking hairs or
appendages. Ascomatal wall of two regions: outer region of thick-
walled, pigmented cells forming a textura angularis; inner region
of elongate, hyaline, thin-walled cells, becoming thinner towards
the centrum. Asci saccate, clavate to cylindrical, unitunicate,
apex simple, rounded or flattened, 8-spored, uniseriate to
irregularly biseriate. Ascospores globose to ellipsoidal, with or
without slightly truncate ends, typically 1-septate, hyaline when
young becoming yellow golden-brown at maturity, thick-walled,
longitudinally striate; ascospores in some species 0-septate,
cerebriform or spinulose. Conidiophores mononematous (aerial)
or grouped on sporodochia, or somewhat erect, loosely
branched sporodochial pustules. Aerial conidiophores simple,
sparsely to highly branched; aerial conidiogenous cells mono-
phialidic, elongate subulate to subcylindrical. Aerial conidia
hyaline, smooth- and thick-walled, of two types: microconidia
subglobose, ellipsoidal to somewhat clavate, 0–2(–4)-septate,
borne in false heads on phialides; macroconidia falcate, slightly
to strongly curved dorsiventrally, 1-septate to multiseptate, with
blunt to hooked to slightly pointed apical cell and papillate to well-
developed foot-shaped basal cell. Sporodochia cream, pale
luteous, light green, olivaceous, bluish, hazel to greyish sepia;
sporodochial conidiophores verticillately or sympodially branched
or sparingly branched and densely packed, consisting of short,
smooth- and thin-walled stipes bearing apical whorl of 2–4
monophialides; sporodochial conidiogenous cells monophialidic,
doliiform, short subcylindrical to subulate, smooth- and thin-
walled, periclinal thickening and collarettes inconspicuous or
absent. Sporodochial macroconidia falcate, smooth- and thick-
walled, straight or curved with parallel walls to unequally curved,
in some species clavate and asymmetrical, tapering towards
both ends, with a pointed to blunt to hooked apical cell and
papillate to well-developed foot-shaped basal cell. Chlamydo-
spores globose to subglobose to ovoid to obovoid, hyaline to
pale golden brown, smooth-walled to slightly verrucose, terminal
or intercalary, solitary or in pairs or forming chains or aggregating
in some species to form buff, olive aeruginous or bluish
microsclerotia.
[Description adapted from Rossman et al. (1999) and Sandoval-
Denis et al. (2019)].
Diagnostic features: Orange-brown to frequently bright, blood red
warted perithecia with papillate or short ostiolar neck producing
saccate, clavate to cylindrical asci bearing globose to ellipsoidal, 0-
or 1-septate, longitudinally striate, cerebriform or spinulose asco-
spores and asexual morphs producing micro- and macroconidia
on elongate subulate to subcylindrical aerial conidiophores with
monophialides or only macroconidia in sporodochia. Chlamydo-
spores formed in hyphae, rarely observed in macroconidia.
Neocosmospora epipeda Quaedvl. & Sand.-Den., sp. nov.
MycoBank MB 838669. Fig. 36.
Fig. 34. Microcera spp. A–C. Ascomata on natural substrate. D. Surface view of perithecial wall in 2 % KOH. E, F. Asci. G–K. Ascospores (J, K. Surface view). L–N.
Conidiophores and conidiogenous cells. O–Q. Macroconidia. A. Microcera auranticola (photo N. Aplin). B, O. Microcera coccophila [adapted from Gr€
afenhan et al. (2011)]. C.
Microcera larvarum [adapted from Gr€
afenhan et al. (2011)]. D, F–J. Microcera coccophila (K(M) 165807). E, K. Microcera larvarum (photo P. Cannon). L, M, Q. Microcera rubra
(CBS 638.76). N, P. Microcera larvarum (CBS 169.30). Scale bars: A, B = 100 μm; G–K=5μm; all others = 10 μm.
CROUS ET AL.
64

Etymology: From the Greek επ
ί
πεδα,flat; referring to the micro-
conidia of this species commonly being flattened on one side.
Typus:Netherlands, from Bouvardia sp. imported from Uganda,
2019, W. Quaedvlieg (holotype CBS H-24666, culture ex-type
CBS 146523 = CPC 38310).
Conidiophores borne on the agar substrate and aerial mycelium,
78–230 μm tall, unbranched or more commonly sympodially
branched at various levels, bearing terminal single phialides;
aerial conidiogenous cells monophialidic, subulate, subcylindrical
to acicular, smooth- and thin-walled, 27.5–62 × 2 –3.5 μm, short
apical collarettes and periclinal thickening inconspicuous or ab-
sent. Aerial conidia microconidial, arranged in false heads on
phialide tips, hyaline, broadly ellipsoidal, ellipsoidal to short
clavate, commonly asymmetrical with a somewhat flattened side,
smooth- and thin-walled, aseptate, (4.5–)6–10(–13.5) × (2–)
3–5μm (av. 8 × 3.5 μm). Sporodochia pale luteous to orange,
formed abundantly on the surface of carnation leaves;
Fig. 35. Neocosmospora spp. A–E. Ascomata on culture. F. Surface view of perithecial wall in 2 % KOH. G–I. Asci. J–Q. Ascospores (K, M, O, Q. Surface view). R–U. Aerial
conidiophores. V. Sporodochial conidiophores. W, X. Microconidia. Y–A5. Macroconidia. A, I, N, O. Neocosmospora vasinfecta (CBS 446.93). B. Neocosmospora sp. (CPC
34617). C, S, W, A1. Neocosmospora elegans (CBS 144396). D. Neocosmospora vasinfecta (CBS 863.70). E. Neocosmospora bataticola (CBS 144398). F, L, M. Neo-
cosmospora ipomoeae (CBS 833.97). G. Neocosmospora robiniae (CBS 119601). H, J, K. Neocosmospora diminuta (CBS 144390). O, Q. Neocosmospora spinulosa (CBS H-
5443). R, V, A3. Neocosmospora solani (CBS 140079). T. Neocosmospora bataticola (CBS 144398). U. Neocosmospora suttoniana (CBS 143214). X. Neocosmospora
tonkinensis (CBS 115.40). Y. Neocosmospora longissima (CBS 126407). Z. Neocosmospora mori (CBS 145467). A2. Neocosmospora pseudoradicicola (CBS 145472). A4.
Neocosmospora keratoplastica (CBS 490.63). A5. Neocosmospora oligoseptata (CBS 143241). [A, C, S, T, W, Y, Z, A1, A2. Adapted from adapted from Sandoval-Denis et al.
(2019). R, V, A3, Adapted from Crous et al. (2019a). U, X, A4. Adapted from Sandoval-Denis & Crous (2018)]. Scale bars: A, B = 200 μm; C–E 100 μm; R–T=20μm; J–Q, W,
X=5μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 65

sporodochial conidiophores laterally and irregularly branched
bearing apical groups of 2–3 monophialides; sporodochial
conidiogenous cells monophialidic, subulate to subcylindrical,
11 –19.5 × 3–4.5 μm, smooth and thin-walled, with short, non-
flared collarettes and inconspicuous or absent periclinal thick-
ening. Sporodochial conidia falcate, almost straight to slightly
curved dorsoventrally, broadest near the half portion or the
upper third, tapering towards both ends, with a blunt to
somewhat pointy and slightly curved apical cell and an often well-
developed foot-shaped basal cell, (3–)4–7(–8)-septate, pre-
dominantly 5-septate, hyaline, smooth- and thick-walled; 3-
septate conidia: 42.5 × 4.4 μm; 4-septate conidia: (41.5–)
44–58(–60) × 4–5μm (av. 51.1 × 4.4 μm); 5-septate conidia:
(53.5–)59–69.5(–76) × 4–6μm (av. 64.3 × 5 μm); 6-septate
conidia: 68–75.5(–79.5) × 4.5–6μm (av. 71.7 × 5.3 μm);
7-septate conidia: (68–)69–74.5(–77) × 5–6μm (av.
71.7 × 5.5 μm); 8-septate conidia: 74–75.5 × 5–6μm (av.
74.7 × 5.3 μm); overall: (42.5–)59–73.5(–79.5) × (4 –)5–6μm
(av. 66.3 × 5.1 μm). Chlamydospores and sexual morph not
observed.
Culture characteristics: Colonies on PDA reaching
38–53 mm diam at 25 °C after 7 d. Surface white to
sulphur yellow with scarce pale ochreous to pale rust patches,
flat to slightly raised with abundant white aerial mycelium, cottony
to woolly, margin filiform; reverse pale luteous to sulphur yellow,
pale apricot to pale rust at centre. On OA, pale luteous, flat,
membranous with entire margin; reverse pale luteous.
Additional material examined:Netherlands, from Bouvardia sp. imported from
Uganda, 2019, W. Quaedvlieg, culture CBS 146524 = CPC 38311.
Notes: The name N. epipeda is coined here for a novel phylo-
genetic lineage discovered on a Bouvardia sp. imported from
Uganda. The new species clusters as the closest phylogenetic
relative of N. catenata (Fig. 14), an opportunistic animal-patho-
genic species characterised by abundant production of catenate
to clustered, pigmented chlamydospores, and by the absence
(as far as known) of macroconidia (O'Donnell et al. 2016,
Sandoval-Denis & Crous 2018). These characters form the most
notable differences with respect to N. epipeda. Additionally,
N. epipeda can be differentiated from N. catenata by its less
Fig. 36. Neocosmospora epipeda (CBS 146524). A–C. Aerial conidiophores and conidiogenous cells. D. Microconidia. E, F. Sporodochia formed on the surface of carnation
leaves. G. Sporodochial conidiophores and conidiogenous cells. H. Macroconidia. Scale bars: A–C=20μm; E, F = 200 μm; D, G, H = 10 μm.
CROUS ET AL.
66

septate and shorter microconidia (aseptate and up to 13.5 μmvs
up to 1-septate and 11 μminN. catenata). Other species pro-
ducing macroconidia of similar size and shape to those of
N. epipeda include N. quercicola,N. robusta, and N. silvicola;
however, the three latter species are genetically distant in that
they belong to monophyletic lineages of clade 3 (N. quercicola
and N. silvicola) and clade 1 (N. robusta)ofNeocosmospora
sensu O'Donnell et al. (2008a).Neocosmospora epipeda can be
distinguished morphologically from N. robusta by the production
of microconidia with absence of aerial macroconidia in the former
species. Morphological differentiation of the novel species from
N. quercicola and N. silvicola is difficult because of overlapping
features; nevertheless, subtle differences exist in the size and
morphology of the microconidia (aseptate in N.epipeda vs up to
1-septate in both N. quercicola and N. silvicola, being also
reniform and longer in the latter species) and sporodochial colour
(pale luteous to orange in N. epipeda vs greenish to citrine in
N. quercicola and N. silvicola, respectively).
Neocosmospora merkxiana Quaedvl. & Sand.-Den., sp. nov.
MycoBank MB 838670. Fig. 37.
Etymology: Named after Trix Merkx, senior technician at the
Westerdijk Fungal Biodiversity Institute, in recognition of her
career as the foremost link in strain handling between the
research groups and the culture collection.
Typus:Netherlands, from Chrysanthemum sp. imported from
Uganda, unknown date, W. Quaedvlieg (holotype CBS H-
24669, culture ex-type CBS 146525 = CPC 38701).
Conidiophores borne on the agar substrate and aerial mycelium,
99–205 μm tall, unbranched or rarely laterally branched,
bearing terminal single phialides; aerial conidiogenous cells
monophialidic, subulate to subcylindrical, smooth- and thin-wal-
led, 41.5–77 × 2.5–4.5 μm, with short and flared apical collar-
ettes and inconspicuous periclinal thickening. Aerial conidia of
two types: microconidia oval to broadly ellipsoidal, straight to
slightly curved and asymmetrical, smooth- and thin-walled,
0(–1)-aseptate, (8.5–)9–15.5(–18.5) × 3 –5.5 μm (av. 12.4 × 4.3
ìm), arranged in false heads on phialide tips; macroconidia
falcate to navicular, smooth- and thin-walled, almost straight to
slightly dorsiventrally curved, ventral face almost straight, with a
blunt apical cell, basal cell obtuse to poorly-developed, foot-
shaped, 1–3-septate, predominantly 1-septate, 1-septate con-
idia: (17.5–)20.5–27(–30.5) × (4.5–)5–6.5( –7.5) μm (av.
23.8 × 5.8 μm); 2-septate conidia: (25.5–)
27–30(–32) × 5.5–7μm (av. 28.4 × 6 μm); 3-septate conidia:
(27–)28.5–33.5(–35.5) × 5–7.5 μm (av. 31.1 × 6.3 μm); over-
all: (17.5–)22–31(–35.5) × (4.5–)5–6.5( –7.5) μm (av.
26.4 × 6 μm), arranged in false heads at the tip of monophialides
and produced intermixed with microconidia. Sporodochia
pale luteous, formed on aerial and substrate mycelium, un-
common on carnation leaves. Sporodochial conidiophores
laterally and irregularly branched bearing apical groups of
2–3 monophialides; sporodochial conidiogenous cells mono-
phialidic, doliiform, subulate to subcylindrical, (13.5–)
15–21.5(–27) × 2.5–5.5 μm, smooth and thin-walled, lacking
apical collarettes and with inconspicuous periclinal thickening.
Sporodochial macroconidia falcate, straight to slightly dorsiven-
trally curved, broadest at the half portion and tapering towards
both ends, apical cell blunt and slightly curved, basal cell poorly-
to well-developed, foot-shaped, (1–)3–5-septate, predominantly
4-septate, hyaline, smooth- and thick-walled; 1-septate conidia:
(23.5–)24.5–28.5 × 5–6.5 μm (av. 25.8 × 5.6 μm); 2-septate
conidia: 27–29 × 5.5–6.5 μm (av. 28 × 6 μm); 3-septate conidia:
(29–)35–45 × (4.5–)5–6μm (av. 40.1 × 5.3 μm); 4-septate
conidia: (41–)44.5–49.5(–51.5) × 4.5–6.5 μm (av. 47 × 5.6 μm);
5-septate conidia: (42–)45.5–51.5(–52.5) × 5–6μm
(av. 48.5 × 5.6 μm); overall: (24.5–)39–51.5(–52.5)
× 4.5–6(–6.5) μm (av. 45.2 × 5.6 μm). Chlamydospores obo-
voidal, subspherical to spherical, hyaline to pale yellow brown,
smooth-walled to slightly roughened, thick-walled, 5–13.5 μm,
single or in chains, terminal, intercalary or produced on short
lateral stipes.
Culture characteristics:Colonies on PDA reaching
45–56 mm diam at 25 °C after 7 d. Surface pale luteus to sulphur
yellow, becoming buff to honey, flat with abundant aerial mycelium,
cottony to woolly with entire to filiform margin; reverse luteous to
buff, pale scarlet to bay at centre. On OA pale luteous to peach
with sparse white cushions of aerial mycelium, flat, velvety to
cottony; reverse pale luteous, peach to pale scarlet.
Additional material examined:Netherlands, from Chrysanthemum sp. imported
from Uganda, unknown date, W. Quaedvlieg, culture CBS 146526 = CPC 38702.
Notes:Neocosmospora merkxiana represents the phylogenetic
species formerly known as “FSSC 41”, one of the few previously
known clades lacking a Latin binomial, originally reported as an
agent of collar rot on Passiflora edulis f. flavicarpa in Brazil
(Cardoso 2015,Sandoval-Denis et al. 2019). Here, this species
is reported causing collar and stem rot symptoms in Chrysan-
themum imported from Uganda.
In the phylogenetic analysis (Fig. 14), N. merkxiana
resolved as the most basal taxon within a lineage containing
the morphologically similar species N. ipomoeae,N. martii,
and N. noneumartii, all characterised by producing both aerial
microconidia and macroconidia, in addition to relatively long
sporodochial conidia. Differing from the aforementioned spe-
cies, N. merkxiana can be differentiated by its fewer septate
and shorter aerial and sporodochial macroconidia formed on
pale luteous sporodochia, and its pale luteous colonies on
PDA, thus contrasting with the greenish sporodochial colour-
ation observed in both N. ipomoeae and N. noneumartii, and
the red pigmentation on PDA typical of N. martii. Sexual
morphs were not observed in the isolates studied here; how-
ever, this lineage was reported as heterothallic, and fertile
perithecial ascomata have been induced in vitro (Cardoso
2015), characterised by ascomata measuring
230–355 × 175–290 μm, 57.5–75 × 5 μm asci producing 1-
septate, 10–12.5 × 5 μm ascospores.
Neocosmospora neerlandica Crous & Sand.-Den., sp. nov.
MycoBank MB 838671. Fig. 38.
Etymology: Named after the country where the type was isolated,
the Netherlands.
Typus:Netherlands, Zeeland Province, Zuid-Beveland, near
Wolphaartsdijk, from Pisum sativum, unknown date, J.C. Went
(holotype CBS H-24667, culture ex-type CBS 232.34).
Conidiophores borne on agar substrate and aerial mycelium up
to 290 μm tall, unbranched or irregularly laterally branched,
bearing terminal single monophialides, commonly proliferating
percurrently; aerial conidiogenous cells monophialidic, subulate
to subcylindrical, commonly extended percurrently, smooth- and
thin-walled, 21–87 × 1.5–3.5 μm, with short and flared apical
FUSARIUM REDELIMITED
www.studiesinmycology.org 67

collarettes and rather evident periclinal thickening. Aerial conidia
of two types: microconidia oval to broadly ellipsoidal, smooth-
and thin-walled, 0- or 1-septate, (5.5–)8–14(–30) × (2–)
3–4.5(–5.5) μm (av. 11 × 3.8 μm), arranged in false heads
on phialide tips; macroconidia fusiform to falcate, smooth- and
thick-walled, straight to slightly curved, with a blunt apical
cell, basal cell often flattened to obtuse, (1–)2–3-septate, pre-
dominantly 3-septate, 1-septate conidia: 22.5–26 × 4.5–6μm
(av. 24.4 × 5.1 μm); 2-septate conidia: (22.5–)
23.5–32 × 3.5–5μm (av. 27 × 4.3 μm); 3-septate conidia: (24–)
25–32.5(–38.5) × (3.5–)4.5–5.5( –6) μm (av. 28.7 × 4.8 μm);
overall: (22.5–)24–31.5(–38.5) × (3.5–)4.5 –6μm (av.
27.7 × 4.8 μm), arranged in false heads at the tip of mono-
phialides and produced intermixed with microconidia. Chla-
mydospores subspherical to spherical, pale golden brown,
smooth- and thick-walled, 6–8μm, single or in pairs, terminal or
more often formed intercalary on hyphae. Sexual morph and
sporodochia unknown.
Fig. 37. Neocosmospora merkxiana (CBS 146525). A–E. Aerial conidiophores and conidiogenous cells. F. Sporodochium on aerial mycelium. G, H. Chlamydospores. I, J.
Sporodochial conidiophores and conidiogenous cells. K. Microconidia. L. Aerial macroconidia. M. Sporodochial macroconidia. Scale bars: A, E = 100 μm; C = 20 μm; all
others = 10 μm.
CROUS ET AL.
68

Culture characteristics: Colonies on PDA reaching
42–51 mm diam at 25 °C after 7 d. Surface white to pale luteous,
flat with abundant dense aerial mycelium, velvety to cottony,
margin regular and filiform; reverse pale luteous to sulphur yel-
low. On OA white to pale luteous, flat to slightly raised, velvety to
cottony, margin regular and filiform; reverse pale luteous.
Notes: The type of N. neerlandica was originally deposited as
N. pisi, an important root pathogen of Pisum sativum. Besides
sharing the same host association, both species are genetically
related, but cluster in distinct phylogenetic lineages and have a
different morphology. Although N. pisi produces typical wedge-
shaped, larger macroconidia (up to 46 um long) on abundant
sporodochia (
Si
si
cet al. 2018b), N. neerlandica is characterised
by short falcate macroconidia (up to 38.5 um long) produced on
aerial conidiophores, while sporodochia are not formed. The latter
features relate N. neerlandica to N. diminuta, a phylogenetically
distant species that produces the shortest falcate conidia knownin
Neocosmospora (Sandoval-Denis et al. 2019). Nevertheless,
N. diminuta is a homothallic species that conspicuously produces
sexual structures, while a sexual morph is not known for
N. neerlandica. Additionally, macroconidia of N. neerlandica differ
from those of N. diminuta by having less curved apices and poorly
developed or non foot-shaped basal cells.
Neocosmospora nelsonii Crous & Sand.-Den., sp. nov.
MycoBank MB 838672. Fig. 39.
Etymology: In honour of Paul E. Nelson, prominent Fusarium
researcher and collector of the ex-type strain of this species.
Typus:Unknown country, from Pisum sativum, unknown date,
P.E. Nelson (holotype CBS H-12719, culture ex-type CBS
309.75).
Conidiophores borne on agar substrate and aerial mycelium,
59–330 μm tall, often simple and reduced to solitary phialides
borne laterally from hyphae, or laterally irregularly and sympo-
dially branching one or two times, bearing terminal single phia-
lides; aerial conidiogenous cells monophialidic, subulate to
subcylindrical, smooth- and thin-walled, 21–57.5 × 2–5μm,
flared apical collarettes and periclinal thickening present. Aerial
microconidia arranged in false heads on phialide tips, hyaline,
broadly ellipsoidal, obovate to broadly clavate, smooth- and thin-
walled, 0(–1)-septate, (5–)7–13(–17) × 2.5–5μm (av.
10.1 × 3.7 μm). Sporodochia (from holotype specimen) pale
citrine to olivaceous; sporodochial conidiophores copiously
branched, laterally, verticillate and irregularly, bearing apical
groups of 2–3 monophialides and lateral solitary phialides;
sporodochial conidiogenous cells monophialidic, doliiform, su-
bulate to subcylindrical, 6–21.5 × 3–4.5 μm, smooth and thin-
walled, with short, conspicuously flared collarettes and con-
spicuous periclinal thickening, profusely proliferating percur-
rently. Sporodochial macroconidia falcate, gently and regularly
curved dorsoventrally or with an almost straight ventral line,
broadest at the middle portion, apical cell blunt and slightly
hooked, basal cell papillate to well-developed, foot-shaped,
1–3(–4)-septate, predominantly 3-septate, hyaline, smooth- and
thick-walled; 1-septate conidia: (17.5–)19–26(–29.5) × 4 –5μm
(av. 22.4 × 4.4 μm); 2-septate conidia: (26–)
27–34 × 3.5–5.5 μm (av. 30 × 4.7 μm); 3-septate conidia:
(25.5–)30.5–38(–42) × 4–5.5 μm (av. 34.3 × 4.8 μm); 4-septate
conidia: 38.5–43.5 × 4.5–5.5 μm (av. 40.7 × 5.0 μm); overall:
(17.5–)27–38(–43.5) × (3.5–)4–5.5 μm (av. 32.5 × 4.7 μm).
Chlamydospores subspherical to spherical, pale golden brown,
smooth- and thick-walled, 4–11.5 μm, formed singly and termi-
nally on hyphae. Sexual morph not observed.
Culture characteristics: Colonies on PDA reaching
35–49 mm diam at 25 °C after 7 d. Surface pale luteous, pale
saffron to sulphur yellow, flat with abundant dense and short
aerial mycelium, velvety to woolly, margin filiform; reverse
sulphur yellow. On OA pale luteous, flat, membranous to dusty
with filiform margin; reverse pale luteous.
Notes: The ex-type of N. nelsonii, originally determined as “F. ”
solani, currently presents a very simple microconidial
morphology with a rather acremonioid touch given its slender,
generally simple conidiophores and mostly aseptate
Fig. 38. Neocosmospora neerlandica (CBS 232.34). A–C. Conidiophores. D. Microconidia. E, F. Chlamydospores. G. Macroconidia. Scale bars: F = 5 μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 69

microconidia. Hence, there are no clear phenotypic characters to
differentiate the species. Failed attempts to induce formation of
sporodochia indicate that the ex-type strain may have lost the
ability to produce macroconidia in vitro. The holotype material, is,
however, a dried subculture from the type strain dated from 1982.
It still contains a large amount of well-preserved sporodochia and
sporodochial conidia, which we describe here. These macro-
conidia are comparable in size to those observed in closely
related species such as N. brevis,N. pisi, and N. neerlandica.
However, macroconidia in N. brevis and N. neerlandica are
produced only in the aerial mycelium, while N. nelsonii produces
only a single type of aerial conidia (microconidia), which also
differ from those observed in the aforementioned species by their
reduced size. In addition, sporodochial conidia in N. nelsonii are
shorter and stout, with shorter and rounder apices compared to
those of N. pisi.
Neocosmospora pseudopisi Sand.-Den. & L. Lombard, sp.
nov.MycoBank MB 838673. Fig. 40.
Etymology: Named after its morphological, phylogenetic and host
affinity with Neocosmospora pisi.
Typus:Unknown country, from Pisum sativum, unknown date
and collector (holotype CBS H-24668, culture ex-type CBS
266.50).
Conidiophores borne on agar substrate and aerial
mycelium, erect and prostrate, up to 340 μm tall, unbranched or
irregularly laterally branched, bearing terminal single phialides,
rarely proliferating percurrently; aerial conidiogenous cells
monophialidic, rarely extended percurrently, subulate to sub-
cylindrical, smooth- and thin-walled, 24.5–74 × 2–4μm, with
cup-shaped, elongated, and flared apical collarettes and
conspicuous periclinal thickening. Aerial microconidia arranged
in false heads on phialide tips, hyaline, broadly ellipsoidal
to clavate, often lightly curved and asymmetrical, smooth- and
thin-walled, 0(–1)-septate, (4.5–)6.5–11(–17.5) × (2 –)
3–4(–5) μm (av. 8.6 × 3.2 μm). Sporodochia pale luteous to pale
sienna coloured, rarely formed on the surface of carnation
leaves, agar surface or on aerial mycelium; sporodochial co-
nidiophores unbranched or laterally and irregularly branched
bearing single monophialides or groups of groups of up to three
monophialides; sporodochial conidiogenous cells monophialidic,
subulate to subcylindrical, 10–25 × 2–5μm, smooth and thin-
walled, collarettes and periclinal thickening present. Sporodo-
chial macroconidia falcate, gently tapering towards both ends,
slightly curved dorsoventrally to almost straight, apical cell blunt
to inconspicuously papillate, basal cell obtuse to poorly-devel-
oped, foot-shaped, 1–4(–5)-septate, predominantly 4-septate,
hyaline, smooth- and thick-walled; 1-septate conidia:
21.5–26(–27.5) × 4–5μm (av. 24.7 × 4.3 μm); 2-septate con-
idia: 28–30 × 4.5–5μm; 3-septate conidia: (28.5–)
34–46.5(–50) × 4–5.5 μm (av. 40.1 × 4.7 μm); 4-septate con-
idia: (36–)42.5–54(–56) × 4–5.5 μm (av. 48 × 4.9 μm); 5-
septate conidia: 50.5 × 5 μm; overall: (21.5–)
34.5–51.5(–56) × 4–5.5 μm (av. 42.9 × 4.8 μm). Chlamydo-
spores subspherical to spherical, hyaline to pale yellow, smooth-
walled, thick-walled, 5.5–10.5 μm, single or in pairs, terminal or
intercalary. Sexual morph not observed.
Culture characteristics: Colonies on PDA reaching
35–48 mm diam at 25 °C after 7 d. Surface pale luteous to pale
sulphur yellow, flat with abundant short aerial mycelium, velvety
to dusty, margin regular entire to filiform; reverse pale luteous
to sulphur yellow. On OA pale luteous to pale sulphur yellow,
Fig. 39. Neocosmospora nelsonii (CBS 309.75). A–D. Conidiophores and conidiogenous cells. E, F. Chlamydospores. G. Microconidia. H. Sporodochium. I, J. Sporodochial
conidiophores and conidiogenous cells. K. Macroconidia. Scale bars: E, F = 5 μm; all others = 10 μm.
CROUS ET AL.
70

flat, velvety to dusty, margin entire to filiform; reverse pale
luteous.
Notes: The type of N. pseudopisi was determined as pathogenic
to Pisum sativum and deposited in WI by W.C. Snyder. It is
phylogenetically and morphologically related to N. pisi, a major
pathogen of Pisum sativum (
Si
si
cet al. 2018b). However, both
species resolved as very closely related lineages in the seven-
marker phylogeny (Fig. 14), as well as on the individual CaM, ITS,
rpb1, and rpb2 phylogenies (data not shown). Morphologically,
N. pseudopisi can be differentiated from N. pisi by its longer
sporodochial conidia (up to 56 μm long vs up to 46 μm long in
N. pisi,
Si
si
cet al. 2018b). Based on the features of its macro-
conidia, N. pseudopisi resembles N. crassa and
N. pseudotonkinensis; the two latter species, though, are
phylogenetically well-separated. Neocosmospora pseudopisi,
however, differs from N. crassa and N. pseudotonkinensis by the
absence of aerial macroconidia in the former species, while un-
like N. crassa, the sporodochial conidia of N. pseudopisi are often
wider on its apical third (vs wider at its basal part in N. crassa).
Neonectria Wollenw., Ann. Mycol. 15: 52. 1917, nom. cons.
prop.Fig. 8.
Synonym:Cylindrocarpon Wollenw., Phytopathology 3: 225.
1913.
(see Chaverri et al. 2011 for additional synonyms)
Type species:Neonectria ramulariae Wollenw., Ann. Mycol. 15:
52. 1917.
Ascomata perithecial, gregarious, seated on an erumpent
stroma, superficial, subglobose to broadly obpyriform, red,
turning dark red in KOH, pigment dissolving in lactic acid, not
collapsing when dry, with blunt to acute apex, rarely papillate,
smooth to slightly rugulose, lacking hairs or appendages.
Ascomatal wall of two regions: outer region of thick-walled,
pigmented cells forming a textura epidermoidea; inner region of
elongate, hyaline, thin-walled cells, becoming thinner toward the
centrum. Asci cylindrical, 8-spored, without an apical ring, uni-
seriate. Ascospores ellipsoidal to fusoid, 1-septate, hyaline,
smooth or finely spinulose. Sporodochia not formed. Co-
nidiophores mononematous, hyaline, septate, unbranched or
irregularly branched, terminating in 1–3 phialides or reduced to
lateral phialides. Conidiogenous cells monophialidic, cylindrical,
tapering towards the apex, with inconspicuous periclinal thick-
ening and collarettes. Microconidia abundant, ellipsoidal to
obovoid, hyaline, aseptate, sometimes forming false heads on
phialides. Macroconidia cylindrical, mostly straight, 3–7(–9)-
septate, with rounded ends. Chlamydospores globose to sub-
globose, hyaline to subhyaline, smooth-walled to slightly verru-
cose, terminal or intercalary, solitary or in pairs or forming chains.
[Description adapted from Chaverri et al. (2011)].
Diagnostic features: Red, mostly smooth-walled perithecia lacking
papilla producing cylindrical asci bearing ellipsoidal to fusoid, 1-
septate ascospores and Cylindrocarpon asexual morph.
Nothofusarium Crous, Sand.-Den. & L. Lombard, gen. nov.
MycoBank MB 838674. Fig. 8.
Etymology: From the Greek prefix notho-, false, illegitimate; and
Fusarium, in reference to the genetic affinity and morphological
resemblance to the genus Fusarium s. str.
Type species:Nothofusarium devonianum L. Lombard, Crous &
Sand.-Den.
Ascomata unknown. Conidiophores mononematous
(aerial conidiophores) or grouped on sporodochia. Aerial co-
nidiophores simple, unbranched or irregularly branched, some-
times reduced to single lateral phialides or phialidic pegs on the
hyphae; conidiogenous cells monophialidic, cylindrical, tapering
towards apex, smooth- and thin-walled, with periclinal thickening
inconspicuous or absent, solitary. Microconidia not formed. Aerial
macroconidia falcate, 1–5(–6)-septate, thick-walled, curved to
lunate, with a blunt apical cell and often obtuse, poorly- to well-
developed foot-shaped basal cell. Sporodochia white, pale
luteous to pale citrine. Sporodochial conidiophores irregularly
Fig. 40. Neocosmospora pseudopisi (CBS 266.50). A–C. Conidiophores and conidiogenous cells. D. Microconidia. E. Sporodochia formed on aerial hyphae. F. Macroconidia
and chlamydospores. G. Macroconidia. Scale bars: C = 20 μm; E = 100 μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 71

and verticillately branched, consisting of short, smooth- and thin-
to thick-walled stipes bearing apical whorls of mono- and poly-
phialides. Sporodochial conidiogenous cells monophialidic and
polyphialidic, doliiform, subulate to subcylindrical, smooth- and
thin-walled, with reduced apical collarette. Sporodochial macro-
conidia similar to aerial macroconidia. Chlamydospores sub-
globose to ellipsoidal, solitary or most commonly in chains.
Diagnostic features: Fusarioid asexual morph characterised by
aerial monophialides and sporodochial mono- and polyphialides
producing slightly curved and slender, mostly 3-septate
macroconidia.
Nothofusarium devonianum L. Lombard, Crous & Sand.-Den.,
sp. nov.MycoBank MB 838675. Fig. 41.
Etymology: The epithet refers to Devon, the English county
where the type specimen was collected.
Typus:UK, England, Devon, Totnes, Berry Pomeroy, Loventor
Manor, on dead cladodes of Ruscus aculeatus, 17 Jul. 1983,
B.C. Sutton & A.V. Sutton (holotype CBS H-24670, culture ex-
type CBS 147304 = IMI 279297 = NRRL 22134).
Conidiophores borne on substrate mycelium, prostrate or erect
and quickly collapsing to the agar surface, 70–240 μm tall, un-
branched or less commonly irregularly laterally branched,
bearing terminal single phialides; aerial conidiogenous cells
monophialidic, subulate to cylindrical, smooth- and thin-walled,
9–34 μm long, 2–5μm at the widest part, or reduced to short
phialidic pegs, 3–6×2–3.5 μm, formed laterally on aerial
hyphae, apical collarettes short or lacking, periclinal thickening
absent. Aerial macroconidia borne on tips of conidiogenous cells
on aerial conidiophores, almost straight or slightly curved,
falcate, 1–5(–6)-septate, predominantly 3-septate, hyaline,
smooth- and thick-walled, with a blunt apical cell and obtuse,
sometimes papillate to poorly-developed, foot-shaped basal cell,
1-septate conidia: (15.5–)19–28(–32) × 2.5–4μm (av.
23.5 × 4.3 μm); 2-septate conidia: (25.5–)27–31 × 2.5–4μm
(av. 28.8 × 3.2 μm); 3-septate conidia: (13–)
41–57(–63.5) × 3–4(–4.5) μm (av. 49 × 3.6 μm); 4-septate
conidia: (48.5–)50–60(–61.5) × 3–4.5 μm (av. 55.1 × 3.8 μm);
5-septate conidia: (47–)50–64(–71) × 3.5–4.5 μm (av.
56.9 × 3.9 μm); 6-septate conidia: (54–)55–71.5 × 3.5 –4μm
(av. 62.3 × 3.8 μm); overall: (13–)35.5–59( –71.5) × 2.5–4.5 μm
(av. 47.2 × 3.6 μm). Sporodochia pale luteous to pale citrine
coloured, small, formed abundantly on the agar surface and less
regularly on the surface of carnation leaves; sporodochial co-
nidiophores irregularly verticillately branched bearing solitary
lateral and terminal phialides or apical groups of 2–3 phialides;
sporodochial conidiogenous cells mono- and polyphialidic,
doliiform, subulate to subcylindrical, 3–25.5 × 2.5 –5μm, smooth
and thin-walled, commonly proliferating sympodially, collarettes
and periclinal thickening absent or inconspicuous. Sporodochial
conidia undifferentiable from aerial conidia. Chlamydospores
subglobose to ellipsoidal, solitary or most commonly in chains.
Sexual morph unknown.
Culture characteristics: Colonies on PDA reaching
23–27 mm diam at 25 °C after 7 d. Surface straw-coloured, pale
Fig. 41. Nothofusarium devonianum (CBS 147304). A–F. Aerial conidiophores and conidiogenous cells. G–I. Sporodochia formed on the surface of carnation leaves. J–O.
Sporodochial conidiophores and conidiogenous cells. P, Q . Chlamydospores. R. Macroconidia. Scale bars: B, D = 20 μm; G, H = 200 μm; O, P = 5 μm; all others = 10 μm.
CROUS ET AL.
72

luteous to pale ochreous, flat, dusty to velvety; reverse white to
pale luteous without diffusible pigments. On OA, grey-white to
pale luteous, flat, membranous to dusty, with irregular velvety
peripheral patches cottony; reverse pale luteous.
Notes: The type of No. devonianum was erroneously assigned to
Trichofusarium rusci (Sutton, 1986) and recombined in Fusarium
(Fusarium rusci,Geiser et al. 2013). Nevertheless, the
morphology exhibited by this strain does not match in respect
with the original description of the supposed basionym nor its
purported synonym Pycnofusarium rusci, as confirmed also by
examination of authentic material of T. rusci (BPI 453152A and
IMI 291476). The latter taxon is characterised by a setose
sporodochial asexual morph with small, fusoid, aseptate conidia,
more reminiscent of the genus Alfaria (Stachybotryaceae,Crous
et al. 2014).
Pseudofusicolla D. Triest, Mycobiology 44: 127. 2016. Figs 8,42.
Type species:Pseudofusicolla belgica D. Triest, Mycobiology 44:
127. 2016.
Ascomata unknown. Conidiophores initially as lateral phialides
on somatic hyphae, sometimes monochasial, verticillate or
penicillate, hyaline. Conidiogenous cells monophialidic, cylindri-
cal to subulate, hyaline, producing micro- and macroconidia.
Microconidia strongly falcate, 0- or 1-septate, hyaline. Macro-
conidia strongly falcate, narrowing towards the ends, apical cell
hooked with a pointed tip, basal cell papillate to poorly-devel-
oped, foot-shaped, 0–3-septate, hyaline. Chlamydospores
globose, in terminal pairs or intercalary chains.
[Description adapted from Triest et al. (2016)].
Diagnostic features: Fusarioid asexual morph that produces
strongly curved, 0- or 1-septate microconidia, and 0–3-septate
macroconidia.
Rectifusarium L. Lombard et al., Stud. Mycol. 80: 229. 2015.
Figs 8,43.
Type species:Rectifusarium ventricosum (Appel & Wollenw.) L.
Lombard & Crous, Stud. Mycol. 80: 229. 2015.
Basionym:Fusarium ventricosum Appel & Wollenw., Phytopa-
thology 3: 32. 1913.
(See F. ventricosum in List section for synonyms)
Ascomata perithecial, mostly gregarious, non-stromatic or on a
thin stroma erumpent through the epidermis, superficial, sub-
globose to globose, laterally pinched when dry, dark red, with
short ostiolar neck, smooth-walled, lacking hairs and ap-
pendages. >Ascomatal wall of two regions: outer region of
thick-walled, pigmented cells forming a textura angularis or
textura globulosa; inner region of elongate, hyaline, thin-walled
cells, becoming thinner towards the centrum. Asci clavate,
apex rounded with distinct pore, 8-spored often with an apical
ring, uniseriate to biseriate. Ascospores ellipsoidal, 1-septate,
constricted at the septum, pale tan, verrucose. Sporodochia
not formed. Conidiophores simple, mononematous, straight to
flexuous, hyaline, septate, unbranched or rarely branched,
terminating in single phialides. Conidiogenous cells mono-
phialidic, cylindrical, tapering towards the apex, with periclinal
thickening and flared collarettes, usually producing macro-
conidia. Microconidia rarely formed, ellipsoidal to fusoid, 0- or
1-septate, hyaline. Macroconidia falcate, straight to slightly
curved dorsiventrally, 3-septate, with blunt to slightly pointed
apical cell and poorly-developed foot-shaped basal cell.
Chlamydospores globose to subglobose to ovoid, hyaline to
subhyaline, verrucose, terminal or intercalary, solitary or in
pairs or forming chains or developing directly from
macroconidia.
[Description adapted from Booth (1971),Gerlach & Nirenberg
(1982) and Lombard et al. (2015)].
Diagnostic features: Dark red, smooth-walled perithecia with
short ostiolar neck producing clavate asci bearing ellipsoidal, 1-
septate ascospores and asexual morphs producing micro- and
macroconidia on elongate cylindrical aerial conidiophores with
monophialides, and not forming sporodochia. Chlamydospores
formed in hyphae and macroconidia.
Rugonectria P. Chaverri & Samuels, Stud. Mycol. 68: 73. 2011.
Fig. 8.
Fig. 42. Pseudofusicolla belgica.A, B. Conidiophores. C–G. Conidiogenous cells. H. Microconidia. I. Chlamydospores. J. Macroconidia. A, B, D–J. IHEM 2413. C. IHEM 5322.
Scale bars: A = 20 μm; F, G = 5 μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 73

Type species:Rugonectria rugulosa (Pat. & Gaillard) Samuels
et al., Stud. Mycol. 68: 73. 2011.
Basionym:Nectria rugulosa Pat. & Gaillard, Bull. Soc. Mycol.
France 4: 115. 1889.
Synonyms:Cucurbitaria rugulosa (Pat. & Gaillard) Kuntze,
Revis. Gen. Pl. 3: 461. 1898.
Neonectria rugulosa (Pat. & Gaillard) Mantiri & Samuels, Canad.
J. Bot. 79: 339. 2001.
Cylindrocarpon rugulosum Brayford & Samuels, Sydowia 46:
148. 1994.
Ascomata perithecial, solitary or gregarious, stromatic, superfi-
cial or partly immersed in stroma, subglobose to globose, orange
to red, turning dark red in KOH, pigment dissolving in lactic acid,
non-papillate, rugose to tuberculate, lacking hairs or append-
ages. Ascomatal wall of two regions: outer region of thick-walled,
pigmented cells forming a textura angularis; inner region of
elongate, hyaline, thin-walled cells, becoming thinner towards the
centrum. Asci clavate, apex simple, 8-spored. Ascospores
ellipsoidal to oblong, 1-septate, not to slightly constricted at the
septum, pale yellow, striate. Sporodochia not formed. Co-
nidiophores simple, mononematous, straight to flexuous, hyaline,
septate, unbranched or rarely to irregularly branched, terminating
in single phialides. Conidiogenous cells monophialidic, cylindri-
cal, tapering towards the apex, with periclinal thickening and
flared collarettes, producing micro- and macroconidia. Micro-
conidia ovoid to cylindrical, 0- or 1-septate, hyaline. Macro-
conidia fusoid, curved, (3–)5–7(–9)-septate, tapering to both
ends, basal cell obtuse with inconspicuous hilum. Chlamydo-
spores not observed.
[Description adapted from Samuels et al. (1990),Samuels &
Brayford (1994) and Chaverri et al. (2011)].
Diagnostic features: Orange to red, rugose to tuberculate,
partially immersed perithecia producing clavate asci bearing
fusoid, 1-septate yellowish, striate ascospores and cylin-
drocarpon-like asexual morph characterised by curved, multi-
septate macroconidia with inconspicuous hilum.
Scolecofusarium L. Lombard, Sand.-Den. & Crous, gen. nov.
MycoBank MB 838676. Figs 8,44.
Etymology: From Greek skṓl
ex, worm, in reference to the worm-
like appearance of the macroconidia.
Type species:Scolecofusarium ciliatum (Link) L. Lombard,
Sand.-Den. & Crous
Ascomata perithecial, solitary or gregarious, partially immersed
on a stroma, smooth- and thin-walled, globose to broadly pyri-
form, red, with a broad, discoid apical region, turning darker in
KOH, pigment dissolving in lactic acid to become yellow, lacking
hairs and warts. Ascomatal wall of a single region composed of
unevenly thickened cells of textura epidermoidea.Asci cylindri-
cal, apex with an obscure refractive ring, 8-spored, ascospores
uniseriate. Ascospores ellipsoidal to fusiform-ellipsoidal, 1-
septate, not constricted at septum, yellow-brown, finely spinu-
lose. Conidiophores mononematous (aerial) or grouped on
sporodochia. Aerial conidiophores unbranched to loosely irreg-
ularly branched, bearing terminal phialides; conidiogenous cells
monophialidic, subcylindrical, smooth- and thin-walled, with
evident periclinal thickening and a non-flared collarette, pro-
ducing only macroconidia. Sporodochia pink, orange to salmon
coloured; sporodochial conidiophores irregularly and verticillately
branched, consisting of short, often swollen, smooth- and thin-
walled stipes bearing single terminal monophialides or apical
whorls of 2–3 monophialides; sporodochial conidiogenous cells
monophialidic, cylindrical to subcylindrical, smooth- and thin-
walled, with evident periclinal thickening. Macroconidia formed in
pink to salmon slimy masses, subcylindrical, (0–)3–7( –10)-
septate, straight or slightly curved, with blunt apical cell and
obtuse to poorly developed, foot-shaped basal cell. Microconidia
unknown. Chlamydospores unknown.
[Description adapted from Samuels et al. (1991) &Gerlach &
Nirenberg (1982)].
Diagnostic features: Red perithecia producing cylindrical
asci containing ellipsoidal, 1-septate, finely spinulose ascospores
and fusarioid asexual morph characterised by monophialides
producing slender and delicate, almost cylindrical macroconidia
from aerial conidiophores and pink to salmon coloured spor-
odochia, lacking microconidia as well as chlamydospores.
Scolecofusarium ciliatum (Link) L. Lombard, Sand.-Den. &
Crous, comb. nov.MycoBank MB 838677.
Basionym:Atractium ciliatum Link, Mag. Ges. Naturf. Freunde
Berlin 7: 32. 1816.
Synonyms:Fusarium ciliatum (Link) Link, in Willdenow, Sp. Pl.,
Ed. 4, 6: 105. 1825.
Microcera ciliata (Link) Wollenw., Fusaria Autogr. Delin. 1: 435.
1916.
Calonectria ciliata (Link) W.C. Snyder & H.N. Hansen, Amer. J.
Bot. 32: 664. 1945.
Sphaeria agnina Desm., Ann. Sci. Nat., Bot. s
er. 3, 6: 72. 1846.
Calonectria agnina (Desm.) Sacc., Michelia 1: 311. 1878.
Dialonectria agnina (Desm.) Cooke, Grevillea 12: 111. 1884.
Fusarium peltigerae Westend., Herb. Crypt. Belg. 9: no. 414.
1849.
Fusarium parasiticum Westend., Bull. S
eances Cl. Sci. Acad.
Roy. Sci. Belgique, s
er. 2, 11: 652. 1861.
Fig. 43. Rectifusarium spp. A–F. Conidiophores and conidiogenous cells. G. Microconidia. H. Macroconidia. A–D, H. Rectifusarium robinianum (CBS 430.91). E –G. Rec-
tifusarium ventricosum (CBS 748.79). Scale bars = 10 μm.
CROUS ET AL.
74

Nectria massariae Pass., in Rabenhorst, Fungi Eur. Exs. no.
1827. 1874.
Microcera massariae Sacc., Michelia 1: 263. 1878.
Calonectria massariae (Pass.) Sacc., Michelia 1: 312. 1878.
Fusisporium filisporum Cooke, Grevillea 8: 8. 1879.
Fusarium filisporum (Cooke) Sacc., Syll. Fung. 4: 708. 1886.
Fusarium scolecoides Sacc. & Ellis, Atti Reale Ist. Veneto Sci.
Lett. Arti, s
er. 6, 3: 728. 1885.
Fusarium elongatum Cooke, Grevillea 19: 4. 1890.
Calonectria dearnessii Ellis & Everh., Proc. Acad. Nat. Sci.
Philadelphia 42: 245. 1891.
Typus:Germany, on branch canker of Fagus sylvatica, 1961, W.
Gerlach (neotype of Atractium ciliatum CBS H-12687 hic des-
ignatus, MBT 10000646, culture ex-neotype CBS
191.65 = ATCC 16068 = ATCC 24137 = BBA 9661 = DSM
62172 = IMI 112499 = NRRL 20431).
Additional descriptions and illustrations:Wollenweber & Reinking
(1935),Doidge (1938),Gerlach & Nirenberg (1982).
Additional material examined:Belgium, Mons, Pommeroeul, on leaf of Fagus
sylvatica, 1984, unknown collector, culture CBS 144385 = IHEM 2989. Denmark,
on Hordeum vulgare mouldy grain, associated with scale insects, 1986, U.
Thrane, culture CBS 155.86 = NRRL 22284. Netherlands, Noord-Brabant
Province, Boxmeer, on Quercus sp., Mar. 2016, S. Helleman, cultures CBS
146672 = CPC 30654; CBS 146673 = CPC 30655; CBS 146674 = CPC 30656;
CBS 146675 = CPC 30657; CBS 146676 = CPC 30658; CBS 146677 = CPC
30659.
Notes: No existent holotype material was located for At. ciliatum.
Therefore, a neotype is designated here. The neotype specimen
originates from a representative isolate studied by Gerlach &
Nirenberg (1982).
Setofusarium (Nirenberg & Samuels) Crous & Sand.-Den., gen.
et stat. nov.MycoBank MB 838678. Figs 8,45.
Basionym:Fusarium sect. Setofusarium Nirenberg & Samuels,
Canad. J. Bot. 67: 3376. 1989.
Etymology: The name refers to the presence of setose spor-
odochia and to its resemblance to the genus Fusarium.
Type species:Fusarium setosum Nirenberg & Samuels, Canad.
J. Bot. 67: 3372. 1989.
Ascomata perithecial, solitary or gregarious on a well-developed
immersed stroma composed of pseudoparenchymatous to hyphal
cells, scaly to warty and thick-walled, pyriform, dark red with an
often darker red-coloured, flattened and non-papillate apical re-
gion, turning darker in KOH, pigment dissolving in lactic acid to
become yellow, lacking hairs. >Ascomatal wall of two regions:
outer region of thick-walled, pigmented cells of textura angularis to
textura globulosa at warts cells; inner region of elongate, hyaline,
thin-walled cells, becoming thinner towards the centrum. Asci
cylindrical to clavate, with rounded to flattened simple apex, 8-
spored, ascospores overlapping uniseriate to biseriate.
Ascospores ellipsoidal, 1-septate, not constricted at septum, pale
yellow-brown, smooth-walled to finely striate. Conidiophores
mononematous (aerial) or grouped on sporodochia. Aerial co-
nidiophores unbranched or rarely branched, bearing terminal
phialides; conidiogenous cells monophialidic, cylindrical to sub-
cylindrical, smooth- and thin-walled, with periclinal thickening
inconspicuous to evident, producing only macroconidia. Spor-
odochia grey; setae arising between and around sporodochia, stiff,
erect, thick-walled with acute tip, at first hyaline later becoming
pale golden brown; sporodochial conidiophores irregularly and
verticillately branched and densely packed, consisting of short,
often swollen, smooth- and thin-walled stipes bearing apical whorl
of 2–3 monophialides or single, terminal monophialides; spor-
odochial conidiogenous cells monophialidic, cylindrical to sub-
cylindrical, smooth- and thin-walled, with inconspicuous to evident
periclinal thickening. Macroconidia formed in off-white or grey slimy
masses, cylindrical, (0–)3–5(–7)-septate, gently curved, with a
blunt apical cell and an obtuse to poorly developed foot-shaped
basal cell. Microconidia unknown. Chlamydospores unknown.
[Description adapted from Samuels & Nirenberg (1989)].
Diagnostic features: Dark red perithecia producing cylindrical to
clavate asci containing ellipsoidal, 1-septate, finely striate as-
cospores and fusarioid asexual morph characterised by mono-
phialides producing robust, almost cylindrical macroconidia from
Fig. 44. Scolecofusarium ciliatum.A, B. Ascomata on natural substrate. C, D. Asci. E–G. Ascospores (G. Surface view). H. Pionnote on agar surface. I. Sporodochium. J–L.
Conidiophores and conidiogenous cells. M. Macroconidia. A–H, J –L. CBS 146674. I. CBS 146676. M. CBS 144385. Scale bars: A, B = 100 μm; E–G=5μm; H = 1 mm;
I=20μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 75

aerial conidiophores and setose sporodochia, lacking micro-
conidia as well as chlamydospores.
Setofusarium setosum (Nirenberg & Samuels) Sand.-Den. &
Crous, comb. nov.MycoBank MB 838679.
Basionym:Fusarium setosum Nirenberg & Samuels, Canad. J.
Bot. 67: 3372. 1989.
Synonym:Nectria setofusarii Samuels & Nirenberg, Canad. J.
Bot. 67: 3372. 1989.
Typus:French Guiana, piste de Saint-Elie: km 16 on road be-
tween Sinnamary and St. Elie, ORSTOM research area
“ECEREX”, on bark of living liana, Mar. 1986, G.J. Samuels,
holotype NY00927992. Epitype of F. setosum (CBS H-24723
hic designatus, MBT 10000647): French Guiana, Vic. Cayenne,
15 km from Remise, trail to Vidal-old farm, secondary forest, from
bark, 25 Feb. 1988, A.Y. Rossman, culture ex-epitype CBS
635.92 = G.J.S. 88-12.
Description and illustrations:Samuels & Nirenberg (1989).
Additional material examined:French Guiana, unknown host and collection date,
A.Y. Rossman, culture CBS 574.94; from wood from unknown host, Feb. 1988,
A.Y. Rossman, IMI 324476. Ghana, Western Region: Wiawso District, Bia
National Park, trail from camp 1, disturbed forest, on living liana, J.G. Samuels &
H.C. Evans, BPI 882043.
Notes: The monotypic, former Fusarium section Setofusarium is
here elevated to generic rank to accommodate “Fusarium
setosum”, a genetically and morphologically divergent taxon
easily differentiated from any known fusarioid taxa by the pro-
duction of setose sporodochia (Samuels & Nirenberg 1989). No
living ex-type culture could be located for this taxon. Isolate CBS
635.92 (as G.J.S. 88-12) is an authentic strain of Fusarium
setosum (Samuels & Nirenberg 1989). Therefore, a dried culture
from this strain is designated as epitype here.
Stylonectria Höhn., Sitzungsber. Kaiserl. Akad. Wiss. Wien,
Math.-Naturwiss. Cl., Abt. 1, 124: 52. 1915. Figs 8,46.
Type species:Stylonectria applanata Höhn., Sitzungsber. Kaiserl.
Akad. Wiss. Wien, Math.-Naturwiss. Kl., Abt. 1, 124: 52. 1915.
Ascomata perithecial, gregarious in groups of up to 20, on a thin,
white to yellow hyphal or subiculum-like stroma, superficial,
subglobose, pyriform to subcylindrical, pale yellow, orange-red,
orange-brown, or pale to dark red, becoming dark red to purple in
KOH, with a rounded or broad, circular, flat disc on a venter-like
neck, smooth to slightly rugulose, lacking hairs or appendages.
Ascomatal wall consisting of two layers; inner layer of hyaline,
thin-walled, compressed, elongated cells and outer layer of
distinct, isodiametric to oblong, angular or globose, thick-walled
cells. Asci cylindrical to clavate, 8-spored, with simple apex or
apical ring. Ascospores cylindrical to allantoid to ellipsoidal, 1-
septate, hyaline or yellow to pale brown, smooth or tuberculate.
Conidiophores initially formed as unbranched phialides on so-
matic hyphae, sometimes loosely branched, sometimes forming
small sporodochia. Conidiogenous cells monophialidic,
Fig. 45. Setofusarium setosum.A–C. Ascomata on natural substrate. D. Surface view of perithecial wall in lactic acid. E. Ascus. F–H. Ascospores (H. Surface view). I, J.
Setose sporodochia. K–M. Setae. N–P. Detail of setae (N. Base. O. Middle portion wall. P. Surface view of apical wall). Q. Conidiophore. R. Macroconidia. A–H. BPI 882043.
I–R. CBS 635.92. Scale bars: A–C, I, Q = 100 μm; J–L=20μm; H, P = 5 μm; all others = 10 μm.
CROUS ET AL.
76

cylindrical to subcylindrical, with a distinct collarette. Microconidia
sparse, allantoid to lunulate, slightly or strongly curved, aseptate,
in slimy heads. Macroconidia orange in mass, subcylindrical or
moderately to strongly curved, falcate, 0- or 1-septate, apex
narrower than base, apical cell blunt or hooked, basal cell not or
scarcely foot-shaped.
[Description adapted from Höhnel (1915) and Gr€
afenhan et al.
(2011)].
Diagnostic features: Pale yellow to dark red, mostly smooth-
walled perithecia with rounded or broad, circular, flat disc on a
venter-like neck, producing cylindrical to clavate asci bearing
cylindrical to allantoid to ellipsoidal, 1-septate hyaline or yellow to
pale brown ascospores and fusarioid asexual morph charac-
terised by 0- or 1-septate macroconidia with blunt or hooked
apical cell, lacking a foot-shaped basal cell.
Stylonectria corniculata Gr€
afenhan, Crous & Sand.-Den., sp.
nov.MycoBank MB 838680. Fig. 47.
Etymology: From Latin corniculum, little horn. Referring to the
shape of the conidiophores.
Typus:Germany, Brandenburg, Stolpe, near Gellmersdorfer
Forst, from unidentified ascomycete on Carpinus sp., 1 Mar.
2007, T. Gr€
afenhan, holotype CBS H-24671, culture ex-type
CBS 125491.
Conidiophores often as single phialides borne laterally
on substrate and aerial hyphae, or irregularly branched and
crowded with phialides produced laterally and terminally, hyaline,
thin- and smooth-walled, 24–89 μm long. Conidiogenous
cells monophialidic, short doliiform, subcylindrical to subulate,
6–28.5 × 2–3.5 μm, often with a conspicuous flared collarette,
periclinal thickening absent, producing micro- and macroconidia.
Microconidia cylindrical to allantoid, hyaline, thin- and smooth-
walled, 0(–1)-septate, (4.5–)6–13.5(–21) × (1.5–)2 –3μm (av.
9.7 × 2.1 μm). Macroconidia falcate, almost straight or gently
dorsiventrally curved, tapering toward the basal portion, (0 –)1-
septate, with a blunt apical cell and obtuse basal cell, (20–)
28–47(–56) × 2–3.5 μm (av. 37.6 × 2.5 μm). Chlamydospores
and sexual morph not observed.
Culture characteristics: Colonies on PDA reaching
16–20 mm diam at 25 °C after 7 d. Surface at first white and
membranous, becoming slimy, saffron to orange, to bright or-
ange at the centre, flat, aerial mycelium absent, moisty at the
centre, velvety at the margin, margin regular, filiform to undulate;
reverse white, pale saffron to orange at centre. On OA, white to
pale orange, flat, membranous to slimy, with regular and undu-
late margin; reverse pale luteous to pale saffron.
Notes: The species is here described based on its morphology
in vitro, where only the asexual morph was obtained. This pre-
vents further comparisons with known species of this genus. The
only known collection, CBS 125491, has been shown to repre-
sent the most basal lineage in Stylonectria in previous phylo-
genetic studies (Gr€
afenhan et al. 2011,Lechat et al. 2015), which
was confirmed here (Fig. 15). Although with neither a clear host
association –an important character for species recognition in
Stylonectria –nor any known sexual morphology, St. corniculata
shows a distinctive morphology when it comes to its asexual
morph, especially regarding the branching pattern and the shape
of its mature conidiophores, which can be very elaborate and
largely resemble antlers (Fig. 47).
Stylonectria hetmanica Akulov, Crous & Sand.-Den., sp. nov.
MycoBank MB 838681. Fig. 48.
Etymology: The epithet refers to the Cossack Hetmanate
(Ukrainian Hetman
s
cyna), the name of the former Cossack state
territories where the type was collected.
Typus:Ukraine, Sumy, Okhtyrka, vicinities of Klymentove
village, Hetmanskyi National Nature Park, on the ascomata of
Diaporthe sp., associated with Phomopsis asexual morph, on
Fig. 46. Stylonectria spp. A–D. Ascomata on natural substrate. E. Ascomata on culture. F. Surface view of perithecial wall in lactic acid. G, H. Asci. I–K. Ascospores. L–M.
Conidiophores and conidiogenous cells. O, P. Microconidia. Q, R. Macroconidia. A, G. Stylonectria qilianshanensis [HMAS 255803, adapted from Zeng et al. (2020)]. B.
Stylonectria norvegica [CLL14047, adapted from Lechat et al. (2015)]. C. Stylonectria purtonii (photo P. Ml
coch). D, I, K. Stylonectria wegeliana (photo B. Bergen). E, F, Q.
Stylonectria hetmanica (CBS 147306). H, J, O. Stylonectria sp. (HPC 2668). L, M. Stylonectria corniculata (CBS 125491). N, P, R. Stylonectria applanata (CBS 125489). Scale
bars: A–E = 100 μm; I–K=5μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 77

dead branches of Frangula alnus still attached to the tree, 13
Oct. 2019, Ya. Mieshkov, CWU (Myc) AS 7177, holotype CBS
H-24672, culture ex-type CBS 147305 = CPC 38725.
Ascomata perithecial, gregarious or solitary, broadly pyriform,
220–310 μm wide, with a distinctive flat and discoid papilla,
130–225 μm wide, dark red, becoming darker in 3 % KOH and
light yellow in lactic acid. Ascomatal wall smooth, 30–45 um
thick, composed of two regions: outer region 25–40 μm thick,
of irregularly shaped cells of textura intricata to textura epi-
dermoidea; inner region 5–10 μm thick of thin-walled, flattened
cells of textura prismatica to textura angularis.
Asci subcylindrical, 45–72 × 4–8μm, 8-spored, apices rounded
and simple, uniseriate or irregularly biseriate. Ascospores ellip-
soidal, 1-septate, often constricted at septum, (7.5–)
8.5–11( –12.5) × 3–4.5(–5.5) μm, smooth to finely spinulose,
thick-walled, hyaline at first, becoming pale golden brown at
maturity. Conidiophores often as single phialides or short phia-
lidic pegs borne laterally on the substrate and aerial hyphae,
rarely irregularly to verticillately branched. Conidiogenous cells
monophialidic, short doliiform, subcylindrical to subulate,
4–21(–27.5) × 2–3.5 μm, often with a conspicuous flared
collarette, periclinal thickening absent, producing micro- and
macroconidia. Microconidia allantoid, hyaline, smooth- and thin-
walled, 0(–1)-septate, (9–)10.5–13.5(–15) × 2–3μm (av.
12 × 2.4 μm). Macroconidia subcylindrical to falcate, almost
straight or moderately dorsiventrally curved, tapering towards
both ends, 0–1(–2)-septate, apical cell blunt to slightly hooked,
basal cell obtuse to poorly-developed, foot-shaped (11.5–)
16.5–28(–34) × 2–3μm (av. 22.2 × 2.5 μm). Chlamydospores
not observed.
Culture characteristics: Colonies on PDA reaching
2.5–3 mm diam at 25 °C after 7 d. Surface straw-coloured to
luteous, pale orange at centre, flat or radially folded, membra-
nous to slimy, margin filiform to undulate; reverse pale luteous to
pale orange. On OA orange to pale apricot, flat, membranous to
slimy, margin filiform with abundant submerged mycelium;
reverse pale orange.
Additional material examined:Ukraine, Sumy, Okhtyrka, in the vicinities of the
village Klymentove, Hetmanskyi National Nature Park, on the conidiomata of
Dothiorella sarmentorum, on recently dead branches of Acer platanoides still
attached to the tree, 13 Oct. 2019, A. Akulov, CWU (Myc) AS 7278, culture CBS
147306 = CPC 38848.
Notes: The morphological description of St. hetmanica is
based on its growth on OA, where both studied strains
showed optimal growth and sporulation. Contrary to most
fusarioid genera, St. hetmanica grows very poorly and fails
tosporulateonSNAandWA.Stylonectria hetmanica is
morphologically comparable and genetically close to St.
purtonii,St. norvegica,andSt. wegeliana. Nevertheless,
ascospores of St. hetmanica are smaller than those of St.
purtonii and St. wegeliana. Additionally, macroconidia of St.
hetmanica, while similar in size to those of St. purtonii,are
less septate (0- or 1-septate, rarely 2-septate in St. het-
manica, and up to 3-septate in St. purtonii). The sexual
morph of the recently described St. norvegica is very similar
to that of St.hetmanica, although both species are geneti-
cally less closely related. The latter species can be distin-
guished by the production of shorter macroconidia.
Thelonectria P. Chaverri & C. Salgado, Stud. Mycol. 68: 76.
2011. Fig. 8.
Type species:Thelonectria discophora (Mont.) P. Chaverri & C.
Salgado, Stud. Mycol. 68: 76. 2011.
Basionym:Sphaeria discophora Mont., Ann. Sci. Nat. Bot., s
er. 2,
3: 353. 1835.
Fig. 47. Stylonectria corniculata (CBS 125491). A–E. Conidiophores and conidiogenous cells. F. Microconidia. G. Macroconidia. Scale bars = 10 μm.
CROUS ET AL.
78

Synonyms:Nectria discophora (Mont.) Mont., Fl. Chil. 7: 454.
1850.
Cucurbitaria discophora (Mont.) Kuntze, Revis. Gen. Pl. 3: 461.
1898.
Neonectria discophora (Mont.) Mantiri & Samuels, Canad. J. Bot.
79: 339. 2001.
Nectria tasmanica Berk., in Hooker, Bot. Antarct. Voy. III, Fl.
Tasman. 2: 279. 1860.
Cucurbitaria tasmanica (Berk.) Kuntze, Revis. Gen. Pl. 3: 462.
1898.
Nectria umbilicata Henn., Hedwigia 41: 3. 1902.
Creonectria discostiolata Chard
on, Bol. Soc. Venez. Ci. Nat. 5:
341. 1939.
Ascomata perithecial, solitary to gregarious, non-stromatic or
sometimes seated on an immersed inconspicuous stroma, su-
perficial, globose to subglobose or pyriform to elongated, orange
to red, with prominent areolate papilla or darkly pigmented apex,
smooth to slightly rugulose, lacking hairs or appendages.
Ascomatal wall of two regions: outer region of thick-walled,
pigmented cells forming a textura epidermoidea; inner region of
elongate, hyaline, thin-walled cells, becoming thinner towards the
centrum. Asci cylindrical to narrowly clavate, 8-spored, with an
apical ring, uniseriate. Ascospores ellipsoidal to fusoid, 1-
septate, hyaline, smooth or finely spinulose or striate. Spor-
odochia not formed. Conidiophores mononematous, hyaline,
septate, irregularly branched, terminating in 1–3 phialides or
reduced to lateral phialides. Conidiogenous cells monophialidic,
cylindrical or slightly swollen, tapering towards the apex, with
periclinal thickening and flared collarettes, producing usually
macroconidia. Microconidia rarely formed, globose to ovoid,
hyaline, aseptate, with displaced inconspicuous hilum. Macro-
conidia subcylindrical to slightly fusoid, curved, broadest at upper
third, (3–)5–7(–9)-septate, with rounded ends or flattened at the
basal cell. Chlamydospores unknown.
[Description adapted from Chaverri et al. 2011)].
Diagnostic features: Orange to red, mostly smooth-walled peri-
thecia with prominent darkened papilla producing cylindrical to
narrowly clavate asci bearing ellipsoidal to fusoid, 1-septate
ascospores and cylindrocarpon-like asexual morph.
Tumenectria C. Salgado & Rossman, Fungal Diversity 80: 451.
2016. Fig. 8.
Type species:Tumenectria laetidisca (Rossman) C. Salgado &
Rossman, Fungal Diversity 80: 451. 2016.
Basionym:Nectria laetidisca Rossman, Mycol. Pap. 150: 36.
1983.
Synonym:Cylindrocarpon bambusicola Matsush., Matsush.
Mycol. Mem. 5: 9. 1987.
Ascomata perithecial, mostly solitary to gregarious, non-stro-
matic, superficial, broadly pyriform, not collapsing when dry,
orange to sienna, turning blood red in KOH, pigment dis-
solving in lactic acid, broadly rounded to flattened papilla,
smooth-walled, lacking hairs and appendages. Ascomatal wall
of two regions: outer region of thick-walled, pigmented cells
forming a textura angularis; inner region of elongate, hyaline,
thin-walled cells, becoming thinner towards the centrum. Asci
narrowly clavate, apex simple, 8-spored, lacking an apical
ring, irregularly multiseriate. Ascospores fusoid, 3-septate,
hyaline, smooth or finely spinulose. Sporodochia not formed.
Conidiophores simple, mononematous, straight to flexuous,
hyaline, septate, unbranched or rarely branched, terminating
in a single phialide or reduced to lateral phialides. Con-
idiogenous cells monophialidic, cylindrical or slightly swollen,
tapering towards the apex, with periclinal thickening and flared
collarettes. Microconidia not formed. Macroconidia cylindrical
to slightly fusoid, straight to slightly curved, 3–6-septate, with
rounded ends. Chlamydospores unknown.
Fig. 48. Stylonectria hetmanica (CBS 147305). A–C. Ascomata (A. On natural substrate. B, C. In culture). D. Surface view of perithecial wall in lactic acid. E–G. Ascospores
(G. Surface view). H–K. Conidiophores and conidiogenous cells. L. Macroconidia. Scale bars: A–C = 100 μm; E–I=5μm; all others = 10 μm.
FUSARIUM REDELIMITED
www.studiesinmycology.org 79

[Description adapted from Rossman (1983) and Salgado-Salazar
et al. (2016)].
Diagnostic features: Orange to sienna, smooth-walled perithecia
with broadly rounded to flattened papilla producing narrowly
clavate asci bearing fusoid, 3-septate phragmo-ascospores and
cylindrocarpon-like asexual morph.
FUSARIUM AND ALLIED GENERA: LIST OF
ACCEPTED NAMES
The following nomenclator lists names that have been introduced
in Fusarium up to January 2021, as well as their current status
(with accepted names indicated in bold and underlined for easier
recognition). Where type specimens have been located,
these details, as well as any ex-type cultures and diagnostic
DNA barcode data are provided, along with notes regarding
potential synonymy. This list will be updated and republished at
regular intervals, and will form the basis for a monograph of
Fusarium and allied genera that will be freely available on www.
Fusarium.org.
aberrans Fusarium J.W. Xia et al., Persoonia 43: 192. 2019.
Holotypus: CBS H-24050.
Ex-type culture: CBS 131385.
Type locality:Australia, Northern Territory, Roper River area.
Type substrate: Stem of Oryza australiensis.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170378; tef1: MN170445.
acaciae Fusarium Berl. & Voglino, Syll. Fung., Addit. I–IV: 201.
1886, nom. illegit., Art. 53.1.
(See Fusarium acaciae Cooke & Harkn.)
acaciae Fusarium Cooke & Harkn., Grevillea 12: 96. 1884.
Synonyms:?Fusarium acaciae Berl. & Voglino, Syll. Fung.,
Addit. I–IV: 201. 1886, nom. illegit., Art. 53.1.
?Fusarium acaciae Sacc., Syll. Fung. 9: 958. 1891, nom. illegit.,
Art. 53.1.
(See Fusarium lateritium)
Holotypus: ?BPI 451718.
Type locality:USA, California.
Type substrate: Stem of Acacia sp.
Note: Synonym fide Wollenweber & Reinking (1935).
acaciae Fusarium Sacc., Syll. Fung. 9: 958. 1891, nom. illegit.,
Art. 53.1.
(See Fusarium acaciae Cooke & Harkn.)
acaciae-mearnsii Fusarium O'Donnell et al., Fungal Genet.
Biol. 41: 619. 2004.
Holotypus: BPI 843477.
Ex-type culture: CBS 110254 = MRC 5120 = NRRL 25754.
Type locality:South Africa, KwaZulu-Natal, Pietermaritzburg.
Type substrate:Acacia mearnsii.
Descriptions and illustrations: See O'Donnell et al. (2004).
Diagnostic DNA barcodes:rpb1: JAAWUD010000100; rpb2:
JAAWUD010000080; tef1: AF212448.
acicola Fusarium Bres., in Strasser, Verh. Zool.-Bot. Ges. Wien
60: 328. 1910.
Holotypus: Not located.
Type locality:Austria, Sonntagberg.
Type substrate: Rotting needles of Pinus sp.
Descriptions and illustrations: See Strasser (1910).
Note: Status unclear. Not Fusarium fide Wollenweber & Reinking
(1935).
acremoniopsis Fusarium Vincens, Bull. Soc. Mycol. France 31:
26. 1915.
(See Fusarium larvarum)
Holotypus: ?PC.
Type locality:Brazil, Par
a, Bel
em.
Type substrate:Agrotis sp. (cutworm).
Descriptions and illustrations: See Vincens (1915).
Note: Synonym fide Wollenweber & Reinking (1935).
acridiorum Fusarium (Trab.) Brongn. & Delacr., Bull. S
eances
Soc. Natl. Agric. France 51: 631. 1891.
Trichothecium acridiorum (Trab.) Madelin, Trans. Brit. Mycol.
Soc. 49: 284. 1966.
Basionym:Botrytis acridiorum Trab., Compt. Rend. Hebd.
S
eances Acad. Sci. 112: 1383. 1891.
Synonym:Lachnidium acridiorum Giard, Compt. Rend. Hebd.
S
eances Acad. Sci. 112: 1520. 1891.
Holotypus: Not located.
Type locality:Algeria.
Type substrate:Acrididae (locust).
Description and illustrations: See Madelin (1966).
acuminatum Fusarium Ellis & Everh., Proc. Acad. Nat. Sci.
Philadelphia 47: 441. 1895.
Synonyms:Microcera acuminata (Ellis & Everh.) Höhn., in
Weese, Sitzungsber. Akad. Wiss. Wien, Math.-Naturwiss. Kl.,
Abt. 1. 128: 729. 1919.
Fusarium scirpi var. acuminatum (Ellis & Everh.) Wollenw.,
Fusaria Autogr. Delin. 3: 930. 1930.
Fusarium scirpi subsp. acuminatum (Ellis & Everh.) Raillo, Fungi
of the Genus Fusarium: 177. 1950.
Fusarium gibbosum var. acuminatum (Ellis & Everh.) Bilaĭ,
Mikrobiol. Zhurn. 49: 6. 1987.
?Selenosporium hippocastani Corda, Icon. Fung. 2: 7. 1838.
Fusarium hippocastani (Corda) Sacc., Syll. Fung. 4: 703. 1886.
Fusarium erubescens Appel & Oven, Landwirtsch. Jahrb. 1905,
nom. illegit., Art. 53.1.
Fusarium caudatum Wollenw., J. Agric. Res. 2: 262. 1914.
Fusarium scirpi var. caudatum (Wollenw.) Wollenw., Fusaria
Autogr. Delin. 3: 934 & 935. 1930.
Fusarium equiseti var. caudatum (Wollenw.) Joffe, Mycopathol.
Mycol. Appl. 53(1–4): 220. 1974.
Fusarium arcuosporum Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 186. 1915.
Fusarium ferruginosum Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 190. 1915.
Fusarium sanguineum Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 193. 1915.
Fusarium lanceolatum O.A. Pratt, J. Agric. Res. 13: 83. 1918.
Fusarium pseudoeffusum Murashk., Arb. Landwirtsch. Akad.
Omsk. 3: 19. 1924.
Fusarium moronei Curzi, Revista Biol. (Lisbon)10: 141. 1928.
Fusarium russianum Manns, Bull. N. Dakota Agric. Exp. Sta.
259: 34. 1932.
Gibberella acuminata Wollenw., Fusarien: 68. 1935.
Spermospora oryza M. Rao, Sci. & Cult. 32: 94. 1966.
Gibberella acuminata C. Booth, The Genus Fusarium: 161.
1971, nom. illegit., Art. 53.1.
Holotypus: NY00928689.
CROUS ET AL.
80

Type locality:USA, New York, Geneva.
Type substrate:Solanum tuberosum.
Descriptions and illustrations:SeeSherbakoff (1915),Booth
(1971),Gerlach & Nirenberg (1982),Burgess & Summerell
(2000) and Leslie & Summerell (2006).
Notes:Fusarium acuminatum is an established name in the
Fusarium literature, but it lacks living type material to confirm its
taxonomic position. Although an older epithet, based on Sele-
nosporium hippocastani, could be used, we refrain from
providing a new combination for this well-known species due to a
lack of DNA-based evidence to support this combination.
Moreover, Holubov
a-Jechov
aet al. (1994) could not locate any
holotype material for S. hippocastani, abstaining from introducing
a neotype, which they argued would cause nomenclatural
instability, a view we fully support.
acutatum Fusarium Nirenberg & O'Donnell, Persoonia 46: 144.
2021.
Synonym:Fusarium acutatum Nirenberg & O'Donnell, Mycologia
90: 435. 1998, nom. inval., Art. 40.1.
Holotypus: B 70 0001695.
Ex-type culture: BBA 69580 = CBS 402.97 = FRC 0-1117 = IMI
376110 = NRRL 13309.
Type locality:India.
Type substrate: Unknown.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998)
and Yilmaz et al. (2021).
Diagnostic DNA barcodes:rpb1: MT010947; rpb2: KT154005;
tef1: KR071754.
acutisporum Fusarium (Sand.-Den. & Crous) O'Donnell et al.,
Index Fungorum 440: 1. 2020.
Neocosmospora acutispora Sand.-Den. & Crous, Persoonia
43: 108. 2019.
Holotypus: CBS H-23969.
Ex-type culture: BBA 62213 = CBS 145461 = NRRL 22574.
Type locality:Guatemala.
Type substrate:Coffea arabica
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834210; rpb2: LR583814;
tef1: LR583593.
aderholdii Fusarium Osterw., Bericht Schweiz. Versuchsanst.
Obst-, Wein- und Gartenbau 1913/14: 519. 1915.
Ilyonectria destructans (Zinssm.) Rossman et al., Stud. Mycol.
80: 217. 2015.
Basionym:Ramularia destructans Zinssm., Phytopathology 8:
570. 1918.
Synonyms:Cylindrocarpon destructans (Zinssm.) Scholten,
Netherlands J. Plant Pathol. 70 suppl. (2): 9. 1964.
Fusarium polymorphum Marchal, Bull. Soc. Roy. Bot. Belgique
34: 145. 1895, nom. illegit., Art. 53.1.
Cylindrocarpon radicicola Wollenw., Fusaria Autogr. Delin. 2:
651. 1924.
Nectria radicicola Gerlach & L. Nilsson, Phytopathol. Z. 48: 255.
1963.
Neonectria radicicola (Gerlach & L. Nilsson) Mantiri & Samuels,
Canad. J. Bot. 79: 339. 2001.
Ilyonectria radicicola (Gerlach & L. Nilsson) P. Chaverri & C.G.
Salgado, Stud. Mycol. 68: 71. 2011.
?Fusarium rhizogenum Aderh., Centralbl. Bacteriol. Parasitenk.,
2. Abth., 6: 623. 1900, nom. illegit., Art. 53.1.
?Septocylindrium radicicola Aderh., Centralbl. Bakteriol. Para-
sitenk., 2. Abth., 6: 623, 1900, nom. illegit., Art. 53.1.
?Septocylindrium aderholdii Sacc & P. Syd., Syll. Fung. 16: 1048.
1902.
Holotypus: Not located.
Type locality:Germany.
Type substrate: Unknown.
Notes: Synonymy fide Wollenweber & Reinking (1935). Although
older epithets are available for Ilyonectria destructans, we refrain
from providing a new combination for this well-known species
due to a lack of DNA-based evidence to support this
combination.
adesmiae Fusarium Henn., Hedwigia 36: 246. 1897.
Synonym:Ramularia adesmiae (Henn.) Wollenw., Fusaria
Autogr. Delin. 1: 466. 1916.
Holotypus:InBfide Hein (1988).
Type locality:Chile, Bío-Bío Province.
Type substrate:Adesmia sp.
Note: Status unclear, not Ramularia fide Braun (1998).
aduncisporum Fusarium Weimer & Harter, J. Agric. Res. 32: 312.
1926.
(See Fusarium solani)
Lectotypus: BPI 451321, designated in Sandoval-Denis et al.
(2019).
Lectotype locality:USA, California, Ventura.
Lectotype substrate: Stems of Melilotus alba.
Note: Synonym fide Wollenweber & Reinking (1935).
aecidii-tussilaginis Fusarium Allesch., Ber. Bot. Vereines Land-
shut 12: 131. 1892.
(See Fusarium avenaceum)
Holotypus:InM.
Type locality:Germany, Oberammergau.
Type substrate:Aecidium tussilaginis.
Note: Synonym fide Wollenweber & Reinking (1935).
aeruginosum Fusarium Delacr., Bull. Soc. Mycol. France 7: 110.
1891.
(See Fusarium caeruleum)
Lectotypus (hic designatus, MBT 10000648): France, Paris, from
Solanum tuberosum, April 1891, G. Delacroix, Bull. Soc. Mycol.
France 7: pl. VIII, fig. h.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
aethiopicum Fusarium O'Donnell et al., Fungal Genet. Biol. 45:
1521. 2008.
Holotypus: BPI 878409.
Ex-type culture: CBS 122858 = NRRL 46726.
Type locality:Ethiopia, Bure district, west Gojjam zone of
Amhara region.
Type substrate:Triticum aestivum.
Descriptions and illustrations: See O'Donnell et al. (2008b).
Diagnostic DNA barcodes:rpb1: MW233298; rpb2: MW233470;
tef1: FJ240298.
affine Fusarium Fautrey & Lambotte, Rev. Mycol. (Toulouse) 18:
68. 1896.
Syntypes: ILL00221136 (Roumegu
ere, Fungi Sel. Gall. Exs. no.
6927)&ILL00221137(Roumegu
ere,FungiSel.Gall.Exs. no.6928).
Type locality:France.
Type substrate:Solanum tuberosum.
FUSARIUM REDELIMITED
www.studiesinmycology.org 81

Notes:Booth (1971) examined the exsiccatae (Fung. Sel. Gall.
Exs., No. 6927 & 6928) of F. af fine and found that one part (no.
6927) is F. solani and the other part (no. 6928) represented
another fungus that was interpreted as Hymenula affinis by
Wollenweber (1916–1935).Booth (1971) indicated that F. af fine
might be a possible synonym of F. tabacinum, which is now
regarded as Plectosphaerella cucumerina (Palm et al. 1995,
Giraldo & Crous 2019). However, both Gams & Gerlach (1968)
and Palm et al. (1995) considered F. af fine as a misapplied
synonym of P. cucumerina.Sherbakoff (1915) also treated the
fungus as F. af fine, which was later reinterpreted as Septomyxa
affine by Wollenweber (1916–1935). Therefore, the current
status of F. af fine is uncertain and requires further investigation.
agapanthi Fusarium O'Donnell et al., Mycologia 108: 987.
2016.
Holotypus: VPRI 41777.
Ex-type culture: NRRL 54463 = VPRI 41777.
Type locality:Australia, Victoria, Melbourne, Royal Botanic
Gardens.
Type substrate:Agapanthus praecox.
Descriptions and illustrations: See Edwards et al. (2016).
Diagnostic DNA barcodes:rpb1: KU900620; rpb2: KU900625;
tef1: KU900630.
agaricorum Fusarium Sarrazin, Rev. Mycol. (Toulouse) 9: 170.
1887.
Lectotypus (hic designatus, MBT 10000649): France, on the cap
of Psalliota campestris (syn. Agaricus campestris), 1887, F.
Sarrazin, ILL00218415 (Roumegu
ere, Fungi Sel. Gall. Exs. no.
4298).
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
ailanthinum Fusarium Speg., Anales Mus. Nac. Hist. Nat. Bue-
nos Aires 6: 350. 1899.
(See Fusarium lateritium)
Holotypus: In LPS (Fungi Argent. n.v.c. #864).
Type locality:Argentina.
Type substrate: Trunk and branches of Ailanthus glandulosa.
Note: Synonym fide Wollenweber & Reinking (1935).
alabamense Fusarium Sacc., Syll. Fung. 4: 722. 1886, nom.
illegit., Art. 52.1.
Synonym:Fusarium erubescens Berk. & M.A. Curtis, Grevillea 3:
98. 1875.
Holotypus: ?K(M).
Type locality:USA, Alabama, Beaumont.
Type substrate: Bark.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
albedinis Fusarium Kill. & Maire ex Malençon, Compt. Rend.
Hebd. S
eances Acad. Sci. 198: 1261. 1934, nom. inval., Art.
6.10.
Synonym:Cylindrophora albedinis Kill. & Maire, Bull. Soc. Hist.
Nat. Afrique N. 21: 97. 1930, nom. inval., Art. 36.1.
(See Fusarium oxysporum)
Authentic material: Not located.
Original locality: Indicated as ‘oasis in Sahara’.
Original substrate: Dead trunk and leaf of Phoenix dactylifera.
Note: Synonym fide Booth (1971).
albertii Fusarium Roum., Fungi Sel. Gall. Exs., Cent. 19: no.
1867. 1881, nom. inval., Art. 38.1(a).
(See Fusarium lateritium)
Authentic material: BR5020140140720.
Original locality:France.
Original substrate: Petiole of Ziziphus volubilis.
Note: Synonym fide Wollenweber & Reinking (1935).
albidoviolaceum Fusarium Dasz. (as ‘albido-violaceum’), Bull.
Soc. Bot. Gen
eve, s
er. 2, 4: 293. 1912.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000650): Switzerland,
Geneva, from soil, 1912, W. Daszewska, Bull. Soc. Bot. Gen
eve,
2s

er. 4: 292, fig. 15.
Notes:Wollenweber (1916–1935; Fusaria Autogr. Delin. 1: 361)
indicated that the living ex-type culture was lodged in the labo-
ratory of W.C. Scholten in Amsterdam, which in turn has been
accessioned into the CBS. However, no record or culture can be
located in the CBS collection. Therefore, an illustration accom-
panying the original protologue is designated as lectotype here.
albidum Fusarium (Rossman) O'Donnell & Geiser, Phytopa-
thology 103: 404. 2013.
Luteonectria albida (Rossman) Sand.-Den. & L. Lombard,
Stud. Mycol. 98 (no. 100116): 60. 2021.
Basionym:Nectria albida Rossman, Mycol. Pap. 150: 79. 1983.
Synonym:Albonectria albida (Rossman) Guu & Y.M. Ju, Bot.
Stud. (Taipei) 48: 189. 2007.
Holotypus: CUP-MJ 942.
Ex-type culture: ATCC 44543 = BBA 67603 = CTR 71-
110 = NRRL 13950 = NRRL 22152.
Type locality:Jamaica, Hanover Parish, Dolphin Head Mountain,
near Askenish.
Type substrate: Erumpent through thin bark of woody stem.
Diagnostic DNA barcode:rpb1: JX171492; rpb2: HQ897738;
tef1: MW834283.
albiziae Fusarium Woron., Vestn. Tiflissk. Bot Sada 48: 34. 1920.
(See Fusarium merismoides)
Syntypes: BPI 451733, BPI 451734 & CUP-017160.
Type locality:Georgia, Batumi, Adjara.
Type substrate:Albizia julibrissin.
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification requires further investigation of the syntypes.
albocarneum Fusarium (Cooke & Harkn.) Sacc., Syll. Fung. 4:
720. 1886.
Basionym:Fusidium albocarneum Cooke & Harkn., Grevillea 9:
129. 1881.
Syntype: BPI 408577.
Type locality:USA, California, San Francisco, San Francisco
Odd Fellows Cemetery.
Type substrate:Eucalyptus sp.
Notes: The generic name Cylindrocarpon (= Neonectria;
Rossman et al. 2013) was conserved over Fusidium, making the
latter generic name a nom. rej. (Art. 14.1, 14.6 & 14.7). There-
fore, Fusidium albocarneum should be transferred to Neonectria
after further investigation. Lectotypification requires further
investigation of the syntype.
albosuccineum Fusarium (Pat.) O'Donnell & Geiser, Phytopa-
thology 103: 404. 2013.
Albonectria albosuccinea (Pat.) Rossman & Samuels, Stud.
Mycol. 42: 107. 1999.
Basionym:Calonectria albosuccinea Pat., Bull. Soc. Mycol.
France 8: 132. 1892.
CROUS ET AL.
82

Synonyms:Nectria albosuccinea (Pat.) Rossman, Mycotaxon 8:
487. 1979.
Calonectria ecuadorica Petrak, Sydowia 4: 463. 1950.
Holotypus:InFHfide Rossman (1983).
Type locality:Ecuador, Puente Chimbo.
Type substrate: Bark.
album Fusarium Sacc., Michelia 1: 82. 1877.
Neonectria punicea (J.C. Schmidt) Castl. & Rossman, Canad.
J. Bot. 84: 1425. 2006.
Basionym:Sphaeria punicea J.C. Schmidt, in Schmidt & Kunze,
Mykol. Hefte 1: 61. 1817.
Synonyms:Nectria punicea (J.C. Schmidt) Fr., Summa Veg.
Scand. 2: 387. 1849.
Cucurbitaria punicea (J.C. Schmidt) Kuntze, Revis. Gen. Pl. 3:
461. 1898.
Cylindrocarpon album (Sacc.) Wollenw., Fusaria Autogr.Delin. 1:
no. 473. 1916.
Nectria punicea f. ilicicola Rehm, Ascomyceten: no. 337. 1876.
Nectria punicea var. ilicis C. Booth, Mycol. Pap. 73: 54. 1959.
Cylindrocarpon album var. majus Wollenw., Z. Parasitenk.
(Berlin) 1: 154. 1928.
Fusarium album var. abietinum Beeli, Bull. Soc. Roy. Bot. Bel-
gique 62: 131. 1930.
Holotypus: Not located.
Type locality:Italy.
Type substrate: Bark of Pinus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
aleurinum Fusarium Ellis & Everh., Bull. Torrey Bot. Club 24:
476. 1897.
(See Fusarium avenaceum)
Syntypes: In BPI, BRU, CLEMS, CUP, F, FLAS, ILL, ILLS, ISC,
MICH, MSC, MU, NCU, NEB, OSC, PH, PUL, UC, WIS & WSP.
Type locality:USA, West Virginia, Fayette County Nuttallburg,
south of Edmond.
Type substrate: Wheat flour that had been on the ground for four
months.
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification requires further investigation of the syntypes.
aleyrodis Fusarium Petch, Trans. Brit. Mycol. Soc. 7: 164. 1921.
Lectotypus (hic designatus, MBT 10000651): USA, Florida,
Sutherland, from Aleyrodes citri, 13 Sep. 1907, F. Wills, in Petch
1921, Trans. Brit. Mycol. Soc. 7, pl. V, fig. 12.
Notes:Wollenweber & Reinking (1935) considered this species
as a synonym of F. scirpi. However, based on the descriptions
and illustrations provided by Fawcett (1908) and Petch (1920),
this species belongs to the genus Microcera, which is also in
agreement with its aetiology. Therefore, a new combination will
presumably be required after further investigation.
algeriense Fusarium Laraba & O'Donnell, Mycologia 109: 944.
2017.
Holotypus: BPI 910347.
Ex-type culture: CBS 142638 = NRRL 66647.
Type locality:Algeria, Guelma Province, Djeballah Khemissi.
Type substrate:Triticum durum.
Descriptions and illustrations: See Laraba et al. (2017).
Diagnostic DNA barcodes:rpb1: MF120488; rpb2: MF120499;
tef1: MF120510.
alkanophilum Fusarium Palacios-Prü & V. Marcano, Rev. Ecol.
Latinoamer. 8: 5. 2001.
Holotypus: EMC, Palacios-Prü, 3 April 1998.
Type locality:Venezuela, Merida State, south of Sierra La
Culata, Valle de San Javier, Los Pinos.
Type substrate: Beetle immersed in kerosene.
Descriptions and illustrations: See Marcano et al. (2001).
Note: No living type material could be located.
allescheri Fusarium Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899.
Replaced synonym:Fusarium glandicola Allesch., Ber. Bot.
Vereines Landshut 12: 130. 1892, nom. illegit., Art. 53.1; non
Cooke & W.R. Gerard 1878.
(See Fusarium melanochlorum)
Holotypus:InM.
Type locality:Germany, München.
Type substrate:Quercus pedunculata.
Note: Synonym fide Wollenweber & Reinking (1935).
allescherianum Fusarium Henn., Verh. Bot. Vereins Prov.
Brandenburg 40: 175. 1899.
Synonyms: Gloeosporium allescherianum (Henn.) Wollenw.,
Fusaria Autogr. Delin. 1: 495. 1916.
?Fusarium personatum Cooke, in Harkness, Grevillea 7: 12.
1878.
Holotypus:InBfide Hein (1988).
Type locality:Germany.
Type substrate: Leaves of Ocotea foetens.
Notes: Status unclear. The taxonomic status of Gloeosporium
allescherianum is questionable. Furthermore, there is no DNA-
based evidence linking F. allescherianum to F. personatum
although Wollenweber & Reinking (1935) considered them both
synonyms under G. allescherianum.
allii-sativi Fusarium Allesch., Ber. Bot. Vereines Landshut 12:
131. 1892.
(See Fusarium solani)
Holotypus:InM.
Type locality:Germany, Unterammergau.
Type substrate:Allium sativum.
alluviale Fusarium Wollenw. & Reinking, Phytopathology 15: 167.
1925.
(See Fusarium solani)
Holotypus: Not located.
Type locality:Honduras.
Type substrate: Alluvial soil.
aloes Fusarium Kalchbr. & Cooke, Grevillea 9: 23. 1880.
(See Fusarium scirpi)
Holotypus: ?K(M).
Type locality:South Africa, Eastern Cape Province, Somerset
East.
Type substrate:Aloe arborescens.
Note: Synonym fide Wollenweber & Reinking (1935).
ambrosium Fusarium (Gadd & Loos) Agnihothr. & Nirenberg,
Stud. Mycol. 32: 98. 1990.
Neocosmospora ambrosia (Gadd & Loos) L. Lombard &
Crous, Stud. Mycol. 80: 227. 2015.
Basionym:Monacrosporium ambrosium Gadd & Loos, Trans.
Brit. Mycol. Soc. 31: 17. 1947.
Synonyms:Dactylella ambrosia (Gadd & Loos) K.Q. Zhang et al.,
Mycosystema 7: 112. 1995.
Fusarium bugnicourtii Brayford, Trans. Brit. Mycol. Soc. 89: 350.
1987.
FUSARIUM REDELIMITED
www.studiesinmycology.org 83

Lectotypus: Trans. Brit. Mycol. Soc. 31: 16, Text-fig. 5. 1947,
designated by Aoki et al. (2018).
Lectotype locality:Sri Lanka.
Lectotype substrate: Gallery of Euwallacea fornicatus infesting
Camellia sinensis.
Epitypus: BPI 910524, designated by Aoki et al. (2018).
Ex-epitype culture: BBA 65390 = CBS 571.94 = NRRL
22346 = MAFF 246287.
Epitype locality:India, Upasi Tea Institute.
Epitype substrate: Gallery of Euwallacea fornicatus infesting
Camellia sinensis.
Diagnostic DNA barcodes:rpb1: KC691587; rpb2: EU329503;
tef1: FJ240350
amenti Fusarium Rostr., Bot. Tidsskr. 14: 240. 1885.
(See Fusarium avenaceum)
Holotypus: F-604398 in UPS.
Type locality:Denmark, Fyn, Holmdrup.
Type substrate:Salix cinerea.
Note: Synonym fide Wollenweber & Reinking (1935).
amentorum Fusarium Lacroix, Fl. Maine-et-Loire 2 (Suppl.): [1].
1854.
(See Fusarium avenaceum)
Lectotypus (hic designatus, MBT 10000652): France, St.
Romain-sur-Vienne, from Salix cinerea, date unknown,J.B.H.J.
Desmazi
eres, BR5020140143752.
Note: Synonym fide Wollenweber & Reinking (1935).
amethysteum Fusarium P. Crouan & H. Crouan, Fl. Finist
ere: 14.
1867.
Holotypus: Not located.
Type locality:France.
Type substrate: Dead stem of Urtica sp.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
ampelodesmi Fusarium Fautrey & Roum., in Roumegu
ere, Rev.
Mycol. (Toulouse) 13: 82. 1891.
(See Fusarium reticulatum)
Syntype: ILL00219841 (Roumegu
ere, Fungi Sel. Gall. Exs. no.
5687).
Type locality:France, Jardin de Noidan.
Type substrate:Ampelodesmos tenax
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification requires further investigation of the syntype.
amplum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index
Fungorum 440: 1. 2020.
Neocosmospora ampla Sand.-Denis & Crous, Persoonia 43:
110. 2019.
Holotypus: CBS H-23970.
Ex-type culture: BBA 4170 = CBS 202.32.
Type locality:German East Africa.
Type substrate:Coffea sp.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834212; rpb2: LR583815;
tef1: LR583594.
ananatum Fusarium A. Jacobs et al., Fung. Biol. 114: 522.
2010.
Holotypus: PREM 58713.
Ex-type culture: CBS 118516 = CMW 18685 = FCC 2986 = MRC
8165.
Type locality:South Africa, KwaZulu-Natal Province, Hluhluwe.
Type substrate:Ananas comosus.
Descriptions and illustrations: See Jacobs et al. (2010).
Diagnostic DNA barcodes:rpb1: MT010937; rpb2: LT996137;
tef1: MT010996.
andinum Fusarium Syd., Ann. Mycol. 37: 437. 1939.
Holotypus: S-F 45569.
Type locality:Ecuador, Tungurahua.
Type substrate:Chusquea serrulata.
Descriptions and illustrations: See Sydow & Sydow (1939).
andiyazi Fusarium Marasas et al., Mycologia 93: 1205. 2001.
Holotypus: BPI 748223.
Ex-type culture: CBS 119857 = IMI 386078 = KSU 4804 = MRC
6122.
Type locality:South Africa, KwaZulu-Natal Province, Greytown.
Type substrate: Soil debris of Sorghum bicolor.
Descriptions and illustrations: See Marasas et al. (2001) and
Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: LT996189; rpb2: LT996138;
tef1: LT996092.
andropogonis Fusarium Cooke ex Sacc., Syll. Fung. 10: 726.
1892.
Synonyms:Fusisporium andropogonis Cooke ex Thüm., Mycoth.
Univ. 7: no. 676. 1877, nom. inval., Art. 38.1(a).
Ramularia andropogonis (Cooke ex Sacc.) Wollenw., Fusaria
Autogr. Delin. 1: 469. 1916.
Lectotypus (hic designatus, MBT 10000653): USA, New Jersey,
Newfield, from dead stem of Andropogon virginicus, Oct. 1874,
J.B. Ellis, BR5020081431482 (Thümen, Mycoth. Univ. 7: no.
676).
Notes: Status unclear, not Ramularia fide Braun (1998). Syno-
nym fide Wollenweber & Reinking (1935).
anguioides Fusarium Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 169. 1915.
Typus: ?CUP-007479.
Type locality:USA, New York, Castile.
Type substrate:Solanum tuberosum.
Descriptions and illustrations: See Sherbakoff (1915),Gerlach &
Nirenberg (1982) and Nelson et al. (1995).
Notes:Nelson et al. (1995) designated BPI 72044 as neotype of
F. anguioides, erroneously stating that no materials were avail-
able for epi- and lectotypification. However, Sherbakoff (1915)
did provide an illustration with the original protologue of
F. anguioides and placed material in CUP, as CUP-007479.
Furthermore, the neotype (BPI 72044) of Nelson et al. (1995)
originated from China and was isolated from soil in a bamboo
grove. An isolate from the original locality (USA) and host (So-
lanum tuberosum) needs to be selected. Lectotypification
pending study of material lodged in CUP.
angustum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 203. 1915.
(See Fusarium oxysporum)
Typus: ?CUP-007435.
Type locality:USA, New York, Ithaca.
Type substrate:Solanum tuberosum.
Descriptions and illustrations: See Sherbakoff (1915).
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in CUP.
anisophilum Fusarium Picado, J. Dept. Agric. Porto Rico 16: 391.
1932.
CROUS ET AL.
84

(See Fusarium lateritium)
Holotypus: Not located.
Type locality:Costa Rica.
Type substrate: Living stem of Coffea sp.
Note: Synonym fide Wollenweber & Reinking (1935).
annulatum Fusarium Bugnic., Rev. G
en. Bot. 59: 17. 1952.
Holotypus: IMI 202878.
Ex-type culture: BBA 63629 = CBS 258.54 = IMI 202878 = MUCL
8059 = NRRL 13619.
Type locality:New Caledonia.
Type substrate: Grain of Oryza sativa.
Descriptions and illustrations: See Bugnicourt (1952),Yilmaz
et al. (2021).
Diagnostic DNA barcodes:rpb1: MT010944; rpb2: MT010983;
tef1: MT010994.
annuum Fusarium Leonian, Bull. New Mex. Coll. Agric. Mech.
Arts 121: 9. 1919.
Lectotypus (hic designatus, MBT 10000654): USA, New Mexico,
from Capsicum annuum, 1919, L.H. Leonian, In Bull. New Mex.
Coll. Agric. Mech. Arts 121: 32, fig. 7.
Notes: No type specimen could be located. Wollenweber &
Reinking (1935) mentioned this species but did not study or
treat it any further. A new collection is required for epitypification
from the type locality and substrate.
anomalum Fusarium Berk. & M.A. Curtis, in Berkeley, Grevillea
3: 99. 1875.
Holotypus: ?K(M).
Type locality:USA, the New England region.
Type substrate:Gleditsia sp.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
anthophilum Fusarium (A. Braun) Wollenw., Ann. Mycol. 15:
14. 1917.
Basionym:Fusisporium anthophilum A. Braun, in Rabenhorst,
Fungi Eur. Exs.: no. 1964. 1875.
Synonyms:Fusarium moniliforme var. anthophilum (A. Braun)
Wollenw., Fusaria Autogr. Delin. 3: 975. 1930.
Fusarium tricinctum var. anthophilum (A. Braun) Bilaĭ, Fusarii
(Biologija I sistematika): 251. 1955.
Fusarium sporotrichiella var. anthophilum (A. Braun) Bilaĭ, Mik-
robiol. Zhurn. 49: 7. 1987.
Fusarium sanguineum var. pallidius Sherb., Mem. Cornell Univ.
Agric. Exp. Sta. 6: 196. 1915.
Fusarium wollenweberi Raillo, Fungi of the Genus Fusarium:
189. 1950, nom. inval., Art. 41.1.
Lectotypus: Rabenhorst, Fungi Eur. Exs. no. 1964 in B, desig-
nated by Yilmaz et al. (2021).
Lectotype locality:Germany, Berchtesgaden.
Lectotype substrate:Succisa pratensis.
Epitypus: CBS 222.76 (preserved as metabolically inactive cul-
ture), designated by Yilmaz et al. (2021).
Ex-epitype culture: BBA 63270 = CBS 222.76 = IMI 196084 = IMI
202880 = NRRL 22943 = NRRL 25216.
Epitype locality:Germany, Berlin.
Epitype substrate:Euphorbia pulcherrima.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Nirenberg (1976),Gerlach & Nirenberg (1982),Nelson
et al. (1983) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: MW402641; rpb2: MW402811;
tef1: MW402114.
apii Fusarium P.E. Nelson & Sherb., Techn. Bull. Michigan Agric.
Exp. Sta. 155: 42. 1937.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:USA.
Type substrate:Apium graveolens var. dulce.
apiogenum Fusarium Sacc., Syll. Fung. 4: 717. 1886.
(See Fusarium lactis)
Holotypus: Not located.
Type locality:Germany.
Type substrate: Rotten fruit.
aquaeductuum Fusarium (Radlk. & Rabenh.) Lagerh. & Rabenh.,
Centralbl. Bakteriol. Parasitenk. Abth.9: 655. 1891.
Fusicolla aquaeductuum (Radlk. & Rabenh.) Gr€
afenhan et al.,
Stud. Mycol. 68: 100. 2011.
Basionym:Selenosporium aquaeductuum Radlk. & Rabenh.,
Kunst- und Gewerbeblatt des Polytechnischen Vereins des
Königreichs Bayern 41(1): 10. 1863.
Synonyms:Fusisporium moschatum Kitasato, Centralbl. Bak-
teriol. Parasitenk., 1. Abth. 5: 368. 1889.
Fusarium moschatum (Kitasato) Sacc., Syll. Fung. 10: 729.
1892.
Fusarium magnusianum Allesch., Fungi Bav. no. 400. 1895.
Fusarium aquaeductuum var. pusillum Wollenw., Ann. Mycol. 15:
53. 1917.
Fusarium aquaeductuum var. volutum Wollenw., Ann. Mycol. 15:
53. 1917.
Fusarium aquaeductuum var. elongatum Wollenw., Fusaria
Autogr. Delin. 3: 847. 1930.
Fusarium aquaeductuum var. majus Wollenw., Fusaria Autogr.
Delin. 3: 845. 1930.
Fusarium bicellulare Kirschst., Hedwigia 80: 136. 1941.
Lectotypus: B 700014034, designated in Gr€
afenhan et al. (2011).
Lectotype locality:Germany, Bayern, München, Gasteigberg.
Lectotype substrate: Water in water fountain.
Epitypus: BBA 64559, designated in Gr€
afenhan et al. (2011).
Ex-epitype culture: BBA 64559 = CBS 837.85 = NRRL
20865 = NRRL 37595.
Epitype locality:Germany.
Epitype substrate: Water from plugged water tap in BBA.
Descriptions and illustrations: See Gerlach & Nirenberg (1982).
Diagnostic DNA barcodes:rpb1: KM232250; rpb2: HQ897744;
tef1: KM231955.
arachnoideum Fusarium (Corda) Sacc., Syll. Fung. 4: 721. 1886.
Basionym:Fusisporium arachnoideum Corda, Icon. Fung. 1: 11.
1837.
(See Fusarium merismoides)
Typus: In PRM.
Type locality:Czech Republic, Prague.
Type substrate: Soil.
Note: Synonym fide Wollenweber & Reinking (1935).Lectoty-
pification pending study of material lodged in PRM.
arcuatisporum Fusarium M.M. Wang et al., Persoonia 43: 78.
2019.
Holotypus: HAMS 248034.
Ex-type culture: CGMCC 3.19493 = LC 12147.
Type locality:China, Hubei.
FUSARIUM REDELIMITED
www.studiesinmycology.org 85

Type substrate: Pollen of Brassica campestris.
Descriptions and illustrations: See Wang et al. (2019).
Diagnostic DNA barcodes:rpb1: MK289799; rpb2: MK289739;
tef1: MK289584.
arcuatum Fusarium Berk. & M.A. Curtis, Grevillea 3: 99. 1875.
(See Fusarium avenaceum)
Lectotypus (hic designatus, MBT 10000655): USA, South Car-
olina, Malus pumila (syn. Pyrus malus), date unknown, M.A.
Curtis, PH00005557.
Note: Synonym fide Wollenweber & Reinking (1935).
arcuosporum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 186. 1915.
(See Fusarium acuminatum)
Typus: ?CUP-007477.
Type locality:USA, New York, Castile.
Type substrate:Solanum tuberosum.
Descriptions and illustrations: See Sherbakoff (1915).
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in CUP.
argillaceum Fusarium (Fr.) Sacc., Syll. Fung. 4: 718. 1886.
Basionym:Fusisporium argillaceum Fr., Syst. Mycol. 3: 446.
1832.
Synonyms:Fusarium solani var. argillaceum (Fr.) Bilaĭ, Mikrobiol.
Zhurn. 49: 7. 1987.
Nectria solani Reinke & Berthold, Untersuch. Bot. Lab. Univ.
Göttingen 1: 39. 1879.
Dialonectria solani (Reinke & Berthold) Cooke, Grevillea 12: 111.
1884.
Cucurbitaria solani (Reinke & Berthold) Kuntze, Revis. Gen. Pl.
3: 461. 1898.
Holotypus: Not located.
Type locality:Unknown.
Type substrate: Periderm of Cucumis sp.
Notes: Status unclear. Requires recollection from type locality
and substrate.
aridum Fusarium O.A. Pratt, J. Agric. Res. 13: 89. 1918.
(See Fusarium sambucinum)
Lectotypus (hic designatus, MBT 10000656): USA, Idaho, from
soil, 1918, O.A. Pratt, in J. Agric. Res.13: 87, fig. 2Q.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
armeniacum Fusarium (G.A. Forbes et al.) L.W. Burgess &
Summerell, comb. nov.MycoBank MB 837636.
Basionym:Fusarium acuminatum subsp. armeniacum G.A.
Forbes et al., Mycologia 85: 120. 1993.
Holotypus: DAR 67507.
Ex-type culture: ATCC 90020 = CBS 485.94 = FRC R-9335 = IMI
352099 = MRC 6230 = NRRL 26908 = NRRL 25141 = NRRL
29133.
Type locality:Australia, New South Wales, Edgeroi.
Type substrate:Triticum aestivum.
Descriptions and illustrations: See Burgess et al. (1993),Burgess
& Summerell (2000) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: KT597715; rpb2: GQ915485;
tef1: GQ915501.
Notes: When proposing F. armeniacum,Burgess & Summerell
(2000) cited the basionym as F. acuminatum subsp. armenia-
cum with reference to the entire pagination of Burgess et al.'s
(1993) paper, rather than the intended basionym alone,
rendering the combination invalid (Art. 41.5, Ex. 15). Here we
validate the new combination with the correct citation of the
basionym.
arthrosporioides Fusarium Sherb., Mem. Cornell Univ. Agric.
Exp. Sta. 6: 175. 1915.
Typus: ?CUP-007467.
Type locality:USA, New York, Castile.
Type substrate:Solanum tuberosum.
Descriptions and illustrations: See Sherbakoff (1915),Booth
(1971) and Gerlach & Nirenberg (1982).
Notes: Synonym fide Wollenweber & Reinking (1935). Lecto-
and epitypification pending study of material lodged in CUP.
arundinis Fusarium (Corda) Sacc., Syll. Fung. 4: 724. 1886.
Trichoderma viride Pers., Neues Mag. Bot. 1: 92. 1794, nom.
sanct. [Fr., Syst. Mycol. 3: 215. 1829].
Synonyms:Pyrenium lignorum Tode, Fung. Mecklenb. Sel. 1: 33,
tab. 3, fig. 29. 1790.
Trichoderma lignorum (Tode) Harz, Bull. Soc. Imp. Naturalistes
Moscou 44: 116. 1871.
Trichoderma viride Schumach., Enum. Pl. 2: 235. 1803, nom.
illegit., Art. 53.1.
Fusisporium arundinis Corda, Icon. Fung. 1: 11. 1837.
Trichoderma glaucum E.V. Abbott, Iowa State Coll. J. Sci. 1: 27.
1927.
Lectotypus (hic designatus, MBT 10000657): Czech Republic,
Prague, rotten leaves of reeds, 1837, A.C.J. Corda, Icon. Fung.
1, tab. II, fig. 163.
Notes: Synonyms fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
arvense Fusarium Speg., Anales Soc. Ci. Argent. 10: 60. 1880.
(See Fusarium merismoides)
Holotypus: In LPS (Fungi Argent. pug. 2, #153).
Type locality:Argentina.
Type substrate: Dried fruits of Solanum elaeagnifolium.
Note: Synonym fide Wollenweber & Reinking (1935).
asclepiadeum Fusarium Fautrey, Rev. Mycol. (Toulouse) 18: 68.
1896.
(See Fusarium lateritium)
Syntype: ILL00221138 (Fungi Sel. Gall. Exs. #6929).
Type locality:France, Montagne de Bard.
Type substrate:Vincetoxicum officinale (syn. V. hirundinaria).
Note: Synonym fide Wollenweber & Reinking (1935).
asclerotium Fusarium (Sherb.) Wollenw., Fusaria Autogr. Delin.
1: 364. 1916.
Basionym:Fusarium oxysporum var. asclerotium Sherb., Mem.
Cornell Univ. Agric. Exp. Sta. 6: 222. 1915.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000658): USA, New
York, Atlanta, rotten tuber of Solanum tuberosum, 1915, C.D.
Sherbakoff, in Mem. Cornell Univ. Agric. Exp. Sta. 6: 221, fig. 35
B–J.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
asiaticum Fusarium O'Donnell et al., Fungal Genet. Biol. 41:
619. 2004.
Holotypus: BPI 843478.
CROUS ET AL.
86

Ex-type culture: CBS 110257 = FRC R-5469 = NRRL 13818.
Type locality:Japan.
Type substrate:Hordeum vulgare.
Descriptions and illustrations: See O'Donnell et al. (2004).
Diagnostic DNA barcodes:rpb1: JX171459; rpb2: JX171573;
tef1: AF212451.
asparagi Fusarium Briard, Rev. Mycol. (Toulouse) 12: 142. 1890.
(See Fusarium incarnatum)
Holotypus: ?PC.
Type locality:France, Aube, Troyes.
Type substrate:Asparagus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
asparagi Fusarium Delacr., Bull. Soc. Mycol. France 6: 99. 1890,
nom. illegit., Art. 53.1., non Fusarium asparagi Briard 1890.
Replacing synonym:Fusarium delacroixii Sacc., Syll. Fung. 10:
725. 1892.
(See Fusarium sambucinum)
Notes: Synonym fide Wollenweber & Reinking (1935). See
F. delacroixii for lectotypification.
asperifoliorum Fusarium (Westend.) Sacc., Syll. Fung. 4: 703.
1886.
Basionym:Selenosporium asperifoliorum Westend., Bull. Acad.
Roy. Sci. Belgique, s
er. 2, 11: 652. 1861.
Holotypus: BR5020140146784.
Type locality:Belgium, Oudenaarde.
Type substrate:Borago officinalis.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
aspidioti Fusarium Sawada, Bot. Mag. (Tokyo) 28: 312. 1914.
(See Fusarium larvarum)
Holotypus: TNS-F-218710.
Type locality:Japan, Shizuoka.
Type substrate:Quadraspidiotus perniciosus (= Aspidiotus per-
niciosus) (San Jose scale).
Note: Synonym fide Wollenweber & Reinking (1935).
atrovinosum Fusarium L. Lombard & Crous, Fungal Syst. Evol.
4: 190. 2019.
Holotypus: CBS H-24015.
Ex-type culture: CBS 445.67 = BBA 10357 = DSM 62169 = IMI
096270 = NRRL 26852 = NRRL 26913.
Type locality:Australia.
Type substrate:Triticum aestivum.
Descriptions and illustrations: See Lombard et al. (2019a).
Diagnostic DNA barcodes:rpb1: MN120713; rpb2: MW928822;
tef1: MN120752.
atrovirens Fusarium (Berk.) Mussat, Syll. Fung. 15: 144. 1901,
nom. inval., Arts. 35.1, 36.1(a), (c).
Fusariella atrovirens (Berk.) Sacc., Atti Reale Ist. Veneto Sci.
Lett. Arti, ser. 6, 2: 463. 1884.
Basionym:Fusisporium atrovirens Berk., in Smith, Engl. Fl. 5 (2):
351. 1836.
Holotypus: ?K(M).
Type locality:UK, Northamptonshire, Kings Cliffe.
Type substrate:Allium sp.
Note: Synonym fide Wollenweber & Reinking (1935).
aurantiacum Fusarium Corda, in Sturm, Deutschl. Fl., 3 Abt.
(Pilze Deutschl.) 2: 19. 1829.
(See Fusarium oxysporum)
Typus: No. 156060 in PRM.
Isotypus: IMI 133948 (slide).
Type locality:France.
Type substrate: Dead branch.
Note: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in PRM.
aureum Fusarium Corda, Icon. Fung. 1: 4. 1837.
Hymenella aurea (Corda) L. Lombard, comb. nov.MycoBank
MB 837637.
Basionym:Fusarium aureum Corda, Icon. Fung. 1: 4. 1837.
Synonym:Hymenula aurea (Corda) Wollenw., Fusarien: 319.
1935.
Typus: In PRM fide Pilat (1938).
Type locality:Czech Republic, Prague.
Type substrate: Rotten vegetables.
Notes:Wollenweber & Reinking (1935) provided a new combi-
nation for F. aureum in the genus Hymenula. However, the generic
name Hymenella (1822) predates the generic name Hymenula
(1828) and therefore we provide a new combination in the latter
genus. Lectotypification pending study of material lodged in PRM.
austroafricanum Fusarium A. Jacobs et al., Mycologia 110:
1197. 2018.
Holotypus: PREM 62137.
Ex-type culture: NRRL 66741 = PPRI 10408.
Type locality:South Africa, Eastern Cape Province,
Humansdorp.
Type substrate: Endophyte of Pennisetum clandestinum.
Descriptions and illustrations: See Jacobs-Venter et al. (2018).
Diagnostic DNA barcodes:rpb1: MH742537; rpb2: MH742616;
tef1: MH742687.
austroamericanum Fusarium T. Aoki et al., Fungal Genet. Biol.
41: 617. 2004.
Holotypus: BPI 843473.
Ex-type culture: CBS 110244 = NRRL 2903.
Type locality:Brazil.
Type substrate: Polypore.
Descriptions and illustrations: See O'Donnell et al. (2004).
Diagnostic DNA barcodes:rpb1: JAAMOD010000230; rpb2:
JAAMOD010000315; tef1: JAAMOD010000079.
avenaceum Fusarium (Fr.) Sacc., Syll. Fung. 4: 713. 1886.
Basionym:Fusisporium avenaceum Fr., Syst. Mycol. 2: 238.
1822, nom. sanct. [Fr., l.c.].
Synonyms:Sarcopodium avenaceum (Fr.) Fr., Summa Veg.
Scand. 2: 472. 1849.
Fusarium herbarum var. avenaceum (Fr.) Wollenw., Fusaria
Autogr. Delin. 3: 899. 1930.
Fusarium roseum var. avenaceum (Fr.) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 32: 663. 1945.
Fusisporium pyrinum Fr., Syst. Mycol. 3: 445. 1832, nom. sanct.
[Fr., l.c.].
Fusarium pyrinum (Fr.) Sacc., Syll. Fung. 4: 720. 1886, nom.
illegit., Art. 53.1.
Fusarium tenue Corda, Icon. Fung. 1: 3. 1837.
Selenosporium tubercularioides Corda, Icon. Fung. 1: 7. 1837.
Fusarium tubercularioides (Corda) Sacc., Syll. Fung. 4: 697. 1886.
Fusarium herbarum var. tubercularioides (Corda) Wollenw.,
Fusaria Autogr. Delin. 3: 892. 1930.
Selenosporium herbarum Corda, Icon. Fung. 3: 34. 1839.
Fusarium herbarum (Corda) Fr., Summa Veg. Scand. 2: 472.
1849.
FUSARIUM REDELIMITED
www.studiesinmycology.org 87

Fusarium graminum var. herbarum (Corda) Wollenw., Fusaria
Autogr. Delin. 3: 941. 1930.
Fusarium avenaceum var. herbarum (Corda) Bilaĭ, Fusarii
(Biologija i sistematika): 95. 1955.
Fusarium tritici Liebman bis, Tidsskr. Landoekon., n.s., 2: 515.
1840.
Fusisporium zeae Westend., Bull. Acad. Roy. Sci. Belgique 18:
414. 1851.
Fusarium zeae (Westend.) Sacc., Syll. Fung. 4: 713. 1886.
Fusarium amentorum Lacroix, Fl. Maine-et-Loire 2 (Suppl.): [1].
1854.
Gloeosporium amentorum (Lacroix) Lind, Ann. Mycol. 3: 431. 1905.
Calogloeum amentorum (Lacroix) Nannf., Svensk Bot. Tidskr.
25: 25. 1931.
Platycarpium amentorum (Lacroix) Petr., Sydowia 7: 296. 1953.
Fusamen amentorum (Lacroix) Arx, Verh. Kon. Akad.
Wetensch., Afd. Natuurk. 51: 57. 1957.
Fusisporium incarcerans Berk., Intellectual Observ. 2: 11. 1863.
Fusarium incarcerans (Berk.) Sacc., Syll. Fung. 4: 713. 1886.
Fusarium stercoris Fuckel, Fungi Rhen. Exs., Suppl. Fasc. 5: no.
1921, 1867.
Menispora penicillata Harz, Bull. Soc. Imp. Naturalistes Moscou
44: 127. 1871.
Fusarium penicillatum (Harz) Sacc., Syll. Fung. 4: 710. 1886.
Fusisporium schiedermayeri Thüm., Fungi Austr. Exs. Cent. 1:
no. 78. 1871.
Fusarium schiedermayeri (Thüm.) Sacc., Syll. Fung. 4: 712.1886.
Fusarium arcuatum Berk. & M.A. Curtis, Grevillea 3: 99. 1875.
Fusarium viticola Thüm., Pilze Weinst.: 52. 1878.
Fusarium herbarum var. viticola (Thüm.) Wollenw., Fusaria
Autogr. Delin. 3: 898. 1930.
Fusarium gaudefroyanum Sacc., Michelia 2: 132. 1880.
Fusisporium cucurbitariae Pat., Rev. Mycol. (Toulouse) 3:10. 1881.
Fusarium cucurbitariae (Pat.) Sacc., Syll. Fung. 4: 708. 1886, nom.
illegit.,Art.53.1,non Fusarium cucurbitariae Peyronel 1918.
Fusarium amenti Rostr., Bot. Tidsskr. 14: 240. 1885.
Fusarium urenidicola Jul. Müll., Ber. Deutsch. Bot. Ges. 3: 395.
1885.
Fusarium diffusum Carmich., Grevillea 16: 81. 1888.
Fusarium iridis Oudem., Ned. Kruidk. Arch., ser. 2, 5: 515. 1889.
Fusarium ustilaginis Kellerm. & Swingle, Rep. (Annual) Kansas
Agric. Exp. Sta. 2: 285. 1890.
Fusarium ruberrimum Delacr., Bull. Soc. Mycol. France 6: 139.
1890.
Fusarium peckii Sacc., Syll. Fung. 10: 727. 1892, nom. illegit.,
Art. 53.1 [pro. p.fide Wollenweber & Reinking (1935)].
Fusarium aecidii-tussilaginis Allesch., Ber. Bot. Vereines Land-
shut 12: 131. 1892.
Fusarium subviolaceum Roum. & Fautrey, Rev. Mycol. (Tou-
louse) 14: 106. 1892.
Fusarium granulosum Ellis & Everh., Proc. Acad. Nat. Sci.
Philadelphia 45: 466. 1894 [1893].
Fusarium jungiae Pat., Bull. Soc. Mycol. France 11: 234. 1895.
Fusarium schnablianum Allesch., Hedwigia 34: 289. 1895.
Fusarium seemenianum Henn., Allg. Bot. Z. Syst. 2: 83. 1896.
Fusarium aleurinum Ellis & Everh., Bull. Torrey Bot. Club 24:
476. 1897.
Fusarium pseudonectria Speg., Anales Mus. Nac. Hist. Nat.
Buenos Aires 6: 351. 1899.
Fusarium limosum Rostr., Bot. Tidsskr. 22: 263. 1899.
Fusarium gracile McAlpine, Proc. Linn. Soc. New South Wales
28: 554. 1903.
Fusarium putrefaciens Osterw., Mitth. Thurgauischen Naturf.
Ges. 16: 123. 1904.
Fusarium paspali Henn., Bot. Jahrb. Syst. 38: 129. 1905.
Fusarium sorghi Henn., Ann. Mus. Congo Belge, Bot., S
er. 5, 2:
105. 1907.
Fusarium speiseri Lindau, Rabenh. Krypt.-Fl., ed. 2, 1(9): 580.
1909.
Fusarium palczewskii Jacz., Bull. Soc. Mycol. France 28: 345. 1912.
Fusarium pseudoheterosporum Jacz., Bull. Soc. Mycol. France
28: 347. 1912.
Fusarium metachroum Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 141. 1913.
Fusarium subulatum Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 131. 1913.
Fusarium biforme Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6:
166. 1915.
Fusarium lucidum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6:
157. 1915.
Fusarium metachroum var. minus Sherb., Mem. Cornell Univ.
Agric. Exp. Sta. 6: 145. 1915.
Fusarium subulatum var. brevius Sherb., Mem. Cornell Univ.
Agric. Exp. Sta. 6: 149. 1915.
Fusarium truncatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 155. 1915.
Fusarium avenaceum var. pallens Wollenw., Fusaria. Autogr.
Delin. 2: 575. 1924.
Fusarium venerorum Dounin & Goldmacher. Actes du premier
Congres Internat. des Sylvicult.: 284–298. 1927.
Fusarium herbarum var. volutum Wollenw., Fusaria Autogr.
Delin. 3: 893. 1930.
Fusarium avenaceum var. volutum (Wollenw.) Wollenw. &
Reinking, Fusarien: 56. 1935.
Fusarium avenaceum subsp. volutum (Wollenw.) Raillo, Fungi of
the Genus Fusarium: 188. 1950.
Fusarium avenaceum var. fabae T.F. Yu, Phytopathology 34:
392. 1944.
Fusarium avenaceum f. fabae (T.F. Yu) W. Yamam., Sci. Rep.
Hyogo Univ. Agric., Ser. Agr. Biol. 2: 60. 1955.
Gibberella avenacea R.J. Cook, Phytopathology 57: 735. 1967.
Fusarium avenaceum f.fabalis X.Y. Ruan et al., Acta Phytopa-
thol. Sin. 12: 32. 1982, nom.inval., Art. 39.1.
Fusarium avenaceum f.fabarum X.Y. Ruan et al., Acta Phyto-
pathol. Sin. 12: 32. 1982, nom.inval., Art. 39.1.
Neotypus (hic designatus, MBT 10000659): Denmark,Hordeum
vulgare, 3 Feb. 1986, U. Thrane, CBS 408.86 (preserved as
metabolically inactive culture).
Ex-neotype culture: CBS 408.86 = FRC R-8510 = IMI
309354 = NRRL 26850 = NRRL 26911.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971),Gerlach & Nirenberg (1982),Nelson
et al. (1983) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: MG282372; rpb2: MG282401;
tef1: MW928836.
Notes: No type material could be located for this species. There-
fore, to provide taxonomic stability to this important cereal-asso-
ciated Fusarium species, CBS 408.86 is designated here as ex-
neotype of Fusisporium avenaceum (= Fusarium avenaceum).
awaxy Fusarium Petters-Vandresen et al., Persoonia 43: 363.
2019.
Holotypus: UPCB93138-H.
Ex-type culture: CMRP 4013 = LGMF1930.
CROUS ET AL.
88

Type locality:Brazil, Paran
a, Guarapuava.
Type substrate: Rotten stalks of Zea mays.
Descriptions and illustrations: See Crous et al. (2019b).
Diagnostic DNA barcodes:rpb2: MK766941; tef1: MG839004.
aywerte Fusarium (Sangal. & L.W. Burgess) Benyon & L.W.
Burgess, Mycol. Res. 104: 1171. 2000.
Basionym:Fusarium avenaceum subsp. aywerte Sangal. & L.W.
Burgess, Mycol. Res. 99: 287. 1995.
Holotypus: DAR 69501.
Ex-type culture: F10108 = NRRL 25410.
Type locality:Australia, Northern Territory, Deep Well.
Type substrate: Soil.
Descriptions and illustrations: See Sangalang et al. (1995),
Benyon et al. (2000) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: JX171513; rpb2: JX171626;
tef1: JABCQV010000336.
azedarachinum Fusarium (Thüm.) Sacc., Syll. Fung. 4: 704. 1886.
Basionym:Fusisporium azedarachinum Thüm., Mycoth. Univ.
14: no. 1379. 1879.
(See Fusarium lateritium)
Syntypes: In BPI, CUP, ILL, NEB, NY, NYS PH & PUL (Myco-
theca Universalis no. 1379).
Type locality:USA, South Carolina, Aiken.
Type substrate:Melia azedarach.
Note: Synonym fide Wollenweber & Reinking (1935).
azukiicola Fusarium T. Aoki et al. (as ‘azukicola’), Mycologia 104:
1075. 2012.
Neocosmospora phaseoli (Burkh.) L. Lombard & Crous, Stud.
Mycol. 80: 227. 2015.
Basionym:Fusarium martii f.phaseoli Burkh., Mem. Cornell Univ.
Agric. Exp. Sta. 26: 1007. 1919.
Synonyms:Fusarium solani f.phaseoli (Burkh.) W.C. Snyder &
H.N. Hansen, Amer. J. Bot. 28: 740. 1941.
Fusarium phaseoli (Burkh.) T. Aoki & O'Donnell, Mycologia 95:
671. 2003.
?Fusarium epimyces Cooke, Grevillea 17: 15. 1888.
?Fusarium pestis Sorauer, Atlas Pfl.-Krankh. 4: 19, pl. XXV. 1890.
?Fusarium martii var. viride Sherb., Mem. Cornell Univ. Agric.
Exp. Sta. 6: 247. 1915.
Fusarium solani var. martii Appel & Wollenw. f. 3 Snyder, Cen-
tralbl. Bakteriol. Parasitenk., 2. Abth. 91: 179. 1934.
Fusarium solani f. sp.glycines K. Roy, Pl. Dis. 81: 264. 1997.
Fusarium tucumaniae T. Aoki et al., Mycologia 95: 664. 2003.
Neocosmospora tucumaniae (T. Aoki et al.) L. Lombard & Crous,
Stud. Mycol. 80: 228. 2015.
Fusarium virguliforme O'Donnell & T. Aoki, Mycologia 95: 667.
2003.
Neocosmospora virguliformis (O'Donnell & T. Aoki)L. Lombard &
Crous, Stud. Mycol. 80: 228. 2015.
Fusarium brasiliense T. Aoki & O'Donnell, Mycoscience 46: 166.
2005.
Fusarium cuneirostrum O'Donnell & T. Aoki, Mycoscience 46:
170. 2005.
Fusarium crassistipitatum Scandiani et al., Mycoscience 53: 171.
2011.
Holotypus: BPI 881712.
Ex-type culture: MAFF 242371 = NRRL 54364.
Type locality:Japan, Hokkaido, Tokachi, Urahoro.
Type substrate: Roots of Vigna angularis.
Descriptions and illustrations: See Aoki et al. (2012b).
Diagnostic DNA barcodes:rpb1: KJ511276; rpb2: KJ511287;
tef1: JQ670137.
babinda Fusarium Summerell et al., Mycol. Res. 99: 1345. 1995.
Holotypus: DAR 70287.
Ex-type culture: BBA 69872 = F11217 = NRRL 25807.
Type locality:Australia, Queensland, Mount Lewis.
Type substrate: Plant material in soil.
Descriptions and illustrations: See Summerell et al. (1995) and
Leslie & Summerell (2006).
Diagnostic DNA barcode:rpb2: MN534245; tef1: AF160305.
Note: The Fusarium babinda species complex encompassed
strains incorrectly assigned to this taxon, based on reference
strains of F. babinda, plus one unnamed Fusarium species
(O'Donnell et al. 2013,Jacobs-Venter et al. 2019,Geiser et al.
2021). However, DNA sequences from diverse gene regions
and phylogenetic analyses made by several authors place the
ex-type of F. babinda (NRRL 25807) within the Fusarium fujikuroi
species complex, as confirmed here (Fig. 8)(O'Donnell et al.
2000b,Lima et al. 2012,Herron et al. 2015,Crous et al.
2019b). Hence, the species in FBSC need to be reassessed
and the species complex renamed accordingly.
baccharidicola Fusarium Henn., Hedwigia 48: 20. 1908.
(See Fusarium coccophilum)
Syntype: Puttemans no. 1274 in B (syntype fide Hein (1988).
Type locality:Brazil,S
~
ao Paulo, Pirutuba.
Type substrate:Baccharis dracunculifolia in association with
cochineal (Dactylopius coccus)
Note: Synonym fide Wollenweber & Reinking (1935).
bacilligerum Fusarium (Berk. & Broome) Sacc., Syll. Fung. 4:
711. 1886.
Pseudocercospora bacilligera (Berk. & Broome) Y.L. Guo &
X.J. Liu, Mycosystema 2: 229. 1989.
Basionym:Fusisporium bacilligerum Berk. & Broome, Ann. Mag.
Nat. Hist., ser. 2, 7: 178. 1851.
Synonyms:Cercospora bacilligera (Berk. & Broome) Wollenw.,
Fusaria Autogr. Delin. 1: 450. 1916.
Fusisporium erubescens Durieu & Mont., Exploration scientifique
de l'Alg
erie 1–9: 351.1848.
Fusarium erubescens (Durieu & Mont.) Sacc., Syll. Fung. 4: 719.
1886, nom. illegit., Art. 53.1.
Holotypus: ?K(M).
Type locality:UK, Wiltshire, Spye Park.
Type substrate: Leaves of Rhamnus alaternus.
Note: Synonyms fide Wollenweber & Reinking (1935).
bactridioides Fusarium Wollenw., Science, N.Y. 79: 572. 1934.
Lectotypus: NY00936830, designated in Seifert & Gr€
afenhan
(2012).
Ex-type culture: BBA 4748 = BBA 63602 = CBS 100057 = CBS
177.35 = DAOM 225115 = IMI 375323 = NRRL 22201.
Type locality:USA, Arizona, Chiricahua Mountains.
Type substrate: Parasitic on Cronartium conigenum growing on a
mummified cone of Pinus leiophylla.
Descriptions and illustrations: See Wollenweber (1934),Gerlach
& Nirenberg (1982) and Seifert & Gr€
afenhan (2012).
Diagnostic DNA barcodes:rpb1: MT010939; rpb2: MT010963;
tef1: KC514053.
bagnisianum Fusarium Thüm., Nuovo Giorn. Bot. Ital. 8: 252. 1876.
Ascochyta caricis Fuckel, Fungi Rhen. Suppl. Fasc. 2: no.
1697. 1866.
FUSARIUM REDELIMITED
www.studiesinmycology.org 89

Synonyms:Phyllosticta caricis (Fuckel) Sacc., Syll. Fung. 3: 61.
1884.
Ascochyta caricis Lambotte & Fautrey, Rev. Mycol. (Toulouse)
19: 141. 1897, nom. illegit., Art. 53.1.
Syntypes: In BPI, ILL, NEB, NY, PUL & S.
Type locality:Italy, Rome, Insugherata.
Type substrate:Spartium junceum.
Note: Synonym fide Wollenweber & Reinking (1935).
bambusae Fusarium (Teng) Z.Q. Zeng & W.Y. Zhuang,
Mycosystema 36: 279. 2017.
Basionym:Lisea australis var. bambusae Teng, Sinensia 4: 278.
1934.
Synonym:Gibberella bambusae (Teng) W.Y. Zhuang & X.M.
Zhang, Nova Hedwigia 76: 195. 2003.
Holotypus: BPI 631179.
Type locality:China, Anhui, Huang-shan.
Type substrate:Bambusoideae culm.
Descriptions and illustrations: See Zhang & Zhuang (2003) and
Zeng & Zhuang (2017a).
bambusicola Fusarium Hara, Bot. Mag. (Tokyo) 27: 255. 1913.
Holotypus: Not located.
Type locality:Japan, Tokyo.
Type substrate:Phyllostachys reticulata.
Note: Type material (specimen(s) and/or living ex-type culture)
not located.
baptisiae Fusarium Henn., Notizbl. Bot. Gart. Berlin 2: 383. 1899.
(See Fusarium dimerum)
Holotypus:InBfide Hein (1988).
Type locality:Germany, Berlin, Botanical Garden.
Type substrate:Baptisia tinctoria.
Note: Synonym fide Wollenweber & Reinking (1935).
barbatum Fusarium Ellis & Everh., J. Mycol. 4: 45. 1888.
Raffaelea barbata (Ellis & Everh.) D. Hawksw. (as ‘barbatum'’),
Bull. Brit. Mus. (Nat. Hist.), Bot. 6: 272. 1979.
Holotypus: NY00928690.
Type locality:USA, New Jersey, Newfield.
Type substrate:Usnea barbata.
bartholomaei Fusarium Peck, Bull. Torrey Bot. Club 36: 157.
1909.
Septogloeum bartholomaei (Peck) Wollenw., Fusaria Autogr.
Delin. 2: 638. 1924.
Synonym:Trichofusarium bartholomaei (Peck) Sacc., Syll. Fung.
22: 1473. 1913.
Holotypus: NYS-F-000437.
Type locality:USA, Kansas, Stockton.
Type substrate:Sorghastrum nutans.
Note: Synonym fide Wollenweber & Reinking (1935).
batatas Fusarium Wollenw. (as ‘batatae’), J. Agric. Res. 2: 268.
1914.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000660): USA, Washington,
Ipomoea batatas, 1914, L.L. Harter & E.C. Field, in Wollenweber,
J. Agric. Res. 2: 268, pl. XVI, figs A–E.
Notes: Synonym fide Wollenweber & Reinking (1935).As
no holotype specimen could be located, an illustration accom-
panying the original protologue is designated here as lectotype.
bataticola Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index
Fungorum 440: 1. 2020.
Neocosmospora bataticola Sand.-Den. & Crous, Persoonia 43:
112. 2019.
Synonym:?Fusarium solani f. batatas T.T. McClure, Phytopa-
thology 41: 75. 1951, nom. inval., Art. 39.1.
Holotypus: CBS H-23971.
Ex-type culture: BBA 64954 = CBS 144398 = FRC S-
0567 = NRRL 22402.
Type locality:USA, North Carolina.
Type substrate:Ipomoea batatas.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218100; rpb2: FJ240381;
tef1: AF178344.
begoniae Fusarium Nirenberg & O'Donnell, Mycologia 90: 437.
1998.
Holotypus: B 70 0001694.
Ex-type culture: BBA 67781 = CBS 403.97 = IMI 375315 = NRRL
25300.
Type locality:Germany.
Type substrate:Begonia elatior.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998)
and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: JAAOAG010000375; rpb2:
MN193886; tef1: AF160293.
beomiforme Fusarium P.E. Nelson et al., Mycologia 79: 886.
1987.
Holotypus: DAOM 196987.
Ex-type culture: CBS 100160 = DAR 58880 = FRC M-1425 = IMI
316127 = MRC 4593 = NRRL 13606.
Type locality:Australia, Queensland, Rockhampton.
Type substrate: Soil.
Descriptions and illustrations: See Nelson et al. (1987) and Leslie
& Summerell (2006).
Diagnostic DNA barcodes:rpb1: MF120485; rpb2: MF120496;
tef1: MF120507.
berenice Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4:
721. 1886.
Ascocalyx berenice (Berk. & M.A. Curtis) Baschien, IMA
Fungus 5: 93. 2014.
Basionym:Fusisporium berenice Berk. & M.A. Curtis, in Ber-
keley, Grevillea 3: 147. 1875.
Synonyms:Bothrodiscus berenice (Berk. & M.A. Curtis) J.W.
Groves, Canad. J. Bot. 46: 1273. 1968.
Holotypus: ?K(M).
Type locality:USA, Massachusetts, Boston, Murray.
Type substrate:Peziza sp.
berkeleyi Fusarium (Mont.) Berk. & Broome, North Amer. Fung.:
108. 1875.
Basionym:Gloeosporium berkeleyi Mont., Ann. Sci. Nat., Bot.,
s
er. 3, 12: 296. 1849.
(See Fusarium lateritium)
Holotypus: Not located.
Type locality:USA, Alabama.
Type substrate: Leaves of Hibiscus syriacus.
Note: Synonym fide Wollenweber & Reinking (1935).
betae Fusarium (Desm.) Sacc., Michelia 2: 132. 1880.
Fusicolla betae (Desm.) Bonord., Handb. Mykol.: 150. 1851.
Basionym:Fusisporium betae Desm., Ann. Sci. Nat., Bot., S
er. 1,
19: 436. 1830.
CROUS ET AL.
90

Synonyms:Pionnotes betae (Desm.) Sacc., Syll. Fung. 4: 726.
1886.
Pionnotes rhizophila var. betae (Desm.) De Wild. & Durieu,
Prodr. Fl. Belg. 2: 367. 1898.
Lectotypus: K(M) 167520, designated in Gr€
afenhan et al. 2011.
Lectotype locality:France.
Lectotype substrate: Tuber of Beta vulgaris.
Epitypus: BBA 64317, designated in Gr€
afenhan et al. 2011.
Ex-epitype culture: BBA 64317.
Epitype locality:Germany, Schleswig-Holstein, Kiel.
Epitype substrate:Triticum aestivum.
Descriptions and illustrations: See Gr€
afenhan et al. (2011).
Diagnostic DNA barcodes:rpb2: HQ897781.
beticola Fusarium A.B. Frank, Kampfbuch gegen die Sch€
adlinge
unserer Feldfrüchte: 137. 1897.
(See Fusarium oxysporum)
Holotypus: ?NY.
Type locality:Germany.
Type substrate:Beta sp.
Note: Synonym fide Wollenweber & Reinking (1935).
biasolettianum Fusarium Corda, Icon. Fung. 2: 3. 1838.
(See Fusarium merismoides)
Typus: PRM 155487.
Type locality:Czech Republic, near Prague.
Type substrate: Young stalks of Betula sp.
Notes: Synonym fide Wollenweber & Reinking (1935). Synon-
ymy under Fusicolla merismoides still questionable (See
Gr€
afenhan et al. 2011). Lectotypification pending study of ma-
terial lodged in PRM.
bicellulare Fusarium Kirschst., Hedwigia 80: 136. 1941.
(See Fusarium aquaeductuum)
Holotypus: B 70 0100184.
Type locality:Germany.
Type substrate: Parasitic on Cryptosporella hypodermia with
Nectria episphaeria.
Note: Synonym fide Wollenweber & Reinking (1935).
biforme Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6:
166. 1915.
(See Fusarium avenaceum)
Lectotypus (hic designatus, MBT 10000661): USA, Wisconsin,
rotten tubers of Solanum tuberosum, date unknown, C.D.
Sherbakoff, in Mem. Cornell Univ. Agric. Exp. Sta. 6: 166, fig. 17
(1915).
Notes: Synonym fide Wollenweber & Reinking (1935).Asno
holotype specimen could be located, an illustration accompa-
nying the original protologue is designated here as lectotype.
bipunctatum Fusarium Preuss, Linnaea 25: 741. 1852.
(See Fusarium tortuosum)
Holotypus: ?B.
Type locality:Germany.
Type substrate: Branches of unknown tree.
Note: Synonym fide Wollenweber & Reinking (1935).
biseptatum Fusarium Sawada, Special Publ. Coll. Agric. Natl.
Taiwan Univ. 8: 228. 1959, nom. inval., Art. 39.1.
Authentic material: Not located.
Original locality:Taiwan.
Original substrate: Leaves of Stephania cepharantha.
biseptatum Fusarium Schroers et al., Mycologia 101: 59. 2009.
(non Fusarium biseptatum Sawada 1959).
Bisifusarium biseptatum (Schroers et al.) L. Lombard & Crous,
Stud. Mycol. 80: 224. 2015.
Holotypus: CBS H-20126.
Ex-type culture: CBS 110311 = FRC E-0228 = NRRL 36184.
Type locality:South Africa, Transkei.
Type substrate: Soil.
Descriptions and illustrations: See Schroers et al. (2009).
Diagnostic DNA barcode:tef1: EU926319.
blackmannii Fusarium W. Br. & A.S. Horne (as ‘blackmanni'’),
Ann. Bot. (London) 38: 379. 1924.
(See Fusarium lateritium)
Notes: Name withdrawn by original author (W. Brown),
See Brown (1928). Synonym fide Wollenweber & Reinking
(1935).
blasticola Fusarium Rostr. (as ‘blasticolum’), Gartn.-Tidende
1895: 122. 1895.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:Germany.
Type substrate:Pinus sylvestris.
Note: Synonym fide Wollenweber & Reinking (1935).
bomiense Fusarium (Z.Q. Zeng & W.Y. Zhuang) O'Donnell et al.,
Index Fungorum 440: 1. 2020.
Neocosmospora bomiensis Z.Q. Zeng & W.Y. Zhuang, Phy-
totaxa 319: 177. 2017.
Holotypus: HMAS 254519.
Ex-type culture: HMAS 248885.
Type locality:China, Tibet Autonomous Region, Bom^
e County.
Type substrate: Twigs.
Descriptions and illustrations: See Zeng & Zhuang (2017b).
Diagnostic DNA barcode:tef1: KY829449.
bonordenii Fusarium Sacc., Syll. Fung. 4: 699. 1886.
Replaced synonym:Selenosporium aurantiacum Bonord., Abh.
Naturf. Ges. Halle 8: 97. 1864, nom. illegit., Art. 53.1, non
Fusarium aurantiacum Corda 1829.
(See Fusarium dimerum)
Holotypus: Not preserved fide Holubov
a-Jechov
aet al. (1994).
Type locality:Germany.
Type substrate: Branches of unknown tree.
Note: Synonym fide Wollenweber & Reinking (1935).
boothii Fusarium O'Donnell et al., Fungal Genet. Biol. 41: 618.
2004.
Holotypus: BPI 843475.
Ex-type culture: CBS 316.73 = IMI 160243 = NRRL 26916.
Type locality:South Africa.
Type substrate:Zea mays.
Descriptions and illustrations: See O'Donnell et al. (2004).
Diagnostic DNA barcodes:rpb1: KM361641; rpb2: KM361659;
tef1: GQ915503.
borneense Fusarium (Petr.) O'Donnell et al., Index Fungorum
440: 1. 2020.
Neocosmospora borneensis (Petr.) Sand.-Den. & Crous,
Persoonia 43: 115. 2019.
Basionym:Nectria borneensis Petr., Sydowia 8: 20. 1954.
Holotypus: K(M) 252860.
Epitypus: CBS H-23972, designated in Sandoval-Denis et al. (2019).
FUSARIUM REDELIMITED
www.studiesinmycology.org 91

Ex-epitype culture: BBA 65095 = CBS 145462 = G.J.S. 85-
197 = NRRL 22579.
Epitype locality:Indonesia, North Sulawesi, Bogani Nani War-
tabone National Park.
Epitype substrate: Bark of a recently dead unidentified tree.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834213; rpb2: FJ240381;
tef1: AF178344.
bostrycoides Fusarium Wollenw. & Reinking, Phytopathology 15:
166. 1925.
Neocosmospora bostrycoides (Wollenw. & Reinking) Sand.-
Den. et al., Persoonia 43: 115. 2019.
Neotypus: CBS H-23973, designated in Sandoval-Denis et al.
(2019).
Ex-neotype culture: CBS 144.25.
Neotype locality:Honduras, Tela.
Neotype substrate: Soil.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218101; rpb2: LR583818;
tef1: LR583597.
brachiariae Fusarium M.M. Costa et al., Mycol. Progr. 20: 67.
2021.
Holotypus: UB 24188.
Ex-type culture: CML 3032.
Type locality:Brazil, Mato Grosso do Sul, Campo Grande.
Type substrate: Seed of Brachiaria decumbens.
Descriptions and illustrations: See Costa et al. (2021).
Diagnostic DNA barcodes:rpb2: MT901314; tef1: MT901348.
brachygibbosum Fusarium Padwick, Mycol. Pap. 12: 11. 1945.
Holotypus: IMI 268019.
Ex-type culture: BBA 64691 = NRRL 20954.
Type locality:India, Telangana, Hyderabad, Parbhani.
Type substrate:Sorghum vulgare.
Descriptions and illustrations: See Padwick (1945).
Diagnostic DNA barcodes:rpb1: MW233246; rpb2: MW233418;
tef1: MW233075.
brasilicum Fusarium T. Aoki et al., Fungal Genet. Biol. 41: 620.
2004.
Holotypus: BPI 843480.
Ex-type culture: CBS 119180 = NRRL 31281.
Type locality:Brazil.
Type substrate:Avena sativa.
Descriptions and illustrations: See O'Donnell et al. (2004).
Diagnostic DNA barcodes:rpb1: JABCJS010000032; rpb2:
JABCJS010000357; tef1: AY452964.
brasiliense Fusarium T. Aoki & O'Donnell, Mycoscience 46: 166.
2005.
(See Fusarium azukiicola)
Holotypus: BPI 843352.
Ex-type culture: MAFF 239050 = NRRL 31757.
Type locality:Brazil, Districto Federal, Brasilia.
Type substrate:Glycines max.
Descriptions and illustrations: See Aoki et al. (2005).
Diagnostic DNA barcodes:rpb1: MAEC01003448; rpb2:
EU329565; tef1: MAEC01004196.
brassicae Fusarium Lib. ex Cooke, Grevillea 8: 83. 1880.
(See Fusarium candidum Ehrenb.)
Holotypus: In B, Libert s.n. fide Index Fungorum.
Type locality:France.
Type substrate: Stem of Brassica oleracea.
Note: Synonym fide Wollenweber & Reinking (1935).
brassicae Fusarium (Thüm.) Sacc., Syll. Fung. 4: 701. 1886,
nom. illegit., Art. 53.1.
Basionym:Selenosporium brassicae Thüm., Hedwigia 19: 191.
1880.
(See Fusarium avenaceum)
Holotypus: Not located.
Type locality:Belgium.
Type substrate: Stem of Brassica oleracea.
Note: Synonym fide Wollenweber & Reinking (1935).
breve Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index
Fungorum 440: 1. 2020.
Neocosmospora brevis Sand.-Den. & Crous, Persoonia 43:
119. 2019.
Holotypus: CBS H-23975.
Ex-type culture: CBS 144387 = MUCL 16108.
Type locality:Belgium, Heverlee.
Type substrate: Soil-water polluted with diethylene glycerol and
ethylene glycerol.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834214; rpb2: LR583822;
tef1: LR583601.
brevicatenulatum Fusarium Nirenberg et al., Mycologia 90:
460. 1998.
Holotypus: Specimen in B fide Nirenberg et al. (1998).
Ex-type culture: BBA 69197 = CBS 404.97 = DAOM 225122= IMI
375329 = NRRL 25446.
Type locality:Madagascar.
Type substrate:Striga asiatica.
Descriptions and illustrations: See Nirenberg et al. (1998) and
Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: MT010948; rpb2: MT010979;
tef1: MT011005.
brevicaudatum Fusarium J.W. Xia et al., Persoonia 43: 195.
2019.
Holotypus: CBS H-24051.
Ex-type culture: NRRL 43638 = UTHSC R-3500.
Type locality:USA, Florida.
Type substrate:Trichechus sp. (manatee).
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb1: KC808322; rpb2: GQ505843;
tef1: GQ505665.
breviconum Fusarium (Wollenw.) O'Donnell et al., Index Fun-
gorum 440: 1. 2020.
Neocosmospora brevicona (Wollenw.) Sand.-Den. & Crous,
Persoonia 43: 117. 2019.
Basionym:Hypomyces haematococcus var. breviconus Wol-
lenw., Fusaria Autogr. Delin. 3: no. 828 (1930).
Synonyms:Fusarium solani var. minus Wollenw., Fusarien: 134.
1935.
Nectria haematococca var. brevicona (Wollenw.) Gerlach,
Fusarium: Diseases, Biology, and Taxonomy (Philadelphia): 422.
1981.
Lectotypus: Fig. 828 in Wollenweber (1930), designated in
Sandoval-Denis et al. (2019).
Epitypus: CBS H-23974 designated in Sandoval-Denis et al.
(2019).
CROUS ET AL.
92

Ex-epitype culture: BBA 2123 = CBS 204.31 = NRRL 22659.
Epitype locality:Indonesia, West Java, Bogor.
Epitype substrate:Gladiolus sp.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218103; rpb2: LR583821;
tef1: LR583600.
briosianum Fusarium Ferraris, Fl. Ital. Crypt. Hyphales, Fasc. 13:
857. 1914.
(See Fusarium lateritium)
Holotypus: Not located.
Type locality:Italy, Pavia.
Type substrate: Branches of Styphnolobium japonicum (syn.
Sophora japonica).
Note: Synonym fide Wollenweber & Reinking (1935).
bubalinum Fusarium J.W. Xia et al., Persoonia 43: 195. 2019
Holotypus: CBS H-24052.
Ex-type culture: CBS 161.25 = NRRL 26857 = NRRL 26918.
Type locality:Australia.
Type substrate: Unknown.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170381; tef1: MN170448.
bufonicola Fusarium (Speg.) Sacc. & Trotter, Syll. Fung. 22:
1486. 1913.
(See Fusarium graminearum)
Basionym:Selenosporium bufonicola Speg., Anales Mus. Nac.
Buenos Aires, ser. 3, 13: 458. 1910.
Holotypus: In LPS (Myc. Argent. ser. 5, no. 1166) fide Farr
(1973).
Type locality:Argentina, Buenos Aires.
Type substrate: Decaying body of Amphibia (toad).
Note: Synonym fide Wollenweber & Reinking (1935).
bugnicourtii Fusarium Brayford, Trans. Brit. Mycol. Soc. 89: 350.
1987.
(See Fusarium ambrosium)
Synonym:Fusarium tumidum var. coeruleum Bugnic., Encycl.
Mycol. 11: 83. 1939.
Holotypus: IMI 296597.
Ex-type culture: IMI 296597 = NRRL 20438 = MAFF 246291.
Type locality:India, Chinchona.
Type substrate:Euwallacea fornicatus on Camellia sinensis.
Descriptions and illustrations: See Brayford (1987).
Diagnostic DNA barcodes:rpb1: JX171470; rpb2: JX171584;
tef1: AF178332.
buharicum Fusarium Jacz. ex Babajan & Teterevn.-Babajan,
Mater. Mikol. Fitopatol. 8: 216. 1929.
Holotypus: LEP 127667.
Epitypus (hic designatus, MBT 10000662): Uzbekistan, Tash-
kent, on Gossypium herbaceum, 1928, A.I. Raillo, CBS 178.35
(preserved as metabolically inactive culture).
Ex-epitype culture: CBS 178.35 = DSM 62166 = NRRL 25488.
Descriptions and illustrations: See Gerlach & Nirenberg (1982).
Diagnostic DNA barcodes:rpb1: KX302920; rpb2: KX302928;
tef1: KX302912.
Notes:Gerlach & Nirenberg (1982) designated CBS 178.35 as
neotype of F. buharicum as they were unable to locate
the type specimen. However, A. Jaczweski did place a
specimen in LEP. Therefore, the neotype designation is su-
perseded here (Art. 9.13) and CBS 178.35 is retained as
epitype for this species.
bulbicola Fusarium Nirenberg & O'Donnell, Mycologia 90: 452.
1998.
Replaced synonym:Fusarium sacchari var. elongatum Niren-
berg, Mitt. Biol. Bundesanst. Land- Forstw. Berlin-Dahlem 169:
59. 1976, non Fusarium elongatum Reinking 1934.
Holotypus: IMI 202877.
Ex-type culture: BBA 63628 = CBS 220.76 = DAOM
225114 = IMI 375322 = NRRL 13618.
Type locality:Germany.
Type substrate:Haemanthus sp.
Descriptions and illustrations: See Nirenberg (1976),Nirenberg &
O'Donnell (1998) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: KF466394; rpb2: KF466404;
tef1: AF160294.
bulbigenum Fusarium Cooke & Massee, Grevillea 16: 49. 1887.
(See Fusarium oxysporum)
Holotypus: ?K(M).
Type locality:UK.
Type substrate:Narcissus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
bullatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6:
198. 1915.
(See Fusarium equiseti)
Typus: CUP-007455.
Type locality:USA, Iowa.
Type substrate: Rotten tuber of Solanum tuberosum. Lectotypi-
fication pending study of material lodged in CUP.
burgessii Fusarium M.H. Laurence et al., Fungal Diversity 49:
109. 2011.
Holotypus: CBS 125537 (preserved as metabolically inactive
culture).
Ex-type culture: CBS 125537 = NRRL 66654 = RBG 5315.
Type locality:Australia, Queensland, Idalia National Park.
Type substrate: Soil.
Descriptions and illustrations: See Laurence et al. (2011).
Diagnostic DNA barcodes:rpb1: MT409440; rpb2: HQ646393;
tef1: HQ667148.
butleri Fusarium Wollenw., Phytopathology 3: 38. 1913, nom.
illegit., Art. 52.1.
(See Fusarium udum)
Authentic material: ?B.
Original locality:India.
Original substrate:Cajanus cajan.
Note: Synonym fide Wollenweber & Reinking (1935).
butleri Fusarium Kr.P. Singh & Edward, Allahabad Farmer 49: 94.
1979, nom. illegit., Art. 53.1, non Fusarium butleri Wollenw. 1913.
Synonym:Gibberella butleri Kr.P. Singh & Edward, Allahabad
Farmer 49: 92. 1979.
Authentic material: Not located.
Original locality:India.
Original substrate:Cajanus cajan.
Notes: Status unclear. No further records available for this taxon.
buxi Fusarium Spreng., Syst. Veg., ed. 16, 4: 565. 1827.
Pseudonectria buxi (DC.) Seifert et al., Stud. Mycol. 68: 107.
2011.
Basionym:Tubercularia buxi DC., Fl. Franç., ed. 3, 5/6: 110.
1815.
Synonyms:Fusisporium buxi (DC.) Fr., Syst. Mycol. 3: 447.
1832, nom. sanct. [Fr., l.c.]
FUSARIUM REDELIMITED
www.studiesinmycology.org 93

Psilonia buxi (DC.) Fr., Syst. Mycol. 3: 447. 1832, nom. inval.,
Art. 36.1(c).
Chaetostroma buxi (DC.) Corda, Icon. Fung. 2: 31. 1838.
Volutella buxi (DC.) Berk. & Broome, Ann. Mag. Nat. Hist., ser. 2,
5: 465. 1850.
Chaetodochium buxi (DC.) Höhn., Mitt. Bot. Inst. T. H. Wien 9:
45. 1932.
Nectria rousseliana Mont., Ann. Sci. Nat., Bot., s
er. 3, 16: 44.
1851.
Stigmatea rousseliana (Mont.) Fuckel, Jahrb. Nassauischen
Vereins Naturk. 23–24: 97. 1870.
Nectriella rousseliana (Mont.) Sacc., Syll. Fung. 2: 452. 1883.
Lasionectria rousseliana (Mont.) Cooke (as ‘rousselliana’), Gre-
villea 12: 111. 1884.
Pseudonectria rousseliana (Mont.) Wollenw., Z. Parasitenk.
(Berlin) 3: 489. 1931.
Notarisiella rousseliana (Mont.) Clem. & Shear, The genera of
Fungi: 280. 1931.
Nectria rousseliana var. viridis Berk. & Broome, Ann. Mag. Nat.
Hist., ser. 3, 3: 376. 1859.
Volutella buxi f. rusci Sacc., Michelia 2: 644. 1882.
Holotypus: ?PC.
Type locality:?Germany/France.
Type substrate: Leaf of Buxus sp.
buxicola Fusarium Sacc., Syll. Fung. 2: 518. 1883.
Cyanonectria buxi (Fuckel) Schroers et al., Stud. Mycol. 68:
120. 2011.
Basionym:Gibbera buxi Fuckel, Jahrb. Nassauischen Vereins
Naturk. 27–28: 32. 1874.
Synonyms:Lisea buxi (Fuckel) Sacc., Syll. Fung. 2: 518. 1883.
Gibberella buxi (Fuckel) Cooke, Grevillea 12: 112. 1884.
Fusarium subcorticale Oudem., Ned. Kruidk. Arch., s
er. 3, 3:
135. 1898.
Fusarium dimorphum J.V. Almeida & Sousa da C^
amara, Revista
Agron. (Lisbon) 1: 306. 1903.
Fusarium buxicola var. chlamydosporum Batikyan (as ‘chlamy-
dosporeae’), Biol. Zhurn. Armenii 22: 90. 1969.
Fusarium lateritium var. buxi C. Booth, The Genus Fusarium:
113. 1971.
Lectotypus: G 00111019, selected in Schroers et al. (2011).
Epitypus: CBS H-20379, designated in Schroers et al. (2011).
Ex-epitype culture: CBS 125551.
Epitype locality:Slovenia, Arboretum Vol
cji Potok.
Epitype substrate: Decaying twig of Buxus sempervirens var.
elegantissima.
Descriptions and illustrations: See Schroers et al. (2011).
Diagnostic DNA barcodes:rpb2: HM626689; tef1: HM626648.
byssinum Fusarium McAlpine, Proc. Linn. Soc. New South
Wales 22: 698. 1897.
Holotypus: VPRI 2556.
Type locality:Australia, New South Wales, Murwillumbah.
Type substrate:Desmodium sp.
Notes: Status unclear. This species was considered a member of
Diymopsis by Saccardo (1899);Hymenula by Wollenweber &
Reinking (1935); and Aschersonia by Walker (1962), who
examined the type specimen and found that the fungus occurred
in association with a scale insect on Desmodium. It is likely that
this species belongs in Microcera, which are usually parasites of
scale insects.
caapi Fusarium M.M. Costa et al., Mycol. Progr. 20: 67. 2021.
Holotypus: UB 24189.
Ex-type culture: CML 3657.
Type locality:Brazil,S
~
ao Paulo, Guaíra.
Type substrate:Brachiaria brizantha.
Descriptions and illustrations: See Costa et al. (2021).
Diagnostic DNA barcodes:rpb2: MT901316; tef1: MT901350.
caatingaense Fusarium A.C.S. Santos et al., Mycologia 111:
248. 2019.
Holotypus: URM 91192.
Ex-type culture: MUM 1859 = URM 6779.
Type locality:Brazil, Pernambuco, Ibimirim.
Type substrate:Dactylopius opuntiae.
Descriptions and illustrations: See Santos et al. (2019).
Diagnostic DNA barcodes:rpb2: LS398495; tef1: LS398466.
cactacearum Fusarium Pasin. & Buzz.-Trav., Nuovo Giorn. Bot.
Ital. 42: 120. 1935.
Lectotypus (hic designatus, MBT 10000663): Italy, Milan, The-
locactus nidulans, 1935, L. Pasinetti & A. Buzzati-Traverso, in
Nuovo Giorn. Bot. Ital. 42: Pl. I, fig. 1.
Descriptions and illustrations: See Pasinetti & Buzzati-Traverso
(1935).
Notes: Based on illustrations by Pasinetti & Buzzati-Traverso
(1935), this species could be a synonym of Neocosmospora
solani but requires further investigation. No holotype specimen
could be located and therefore an illustration is designated as
lectotype.
cacti-maxonii Fusarium Pasin. & Buzz.-Trav., Nuovo Giorn.
Bot. Ital. 42: 120. 1935.
Lectotypus (hic designatus, MBT 10000664): Italy, Milan, Cactus
maxonii, 1935, L. Pasinetti & A. Buzzati-Traverso, in Nuovo
Giorn. Bot. Ital. 42: Pl. I, fig. 4.
Descriptions and illustrations: See Pasinetti & Buzzati-Traverso
(1935).
Notes: Based on illustrations by Pasinetti & Buzzati-Traverso
(1935), this species could be a synonym of Fusarium oxy-
sporum but requires further investigation. No holotype specimen
could be located and therefore an illustration is designated as
lectotype.
caeruleum Fusarium Lib. ex Sacc. (as ‘c
æ
ruleum’), Syll. Fung. 4:
705. 1886.
Synonyms:Fusarium solani var. caeruleum (Lib. ex Sacc.) Bilaĭ,
Fusarii (Biologija i sistematika): 287. 1955, nom. inval., Art. 41.5.
Fusarium solani var. caeruleum (Lib. ex Sacc.) C. Booth, The
Genus Fusarium: 51. 1971.
?Fusarium violaceum Fuckel, Fungi Rhen. Exs., Fasc. 3: no.
209. 1863.
Fusarium aeruginosum Delacr., Bull. Soc. Mycol. France 7: 110.
1891.
Selenosporium caeruleum Lib., 1834. (in herb.; nom. inval., Art.
38.1a).
Fusarium caeruleum var. cellulosae Sartory et al., Papier 38: 43.
1935.
?Hypomyces asclepiadis Zerova, Zhurn. Inst. Bot. Vseukraïns'k.
Akad. Nauk 11: 103. 1937.
Holotypus: BR5020140171069.
Type locality:Belgium.
Type substrate:Solanum tuberosum.
Notes: Status doubtful. See Sandoval-Denis et al. (2019).
calcareum Fusarium (Thüm.) Sacc., Syll. Fung. 4: 712. 1886.
CROUS ET AL.
94

(See Fusarium oxysporum)
Basionym:Fusisporium calcareum Thüm., Inst. Coimbra 28: 262.
1881.
Holotypus: S-F45605.
Type locality:Portugal, Coimbra.
Type substrate:Lagenaria vulgaris.
Note: Synonym fide Wollenweber & Reinking (1935).
?calidariorum Fusarium Sacc., Ann. Mycol. 4: 274. 1906.
Colletotrichum anthurii Delacr., Bull. Soc. Mycol. France 13:
110. 1897.
Synonyms:Fusoma calidariorum Sacc., Ann. Mycol. 4: 274.
1906.
Fusoma calidariorum var. acanthi Lindegg, Riv. Patol. Veg. 25:
233. 1935.
Holotypus: In PAD.
Type locality:Italy, Padua, botanical garden.
Type substrate:Anthurium scherzerianum.
Notes: Synonym fide Wollenweber & Reinking (1935). No record
could be located for the transfer of this epithet to the genus
Fusarium.InSaccardo (1906) on p. 274, no new combination is
provided and only the new name Fusoma calidariorum was
introduced. Similarly, Lindegg (1935) introduced a new variety as
Fusoma calidariorum var. acanthi, not in the genus Fusarium.
Although Wollenweber & Reinking (1935) did treat this as
Fusoma,Booth (1971) incorrectly treated the variety acanthi in
the genus Fusarium.
callistephi Fusarium L. Lombard & Crous, Persoonia 43: 15.
2018 [2019].
Holotypus: CBS H-23608.
Ex-type culture: CBS 187.53 = NRRL 36330.
Type locality:Netherlands, Oostenbrink.
Type substrate:Callistephus chinensis.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb2: MH484875; tef1: MH484966.
callosporum Fusarium Pat., Bull. Soc. Mycol. France 9: 164.
1893.
(See Fusarium coccophilum)
Holotypus: Not located.
Type locality:Ecuador, Quito.
Type substrate: Parasitic on Septobasidium pedicellatum.
Note: Synonym fide Wollenweber & Reinking (1935).
camerunense Fusarium Henn., Bot. Jahrb. Syst. 22: 81. 1895.
Gloeosporium camerunense (Henn.) Wollenw., Fusaria
Autogr. Delin. 1: 499. 1916.
Holotypus:InBfide Hein (1988).
Type locality:Cameroon, Itoki.
Type substrate: Bark of unknown tree.
Note: Synonym fide Wollenweber & Reinking (1935).
camptoceras Fusarium Wollenw. & Reinking, Phytopathology
15: 158. 1925.
Neotypus: CBS H-24077, designated in Xia et al. (2019).
Ex-neotype culture: ATCC 16065 = ATCC 24364 = BBA
9810 = CBS 193.65 = DSM 62167 = IMI 112500 = NRRL
20716 = NRRL 36344.
Neotype locality:Costa Rica.
Neotype substrate: Cushion gall of Theobroma cacao.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971),Gerlach & Nirenberg (1982),Marasas
et al. (1998) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: MW928800; rpb2: MN170383;
tef1: MN170450.
campylopodii Fusarium Weir, Mycologia 60: 374. 1968, nom.
inval., Art. 38.1(a).
Authentic material: Not located.
Original locality:USA, Washington.
Original substrate:Arceuthobium sp.
Note: The name is mentioned but neither a diagnosis nor a
description was provided.
candidulum Fusarium Sacc., Ann. Mycol. 6: 567. 1908.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:Mexico.
Type substrate:Myrtillocactus geometrizans.
Note: Synonym fide Wollenweber & Reinking (1935).
candidum Fusarium Ehrenb., Sylv. Mycol. Berol.: 24. 1818.
Neonectria candida (Ehrenb.) Rossman et al., Stud. Mycol. 80:
217. 2015.
Synonyms:Ramularia candida (Ehrenb.) Wollenw., Phytopa-
thology 1: 220. 1913.
Cylindrocarpon ehrenbergii Wollenw., Fusaria Autogr. Delin. 1:
461. 1916.
Sclerotium castaneum Lib., in herb. 1832, nom. nud.
Fusarium castaneum Lindau (as “(Lib.) Lindau”), Rabenh. Krypt.-
Fl. 1(9): 556. 1909.
?Fusidium candidum Willk., Die mikroskopischen Feinde des
Waldes 1: 103. 1866, nom. illegit., Art. 53.1.
?Fusarium candidum Sacc. & D. Sacc., Syll. Fung. 18: 674.
1906, nom. illegit., Art. 53.1.
?Fusarium candidum Dasz., Bull. Soc. Bot. Gen
eve, 2 s
er. 4:
293. 1913, nom. illegit., Art. 53.1.
Fusarium brassicae Lib. ex Cooke, Grevillea 8: 83. 1880.
Selenosporium brassicae Thüm., Hedwigia 19: 191. 1880.
Fusarium brassicae (Thüm.) Sacc., Syll. Fung. 4: 701. 1886,
nom. illegit., Art. 53.1.
Fusarium obtusiusculum Sacc., Michelia 2: 297. 1881.
Fusarium rhizogenum Pound & Clem., Bot. Surv. Nebraska 3:
12. 1894.
Fusarium oxysporum var. obtusiusculum (Sacc.) Cif., Ann. Bot.
(Rome) 16: 221. 1924.
Cylindrocarpon obtusiusculum (Sacc.) U. Braun, Cryptog. Bot. 4:
113. 1993.
Fusarium eichleri Bres., Ann. Mycol. 1: 130. 1903.
Neonectria ramulariae Wollenw., Ann. Mycol. 15: 52. 1917.
Nectria ramulariae (Wollenw.) E. Müll., Beitr. Kryptogamenfl.
Schweiz 11: 634. 1962.
Cylindrocarpon magnusianum Wollenw., Z. Parasitenk. (Berlin)
1: 172. 1928.
Holotypus: Not located.
Type locality:Germany, Berlin.
Type substrate: Unknown.
candidum Fusarium (Link) Sacc., Syll. Fung. 4: 720. 1886, nom.
illegit., Art. 53.1.
Neonectria ditissima (Tul. & C. Tul.) Samuels & Rossman, CBS
Biodiversity Ser. 4: 134. 2006.
Basionym:Nectria ditissima Tul. & C. Tul., Select. Fung. Carpol.
3: 73. 1865.
Synonyms:Cucurbitaria ditissima (Tul. & C. Tul.) Kuntze, Revis.
Gen. Pl. 3: 461. 1898.
FUSARIUM REDELIMITED
www.studiesinmycology.org 95

Fusidium candidum Link, Mag. Neuesten Entdeck. Gesammten
Naturk. Ges. Naturf. Freunde Berlin 3: 8. 1809, nom. sanct. [Fr.,
Syst. Mycol. 3: 481. 1832].
Cylindrocarpon candidum (Link) Wollenw., Fusaria Autogr. Delin.
1: 476. 1916.
?Fusisporium cylindricum Mont., Ann. Sci. Nat., Bot., s
er. 2, 17:
120. 1842.
?Fusarium cylindricum (Mont.) Sacc., Syll. Fung. 4: 720. 1886.
Fusarium fissum Peyl, Lotos 8: 30. 1858.
?Fusarium heteronemum Berk. & Broome (as ‘heteronema'’),
Ann. Mag. Nat. Hist., Ser. 3, 15: 402. 1865.
?Cylindrocarpon heteronema (Berk. & Broome) Wollenw. (as
‘heteronemum’), Fusaria Autogr. Delin. 1: 460. 1916.
?Ramularia heteronema (Berk. & Broome) Wollenw. (as ‘heter-
onemum'’), Fusaria Autogr. Delin. 1: 460. 1916.
Fusarium ulmi P. Crouan & H. Crouan, Fl. Finist
ere: 14. 1867.
Fusarium fragrans P. Crouan & H. Crouan, Fl. Finist
ere: 14.
1867.
Fusarium decipiens Cooke & Massee, in Cooke, Handb. Austral.
Fungi: 388. 1892, nom. inval., Art. 39.1.
Fusarium mali Allesch., Ber. Bot. Vereines Landshut 12: 130.
1892.
Fusarium sarcochroum f. mali (Allesch.) Ferraris, 1910.
Cylindrocarpon mali (Allesch.) Wollenw., Phytopathology 18:
225. 1928.
Sporotrichum amenti P. Karst., Hedwigia 31: 296. 1892.
Fusarium fractum Sacc. & Cavara, Nuovo Giorn. Bot. Ital., n.s. 7:
308. 1900.
Cylindrocarpon fractum (Sacc. & Cavara) Wollenw., Fusaria
Autogr. Delin. 2: 655. 1924.
Nectria galligena Bres., in Strasser, Verh. K. K. Zool.-Bot. Ges.
Wien 51: 413. 1901.
Dialonectria galligena (Bres.) Petch ex E.W. Mason & Grainger,
Cat. Yorkshire Fung.: 32. 1937.
Neonectria galligena (Bres.) Rossman & Samuels, Stud. Mycol.
42: 159. 1999.
Fusarium prunorum McAlpine, Fungus Diseases of stone-fruit
trees in Australia: 91. 1902.
Fusarium willkommii Lindau, Rabenh. Krypt.-Fl. ed. 2, 1(9): 551.
1909.
Cylindrocarpon willkommii (Lindau) Wollenw., Z. Parasitenk.
(Berlin) 1: 150. 1928.
Fusarium luteum Parav., Ann. Mycol. 16: 302. 1918, nom. illegit.,
Art. 53.1.
Nectria ditissima var. arctica Wollenw., Angew. Bot. 8: 189. 1926.
Cylindrocarpon candidum var. medium Wollenw., Z. Parasitenk.
(Berlin) 1: 158. 1928.
Cylindrocarpon candidum var. majus Wollenw., Z. Parasitenk.
(Berlin) 1: 158. 1928.
Cylindrocarpon candidum var. minus Wollenw., Z. Parasitenk.
(Berlin) 1: 155. 1928.
Cylindrocarpon mali var. flavum Wollenw., Z. Parasitenk. (Berlin)
1: 150. 1928.
Cylindrocarpon willkommii var. pluriseptatum Wollenw., Z. Par-
asitenk. (Berlin) 1: 152. 1928.
Cylindrocarpon willkommii var. minus Wollenw., Z. Parasitenk.
(Berlin) 1: 152. 1928.
Holotypus: Not located.
Type locality:Unknown.
Type substrate: Branch.
Notes: Synonyms fide Wollenweber & Reinking (1935). Several
names that include Fusidium candidum (1809), Fusisporium
cylindricum (1842) and Fusarium fissum (1858) should take
preference for this taxon. However, the epithet “candidum”is
already occupied in the genus Neonectria and cannot be used.
Furthermore, the link between Fusisporium cylindricum and
Fusarium fissum with Neonectria ditissima still needs to be
established. Therefore, we choose to retain the name Neonectria
ditissima for this taxon.
candidum Fusarium Sacc. & D. Sacc., Syll. Fung. 18: 674. 1906,
nom. illegit., Art. 53.1, non Fusarium candidum Ehrenb. 1818.
Basionym:Fusidium candidum Willk., Die mikroskopischen
Feinde des Waldes 1: 103. 1866.
Replacing synonym:Fusarium willkommii Lindau, Rabenh.
Krypt.-Fl. ed. 2, 1(9): 551. 1910.
(See Fusarium willkommii)
capitatum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s., 4:
302. 1832.
Synonym:Pionnotes capitata (Schwein.) Fr., Summa Veg.
Scand. 2: 481. 1849.
Holotypus: PH00081394.
Type locality:USA, Pennsylvania.
Type substrate:Tsuga canadensis.
Notes: The type material of Fusarium capitatum, type species of
the genus Pionnotes, was re-examined by Seifert (2013).It
represents not a hyphomycete but a basidiomycete identical to
Dacrymyces chrysospermus. Therefore, the generic name
Pionnotes is a synonym of Dacrymyces rather than Fusarium.
Further evaluations are necessary in future phylogenetic re-
visions of the Dacrymycetales.
caricis Fusarium Oudem., Verslagen Meded. Afd. Natuurk. Kon.
Akad. Wetensch., ser. 3, 7: 325. 1890.
(See Fusarium graminearum)
Holotypus: ?L.
Type locality:Netherlands, Zuid-Holland Province, Den Haag.
Type substrate: Leaves of Carex sp.
Note: Synonym fide Wollenweber & Reinking (1935).
caries Fusarium Nees, Nova Acta Phys.-Med. Acad. Caes.
Leop.-Carol. Nat. Cur. 19, Suppl. 1: 478. 1843.
Holotypus: ?B, L or STR.
Type locality:China.
Type substrate:Meoschium lodiculare.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
carminascens Fusarium L. Lombard et al., Persoonia 43: 19.
2018 [2019].
Holotypus: CBS H-23609.
Ex-type culture: CBS 144738 = CPC 25800.
Type locality:South Africa, KwaZulu-Natal Province.
Type substrate:Zea mays.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb1: MW928801; rpb2: MH484937;
tef1: MH485028.
carneolum Fusarium P. Karst., Meddeland. Soc. Fauna Fl. Fenn.
16: 35. 1888.
Vermicularia herbarum Westend., Herb. Crypt. Belg. no. 393.
1849.
Holotypus: ?H.
Type locality:Finland, Tammela.
Type substrate:Iris pseudacorus.
Note: Synonym fide Wollenweber & Reinking (1935).
CROUS ET AL.
96

carneoroseum Fusarium Cooke, Grevillea 19: 4. 1890.
(See Fusarium lateritium)
Holotypus: In K(M), Colenso 538 fide Index Fungorum.
Type locality:New Zealand.
Type substrate: Bark.
Note: Synonym fide Wollenweber & Reinking (1935).
carneum Fusarium (Mont.) Sacc., Syll. Fung. 4: 724. 1886.
Basionym:Fusisporium carneum Mont., Ann. Sci. Nat., Bot., s
er.
2, 17: 120. 1842.
Holotypus: ?PC.
Type locality:Cuba.
Type substrate: Leaf of monocotyledon.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
carniforme Fusarium Ellis & Tracy, nom. inval., Art. 38.1(a).
Synonym:Ramularia carniformis Sherb., Phytopathology 18:
149. 1928.
Authentic material: NY0093683.
Original locality:USA, Mississippi, Starkville.
Original substrate:Tripsacum dactyloides.
Notes: Status unclear. Braun (1998) considered this species
doubtful as conidia appeared microdochium-like.
carpineum Fusarium Davis, Trans. Wisconsin Acad. Sci. 18:
106. 1915.
Holotypus: BPI 442722.
Type locality:USA, Wisconsin, Wyalusing.
Type substrate:Carpinus caroliniana.
Notes: This species was not treated by any of Wollenweber &
Reinking (1935),Booth (1971),orGerlach & Nirenberg (1982).
A literature search could not find any additional information
pertaining to this species.
carpini Fusarium Schulzer & Sacc., Hedwigia 23: 128. 1884.
(See Fusarium expansum)
Holotypus: Not located.
Type locality:Croatia, Vinkovci.
Type substrate:Carpinus betulus.
Note: Synonym fide Wollenweber & Reinking (1935).
cassiae Fusarium R.H. Perera et al., Mycosphere 11: 2138.
2020.
Holotypus: MFLU 18-2751.
Ex-type culture: MFLUCC 18-0573.
Type locality:Thailand, Phayao Province.
Type substrate: Pods of Cassia fistula.
Descriptions and illustrations: See Perera et al. (2020).
Diagnostic DNA barcodes:rpb2: MT212197; tef1: MT212205.
castagnei Fusarium Mont., Ann. Sci. Nat., Bot., s
er. 3, 12: 296.
1849.
Myxosporium castagnei (Mont.) Wollenw., Fusaria. Autogr.
Delin. 1: 489. 1916.
Holotypus: ?PC.
Type locality:France, Marseille.
Type substrate:Psoralea bituminosa.
Note: Synonym fide Wollenweber & Reinking (1935).
castaneicola Fusarium W. Yamam., Trans. Mycol. Soc. Japan 3:
114. 1962, nom. inval., Art. 39.1 & 40.1.
Rugonectria castaneicola (W. Yamam. & Oyasu) Hirooka & P.
Chaverri, Stud. Mycol. 68: 73. 2011.
Basionym:Nectria castaneicola W. Yamam. & Oyasu, Sci. Rep.
Hyogo Univ. Agric. 3: 15. 1957.
Synonyms:Neonectria castaneicola (W. Yamam. & Oyasu) Tak.
Kobay. & Hirooka, J. Gen. Pl. Pathol. 71: 126. 2005, nom. inval.,
Art. 41.5.
Cylindrocarpon castaneicola Tak. Kobay. & Hirooka, J. Gen. Pl.
Pathol. 71: 126. 2005.
Authentic material: Not designated.
Original locality:Japan, Hyogo.
Original substrate:Castanea crenata.
Note: This Fusarium epithet is invalid as neither a Latin diagnosis
(Art. 39.1) nor a type designation (Art. 40.1) was included in the
original description.
castaneum Fusarium Lindau (as “(Lib.) Sacc.“), Rabenh. Krypt.-
Fl. ed. 2, 1(9): 556. 1909.
Synonym:Sclerotium castaneum Lib., in herb. 1832, nom. nud.
(See Fusarium candidum Ehrenb.)
Authentic material: Not located.
Original locality:Belgium, Ardennes.
Original substrate:Brassica oleracea.
cataleptum Fusarium Cooke & Harkn., Grevillea 12: 96. 1884.
(See Fusarium coccophilum)
Holotypus: In K(M), Harkness 1981 fide Index Fungorum.
Type locality:USA, California, San Rafael.
Type substrate:Acacia sp.
Note: Synonym fide Wollenweber & Reinking (1935).
catenatum Fusarium (Sand.-Den. & Crous) O'Donnell et al., In-
dex Fungorum. 440: 1. 2020.
Neocosmospora catenata Sand.-Den. & Crous, Persoonia 41:
115. 2018.
Holotypus: CBS H-23225.
Ex-type culture: CBS 143229 = NRRL 54993 = UTHSC 09-1009.
Type locality:USA, Georgia.
Type substrate:Stegostoma fasciatum.
Descriptions and illustrations: See Sandoval-Denis & Crous
(2018).
Diagnostic DNA barcodes:rpb1: KC808292; rpb2: KC808355;
tef1: KC808214.
cateniforme Fusarium J.W. Xia et al., Persoonia 43: 197. 2019
Holotypus: CBS H-24053.
Ex-type culture: ATCC 11853 = CBS 150.25.
Type locality:Unknown.
Type substrate: Unknown.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170384; tef1: MN170451.
catenulatum Fusarium F.J. Chen, Mycosystema 19: 459. 2000.
Holotypus: HMAS 71749.
Ex-type culture: AS 3.4704.
Type locality:China, Shaanxi, Yangling.
Type substrate:Gossypium hirsutum.
Descriptions and illustrations: See Chen (2000).
caucasicum Fusarium Letov, Mater. Mikol. Fitopatol. 8: 225.
1929.
Holotypus: Not located.
Ex-type culture: CBS 179.35 = IFO 5979 = NRRL 13954.
Type locality:Republic of Azerbaijan.
Type substrate:Gossypium hirsutum.
Descriptions and illustrations: See Gerlach & Nirenberg (1982).
FUSARIUM REDELIMITED
www.studiesinmycology.org 97

Notes: Status doubtful/unclear. The ex-type culture (CBS 179.35)
accessioned in CBS appears to be either contaminated or trans-
positioned by another Fusarium sp. (Sandoval-Denis et al. 2019).
A sequence of the tef1 gene region (DQ247543) from the copy
accessioned at NRRL (NRRL 13954) places this species within
the Neocosmospora falciformis clade (Sandoval-Denis et al.
2019). The status of the copy accessioned at IFO is not known.
caudatum Fusarium Wollenw., J. Agric. Res. 2: 262. 1914.
(See Fusarium scirpi)
Lectotypus (hic designatus, MBT 10000665): USA, South Car-
olina, Clemson College, Ipomoea batatas, date unknown, Harter
& Field, in Wollenweber, J. Agric. Res. 2: 262, pl. 16, fig. M.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
cavispermum Fusarium Corda, Icon. Fung. 1: 3. 1837.
Cosmosporella cavisperma (Corda) Sand.-Den. et al., Stud.
Mycol. 98 (no. 100116): 44. 2021.
Synonyms:Fusarium aquaeductuum var. cavispermum (Corda)
Raillo, Fungi of the Genus Fusarium: 280. 1950.
Fusarium oxydendri Ellis & Everh., Bull. Torrey Bot. Club 24: 477.
1897.
Fusarium cavispermum var. minus Wollenw., Fusaria Autogr.
Delin. 3: 848. 1930.
Lectotypus: AKJ. Corda, Icon. Fung. 1: pl. I, fig. 58, designated in
this study.
Type locality:Czech Republic.
Type substrate: Resin of Pinus sp.
Epitypus: CBS 172.31 (metabolic inactive specimen) designated
in this study.
Ex-epitype: CBS 172.31 = NRRL 13996.
Epitype locality:Norway.
Epitype substrate:Pinus sylvestris.
Diagnostic DNA barcodes:rpb1: JX171465; rpb2: JX171579.
celosiae Fusarium T. Abe, Mem. Coll. Agric. Kyoto Imp. Univ. 7:
51. 1928.
(See Fusarium fujikuroi)
Holotypus: Not located.
Type locality:Japan.
Type substrate: Living stems and leaves of Celosia cristata.
Note: Synonym fide Wollenweber & Reinking (1935).
celtidicola Fusarium Q.J. Shang et al., Phytotaxa 361: 255.
2018.
Holotypus: MFLU 15-3646.
Ex-type culture: KUMCC 16-0019 = MFLUCC 16-0526.
Type locality:Italy, Forlì-Cesena Province, Forlì, Viale
dell’Appennino.
Type substrate:Celtis australis.
Descriptions and illustrations: See Shang et al. (2018).
Diagnostic DNA barcodes:rpb1: MH576579; rpb2: MH576577;
tef1: MH576581.
celtidis Fusarium Ellis & Tracy, J. Mycol. 6: 76. 1890.
(See Fusarium lateritium)
Syntypes: In BPI, ISC & MICH.
Type locality:USA, Mississippi, Starkville.
Type substrate:Celtis occidentalis.
Note: Synonym fide Wollenweber & Reinking (1935).
celtidis Fusarium Pass., Atti Reale Accad. Lincei, Rendiconti Cl.
Sci. Fis., 4 s
er. 7: 51. 1891, nom. illegit., Art. 53.1.
Replacing synonym:Fusarium sphaeriiforme Sacc. (as
‘sphaeriaeforme’), Syll. Fung. 10: 723. 1892.
(See Fusarium melanochlorum)
Holotypus: ?PARMA.
Type locality:Italy, Parma, Vigheffio.
Type substrate: Dead branch of Celtis australis.
Note: Synonym fide Wollenweber & Reinking (1935).
cepae Fusarium Hanzawa, Mycol. Centralbl. 5(1): 5. 1914.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000666): Japan, Sapporo,
Allium cepa, 1914, J. Hanzawa, 5(1): 6, fig. 1.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
cerasi Fusarium Rolland & Ferry, in Roumegu
ere, Rev. Mycol.
(Toulouse) 14: 170. 1892.
?Foveostroma drupacearum (L
ev.) DiCosmo, Canad. J. Bot.
56: 1682. 1978.
Basionym:Micropera drupacearum L
ev., Ann. Sci. Nat., Bot., s
er.
3, 5: 283. 1846.
Synonyms:?Peziza cerasi Pers., Neues Mag. Bot. 1: 115. 1794.
?Dermea cerasi (Pers.) Fr., Syst. Orb. Veg. 1: 115. 1825.
Syntype: ILL00220294 (Fungi Sel. Gall. Exs. No. 6119).
Type locality:France, Saint-Di
e-des-Vosges.
Type substrate:Prunus sp. (cherry tree).
Note: This species was excluded from Fusarium by Wollenweber
(1943).Gerlach & Nirenberg (1982) considered this species as a
possible synonym of Micropera drupacearum on which the
present synonymies are based.
cerealis Fusarium (P. Karst.) Gruyter & J.H.M. Schneid., Jaarb.
Plantenziektenk. Dienst 1989/1990, no. 168: 135. 1991, nom.
inval., Art. 41.4.
Gliomastix cerealis (P. Karst.) C.H. Dickinson, Mycol. Pap. 115:
19. 1968.
Basionym:Coniosporium cerealis P. Karst., Meddeland. Soc.
Fauna Fl. Fenn. 14: 109. 1887.
Synonyms:Acremonium cerealis (P. Karst.) W. Gams, Cepha-
losporium-artige Schimmelpilze (Stuttgart): 88. 1971.
Gliomastix guttuliformis J.C. Br. & W.B. Kendr., Trans. Brit.
Mycol. Soc. 41: 499. 1958.
Holotypus: In herb. P.A. Karsten in H fide Dickinson (1968).
Type locality:Finland, Mustiala.
Type substrate:Secale cereale.
cerealis Fusarium (Cooke) Sacc., Syll. Fung. 4: 713. 1886.
Basionym:Fusisporium cerealis Cooke, Grevillea 6: 139. 1878.
Synonym:Fusarium culmorum var. cerealis (Cooke) Wollenw.,
Fusaria Autogr. Delin. 3: 946. 1930.
Fusarium roseum f.cerealis (Cooke) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 32: 663. 1945.
Gibberella rosea f.cerealis (Cooke) W.C. Snyder & H.N. Hansen,
Amer. J. Bot. 32: 664. 1945.
Fusarium sambucinum var. cerealis (Cooke) Raillo, Fungi of the
Genus Fusarium: 211. 1950.
Fusarium crookwellense L.W. Burgess et al., Trans. Brit. Mycol.
Soc. 79: 498. 1982.
Holotypus: ?K(M) 133541.
CROUS ET AL.
98

Type locality:USA, California, Gainesville.
Type substrate:Zea mays.
Notes:Wollenweber & Reinking (1935) considered F. cerealis as
a variety of F. culmorum, whereas Raillo (1950) considered it as
a variety of F. sambucinum.Gerlach & Nirenberg (1982) applied
a broader concept to F. culmorum that did not separate this
variety in F. culmorum.Nirenberg (1990) recognised F. cerealis
as a species and considered F. crookwellense as a synonym of
F. cerealis. However, Leslie & Summerell (2006) recommend the
use of the name F. crookwellense over F. cerealis, indicating
that no type material is available for F. cerealis. We choose to
follow Nirenberg (1990) to consider F. crookwellense a synonym
under F. cerealis. The material lodged in K(M) requires further
investigation to determine whether epi- or neotypification is
required.
cesatii Fusarium Rabenh., Klotzschii Herb. Viv. Mycol. Cent. 15:
no. 1440. 1850.
Hymenula rubella Fr., Elench. Fung. 2: 38. 1828.
Lectotypus (of Fusarium cesatii,hic designatus, MBT 10000667):
Italy, Vercelli, Carex sp., 1849, collector unknown, Rabenh.,
Klotzschii Herb. Viv. Mycol. Ed. I no. 1440 in HAL.
Note: Synonym fide Wollenweber & Reinking (1935).
cesatii Fusarium Thüm., Pilze Weinst.: 49. 1878, nom. illegit., Art.
53.1, non Fusarium cesatii Rabenh. 1850.
Elsinoe ampelina (de Bary) Shear, Phytopathology 19: 677.
1929.
Basionym:Sphaceloma ampelina de Bary, Ann. Oenol. 4: 165.
1874.
Synonyms:Manginia ampelina (de Bary) Viala & Pacottet, C. r.
hebd. S
eanc. Acad. Sci., Paris 139: 88. 1904.
Pionnotes cesatii Sacc., Syll. Fung. 4: 726. 1886.
Ramularia ampelophaga Pass., Bol. Comit. Agric. Parmense 9:
125. 1876.
Gloeosporium ampelophagum (Pass.) Sacc., Michelia 1: 217.
1878.
Authentic material: S-F47363.
Original locality:Italy, Vercelli.
Original substrate: Decaying stump of Vitis vinifera.
Note: Synonym fide Wollenweber & Reinking (1935).
chaetomium Fusarium Wallr., Fl. Crypt. Germ. 2: 242. 1833.
Colletotrichum chaetomium (Wallr.) S. Hughes, Canad. J. Bot.
36: 753. 1958.
Holotypus: ?STR.
Type locality:Germany.
Type substrate: Decaying Cucurbita.
chenopodinum Fusarium (Thüm.) Sacc., Syll. Fung. 4: 701.
1886.
(See Fusarium scirpi)
Basionym:Fusisporium chenopodinum Thüm., Mycoth. Univ.
Cent. 14: no. 1378. 1879.
Syntypes: In BPI, CHRB, ILL, NEB, NY, NYS & PUL.
Type locality:Austria, Niederösterreich, Klosterneuburg.
Type substrate:Chenopodium album.
Note: Synonym fide Wollenweber & Reinking (1935).
chilense Fusarium (Mont.) Sacc., Syll. Fung. 4: 716. 1886.
Gloeosporium chilense (Mont.) Wollenw., Z. Parasitenk.
(Berlin) 3: 496. 1931.
Basionym:Fusisporium chilense Mont., in Gay, Fl. Chil. 8: 25.
1852.
Fusisporium argillaceum Mont., Bull. Mass. Agric. Exp. Sta. no.
55. 1842, nom. illegit., Art. 53.1, non Fusarium argillaceum Fr.
1832.
Holotypus: In UPS fide Wollenweber, Fusaria Autogr. Delin. 2:
658.
Type locality:Chile, Juan Fern
andez Islands.
Type substrate: Bark of Urtica excelsa.
Note: Synonym fide Wollenweber & Reinking (1935).
chinhoyiense Fusarium Yilmaz & Crous, Persoonia 46: 147.
2021.
Holotypus: PREM 63215.
Ex-type culture: BBA 69031 = DAOM 225149 = Frank
5bCn8 = IMI 375355 = NRRL 25221 = NY007.I2.
Type locality:Zimbabwe, Chinhoyi.
Type substrate:Zea mays.
Descriptions and illustrations: See Yilmaz et al. (2021).
Diagnostic DNA barcodes:rpb1: MW402711; rpb2: MN534262;
tef1: MN534050.
chlamydosporum Fusarium Wollenw. & Reinking, Phytopa-
thology 15: 156. 1925.
Synonyms:Fusarium sporotrichioides var. chlamydosporum
(Wollenw. & Reinking) Joffe, Mycopathol. Mycol. Appl. 53: 211.
1974, nom. inval., Art. 41.1.
Dactylium fusarioides Gonz. Frag. & Cif., Bol. Real Soc. Esp.
Hist. Nat. 27: 280. 1927.
Fusarium fusarioides (Gonz. Frag. & Cif.) C. Booth, The Genus
Fusarium: 88. 1971.
Pseudofusarium purpureum Matsush., Microfungi of the Solo-
mon Islands and Papua New Guinea: 47. 1971.
Neotypus: CBS 145.25 (preserved as metabolically inactive
culture), designated in Lombard et al. (2019a).
Ex-neotype culture: CBS 145.25 = NRRL 26851 = NRRL 26912.
Neotype locality:Honduras, Tela.
Neotype substrate:Musa sapientum.
Descriptions and illustrations: See Wollenweber & Reinking
(1925),Booth (1971),Gerlach & Nirenberg (1982) and Leslie
& Summerell (2006).
Diagnostic DNA barcodes:rpb1: MN120715; rpb2: MN120735;
tef1: MN120754.
cicatricum Fusarium (Berk.) O'Donnell & Geiser, Phytopathology
103: 404. 2013.
Geejayessia cicatricum (Berk.) Schroers, Stud. Mycol. 68: 124.
2011.
Basionym:Sphaeria sanguinea var. cicatricum Berk., Mag. Zool.
Bot. 1: 48. 1837.
Synonyms:Nectria cicatricum (Berk.) Tul. & C. Tul., Select.
Fung. Carpol. 3: 77. 1865.
Sphaeria sanguinea var. cicatricum Haller, Syst. Nat., ed 13, 1:
LII. 1768.
Sphaeria coccinea var. cicatricum Desm., Ann. Sci. Nat., Bot.,
s
er. 3, 10: 351. 1848.
Nectria coccinea var. cicatricum (Desm.) Sacc., Syll. Fung. 2:
482. 1883.
Cucurbitaria cicatricum (Desm.) Kuntze, Revis. Gen. Pl. 3: 462.
1898.
Nectria gibbera Fuckel, Jahrb. Nassauischen Vereins Naturk.
23–24: 177. 1870.
Fusarium fuckelii Sacc., Syll. Fung. 4: 695. 1886.
Nectria desmazieri Fuckel ex Sacc., Syll. Fung. 4: 695. 1886,
nom. inval., Art. 36.1(d).
FUSARIUM REDELIMITED
www.studiesinmycology.org 99

Lectotypus: K(M) 160064 (MBT 10001323 hic designatus).
Epitypus: CBS H-20374 (MBT 10001324 hic designatus).
Ex-epitype culture: CBS 125549.
Epitype locality:Slovenia, Arboretum Vol
cji Potok.
Epitype substrate: Decaying twigs of Buxus sempervirens.
Descriptions and illustrations: See Schroers et al. (2011).
Diagnostic DNA barcodes:rpb1: KM232231; rpb2: HM626679;
tef1: HM626643.
Notes: The epitypification in Schroers et al. (2011) was not Code
compliant as neither a supporting holo-, lecto- nor epitype was
cited. The specimen in the Kew herbarium was cited as isotype.
In the protologue a single gathering is mentioned, but an illus-
tration is also cited so a lectotypification is necessary. The epi-
typification is validated herein.
ciliatum Fusarium (Link) Link, in Willdenow, Sp. Pl., Ed. 4, 6: 105.
1825.
Scolecofusarium ciliatum (Link) L. Lombard et al., Stud. Mycol.
98 (no. 100116): 74. 2021.
Basionym:Atractium ciliatum Link, Mag. Neuesten Entdeck.
Gesammten Naturk. Ges. Naturf. Freunde Berlin 7: 32. 1816.
Synonyms:Microcera ciliata (Link) Wollenw., Fusaria Autogr.
Delin. 1: 435. 1916.
Calonectria ciliata (Link) W.C. Snyder & H.N. Hansen, Amer. J.
Bot. 32: 664. 1945.
Sphaeria agnina Desm., Ann. Sci. Nat., Bot. s
er. 3, 6: 72. 1846.
Calonectria agnina (Desm.) Sacc., Michelia 1(3): 311. 1878.
Dialonectria agnina (Desm.) Cooke, Grevillea 12: 111. 1884.
Fusarium peltigerae Westend., Herb. Crypt. Belg. 9: no. 414.
1849.
Fusarium parasiticum Westend., Bull. S
eances Cl. Sci. Acad.
Roy. Sci. Belgique, s
er. 2, 11: 652. 1861.
Nectria massariae Pass., in Rabenhorst, Fungi Eur. Exs. no.
1827. 1874.
Microcera massariae Sacc., Michelia 1(2): 262. 1878.
Calonectria massariae (Pass.) Sacc., Michelia 1(3): 312. 1878.
Fusisporium filisporum Cooke, Grevillea 8: 8. 1879.
Fusarium filisporum (Cooke) Sacc., Syll. Fung. 4: 708. 1886.
Fusarium scolecoides Sacc. & Ellis, Atti Reale Ist. Veneto Sci.
Lett. Arti, s
er. 6, 3: 728. 1885.
Fusarium elongatum Cooke, Grevillea 19: 4. 1890.
Calonectria dearnessii Ellis & Everh., Proc. Acad. Nat. Sci.
Philadelphia 42: 245. 1891.
Neotypus: CBS H-12687 designated in this study.
Ex-neotypus: ATCC 16068 = ATCC 24137 = BBA 9661 = CBS
191.65 = DSM 62172 = IMI 112499 = NRRL 20431.
Neotype locality:Germany.
Neotype substrate: Branch canker of Fagus sylvatica.
Diagnostic DNA barcodes:rpb1: MW834264; rpb2: MW834035;
tef1: MW834296.
cinctum Fusarium Corda, Icon. Fung. 5: 80. 1842.
Striaticonidium cinctum (Corda) L. Lombard & Crous, Per-
soonia 36: 229. 2016.
Synonyms:Myrothecium cinctum (Corda) Sacc., Syll. Fung. 4:
751. 1886.
?Myrothecium ellipsosporum Fuckel (as ‘ellipsisporium’), Fungi
Rhen. Exs. Cent. 16, no. 1529 (1865).
?Hymenopsis ellipsospora (as ‘ellipsosporum’) (Fuckel) Sacc.,
Syll. Fung. 4: 745. 1886.
Myrothecium striatisporum N.C. Preston, Trans. Brit. Mycol. Soc.
31: 275. 1948.
Myrothecium longistriatisporum Matsush., Microfungi Solomon
Isl. Papua-New Guinea: 39. 1971.
Lectotypus: PR 155489, designated in Tulloch (1972).
Epitypus: CBS H-22471, designated in Lombard et al. (2016).
Ex-epitype culture: CBS 932.69 = IMI 145760.
Epitype locality:Netherlands, Eastern Flevoland.
Epitype substrate: Agricultural soil.
Note: The lectotype was cited as holotype in Lombard et al.
(2016) but this is correctable according to Art. 9.10 of the
Code (see also Ex. 11).
cinnabarinum Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung.
4: 722. 1886.
(See Fusarium lateritium)
Basionym:Fusisporium cinnabarinum Berk. & M.A. Curtis,
Grevillea 3: 146. 1875.
Syntypes: In PH, Pul & USCH:Fungi (Ellis, N. Amer. F. 3990).
Type locality:USA, Alabama.
Type substrate:Acer negundo.
Note: Synonym fide Wollenweber & Reinking (1935).
circinatum Fusarium Nirenberg & O'Donnell, Mycologia 90:
442. 1998.
Synonyms:Gibberella circinata Nirenberg & O'Donnell, Myco-
logia 90: 440. 1998, nom. inval., Art. 40.3.
Gibberella circinata Nirenberg & O'Donnell ex Britz et al.,
Sydowia 54: 16. 2002.
Holotypus: B 70 0001693.
Ex-type culture: BBA 69720 = CBS 405.97 = DAOM
225113 = IMI 375321 = NRRL 25331.
Type locality:USA, California.
Type substrate:Pinus radiata.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998).
Diagnostic DNA barcodes:rpb1: JX171510; rpb2: JX171623;
tef1: AF160295.
cirrosum Fusarium Höhn., Sitzungsber. Kaiserl. Akad. Wiss.
Wien, Math.-Naturwiss. Cl., Abt. 1., 116: 153. 1907.
(See Fusarium expansum)
Holotypus: FH00284266.
Type locality:Austria, Niederösterreich, Irenental near
Untertullnerbach.
Type substrate: Parasictic in the acervuli of Steganosporium
pyriforme (syn. Steganosporium ovatum).
Note: Synonym fide Wollenweber & Reinking (1935).
citri Fusarium M.M. Wang et al., Persoonia 43: 79. 2019.
Holotypus: HAMS 248036.
Ex-type culture: CGMCC 3.19467 = LC6896.
Type locality:China, Hunan Province.
Type substrate: Leaves of Citrus reticulata.
Descriptions and illustrations: See Wang et al. (2019).
Diagnostic DNA barcodes:rpb1: MK289828; rpb2: MK289771;
tef1: MK289617.
citricola Fusarium Guarnaccia et al., Persoonia 40: 12. 2017.
[2018].
Holotypus: CBS H-23020.
Ex-type culture: CBS 142421 = CPC 27805.
Type locality:Italy, Cosenza, Rocca Imperiale.
Type substrate:Citrus reticulata ‘Caffin’.
Descriptions and illustrations: See Sandoval-Denis et al.
(2018a).
CROUS ET AL.
100

Diagnostic DNA barcodes:rpb1: LT746290; rpb2: LT746310;
tef1: LT746197.
citriforme Fusarium Jamal., Valt. Maatalousk. Julk. 123: 11.
1943.
(See Fusarium tricinctum)
Lectotypus (hic designatus, MBT 10000668): Finland, Pyhaj€
arvi,
Hordeum sativum, 1938, E. Jamalainen, in Valt. Maatalousk.
Julk. 123: 10. 1943, fig. 2.
Ex-type culture: CBS 253.50.
Diagnostic DNA barcodes:rpb1: MW928802; rpb2: MW928823;
tef1: KR071775.
Notes:Jamalainen (1943) cited various specimens in the pro-
tologue of F. citriforme, but failed to indicate a holotype. There-
fore, a lectotypification is done here to fix the name. Isolate CBS
253.50 was deposited in the public collection of CBS by E.
Jamalainen in 1950. The isolate was indicated as the living ex-
type culture of F. citriforme.
citrinum Fusarium Wollenw., in Lewis, Bull. Maine Agric. Exp.
Sta. 219: 256. 1913.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000669): Germany, Berlin,
Dahlem, rotten fruit of Solanum lycopersicum, Oct. 1910, H.W.
Wollenweber, B70 0100185.
Notes: Synonym fide Wollenweber & Reinking (1935). Only one
specimen located at B matches the original collection event, but
it is not indicated as the type. Therefore B 70 0100185 is
designated as lectotype here.
citrulli Fusarium Taubenh., Bull. Texas Agric. Exp. Sta. 260: 27.
1920.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000670): USA, Texas, Waller
County, seedlings of Citrullus lanatus, 1920, J.J. Taubenhaus, in
Bull. Texas Agric. Exp. Sta. 260: 30, fig. 8h.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
citrulli Fusarium Sartory, Compt. Rend. Hebd. S
eances Acad. Sci.
188: 1434. 1929, nom. inval., Art. 35.2; nom. illegit.,Art.53.1.
Neocosmospora martii (Appel & Wollenw.) Sand.-Den. &
Crous, Persoonia 43: 142. 2019.
Basionym:Fusarium martii Appel & Wollenw., Arbeiten Kaiserl.
Biol. Anst. Land-Forstw. 8: 83. 1910.
Synonyms:Fusarium solani var. martii (Appel & Wollenw.)
Wollenw., Fusaria Autogr. Delin. 3: 1034. 1930.
?Selenosporium fuscum Bonord., Handb. Mykol.: 135. 1851.
?Fusarium fuscum (Bonord.) Sacc., Syll. Fung. 4: 699. 1886.
Fusarium citrulli Sartory & J. Mey., Compt. Rend. Soc. Biol. 107:
55. 1931, nom. illegit., Art. 53.1, non Fusarium citrulli Taubenh.
1920.
Neocosmospora croci Guarnaccia et al., Persoonia 40: 17. 2017
[2018].
Authentic material: Not located.
Original locality:France.
Original substrate:Citrullus vulgaris.
Note: Synonyms fide Wollenweber & Reinking (1935) and
Sandoval-Denis et al. (2019).
clavatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 234. 1915.
(See Fusarium flocciferum)
Lectotypus (hic designatus, MBT 10000671): USA, New York,
Castile, rotten tuber of Solanum tuberosum, 1915, C.D. Sher-
bakoff, in Mem. Cornell Univ. Agric. Exp. Sta. 6: 235, fig. 40.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
clavus Fusarium J.W. Xia et al. (as ‘clavum’), Persoonia 43:
199. 2019.
Holotypus: CBS H-24054.
Ex-type culture: CBS 126202 = RMF N 38.
Type locality:Namibia, northern Karoo, 30 km west of
Maltahöhe.
Type substrate: Desert soil.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170389; tef1: MN170456.
clematidis Fusarium Rolland & Fautrey, Rev. Mycol. (Toulouse)
16: 72. 1894.
Macroconia sphaeriae (Fuckel) Gr€
afenhan & Schroers, Stud.
Mycol. 68: 103. 2011.
Basionym:Fusarium sphaeriae Fuckel, Fungi Rhen. Exs. Fasc.
3: no. 212. 1863.
Synonyms:Fusarium sphaeriae var. robustum Davis, Trans.
Wisconsin Acad. Sci. 19: 714. 1919.
Septogloeum robustum (Davis) Wollenw. & Reinking, Fusarien:
336. 1935.
?Nectria leptosphaeriae var. macrospora Wollenw., Angew. Bot.
8: 187. 1926.
Syntype: ILL00220727 (Roumegu
ere, Fungi Sel. Gall. Exs. no.
6537).
Type locality:France.
Type substrate:Clematis vitalba.
Note: Synonym fide Wollenweber & Reinking (1935).
clypeaster Fusarium (Corda) Sacc., Syll. Fung. 4: 706. 1886.
Septogloeum clypeaster (Corda) Wollenw., Fusarien: 321.
1935.
Basionym:Fusisporium clypeaster Corda, Icon. Fung. 4: 26.
1840.
Lectotypus (hic designatus, MBT 10000672): Czech Republic,
Phragmites, May 1839, A.C.J. Corda, in Icon. Fung. 4, Tab. 6, fig.
82. 1840.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
coccidicola Fusarium Henn. (as ‘coccideicola’), Bot. Jahrb. Syst.
34: 57. 1904.
Microcera diploa (Berk. & M.A. Curtis) Gr€
afenhan & Seifert,
Stud. Mycol. 68: 106. 2011.
Basionym:Nectria diploa Berk. & M.A. Curtis, J. Linn. Soc., Bot.
10: 378. 1868.
Synonyms:Cucurbitaria diploa (Berk. & M.A. Curtis) Kuntze,
Revis. Gen. Pl. 3: 461. 1898.
Creonectria diploa (Berk. & M.A. Curtis) Seaver, Mycologia 1:
190. 1909.
Calonectria diploa (Berk. & M.A. Curtis) Wollenw., Angew. Bot. 8:
193. 1926.
Cosmospora diploa (Berk. & M.A. Curtis) Rossman & Samuels,
Stud. Mycol. 42: 121. 1999.
Fusarium derridis Henn., Beibl. Hedwigia 41: (66). 1902.
Fusarium juruanum Henn., Hedwigia 43: 398. 1904.
FUSARIUM REDELIMITED
www.studiesinmycology.org 101

Fusarium pentaclethrae Henn., Hedwigia 44: 71. 1905.
Aschersonia henningsii Koord., Verh. Kon. Ned. Akad.
Wetensch., Afd. Natuurk. 13: 213. 1907.
Microcera henningsii (Koord.) Petch, Ann. Roy. Bot. Gard.
(Peradeniya) 5: 533. 1914.
Pseudomicrocera henningsii (Koord.) Petch, Trans. Brit. Mycol.
Soc. 7: 100. 1921.
Microcera fujikuroi Miyabe & Sawada, J. Fac. Agric. Hokkaido
Imp. Univ. 5: 83. 1913.
Microcera merrillii Syd. & P. Syd., Ann. Mycol. 12(6): 576. 1914.
Pseudomicrocera henningsii var. longispora Petch, Trans. Brit.
Mycol. Soc. 7: 164. 1921.
Fusarium microcera Bilaĭ, Fusarii (Biologija i sistematika): 292.
1955, nom. inval., Art. 39.1.
Holotypus: Zimmerman no. 26 in B fide Hein (1988).
Type locality:Tanzania, East Usambara, Magrotto.
Type substrate: Parasitic on Coccoidea sp. on Camellia sinensis.
coccinellum Fusarium Kalchbr., Flora (Regensburg) 59: 426.
1876.
(See Fusarium coccophilum)
Syntype: ?NY00899913.
Type locality:South Africa, Eastern Cape Province, Somerset-
East.
Type substrate:Acacia horrida.
Note: Synonym fide Wollenweber & Reinking (1935).
coccineum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s. 4:
302. 1834.
Holotypus: ?PH00062490.
Type locality:USA, Pennsylvania, Northhampton, Nazareth.
Type substrate: Bark of Castanea sp.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
coccophilum Fusarium (Desm.) Wollenw. & Reinking, Fusarien:
34. 1935.
Microcera coccophila Desm., Ann. Sci. Nat. Bot., s
er. 3, 10:
359. 1848.
Synonyms:Tubercularia coccophila (Desm.) Bonord., Abh.
Naturf. Ges. Halle 8: 96. 1864.
Fusarium episphaeria f.coccophilum (Desm.) W.C. Snyder &
H.N. Hansen, Amer. J. Bot. 32: 662. 1945.
Nectria episphaeria f.coccophila (Desm.) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 32: 662. 1945.
Fusarium coccinellum Kalchbr., Flora (Regensburg) 56: 426. 1876.
Fusisporium coccinellum (Kalchbr.) Kalchbr., in Thümen, Mycoth.
Univ. no. 782. 1877.
Fusarium cataleptum Cooke & Harkn., Grevillea 12: 96. 1884.
Microcera pluriseptata Cooke & Massee, Grevillea 17: 43. 1888.
Fusarium callosporum Pat., Bull. Soc. Mycol. France 9: 164.
1893.
Fusarium baccharidicola Henn., Hedwigia 48: 20. 1908.
Microcera coccophila var. platyspora Sousa da C^
amara, Revista
Agron. (Lisbon): 5 (extr.). 1920.
Lectotypus: K(M) 165807, designated in Gr€
afenhan et al. (2011).
Type locality:France, Normandy, near Caen.
Type substrate: Parasitic on Eulecanium tiliae on Salix sp. and
Fraxinus excelsior.
Descriptions and illustrations: See Gr€
afenhan et al. (2011).
Notes: No living type material available. Gr€
afenhan et al. (2011)
designated a lectotype but did not designate an epitype, which is
still required.
coffeatum Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4:
191. 2019.
Replaced synonym:Fusarium chlamydosporum var. fuscum
Gerlach, Phytopathol. Z. 90: 41. 1977.
Holotypus: BBA 62053.
Isotypus: CBS H-631.
Ex-type culture: BBA 62053 = CBS 635.76 = NRRL 20841.
Type locality:South Africa.
Type substrate:Cynodon lemfuensis.
Descriptions and illustrations: See Gerlach (1977a),Gerlach &
Nirenberg (1982) and Xia et al. (2019).
Diagnostic DNA barcodes:rpb1: MN120717; rpb2: MN120736;
tef1: MN120755.
coffeicola Fusarium Henn., Bot. Jahrb. Syst. 22: 82. 1895.
Synonym:Gloeosporium coffeicola (P. Henn.) Wollenw., Fusaria
Autogr. Delin. 1: 493. 1916, nom. illegit., Art. 53.1, non Gloeo-
sporium coffeicola Tassi 1900.
Holotypus:InBfide Hein (1988).
Type locality:Cameroon, Victoria.
Type substrate:Coffea liberica.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
coicis Fusarium Johanssen et al., Fungal Diversity 77: 356.
2015 [2016].
Holotypus: RBG 5368.
Ex-type culture: FRL 19329 = NRRL 66233 = RBG 5368.
Type locality:Australia, Queensland, Mareeba.
Type substrate:Coix gasteenii.
Descriptions and illustrations: See Laurence et al. (2016).
Diagnostic DNA barcodes:rpb1: KP083269; rpb2: KP083274;
tef1: KP083251.
colorans Fusarium (De Jonge) Appel & Wollenw., Arbeiten
Kaiserl. Biol. Anst. Land-Forstw. 8: 39. 1913.
Albonectria rigidiuscula (Berk. & Broome) Rossman & Sam-
uels, Stud. Mycol. 42: 105. 1999.
Basionym:Nectria rigidiuscula Berk. & Broome, J. Linn. Soc.,
Bot. 14: 116. 1873 [1875].Synonyms:Calonectria rigidiuscula (Berk.
& Broome) Sacc., Michelia 1(3): 313. 1878.
Fusarium rigidiusculum (Berk. & Broome) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 32: 664. 1945.
Calonectria eburnea Rehm, Hedwigia 37: 196. 1898.
Calonectria lichenigena Speg., Bol. Acad. Nac. Ci. Republ.
Argent. 11: 530. 1889.
Calonectria sulcata Starb€
ack, Bih. Kongl. Svenska Vetensk.-
Akad. Handl. 25: 29. 1899.
Fusarium decemcellulare Brick, Jahresber. Vereinigung Angew.
Bot. 6: 227. 1908.
Spicaria colorans De Jonge, Recueil Trav. Bot. N
eerl. 6: 48.
1909.
Scoleconectria tetraspora Seaver, N. Amer. Fl. 3: 27. 1910.
Calonectria tetraspora (Seaver) Sacc. & Trotter, Syll. Fung. 22:
487. 1913.
Nectria rigidiuscula f.theobromae E.J. Ford et al., Phytopa-
thology 57: 712. 1967.
Holotypus: Not located.
Type locality:Surinam.
Type substrate:Theobroma cacao.
Notes: Synonym fide Wollenweber & Reinking (1935).
Wollenweber (1916–1935) indicated that cultures and speci-
mens of Spicaria colorans (basionym of F. colorans) were
CROUS ET AL.
102

deposited in the Willie Commelin Scholten collection in
Amsterdam. This collection has been accessioned into the CBS
collection (CBS & CBS H). However, no cultures and specimens
or records could be located at CBS.
commune Fusarium K. Skovg. et al., Mycologia 95: 632. 2003.
Holotypus: BBA 71639 in B.
Ex-type culture: AAS 156 = BBA 71639 = CBS 110090 = NRRL
31076.
Type locality:Denmark.
Type substrate: Soil.
Descriptions and illustrations: See Skovgaard et al. (2003).
Diagnostic DNA barcodes:rpb1: MW928803; rpb2: MW934368;
tef1: AF362263.
commutatum Fusarium Sacc., Syll. Fung. 4: 710. 1886.
(See Fusarium solani)
Replaced synonym:Fusisporium candidum Bonord., Handb.
Allg. Mykol.: 96 (1851), nom. illegit., Art. 53.1, non Fusisporium
candidum Link 1824.
Holotypus: Not located.
Type locality:Germany.
Type substrate:Solanum tuberosum.
Note: Synonyms fide Wollenweber & Reinking (1935) and
Sandoval-Denis et al. (2019).
compactum Fusarium (Wollenw.) Raillo, Fungi of the Genus
Fusarium: 180. 1950.
Basionym:Fusarium scirpi var. compactum Wollenw., Fusaria
Autogr. Delin. 3: no. 924. 1930.
Synonym:Fusarium compactum (Wollenw.) Gordon, Canad. J.
Bot. 30: 224. 1952, nom. inval., Art. 53.1.
Lectotypus: Illustration in Wollenweber, Fusaria Autogr. Delin. no.
924 (1930), designated in Xia et al. 2019.
Epitypus: CBS 186.31 (preserved as metabolically inactive cul-
ture), designated in Xia et al. (2019).
Ex-epitype culture: CBS 186.31 = NRRL 36323.
Epitype locality:UK, Kew.
Epitype substrate: Cotton thread.
Descriptions and illustrations: See Wollenweber (1916–1935,
no. 924), Raillo (1950),Gordon (1952),Gerlach & Nirenberg
(1982) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb2: GQ505826; tef1: GQ505648.
concentricum Fusarium Nirenberg & O'Donnell, Mycologia 90:
442. 1998.
Holotypus: B 70 0001694.
Ex-type culture: BBA 64354 = CBS 450.97 = DAOM
225146 = IMI 375352 = NRRL 25181.
Type locality:Costa Rica.
Type substrate:Musa sapientum.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998)
and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: LT996192; rpb2: LT575063;
tef1: AF160282.
concolor Fusarium Reinking, Zentralbl. Bakteriol., 2. Abt. 89:
512. 1934.
Synonym:Fusarium polyphialidicum Marasas et al., Mycologia
78: 678. 1986.
Holotypus: IMI 112502.
Ex-type culture: BBA 2607 = BBA 63601 = CBS 183.34 = DAOM
225131 = DSM 62179 = IMI 112502 = NRRL 13994.
Type locality:Uruguay, Montevideo.
Type substrate:Hordeum vulgare.
Descriptions and illustrations: See Gerlach & Nirenberg (1982)
and Marasas et al. (1986).
Diagnostic DNA barcodes:rpb1: MH742492; rpb2: MH742569;
tef1: MH742650.
conglutinans Fusarium Wollenw., Ber. Deutsch. Bot. Ges. 31: 34.
1913.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:USA, Wisconsin.
Type substrate:Brassica oleracea var. capitata.
congoense Fusarium Wollenw., Fusaria Autogr. Delin. 1: 307.
1916.
(See Fusarium heterosporum)
Syntype: BPI 451889.
Type locality:Democratic Republic of the Congo.
Type substrate:Bromus willdenowii.
Note: Synonyms fide Wollenweber & Reinking (1935).
coniosporiicola Fusarium Henn., Ann. Mus. Congo Belge, Bot.,
S
er. 5, 2: 106. 1907.
Dendrodochium coniosporiicola (Henn.) Hansf., Proc. Linn.
Soc. London 155: 60. 1943.
Synonym:Fusidium coniosporiicola (Henn.) Wollenw., Fusaria
Autogr. Delin. 1: 477. 1916.
Syntypes:InBR&S.
Type locality:Democratic Republic of the Congo, Gongolo.
Type substrate:Albizia aff. fastigiata.
constrictum Fusarium Penz., Michelia 2: 486. 1882.
Synonym:Ramularia constricta (Penz.) Wollenw., Fusarien: 322.
1935.
Holotypus: Not located; destroyed fide U. Braun.
Type locality:Italy, Padua.
Type substrate: Leaves of Citrus sp.
Notes: Status unclear. Neither Fusarium fide Wollenweber &
Reinking (1935) nor Ramularia (pers. comm. U. Braun).
contaminatum Fusarium L. Lombard & Crous, Persoonia 43:
20. 2018 [2019].
Holotypus: CBS H-23610.
Ex-type culture: CBS 114899.
Type locality:Germany, Schlüchtern.
Type substrate: Pasteurised chocolate milk.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb2: MH484901; tef1: MH484992.
continuum Fusarium X. Zhou et al., Mycologia 108: 677. 2016.
Holotypus: HMNWAFU NX-Ffpl-10-20100851.
Ex-type culture: CBS 140841 = F201030 = NRRL 66286.
Type locality:China, Shaanxi, Fuping, Lei village.
Type substrate:Zanthoxylum bungeanum.
Descriptions and illustrations: See Zhou et al. (2016).
Diagnostic DNA barcodes:rpb1: KM520387; rpb2: KM236782;
tef1: KM236722.
convolutans Fusarium Sand.-Den. et al., MycoKeys 34: 77.
2018.
Holotypus: CBS H-23495.
Ex-type culture: CBS 144207 = CPC 33733.
Type locality:South Africa, Kruger National Park, Skukuza,
Granite Supersite.
FUSARIUM REDELIMITED
www.studiesinmycology.org 103

Type substrate: Rhizosphere of Kyphocarpa angustifolia.
Descriptions and illustrations: See Sandoval-Denis et al.
(2018b).
Diagnostic DNA barcodes:rpb1: LT996193; rpb2: LT996141;
tef1: LT996094.
corallinum Fusarium Mattir., Atti Accad. Sci. Ist. Bologna, Cl. Sci.
Fis., Mem. 6: 677. 1897, nom. illegit., Art. 53.1.
(See Fusarium culmorum)
Authentic material: Not located.
Type locality:Italy.
Type substrate:Andropogon sp.
Note: Synonym fide Wollenweber (1931).
corallinum Fusarium Sacc., Nuovo Giorn. Bot. Ital. 8: 196. 1876.
(See Fusarium graminum)
Holotypus: In PAD.
Type locality:Italy, Treviso, Selva.
Type substrate:Cynodon dactylon.
cordae Fusarium Massee, Brit. Fung.-Fl. 3: 481. 1893.
(See Fusarium oxysporum)
Notes: Massee introduced this name to replace F. aurantiacum
Corda, indicating that F. aurantiacum (Link) Sacc., based on
Fusisporium aurantiacum Link (1809), predates Corda's use of
the epithet. However, Corda's use of the epithet in Fusarium
predates Saccardo's recombination into Fusarium.
cortaderiae Fusarium O'Donnell et al., Fungal Genet. Biol. 41:
620. 2004.
Holotypus: BPI 843479.
Ex-type culture: CBS 119183 = ICMP 5435 = NRRL 29297.
Type locality:New Zealand, Auckland, Henderson.
Type substrate:Cortaderia selloana.
Descriptions and illustrations: See O'Donnell et al. (2004).
Diagnostic DNA barcodes:rpb1: KM361644; rpb2: KM361662;
tef1: AY225885.
crassistipitatum Fusarium Scandiani et al., Mycoscience 53: 171.
2011.
(See Fusarium azukiicola)
Holotypus: BPI 871490.
Ex-type culture: MAFF 239757 = NRRL 36877.
Type locality:Argentina, Santa Fe, Zavalla.
Type substrate:Glycine max.
Descriptions and illustrations: See Aoki et al. (2012a).
Diagnostic DNA barcodes:rpb2: FJ240405; tef1: FJ240351.
crassum Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index
Fungorum 440: 1. 2020.
Neocosmospora crassa Sand.-Den. & Crous, Persoonia 43:
122. 2019.
Holotypus: CBS H-23976.
Ex-type culture: CBS 144386 = MUCL 11420.
Type locality:France, Paris.
Type substrate: Unknown.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218109; rpb2: LR583823;
tef1: LR583604.
croceum Fusarium J.W. Xia et al., Persoonia 43: 201. 2019.
Holotypus: CBS H-24055.
Ex-type culture: CBS 131777.
Type locality:Iran, Golestan Province, Gonbad-e Qabus.
Type substrate:Triticum sp.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170396; tef1: MN170463.
croci Fusarium (Guarnaccia, Sand.-Den. & Crous) O'Donnell
et al., Index Fungorum 440: 1. 2020.
Basionym:Neocosmospora croci Guarnaccia, Sand.-Den. &
Crous, Persoonia 40: 17. 2017.
(See Fusarium citrulli Sartory)
Holotypus: CBS H-23022.
Ex-type culture: CBS 142423 = CPC 27186.
Type locality:Italy, Sicily, Catania, Patern
o.
Type substrate:Citrus sinensis.
Descriptions and illustrations: See Sandoval-Denis et al.
(2018a).
Diagnostic DNA barcodes:rpb2: LT746329; tef1: LT746216.
cromyophthoron Fusarium Sideris, Phytopathology 14: 212.
1924.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000673): USA, California,
Stockton, roots of Allium sp.,1924, C.P. Sideris, in Phytopa-
thology 14, pl. IX.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
crookwellense Fusarium L.W. Burgess et al., Trans. Brit. Mycol.
Soc. 79: 498. 1982.
(See Fusarium cerealis (Cooke) Sacc.)
Holotypus: FRC R-3090.
Ex-type culture: NRRL 13163.
Type locality:Australia, New South Wales, Crookwell.
Type substrate:Solanum tuberosum tubers.
Descriptions and illustrations: See Burgess et al. (1982).
Note: See Notes under F. cerealis.
cruentum Fusarium Teich, Byull. Sredne-Aziatsk. Gosud. Univ.
19: 178. 1934.
Holotypus: Not located.
Type locality:Uzbekistan, Tashkent.
Type substrate: Roots and stems of Vitis vinifera.
Notes: Status unclear. This species was not treated by any of
Wollenweber & Reinking (1935),Raillo (1950),Bilaĭ(1955),
Booth (1971),Joffe (1974),orGerlach & Nirenberg (1982).
Furthermore, no additional records could be located.
cryptoseptatum Fusarium (Sand.-Den. & Crous) O'Donnell, In-
dex Fungorum 440: 1. 2020.
Neocosmospora cryptoseptata Sand.-Den. & Crous, Persoo-
nia 43: 122. 2019.
Holotypus: CBS H-23977.
Ex-type culture: BBA 65024 = CBS 145463 = NRRL 22412.
Type locality:French Guiana.
Type substrate: Bark.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834215; rpb2: EU329510;
tef1: AF178351.
cryptum Fusarium McAlpine, Fungus Diseases of Citrus trees in
Australia: 106. 1899.
(See Fusarium larvarum)
Holotypus: VPRI 2557.
Type locality:Australia, South Australia.
Type substrate: Twigs of Citrus limonia.
CROUS ET AL.
104

Note: Synonym fide Wollenweber & Reinking (1935).
cubense Fusarium E.F. Sm., Science, N.Y. 31: 754. 1910.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:Cuba.
Type substrate:Musa sp.
Note: Synonym fide Wollenweber & Reinking (1935).
cucumerinum Fusarium Berk. & Broome, Ann. Mag. Nat. Hist.,
ser. 4, 17: 141. 1876.
Holotypus: ?K(M).
Type locality:UK, Northamptonshire, Daventry, Sibbertoft.
Type substrate: Diseased Cucumis sativus.
Notes: Status unclear. Wollenweber & Reinking (1935) synony-
mised this species under Septomyxa persicina. In contrast, Index
Fungorum indicates that this species is a synonym under
F. oxysporum. The original protologue (Berkeley & Broome 1876)
fits neither S. persicina nor F. oxysporum.
cucurbitae Fusarium Taubenh., Bull. Texas Agric. Exp. Sta. 260:
27. 1920.
Lectotypus (hic designatus, MBT 10000674): USA, Texas, Waller
County, from squash, date unkown, J.J. Taubenhaus, in Bull.
Texas Agric. Exp. Sta. 260: 30, fig. 8j. 1920.
Notes: Based on the description and illustrations provided by
Taubenhaus (1920), this species could represent F. oxysporum.
However, recollection and epitypification are required to confirm
this. No holotype specimen could be located and therefore an
illustration is designated as lectotype.
cucurbitariae Fusarium (Pat.) Sacc., Syll. Fung. 4: 708. 1886.
(See Fusarium avenaceum)
Basionym:Fusisporium cucurbitariae Pat., Rev. Mycol. (Tou-
louse) 3: 10. 1881.
Holotypus: ?FH01093588.
Type locality:France, Lons-le-Saunier.
Type substrate: Diseased Cucumis sativus.
Note: Synonym fide Wollenweber & Reinking (1935).
cucurbitariae Fusarium Peyronel, Nuovo Giorn. Bot. Ital., n.s. 25:
436. 1918, nom. illegit., Art. 53.1.
Holotypus: ?ROPV.
Type locality:Italy, Piemonte, Riclaretto.
Type substrate: Parasitic on perithecia of Camarosporidiella
laburni (≡Cucurbitaria laburni).
Notes: Status unclear. Not treated by any of Wollenweber &
Reinking (1935),Booth (1971),orGerlach & Nirenberg (1982).
cucurbiticola Fusarium O'Donnell et al., Index Fungorum 440: 2.
2020.
Neocosmospora cucurbitae Sand.-Den. et al., Persoonia 43:
125. 2019.
Synonyms:Fusarium solani f.cucurbitae W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 28: 740. 1941.
Fusarium solani f. sp.cucurbitae W.C. Snyder & H.N. Hansen,
Root rots caused by Phycomycetes 28: 740. 1941.
Hypomyces solani f.cucurbitae W.C. Snyder & H.N. Hansen,
Amer. J. Bot. 28: 741. 1941.
Nectria haematococca var. cucurbitae (W.C. Snyder & H.N.
Hansen) Dingley, New Zealand J. Agric. Res. 4: 337. 1961.
Nectria solani f. cucurbitae (W.C. Snyder & H.N. Hansen) G.R.W.
Arnold, Z. Pilzk. 37: 193. 1972.
Holotypus: CBS H-23978.
Ex-type culture: BBA 64411 = CBS 616.66 = NRRL 22399.
Type locality:Netherlands.
Type substrate:Cucurbita viciifolia.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834217; rpb2: LR583825;
tef1: DQ247592.
cugenangense Fusarium Maryani et al., Stud. Mycol. 92: 181.
2018 [2019].
Holotypus: InaCC F984 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F984.
Type locality:Indonesia, West Java, Cianjur, Cugenang.
Type substrate: Pseudostem of Musa var. Pisang Kepok.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb1: LS479560; rpb2: LS479308;
tef1: LS479757.
culmorum Fusarium (Wm.G. Sm.) Sacc., Syll. Fung. 10: 726.
1892.
Basionym:Fusisporium culmorum Wm.G. Sm., Diseases of field
and garden crops, chiefly as are caused by fungi: 209. 1884.
Synonyms:Fusarium schribauxii Delacr., Bull. Soc. Mycol.
France 6: 99. 1890.
Fusarium corallinum Mattir., Atti Accad. Sci. Ist. Bologna, Cl. Sci.
Fis., Mem. 6: 677. 1897, nom. illegit., Art. 53.1.
Fusarium versicolor Sacc., Syll. Fung. 16: 1099. 1902.
Fusarium heidelbergense Sacc., Ann. Mycol. 8: 346. 1910.
?Fusarium neglectum Jacz., Bull. Trimestriel Soc. Mycol.
France 28: 348. 1912.
Fusarium rubiginosum Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land-Forstw. 8: 108. 1910 [1913].
Fusarium culmorum var. leteius Sherb., Mem. Cornell Univ.
Agric. Exp. Sta. 6: 242. 1915.
Fusarium culmorum var. majus Wollenw., Fusaria Autogr. Delin.
2: 613. 1924.
Lectotypus (hic designatus, MBT 10000675): UK, infected ear of
Triticum sp., 1884, W.G. Smith, in Diseases of field and garden
crops, chiefly as are caused by fungi: 210. fig. 92.
Epitypus (hic designatus, MBT 10000676): Denmark, moldy
kernel of Hordeum vulgare, 3 Feb. 1986, U. Thrane, CBS 417.86
(preserved as metabolic inactive culture).
Ex-epitype culture: CBS 417.86 = FRC R-8504 = IMI 309344=
NRRL 25475.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971),Gerlach & Nirenberg (1982) and Leslie
& Summerell (2006).
Diagnostic DNA barcodes:rpb1: JX171515; rpb2: JX171628;
tef1: MW233082.
Notes: No holotype specimen could be located. Therefore, an
illustration is designated as lectotype and CBS 417.86 is
designated as epitype as this isolate is commonly used as an
authentic strain for F. culmorum in literature (Ward et al. 2002,
O'Donnell et al. 2013,2020,Geiser et al. 2021).
cuneiforme Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 129. 1915.
(See Fusarium ventricosum)
Typus: ?CUP-007474.
Type locality:USA, New York.
Type substrate:Solanum tuberosum.
FUSARIUM REDELIMITED
www.studiesinmycology.org 105

Notes: Synonym fide Wollenweber & Reinking (1935) and Booth
(1971). Lectotypification pending study of material lodged in
CUP.
cuneirostrum Fusarium O'Donnell & T. Aoki, Mycoscience 46:
170. 2005.
(See Fusarium azukiicola)
Holotypus: BPI 843353.
Ex-type culture: FRC S-1551 = MAFF 239038 = NRRL 31157.
Type locality:USA, Michigan, Presque Isle.
Type substrate:Phaseolus vulgaris.
Descriptions and illustrations: See Aoki et al. (2005).
Diagnostic DNA barcodes:rpb1: KJ511271; rpb2: FJ240389;
tef1: MAEA01003816.
curvatum Fusarium L. Lombard & Crous, Persoonia 43: 21.
2018 [2019].
Holotypus: CBS H-23611.
Ex-type culture: CBS 238.94 = NRRL 26422 = PD 94/184.
Type locality:Netherlands.
Type substrate:Beaucarnea sp.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb1: MW928804; rpb2: MH484893;
tef1: MH484984.
cuticola Fusarium (R. Blanch.) Gu
eg., Champ. Paras. Homme:
262. 1904.
(See Fusarium oxysporum)
Basionym:Selenosporium cuticola R. Blanch., Compt. Rend.
Hebd. S
eances Acad. Sci. 111: 479. 1890.
Holotypus: Not located.
Type locality:France.
Type substrate: Skin of Chamaeleo vulgaris and Lacerta viridis
(lizards).
Notes: Synonym fide Wollenweber & Reinking (1935). Based on
the substrate, this species could belong to the genus Bisifusa-
rium. However, the protologue is not definitive, and recollection
from type substrate is needed to confirm its taxonomic position.
cyanescens Fusarium (G.A. de Vries et al.)O'Donnell et al.,
Index Fungorum 440: 2. 2020.
Neocosmospora cyanescens (G.A. de Vries et al.) Summerb.
et al., Biology of Microfungi (Cham): 183. 2016.
Basionym:Phialophora cyanescens G.A. de Vries et al., Antonie
van Leeuwenhoek 50: 150. 1984.
Synonyms:Cylindrocarpon cyanescens (G.A. de Vries et al.)
Sigler, J. Clin. Microbiol. 29: 1858. 1991.
Holotypus: CBS 518.82 (maintained as metabolically inactive
culture).
Ex-type culture: CBS 518.82.
Type locality:Netherlands, Groningen Province, Groningen.
Type substrate: Subcutaneous tissue of the right foot of a male
Homo sapiens.
Descriptions and illustrations: See de Vries et al. (1984) and
Zoutman & Sigler (1991).
Diagnostic DNA barcodes:rpb1: MW218110; rpb2: LR583826;
tef1: LR583605.
cyanostomum Fusarium (Sacc. & Flageolet) O'Donnell & Geiser,
Phytopathology 103: 404. 2013.
Cyanonectria cyanostoma (Sacc. & Flageolet) Samuels & P.
Chaverri, Mycol. Progr. 8: 56. 2009.
Basionym:Nectria cyanostoma Sacc. & Flageolet, Rendiconti
Congr. Bot. Palermo 1902: 53. 1902.
Lectotypus: BPI 551652, designated in Samuels et al. (2009).
Epitypus: BPI 748307, designated in Samuels et al. (2009).
Ex-epitype culture: BBA 70964 = CBS 101734 = G.J.S. 98-127.
Epitype locality:France.
Epitype substrate:Buxus sempervirens.
Descriptions and illustrations: See Samuels et al. (2009).
Diagnostic DNA barcodes:rpb1: JX171546; rpb2: HQ897759;
tef1: HM626647.
cyclogenum Fusarium Sacc., Nuovo Giorn. Bot. Ital. 8: 197.
1876.
?Gloeosporium orbiculare (Berk.) Berk., Just's Bot. Jahresber.
4: 1274. 1876.
Basionym:Cytospora orbicularis Berk., Ann. Nat. Hist. 1: 207.
1838.
Synonyms:Myxosporium orbiculare (Berk.) Berk., Outl. Brit.
Fungol.: 325. 1860.
Colletotrichum orbiculare (Berk.) Arx, Verh. Kon. Ned. Akad.
Wetensch., Afd. Natuurk., Sect. 2, 51: 112. 1957, nom. inval., Art.
36.2 (Melbourne).
Sirogloea orbicularis (Berk.) Arx, Verh. Kon. Ned. Akad.
Wetensch., Afd. Natuurk., Sect. 2, 51: 113. 1957, nom. inval., Art.
36.2 (Melbourne).
Syntypes:InBPI&S.
Type locality:Italy, Treviso, Selva.
Type substrate:Citrullus sp.
Note:Cytospora orbicularis is not a Colletotrichum nor a Fusa-
rium (small ellipsoidal conidia discharged in tendrils) as outlined
in Damm et al. (2013).
cydoniae Fusarium Allesch., Ber. Bot. Vereines Landshut 12:
130. 1892.
(See Fusarium lateritium)
Holotypus:InM.
Type locality:Germany, München.
Type substrate:Cydonia vulgaris.
Note: Synonym fide Wollenweber & Reinking (1935).
cydoniae Fusarium Roum. & Fautrey, Rev. Mycol. (Toulouse) 14:
170. 1892, nom. illegit., Art. 53.1, non Allescher 1892.
(See Fusarium rollandianum)
cydoniae Fusarium (Schulzer) Sacc. & Traverso, Syll. Fung. 19:
724. 1910, nom. illegit., Art. 53.1, non Allescher 1892, nec Roum.
& Fautrey 1892.
Basionym:Selenosporium cydoniae Schulzer, Verhand. K.K.
Zool.-Bot. Ges. Wien 21: 1240. 1871.
(See Fusarium lateritium)
Holotypus: Not located.
Type locality:Austria, Vienna.
Type substrate:Cydonia vulgaris.
Note: Synonyms fide Wollenweber & Reinking (1935).
cylindricum Fusarium (Mont.) Sacc., Syll. Fung. 4: 720. 1886.
Basionym:Fusisporium cylindricum Mont., Ann. Sci. Nat., Bot.,
s
er. 2, 17: 120. 1842.
(See Fusarium candidum (Link) Sacc.)
Holotypus: ?PC.
Type locality:Cuba.
Type substrate: Sarcocarp of unknown fruit.
CROUS ET AL.
106

Note: Synonyms fide Wollenweber & Reinking (1935).
cymbiferum Fusarium Berk. & M.A. Curtis, in Berkeley, Grevillea
3: 98. 1875.
Colletotrichum coccodes (Wallr.) S. Hughes, Canad. J. Bot.
36: 754. 1958.
Basionym:Chaetomium coccodes Wallr., Fl. Crypt. Germ. 2:
265. 1833.
Synonyms:Fusarium effusum Schwein., Trans. Amer. Philos.
Soc., n.s. 4: 302. 1832 [1834].
Fusarium georginae Corda, Icon. Fung. 2: 4. 1838.
Vermicularia atramentaria Berk. & Broome, Ann. Mag. Nat. Hist.
5: 378. 1850.
Colletotrichum atramentarium (Berk. & Broome) Taubenh., Mem.
New York Bot. Gard. 6: 554. 1916.
Acrothecium solani Sacc., Michelia 1(3): 74. 1877.
Fusisporium elasticae Thüm., Boll. Soc. Adriat. Sci. Nat. Trieste
3: 440. 1877.
Fusarium elasticae (Thüm.) Sacc., Syll. Fung. 4: 711. 1886.
Gloeosporium elasticae Cooke & Massee, in Cooke, Grevillea
18: 74. 1890.
Fusarium foliicola Allesch., Hedwigia 34: 289. 1895.
Gloeosporium foliicola (Allesch.) Wollenw., Fusarien: 325. 1935,
nom. illegit., Art. 53.1.
Colletotrichum solanicola O'Gara, Mycologia 7: 39. 1915.
Colletotrichum biologicum Chaudhuri, Ann. Bot. 38: 735. 1924.
Holotypus: ?K(M).
Type locality:USA.
Type substrate: Stems of some herbaceous plants.
Note: Synonyms fide Wollenweber & Reinking (1935).
cypericola Fusarium Henn., Hedwigia 48: 116. 1908.
Libertella cypericola (Henn.) Wollenw., Fusaria Autogr. Delin.
1: 486. 1916.
Syntype:InBfide Hein (1988).
Type locality:Brazil, Par
a.
Type substrate:Cyperus exaltatus.
Note: Synonym fide Wollenweber & Reinking (1935).
dactylidis Fusarium T. Aoki et al., Mycologia 107: 412. 2015.
Holotypus: BPI 892886.
Ex-type culture: CBS 119181 = ICMP 5269 = NRRL 29298.
Type locality:New Zealand, Manawatu, Palmerston North.
Type substrate:Dactylis glomerata.
Descriptions and illustrations: See Aoki et al. (2015).
Diagnostic DNA barcodes:rpb1: KM361654; rpb2: KM361672;
tef1: DQ459748.
decemcellulare Fusarium Brick, Jahresber. Vereinigung Angew.
Bot. 6: 227. 1908.
(See Fusarium colorans)
Holotypus: ?HBG.
Type locality:Cameroon.
Type substrate:Theobroma cacao.
decipiens Fusarium Cooke & Massee, in Cooke, Handb. Austral.
Fungi: 388. 1892, nom. inval., Art. 39.1.
(See Fusarium candidum (Link) Sacc.)
Authentic material: ?K(M).
Original locality:Australia, Queensland.
Original substrate:Ficus aspera.
Note: Synonym fide Wollenweber & Reinking (1935).
deformans Fusarium J. Schröt., Jahresber. Schles. Ges. Vaterl.
Cult. 61: 179. 1883.
Gloeosporium deformans (J. Schröt.) Lind, Ann. Bot. 7: 19.
1908.
Synonyms:Fusamen deformans (J. Schröt.) P. Karst., Bidrag
K€
annedom Finlands Natur Folk 51: 485. 1892.
Calogloeum deformans (J. Schröt.) Nannf., Svensk Bot. Tidskr.
25: 25. 1931.
Platycarpium deformans (J. Schröt.) Petr., Sydowia 7: 296. 1953.
Holotypus:InBfide Wollenweber (1916 –1935).
Type locality:Poland, Breslau.
Type substrate:Salix cinerea.
Note: Synonyms fide Wollenweber & Reinking (1935).
delacroixii Fusarium Sacc., Syll. Fung. 10: 725. 1892.
(See Fusarium sambucinum)
Replaced synonym:Fusarium asparagi Delacr., Bull. Soc. Mycol.
France 6: 99. 1890, nom. illegit., Art. 53.1, non Fusarium
asparagi Briard 1890.
Lectotypus (hic designatus, MBT 10000677): France, Paris,
Asparagus officinalis, 1890, M.G. Delaroix, in Bull. Soc. Mycol.
France 6, pl. XV. fig. III.
Notes: Synonyms fide Wollenweber & Reinking (1935). No ho-
lotype material is available for the replaced synonym F. asparagi
Delacr. and therefore, an illustration from the original protologue
is designated as lectotype.
delphinoides Fusarium Schroers et al., Mycologia 101: 57. 2009.
Bisifusarium delphinoides (Schroers et al.) L. Lombard &
Crous, Stud. Mycol. 80: 224. 2015.
Holotypus: CBS H-20124.
Ex-type culture: CBS 120718 = NRRL 53290.
Type locality:South Africa, Western Cape Province, Clanwilliam.
Type substrate:Hoodia gordonii stem lesions.
Descriptions and illustrations: See Schroers et al. (2009).
Diagnostic DNA barcodes:rpb1: KM232210; tef1: EU926296.
denticulatum Fusarium Nirenberg & O'Donnell, Mycologia 90:
445. 1998.
Holotypus: B 70 0001691.
Ex-type culture: BBA 67772 = CBS 407.97 = IMI 376115 = NRRL
25311.
Type locality:USA, Louisiana.
Type substrate:Ipomoea batatas.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998)
and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: MT010953; rpb2: MT010970;
tef1: KR909385.
derridis Fusarium Henn., Beibl. Hedwigia 41: (66). 1902.
(See Fusarium coccidicola)
Holotypus:InBfide Hein (1988).
Type locality:Papua New Guinea.
Type substrate:Derris sp.
Note: Synonym fide Wollenweber & Reinking (1935).
desaboruense Fusarium N. Maryani et al., Persoonia 43: 59.
2019.
(See Fusarium sacchari)
Holotypus: InaCC F951 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F951.
Type locality:Indonesia, East Nusa Tenggara, Sikka Flores,
Kecamatan Waigate, Desa Boru.
Type substrate:Musa var. Pisang Kepok.
Descriptions and illustrations: See Maryani et al. (2019b).
FUSARIUM REDELIMITED
www.studiesinmycology.org 107

Diagnostic DNA barcodes:rpb1: LS479870; rpb2: LS479852.
desciscens Fusarium Oudem., Ned. Kruidk. Arch., 2 s
er., 5: 515.
1889.
(See Fusarium sarcochroum)
Holotypus: ?L.
Type locality:Netherlands, Zuid-Holland Province, Den Haag,
Scheveningen.
Type substrate:Sarothamnus vulgaris.
Note: Synonym fide Wollenweber & Reinking (1935).
detonianum Fusarium Sacc. (as ‘de-tonianum’), Syll. Fung. 4:
708. 1886, nom. illegit., Art. 52.1.
(See Fusarium miniatum Sacc.)
Authentic material: Not located.
Original locality:Italy.
Original substrate: Sporangium of Cyathus vernicosa.
dianthi Fusarium Prill. & Delacr., Compt. Rend. Hebd. S
eances
Acad. Sci. 129: 745. 1899.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:France, Antibes.
Type substrate:Dianthus caryophyllus.
didymum Fusarium (Harting) Lindau, Rabenh. Krypt.-Fl. Ed. 2,
1(9): 574. 1909.
Basionym:Fusisporium didymum Harting, Nieuwe Verh. Eerste
Kl. Kon. Ned. Inst. Wetensch. Amsterdam 12: 228. 1846.
(See Fusarium eichleri)
Lectotypus (hic designatus, MBT 10000678): Netherlands,So-
lanum tuberosum, date unknown, Harting, in Nieuwe Verh.
Eerste Kl. Kon. Ned. Inst. Wetensch. Amsterdam 12 (1846), tab.
II, figs 2–4.
Notes: Requires recombination into Neonectria after further
investigation. No preserved specimen could be located and
therefore an illustration is designated as lectotype.
diffusum Fusarium Carmich., Grevillea 16: 81. 1888.
(See Fusarium avenaceum)
Holotypus: ?K(M).
Type locality:UK, Scotland, Appin.
Type substrate: Stems of Asteraceae (thristle).
Note: Synonym fide Wollenweber & Reinking (1935).
dimerum Fusarium Penz., Michelia 2: 484. 1882.
Bisifusarium dimerum (Penz.) L. Lombard & Crous, Stud.
Mycol. 80: 225. 2015.
Synonyms:Fusarium aquaeductuum var. dimerum (Penz.)
Raillo, Fungi of the Genus Fusarium: 279. 1950.
Microdochium dimerum (Penz.) Arx, Trans. Brit. Mycol. Soc. 83:
374. 1984.
?Fusisporium flavum Fr., Syst. Mycol. 3: 444. 1832.
?Pionnotes flava (Fr.) Sacc., Syll. Fung. 4: 726. 1886.
?Fusarium flavum (Fr.) Wollenw., Z. Parasitenk. 3: 305. 1931.
?Fusarium aquaeductuum var. flavum (Fr.) Raillo, Fungi of the
Genus Fusarium: 280. 1950.
Selenosporium aurantiacum Bonord., Abh. Naturf. Ges. Halle 8:
97. 1864, nom. illegit., Art. 53.1.
Fusarium bonordenii Sacc., Syll. Fung. 4: 699. 1886.
Fusarium baptisiae Henn., Notizbl. Bot. Gart. Berlin 2: 383. 1899.
Fusarium subnivale Höhn., in Penther & Zederbauer, Ann. K.K.
Naturhist. Hofmus. 20: 369. 1905.
Fusarium dimerum var. majusculum Wollenw., Fusaria Autogr.
Delin. 1: 90. 1916.
?Fusarium pusillum Wollenw., Fusaria Autogr. Delin. 2: 550. 1924.
?Fusarium dimerum var. pusillum (Wollenw.) Wollenw., Fusaria
Autogr. Delin. 3: 851. 1930.
Fusarium dimerum var. violaceum Wollenw., Fusaria Autogr.
Delin. 3: 854. 1930.
Lectotypus: Fig. 1212 in Penzig (1882), designated in Schroers
et al. (2009).
Epitypus: CBS H-20129, designated in Schroers et al. (2009).
Ex-epitype culture: CBS 108944 = NRRL 36140.
Epitype locality:Netherlands.
Epitype substrate: Blood of Homo sapiens with acute myeloid
leukemia.
Descriptions and illustrations: See Schroers et al. (2009).
Diagnostic DNA barcodes:rpb1: KM232212; rpb2: KM232363;
tef1: EU926334.
Note: Synonyms fide Wollenweber & Reinking (1935) and Booth
(1971).
diminutum Fusarium (Sand.-Den. & Crous) O'Donnell et al., In-
dex Fungorum 440: 2. 2020.
Neocosmospora diminuta Sand.-Den. & Crous, Persoonia 43:
127. 2019.
Holotypus: CBS H-23979.
Ex-type culture: CBS 144390 = MUCL 18798.
Type locality:?Ivory Coast.
Type substrate: Treated wood of Coelocaryon preussii.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834218; rpb2: LR583828;
tef1: LR583607.
dimorphum Fusarium J.V. Almeida & Sousa da C^
amara, Revista
Agron. (Lisbon) 1: 306. 1903.
(See Fusarium buxicola)
Holotypus: MA-Funhist:6036-1.
Type locality:Portugal.
Type substrate:Buxus sempervirens.
Note: Synonym fide Wollenweber & Reinking (1935).
diplosporum Fusarium Cooke & Ellis, Grevillea 7: 38. 1878.
(See Fusarium sarcochroum)
Holotypus: ?K(M).
Type locality:USA, New Jersey.
Type substrate: Stems of Solanum tuberosum.
Note: Synonym fide Wollenweber & Reinking (1935).
discoideum Fusarium Fautrey & Roum., Rev. Mycol. (Toulouse)
13: 173. 1891.
(See Fusarium lateritium)
Syntype: ILL00220061 (Roumegu
ere, Fungi Sel. Gall. Exs. no.
5898).
Type locality:France, Noidan.
Type substrate:Sambucus nigra.
Note: Synonym fide Wollenweber & Reinking (1935).
discolor Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst.
Land-Forstw. 8: 114. 1913.
(See Fusarium sambucinum)
Holotypus: ?S-F45617.
Type locality:Germany, Berlin.
Type substrate:Solanum tuberosum.
Note: Synonym fide Wollenweber & Reinking (1935).
diversisporum Fusarium Sherb., Mem. Cornell Univ. Agric.
Exp. Sta. 6: 161. 1915.
CROUS ET AL.
108

Typus: ?CUP-007430.
Type locality:USA, New York.
Type substrate:Solanum tuberosum
Descriptions and illustrations: See Sherbakoff (1915) and
Gerlach & Nirenberg (1982).
Notes: This species is recognised by Gerlach & Nirenberg (1982)
who considered isolate CBS 795.70 as authentic for
F. diversisporum. However, typification of F. diversisporum first
requires study of the specimen lodged in CUP.
dlaminii Fusarium Marasas et al., Mycologia 77: 971. 1986
[1985].
Holotypus: DAOM 191112.
Ex-type culture: ATCC 58097 = BBA 69859 = CBS
175.88 = DAOM 191112 = FRC M-1637 = IMI 290241 = MRC
3032 = NRRL 13164.
Type locality:South Africa, Eastern Cape Province, Butterworth.
Type substrate: Plant debris in soil.
Descriptions and illustrations: See Marasas et al. (1985) and
Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: KU171681; rpb2: KU171701;
tef1: KU171721.
domesticum Fusarium (Fr.) H.P. Bachm., LWT –Food Sci.
Technol. 38: 405. 2005, nom. inval., Art. 41.5, See Art. 41.7.
Bisifusarium domesticum (Fr.) L. Lombard & Crous, Stud.
Mycol. 80: 225. 2015.
Basionym:Trichothecium domesticum Fr., Syst. Mycol. 3: 427.
1832.
Neotypus: CBS 434.34 (preserved as metabolically inactive
culture), designated in Bachmann et al. (2005).
Ex-neotype culture: ATCC 13417 = CBS 434.34 = MUCL 9826.
Type locality:Belgium.
Type substrate: Cheese.
Descriptions and illustrations: See Schroers et al. (2009).
dominicanum Fusarium Cif., Sydowia 9: 325. 1955
Holotypus:?PAV.
Type locality:Dominican Republic, Santo Domingo, Villa
Altagracia.
Type substrate:Byrsonima sp. (between mycelium of Meliola
byrsonimae).
Descriptions and illustrations: See Ciferri (1955).
Notes:Ciferri (1955) considered this a ‘conventional’species as
the author indicated that more information based on culture
characteristics is required. No living material of this species could
be located and recollection from the type locality is required.
duofalcatisporum Fusarium J.W. Xia et al., Persoonia 43: 201.
2019.
Holotypus: CBS H-24056.
Ex-type culture: CBS 384.92 = NRRL 36448.
Type locality:Sudan, Nile Province.
Type substrate: Seeds of Phaseolus vulgaris.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: GQ505830; tef1: GQ505652.
duoseptatum Fusarium Maryani et al., Stud. Mycol. 92: 181.
2018 [2019].
Holotypus: InaCC F916 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F916.
Type locality:Indonesia, Central Kalimantan, Kapuas Timur,
Anjir Serapat Tengah.
Type substrate: Pseudostem of Musa var. Pisang Kepok.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb1: LS479495; rpb2: LS479239;
tef1: LS479688.
echinatum Fusarium Sand.-Den. & G.J. Marais, Stud. Mycol.
98 (no. 100116): 47. 2021.
Holotypus: CBS H-24658.
Ex-type culture: CAMS 000733 = CBS 146497 = CPC 30815.
Type locality:South Africa.
Type substrate: Unidentified tree.
Descriptions and illustrations: See this study.
Diagnostic DNA barcodes:rpb1: MW834187; rpb2: MW834004;
tef1: MW834273.
echinosporum Fusarium Sibilia, Ann. Reale. Ist. Super. Agrar.
Forest., ser. 2, 1: 77. 1925.
Holotypus: Not located.
Type locality:Italy.
Type substrate:Cedrus deodara.
Descriptions and illustrations: See Sibilia (1925).
Notes: This species is recognised in Petrak's Lists V. 3.
Wollenweber & Reinking (1935) mention this species, but they
did not treat it any further. Booth (1971) considered it a possible
synonym of F. graminearum. Requires recollection from the type
locality and substrate.
effusum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s., 4:
302. 1832 [1834].
(See Fusarium cymbiferum)
Holotypus: PH00062491.
Type locality:USA, Pennsylvania, Northampton, Bethlehem.
Type substrate:Hypericum frondosum.
Note: Synonym fide Wollenweber & Reinking (1935).
eichleri Fusarium Bres., Ann. Mycol. 1: 130. 1903.
(See Fusarium candidum Ehrenb.)
Holotypus: S-F45618.
Type locality:Poland.
Type substrate:Salix caprea.
elaeidis Fusarium L. Lombard & Crous, Persoonia 43: 23. 2018
[2019].
Holotypus: CBS H-23612.
Ex-type culture: CBS 217.49 = NRRL 36358.
Type locality:Zaire.
Type substrate:Elaeis sp.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb1: MW928805; rpb2: MH484870;
tef1: MH484961.
elasticae Fusarium (Thüm.) Sacc., Syll. Fung. 4: 711. 1886.
Basionym:Fusisporium elasticae Thüm., in Bolle & Thümen,
Boll. Soc. Adriat. Sci. Nat. Trieste 3: 440. 1877.
(See Fusarium cymbiferum)
Lectotypus (hic designatus, MBT 10000679): Italy, Gorizia, Ficus
elastica, 1877, F. de Thümen, in Bolle & Thümen, Boll. Soc.
Adriat. Sci. Nat. Trieste 3, tab. I, fig. 13.
Notes: Synonyms fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
FUSARIUM REDELIMITED
www.studiesinmycology.org 109

elegans Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst.
Land-Forstw. 8: 94. 1913, nom. inval., Art. 36.1(a).
(See Fusarium oxysporum)
Notes: Appel and Wollenweber (l.c.) proposed this name only
provisionally under Fusarium solani. They added an illustration of
conidia on page 38 (fig. 2D).
elegans Fusarium W. Yamam. & Maeda, Trans. Mycol. Soc.
Japan 3: 115. 1962.
Neocosmospora elegans (W. Yamam. & Maeda) Sand.-Den. &
Crous, Persoonia 43: 127. 2019.
Basionym:Nectria elegans W. Yamam. & Maeda, Hyogo Univ.
Agric. ser. Agric. Biol. 3: 15. 1957.
Synonyms:?Fusarium solani f.xanthoxyli Y. Sakurai & Matuo,
Ann. Phytopathol. Soc. Japan 26: 117. 1961, nom. inval., Art.
39.1.
?Hypomyces solani f. xanthoxyli Y. Sakurai & Matuo, Ann.
Phytopathol. Soc. Japan 26: 117. 1961, nom. inval., Art. 39.1.
Fusarium yamamotoi O'Donnell et al., Index Fungorum 440: 5.
2020.
Lectotypus:figs 1–9, p. 16, in Yamamoto et al. (1957), desig-
nated in Sandoval-Denis et al. (2019).
Epitypus: CBS H-23980, designated in Sandoval-Denis et al.
(2019).
Ex-epitype culture: ATCC 42366 = CBS 144396 = MAFF
238541 = NRRL 22277 = SUF XV-1.
Epitype locality:Japan,Hy

ogo.
Epitype substrate: Trunk of Zanthoxylum piperitum
Diagnostic DNA barcodes:rpb1: MW218113; rpb2: FJ240380;
tef1: AF178336
Note: This is a valid species name that is not a
homonym since the name F. elegans Appel & Wollenw. is an
invalid name.
eleocharidis Fusarium Rostr. (as ‘heleocharidis’), in Thümen,
Mycoth. Univ., Cent. 22: no. 2185. 1883.
(See Fusarium heterosporum)
Syntypes: In BPI, NEB & S (Mycoth. Univ., Cent. 22: no. 2185).
Type locality:Denmark, Fyn, Langeland.
Type substrate:Eleocharis palustris.
Notes: Synonym fide Wollenweber & Reinking (1935).
elongatum Fusarium Cooke, Grevillea 19: 4. 1890.
(See Fusarium ciliatum)
Holotypus: In K(M), Colenso 538 fide Index Fungorum .
Type locality:New Zealand.
Type substrate: Twigs.
Note: Synonym fide Wollenweber & Reinking (1935).
elongatum Fusarium De Wild., Ann. Soc. Belge Microsc.17: 42.
1893, nom illegit., Art. 53.1.
Replacing synonym:Fusarium longissimum Sacc. & P. Syd.,
Syll. Fung. 14: 1128. 1899.
Amniculicola longissima (Sacc. & P. Syd.) Nadeeshan & K.D.
Hyde, IMA Fungus 7: 301. 2016.
Synonyms:Anguillospora longissima (Sacc. & P. Syd.) Ingold,
Trans. Brit. Mycol. Soc. 25: 402. 1942.
Holotypus: Not located.
Type locality:Belgium, Brussels, Botanical Garden.
Type substrate: Submerged plant material.
Note: Synonyms fide Rossman et al. (2016).
elongatum Fusarium O.A. Pratt, J. Agric. Res. 13: 84. 1918, nom.
illegit., Art. 53.1.
(See Fusarium sambucinum)
Authentic material: Not located.
Original locality:USA, Idaho.
Original substrate: Soil.
Note: Synonym fide Wollenweber & Reinking (1935).
elongatum Fusarium Reinking, Zentralbl. Bakteriol. Parasitenk.,
Abt. 2, 89: 511. 1934, nom. illegit., Art. 53.1.
(See Fusarium sublunatum)
Authentic material: B 70 0100189.
Original culture: CBS 190.34 = NRRL 20897.
Original locality:Costa Rica.
Original substrate: Soil from Musa sapientum and Theobroma
cacao plantation.
Diagnostic DNA barcodes:rpb1: KX302927; rpb2: KX302935;
tef1: KX302919.
Note: Synonym fide Wollenweber & Reinking (1935).
ensiforme Fusarium Wollenw. & Reinking, Phytopathology 15:
169. 1925.
Synonym:Fusarium javanicum var. ensiforme (Wollenw. &
Reinking) Wollenw., Z. Parasitenk. 3: 483. 1931.
Fusarium javanicum subsp. ensiforme (Wollenw. & Reinking)
Raillo, Fungi of the Genus Fusarium: 229. 1950.
Holotypus: Not located.
Type locality:Honduras.
Type substrate: Rotten fruit of Ficus sp.
Notes: Synonyms fide Wollenweber & Reinking (1935). Syno-
nym of F. javanicum fide Gerlach & Nirenberg (1982). Status
unclear [see Sandoval-Denis et al. (2019)].
entomophilum Fusarium Petch, Trans. Brit. Mycol. Soc. 11: 260.
1926.
(See Fusarium lateritium)
Holotypus: ?K(M).
Type locality:Sri Lanka, Suduganga.
Type substrate:Clitellaria heminopla.
Note: Synonym fide Wollenweber & Reinking (1935).
epicoccum Fusarium McAlpine, Fungus Diseases of Citrus trees
in Australia: 113. 1899.
(See Fusarium larvarum)
Lectotypus (hic designatus, MBT 10000680): Australia, Victoria,
Melbourne, Aspidiotus aurantium on Citrus deliciosa, 1899, D.
McAlpine, in Fungus Diseases of Citrus trees in Australia, figs
177–180.
Note: Synonym fide Wollenweber & Reinking (1935). No holo-
type specimen could be located and therefore an illustration is
designated as lectotype.
epimyces Fusarium Cooke, Grevillea 17: 15. 1888, nom. inval.,
Art. 38.1(a).
(See Fusarium azukiicola)
Authentic material: In K(M) fide Index Fungorum.
Original locality:UK, Reading.
Original substrate:Scleroderma sp.
Note: Synonym fide Wollenweber & Reinking (1935).
episphaeria Fusarium (Tode) W.C. Snyder & H.N. Hansen, Amer.
J. Bot. 32: 662. 1945.
Dialonectria episphaeria (Tode) Cooke (as ‘episph
æ
rica’),
Grevillea 12: 82. 1884.
CROUS ET AL.
110

Basionym:Sphaeria episphaeria Tode, Fung. Mecklenb. Sel. 2:
21. 1791.
Synonyms:Nectria episphaeria (Tode) Fr., Summa Veg. Scand.
2: 388. 1849.
Cucurbitaria episphaeria (Tode) Kuntze, Revis. Gen. Pl. 3: 461.
1898.
Cosmospora episphaeria (Tode) Rossman & Samuels, Stud.
Mycol. 42: 121. 1999.
Hypoxylon phoeniceum Bull., Hist. Champ. France 1: 171. 1791.
Sphaeria sanguinea var. media Fr., Syst. Mycol. 2: 453. 1823.
Nectria episphaeria var. media (Fr.) Sacc., Syll. Fung. 2: 497.
1883.
Dialonectria episphaeria var. verruculosa Cooke, Grevillea 12:
82. 1884.
Nectria episphaeria var. verruculosa (Cooke) Berl. & Voglino,
Syll. Fung., Addit. Vol. 1–4: 203. 1886.
Nectria episphaeria var. kretzschmariae Henn., Bot. Jahrb. Syst.
14: 364. 1891.
Nectria episphaeria var. gregaria Starb€
ack, Ark. Bot. 5: 9. 1905.
Lectotypus: L 0112704 (Herb. Lugd. Bat. 910267659 ex Herb.
Persoon), selected in Booth (1959).
Type locality:Unknown.
Type substrate: Partially decorticated twig of Diatrype stigma.
episphaericum Fusarium (Cooke & Ellis) Sacc., Syll. Fung. 4:
708. 1886.
Basionym:Fusisporium episphaericum Cooke & Ellis, Grevillea
5: 50. 1876.
Cosmospora nothepisphaeria (Samuels) Rossman & Sam-
uels, Stud. Mycol. 42: 123. 1999.
Basionym:Nectria nothepisphaeria Samuels, Mycol. Pap. 164:
30. 1991.
Synonyms:Fusarium ciliatum var. episphaericum (Cooke & Ellis)
Wollenw., Fusaria Autogr. Delin. 3: 871. 1930.
Fusarium ciliatum var. majus Wollenw., Fusaria Autogr. Delin. 3:
872. 1930.
Lectotypus (of Fusisporium episphaericum, hic designatus, MBT
10000681): USA, New Jersey, parasitic on Diatrypella sp. on
Corylus avellana, 1876, M.C. Cooke & J.B. Ellis, in Grevillea 5,
pl. 80, fig. 10.
Note: No holotype specimen could be located and therefore an
illustration is designated as lectotype.
epistroma Fusarium (Höhn.) C. Booth (as ‘epistromum’), The
Genus Fusarium: 66. 1971.
Fusicolla epistroma (Höhn.) Gr€
afenhan & Seifert, Stud. Mycol.
68: 100. 2011.
Basionym:Dendrodochium epistroma Höhn., Sitzungsber. Kai-
serl. Akad. Wiss. Wien. Math.-Naturwiss. Cl., Abt. 1., 118: 424.
1909.
Lectotypus: B 700014042, designated in Gr€
afenhan et al. (2011).
Lectotype locality:Germany, Brandenburg, “Schmidt's Grund”
near Tamsel.
Lectotype substrate: Old stromata of Diatrypella favacea.
Epitypus: IMI 85601, designated in Gr€
afenhan et al. (2011).
Ex-epitype culture: ATCC 24369 = BBA 62201 = NRRL
20439 = NRRL 20461.
Epitype locality:UK, Yorkshire.
Epitype substrate:Diatrypella on Betula.
Diagnostic DNA barcode:rpb2: HQ897765.
epithele Fusarium McAlpine, Fungus Diseases of Citrus trees in
Australia: 80. 1899.
(See Fusarium reticulatum)
Holotypus: VPRI 2563.
Type locality:Australia, New South Wales.
Type substrate: Rotten fruit of Citrus xlimon.
Note: Synonym fide Wollenweber & Reinking (1935).
equinum Fusarium Növgaard, Science, N.Y. 14: 899. 1901.
Holotypus: Not located.
Type locality:USA.
Type substrate: Infected skin of Equus sp. (horse).
Notes: Status unclear. Doubtful species fide Wollenweber &
Reinking (1935). Based on the original substrate, this species
might belong to the medically important genus Neocosmospora.
However, recollection is required to confirm its taxonomic
affiliation.
equiseti Fusarium (Corda) Sacc., Syll. Fung. 4: 707. 1886.
Basionym:Selenosporium equiseti Corda, Icon. Fung. 2: 7. 1838.
Synonyms:Fusisporium ossicola Berk. & M.A. Curtis, Grevillea
3: 147. 1875.
Fusarium ossicola (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4:
714. 1886.
Fusarium nectriae-palmicolae Henn., Bot. Jahrb. Syst. 23: 290.
1896.
Fusarium gibbosum Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land-Forstw. 8: 190. 1910.
Fusarium roseum var. gibbosum (Appel & Wollenw.) Messiaen &
R. Cass., Ann. Inst. Natl. Rech. Agron. Tunisie 19: 435. 1968,
nom. inval., Art. 41.5.
Fusarium roseum var. gibbosum (Appel & Wollenw.) Messiaen &
R. Cass., Agronomie 8: 220. 1988, nom. inval., Art. 41.1.
Fusarium bullatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6:
198. 1915.
Fusarium equiseti var. bullatum (Sherb.) Wollenw., Fusaria
Autogr. Delin. 3: 916. 1930.
Fusarium gibbosum var. bullatum (Sherb.) Bilaĭ, Mikrobiol.
Zhurn. 49: 6. 1987.
Fusarium bullatum var. roseum Sherb., Mem. Cornell Univ. Agric.
Exp. Sta. 6: 201. 1915.
Fusarium roseobullatum Wollenw. (as ‘roseo-bullatum'’), Fusaria
Autogr. Delin. 1: 117. 1916.
Fusarium vasinfectum var. pisi Schikora, Arbeiten. Biol. Anst.
Land-Forstwirt. 5: 188, pl. 7. 1906, nom. illegit., Art. 53.1.
Fusarium falcatum Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land-Forstw. 8: 184. 1910.
Fusarium falcatum var. fuscum Sherb., Mem. Cornell Univ. Agric.
Exp. Sta. 6: 138. 1915.
Fusarium equiseti var. crassum Wollenw., Fusaria Autogr. Delin.
3: 921. 1930.
Fusarium terrestre Manns, Bull. North Dakota Agric. Exp. Sta.:
no. 259. 1932.
Gibberella intricans Wollenw., Fusaria Autogr. Delin. 3: 810. 1930.
Fusarium eucheliae Sartory, R. Sartory & J. Mey., Ann. Mycol.
30: 471. 1932.
Fusarium equiseti var. intermedium Saccas, Agron. Trop. (Mar-
acay) 10: 49. 1955, nom. inval., Art. 39.1.
Lectotypus:(hic designatus, MBT 10001325): Czech Republic,
Kuchelbad, near Prague, on stems of Equisetum sp., 1836, AKJ.
Corda. Icon. Fung. 2, tab. IX, fig. 32.
Epitypus (hic designatus, MBT 10000682): Germany,
Braunschweig, Niedersachsen, soil, 3 Aug. 1994, H. I. Nirenberg,
CBS H-5570.
Ex-epitype culture: BBA 68556 = CBS 307.94 = NRRL 26419.
FUSARIUM REDELIMITED
www.studiesinmycology.org 111

Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971),Gerlach & Nirenberg (1982),Holubov
a-
Jechov
aet al. (1994) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb2: GQ505777; tef1: GQ505599.
Notes:Holubov
a-Jechov
aet al. (1994) incorrectly designated
CBS 307.94 (CBS H-5570) as neotype for Selenosporium
equiseti even though original material was available in PRM as
well as an illustration provided in the protologue. A lectotypifi-
cation rather than a neotypification was required. Therefore, the
original illustration is selected as lectotype and CBS H-5570 (=
CBS 307.94) is designated as epitype here, superseding the
neotype designation.
equiseticola Fusarium Allesch., Hedwigia 34: 289. 1895.
(See Fusarium scirpi)
Holotypus:InM.
Type locality:Germany, Oberammergau.
Type substrate: Dried stems of Equisetum limosum.
Note: Synonym fide Wollenweber & Reinking (1935).
equisetorum Fusarium Desm., Pl. Crypt. N. France: no. 1546/
1846? 1843.
Basionym:Hymenula equiseti Lib., Pl. Crypt. Arduenna 3: no.
236. 1834.
(See Fusarium oxysporum)
Syntypes: In BPI, BRU, CUP, ISC PH, S & UPS (Pl. Crypt.
Arduenna 3: no. 236).
Type locality:Belgium.
Type substrate:Equisetum limosum.
Notes: Synonym fide Wollenweber & Reinking (1935).
ershadii Fusarium M. Papizadeh et al., Europ. J. Pl. Pathol. 151:
693. 2018, nom. illegit., Art. 52.1.
Basionym:Cylindrocarpon tonkinense Bugnic., Encycl. Mycol.
11: 181. 1939.
(See Fusarium tonkinense)
erubescens Fusarium Berk. & M.A. Curtis, Grevillea 3: 98. 1875.
Synonym:Fusarium alabamense Sacc., Syll. Fung. 4: 722. 1886,
nom. illegit., Art. 52.1.
Holotypus: ?K(M).
Type locality:USA, Alabama, Beaumont.
Type substrate: Dead bark.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
erubescens Fusarium (Durieu & Mont.) Sacc., Syll. Fung. 4: 719.
1886, nom. illegit., Art. 53.1.
Basionym:Fusisporium erubescens Durieu & Mont., Exploration
scientifique de l'Alg
erie 1–9: 351. 1848.
(See Fusarium bacilligerum)
Holotypus: ?PC.
Type locality:Algeria,B

ejaïa.
Type substrate:Rhamnus alaternus.
Note: Synonym fide Wollenweber & Reinking (1935).
erubescens Fusarium Appel & Oven, Landwirtsch. Jahrb. 1905,
nom. illegit., Art. 53.1.
(See Fusarium acuminatum)
Authentic material: Not located.
Original locality:Germany.
Original substrate:Solanum lycopersicum.
Note: Synonym fide Wollenweber & Reinking (1935).
eucalypticola Fusarium Henn., Hedwigia 40: 355. 1901.
Holotypus:InBfide Hein (1988).
Type locality:Australia, Western Australia, Cranbrook.
Type substrate:Eucalyptus baxteri (syn. E. santalifolia)
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
eucalyptorum Fusarium Cooke & Harkn., Grevillea 9: 128. 1881.
(See Fusarium oxysporum)
Syntype: BPI 452103.
Type locality:USA, California, San Francisco Masonic Cemetery.
Type substrate:Eucalyptus sp.
Note: Synonym fide Arya & Jain (1962).
eucheliae Fusarium Sartory, R. Sartory & J. Mey., Ann. Mycol.
30: 471. 1932.
(See Fusarium equiseti)
Lectotypus (hic designatus, MBT 10000683): France, digestive
track of living caterpillar, 1932, A. Sartory, R. Sartory & J. Meyer,
in Ann. Mycol. 30: 473, figs 1–13.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
eumartii Fusarium C.W. Carp., J. Agric. Res. 5: 204. 1915.
(See Fusarium solani)
Lectotypus: Illustration Plate XIV, number 4, in Carpenter (1915),
designated in Sandoval-Denis et al. (2019).
Type locality:Unknown.
Type substrate:Solanum tuberosum.
euonymi Fusarium Syd., Beibl. Hedwigia 39: (6). 1900.
(See Fusarium lateritium)
Syntype: S-F45621 (Sydow, Mycoth. March. no. 4896).
Type al locality:Germany, Berlin.
Type substrate:Euonymus bungeanus.
Note: Synonym fide Wollenweber & Reinking (1935).
euonymi-japonici Fusarium Henn., Hedwigia 41: 139. 1902.
(See Fusarium lateritium)
Holotypus:InBfide Hein (1988).
Type locality:Germany, Berlin.
Type substrate:Euonymus japonicus.
Note: Synonym fide Wollenweber & Reinking (1935).
euwallaceae Fusarium S. Freeman et al., Mycologia 105: 1599.
2013.
Neocosmospora euwallaceae (S. Freeman et al.) Sand.-Den.
et al., Persoonia 43: 129. 2019.
Holotypus: BPI 884203.
Ex-type culture: CBS 135854 = NRRL 54722.
Type locality:Israel, central coastal region, Kibbutz Glil Yam.
Type substrate:Euwallacea sp. beetle infecting Persea ameri-
cana cv. Hass.
Descriptions and illustrations: See Freeman et al. (2013).
Diagnostic DNA barcodes:rpb1: JQ038021; rpb2: JQ038028;
tef1: JQ038007.
expansum Fusarium Schltdl., Fl. Berol. 2: 139. 1824.
Synonym:?Fusarium carpini Schulzer & Sacc., Hedwigia 23:
128. 1884.
Fusarium socium Sacc., Atti Ist. Veneto Sci. Lett. Arti, s
er. 6, 2:
450. 1884.
CROUS ET AL.
112

Fusarium cirrosum Höhn., Sitzungsber. Kaiserl. Akad. Wiss.
Wien, Math.-Naturwiss. Cl., Abt. 1., 116: 153. 1907.
Fusarium macounii Dearn., Mycologia 9: 363. 1917.
Holotypus: HAL 1614 F.
Type locality:Germany, Berlin.
Type substrate:Carpinus betulus.
Descriptions and illustrations: See Wollenweber (1916–1935)
and Gerlach & Nirenberg (1982).
Notes: Both Wollenweber & Reinking (1935) and Gerlach &
Nirenberg (1982) recognised this species. This species re-
quires epitypification from the type locality.
fabacearum Fusarium L. Lombard et al., Persoonia 43: 24.
2018 [2019].
Holotypus: CBS H-23613.
Ex-type culture: CBS 144743 = CPC 25802.
Type locality:South Africa, Western Cape Province.
Type substrate:Glycine max.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb1: MW928806; rpb2: MH484938;
tef1: MH485029.
falcatum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land-Forstw. 8: 184. 1913.
Replaced synonym:Fusarium vasinfectum var. pisi Schikora,
Arbeiten Biol. Anst. Land-Forstwirt. 5: 188, pl. 7. 1906, nom.
illegit., Art. 53.1
(See Fusarium equiseti)
Holotypus: Not located.
Type locality:Germany, Berlin.
Type substrate:Pisum sativum.
Notes: Synonym fide Wollenweber & Reinking (1935).
falciforme Fusarium (Carri
on) Summerb. & Schroers, J. Clin.
Microbiol. 40: 2872. 2002.
Neocosmospora falciformis (Carri
on) L. Lombard & Crous,
Stud. Mycol. 80: 227. 2015.
Basionym:Cephalosporium falciforme Carri
on, Mycologia 43:
523. 1951.
Synonyms:Acremonium falciforme (Carri
on) W. Gams, Cepha-
losporium-artige Schimmelpilze: 139. 1971.
Fusarium paranaense S.S. Costa et al., Fungal Biology 120: 55.
2015 [2016].
Holotypus: CBS 475.67 (preserved as metabolically inactive
culture).
Ex-type culture: CBS 475.67 = IHM 939 = IMI 268681.
Type locality:Puerto Rico.
Type substrate: Mycetoma from Homo sapiens.
Diagnostic DNA barcodes:rpb1: MW218114; rpb2: LT960558;
tef1: LT906669.
fasciculatum Fusarium J.W. Xia et al., Persoonia 43: 203.
2019.
Holotypus: CBS H-24057.
Ex-type culture: CBS 131382.
Type locality:Australia, Northern Territories, Roper River area.
Type substrate: Stems of Oryza australiensis.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170406; tef1: MN170473.
fautreyi Fusarium Sacc., Syll. Fung. 10: 934. 1892.
Replaced synonym:Fusarium parasiticum Fautrey, Rev. Mycol.
(Toulouse) 11: 153. 1889, nom. illegit., Art. 53.1.
(See Fusarium lateritium)
Typus: BR5020140789424.
Type locality:France, Noidan.
Type substrate:Vitis vinifera.
Note: Synonyms fide Wollenweber & Reinking (1935).
ferrugineum Fusarium (Sand.-Den. & Crous) O'Donnell et al.,
Index Fungorum 440: 2. 2020.
Neocosmospora ferruginea Sand.-Den. & Crous, Persoonia
43: 130. 2019.
Holotypus: CBS H-23981.
Ex-type culture: CBS 109028 = NRRL 32437.
Type locality:Switzerland.
Type substrate: Subcutaneous nodule of Homo sapiens.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: HM347157; rpb2: EU329581;
tef1: DQ246979.
ferruginosum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 190. 1915.
(See Fusarium acuminatum)
Typus: ?CUP-007445.
Type locality:USA, New York, Long Island
Type substrate:Solanum tuberosum
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in CUP.
ficicrescens Fusarium Al-Hatmi et al., Fungal Biol. 120: 274.
2015 [2016].
Holotypus: CBS H-21815.
Ex-type culture: CBS 125178.
Type locality:Iran, Estahban.
Type substrate: Fruit of Ficus carica.
Descriptions and illustrations: See Al-Hatmi et al. (2016).
Diagnostic DNA barcodes:rpb1: MT010950; rpb2: MT010977;
tef1: MT011004.
filiferum Fusarium (Preuss) Wollenw., Fusaria Autogr. Delin. 1:
220. 1916.
Basionym:Fusoma filiferum Preuss, Linnaea 25: 73. 1852.
Synonym:Fusarium scirpi var. filiferum (Preuss) Wollenw.,
Fusaria Autogr. Delin. 3: 936. 1930.
(See Fusarium scirpi)
Holotypus: Not located.
Type locality:Germany.
Type substrate: Bark of Pinus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
filisporum Fusarium (Cooke) Sacc., Syll. Fung. 4: 708. 1886.
Basionym:Fusisporium filisporum Cooke, Grevillea 8: 8. 1879.
(See Fusarium ciliatum)
Holotypus: In K(M), Muller s.n. fide Index Fungorum.
Type locality:UK, Eastbourne.
Type substrate:Orthotrichum sp.
Note: Synonym fide Wollenweber & Reinking (1935).
fissum Fusarium Peyl, Lotos 8: 30. 1858.
(See Fusarium candidum (Link.) Sacc.)
Lectotypus (hic designatus, MBT 10000684): Germany, twigs of
Citrus aurantiacum, 1858, J. Peyl, in Lotos 8, fig. 17.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
flagelliforme Fusarium J.W. Xia et al., Persoonia 43: 204. 2019.
Holotypus: CBS H-24058.
FUSARIUM REDELIMITED
www.studiesinmycology.org 113

Ex-type culture: CBS 162.57 = NRRL 36269.
Type locality:Croatia, Zagreb.
Type substrate: Seedlings of Pinus nigra.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: GQ505823; tef1: GQ505645.
flavidum Fusarium (Bonord.) Sacc., Syll. Fung. 4: 698. 1886.
Basionym:Fusisporium flavidum Bonord., Bot. Zeitung (Berlin)
19: 194. 1861.
(See Fusarium reticulatum)
Lectotypus (hic designatus, MBT 10000685): Germany, rotten
tree, 1861, H.F. Bonorden, in Bot. Zeitung (Berlin) 19: tab. VIII,
fig. 3.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
flavum Fusarium (Fr.) Wollenw., Z. Parasitenk. (Berlin) 3: 305.
1931.
Basionym:Fusisporium flavum Fr., Syst. Mycol. 3: 444. 1832.
(See Fusarium dimerum)
Holotypus: Not located.
Type locality:Germany, Bonn.
Type substrate:Aster sp.
Note: Synonym fide Booth (1971).
flocciferum Fusarium Corda, in Sturm, Deutschl. Fl., Abt. 3,
Pilze Deutschl. 2: 17. 1828.
Synonyms:Fusarium vinosum Massee, Brit. Fung.-Fl. 3: 479.
1893.
Fusarium clavatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 234. 1915.
Fusarium idahoanum O.A. Pratt, J. Agric. Res. 13: 86. 1918.
Fusarium nigrum O.A. Pratt, J. Agric. Res. 13: 90. 1918.
Lectotypus:(hic designatus, MBT 10001326) Germany, Berlin,
on shell of the fruit of Aesculus hippocastanum. AKJ. Corda,
Sturm, Deutschl. Fl., Abt. 3, Pilze Deutschl. 2, pl. 7.
Epitypus (hic designatus, MBT 10000686): Germany, green-
house soil, 1966, D. Bredemeier, CBS 821.68 (preserved as
metabolically inactive culture).
Ex-epitype culture: CBS 821.68 = NRRL 28450.
Descriptions and illustrations: See Booth (1971) and Gerlach &
Nirenberg (1982).
Diagnostic DNA barcodes:rpb1: MW928807; rpb2: MW928824;
tef1: MW928837.
Notes: Corda's original illustration of Fusarium flocciferum is here
selected as lectotype. Gerlach & Nirenberg (1982) considered
isolate CBS 821.68, along with CBS 792.70, as good repre-
sentatives of F. flocciferum. Based on their observations and
collection locality, CBS 821.68 is designated as epitype of
F. flocciferum.
floridanum Fusarium T. Aoki et al., Mycologia 111: 922. 2019.
Neocosmospora floridana (T. Aoki et al.) L. Lombard & Sand.-
Den., comb. nov.MycoBank MB 837664.
Basionym:Fusarium floridanum T. Aoki et al., Mycologia 111:
922. 2019.
Holotypus: BPI 910972.
Ex-type culture: MAFF 246849 = NRRL 62628.
Type locality:USA, Florida, Gainsville.
Type substrate: Mycangium of Euwallacea interjectus infesting
Acer negundo.
Descriptions and illustrations: See Aoki et al. (2019).
Diagnostic DNA barcodes:rpb1: KC691593; rpb2: KC691624,
KC691653; tef1: KC691535.
Notes: A new combination is provided in the genus Neo-
cosmospora based on the phylogenetic relationship (Aoki et al.
2019) of this species to other Neocosmospora spp. in the am-
brosia clade.
foeni Fusarium (Berk. & Broome) Sacc., Syll. Fung. 4: 699. 1886.
Basionym:Fusisporium foeni Berk. & Broome, Ann. Mag. Nat.
Hist., ser. 2, 7: 179. 1851.
(See Fusarium merismoides)
Holotypus: ?K(M).
Type locality:UK, Northamptonshire, Apethrope.
Type substrate: A hay stalk.
Note: Synonym fide Wollenweber & Reinking (1935).
foetens Fusarium Schroers et al., Mycologia 96: 398. 2004.
Holotypus: CBS 110286 (preserved as metabolically inactive
culture).
Ex-type culture: CBS 110286 = NRRL 31852 = PD 2001/7244.
Type locality:Netherlands, Zuid-Holland Province, Maasland.
Type substrate:Begonia elatior hybrid.
Descriptions and illustrations: See Schroers et al. (2004) and
Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: MW928808; rpb2: MW928825;
tef1: AY320087.
foliicola Fusarium Allesch., Hedwigia 34: 289. 1895.
(See Fusarium cymbiferum)
Holotypus:InM.
Type locality:Germany, Oberammergau.
Type substrate:Arabis alpina.
Note: Synonym fide Wollenweber & Reinking (1935).
fracticaudum Fusarium Herron et al., Stud. Mycol.80: 137.
2015.
Holotypus: PREM 60895.
Ex-type culture: CBS 137233 = CMW 25245.
Type locality:Colombia, Risaralda, Angela Maria (Santa Rosa).
Type substrate:Pinus maximinoi.
Descriptions and illustrations: See Herron et al. (2015).
Notes: Comparisons of recently generated sequences for the
living ex-type (CBS 137233 = CMW 25245) of F. fracticaudum
indicate a strain transposition or contamination by another
Fusarium species. Therefore, this species needs to be recol-
lected from the type locality and substrate or sequences need to
be generated from the holotype specimen.
fractiflexum Fusarium T. Aoki et al., Mycoscience 42: 462.
2001.
Holotypus: NIAES 20515.
Ex-type culture: MAFF 237529 = NRRL 28852.
Type locality:Japan, Yamanashi, Enzan.
Type substrate:Cymbidium sp.
Descriptions and illustrations: See Aoki et al. (2001).
Diagnostic DNA barcodes:rpb1: LR792578; rpb2: LT575064;
tef1: AF160288.
fractum Fusarium Sacc. & Cavara, Nuovo Giorn. Bot. Ital., n.s.,
7: 308. 1900.
(See Fusarium candidum (Link) Sacc.)
Holotypus: In PAD.
Type locality:Italy.
Type substrate:Fagus sp.
CROUS ET AL.
114

Note: Synonym fide Wollenweber & Reinking (1935).
fragrans Fusarium P. Crouan & H. Crouan, Fl. Finist
ere: 14.
1867.
(See Fusarium candidum (Link) Sacc.)
Holotypus: ?PC.
Type locality:France.
Type substrate:Salix sp.
Note: Synonym fide Wollenweber & Reinking (1935).
fraxini Fusarium Allesch., Ber. Bot. Vereines Landshut 12: 130.
1892.
(See Fusarium sambucinum)
Holotypus:InM.
Type locality:Germany, München.
Type substrate:Fraxinus excelsior.
Note: Synonym fide Wollenweber & Reinking (1935).
fraxini Fusarium Kab
at & Bub
ak, Fungi Imperf. Exs., no. 900.
1912, nom. illegit., Art. 53.1.
Fusicoccum fraxini Sherb., Phytopathology 18: 148. 1928.
Authentic material: BPI 451324.
Original locality:Czech Republic.
Original substrate:Fraxinus excelsior.
fredkrugeri Fusarium Sand.-Den. et al., MycoKeys 34: 79. 2018.
Holotypus: CBS H-23496.
Ex-type culture: CBS 144209 = CPC 33747.
Type locality:South Africa, Kruger National Park, Skukuza,
Granite Supersite.
Type substrate: Rhizosphere soil of Melhania acuminata.
Descriptions and illustrations: See Sandoval-Denis et al.
(2018b).
Diagnostic DNA barcodes:rpb1: LT996199; rpb2: LT996147;
tef1: LT996097.
fructigenum Fusarium Fr., Syst. Mycol. 3: 471. 1832.
(See Fusarium lateritium)
Holotypus: Not located.
Type locality:Unknown.
Type substrate: Fruit of Rosa pomifera.
Note: Synonym fide Wollenweber & Reinking (1935).
fuckelii Fusarium Sacc., Syll. Fung. 4: 695. 1886.
Geejayessia desmazieri (Becc. & De Not.) Schroers et al.,
Stud. Mycol. 68: 130. 2011.
Basionym:Nectria desmazieri Becc. & De Not., Schem. di
Classif. Sferiacei: 10. 1863.
Synonyms:Dialonectria desmazieri (Becc. & De Not.) Petch,
Naturalist (London): 281. 1937.
Nectria coccinea var. cicatricum Desm., Ann. Sci. Nat., Bot 10:
351. 1848 (fide Wollenweber & Reinking 1935 and Booth 1971).
Nectria gibbera Fuckel, Jahrb. Nassauischen Vereins Naturk.
23–24: 177. 1870.
Lectotypus: G 00110886 (Fuckel, Fungi Rhen. No. 2357),
designated in Schroers et al. (2011).
Type locality:Germany, Rheingau.
Type substrate:Buxus sempervirens.
fujikuroi Fusarium Nirenberg, Mitt. Biol. Bundesanst. Land-
Forstw. Berlin-Dahlem 169: 32. 1976
Synonyms:Lisea fujikuroi Sawada, Special Bull. Agric. Exp. Sta.
Gov. Formosa 19: 251. 1919.
Gibberella fujikuroi (Sawada) Wollenw., Z. Parasitenk. (Berlin) 3:
514. 1931.
?Gibberella fujikuroi var. subglutinans E.T. Edwards, Agric. Gaz.
New South Wales 44: 895. 1933.
?Gibberella subglutinans (E.T. Edwards) P.E. Nelson et al.,
Fusarium species. An illustrated manual for identification (Uni-
versity Park): 135. 1983.
?Oospora cephalosporioides Luchetti & Favilli, Annali Fac. Agrar.
R. Univ. Pisa 1: 399. 1938.
?Gibberella fujikuroi f.oryzae Saccas, Rev. Pathol. Veg. Ento-
mol. Agric. France 30: 77. 1951.
?Gibberella fujikuroi var. intermedia Kuhlman, Mycologia 74:
766. 1982.
Holotypus: IMI 202879.
Ex-type culture: BBA 12428 = BBA 63630 = CBS 221.76 = IHEM
3821 = IMI 196086 = IMI 202879 = NRRL 13620 = NRRL
13998 = NRRL 22174.
Type locality:Taiwan.
Type substrate:Oryza sativa.
Descriptions and illustrations: See Nirenberg (1976),Gerlach &
Nirenberg (1982) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: JX171456; rpb2: JX171570;
tef1: AF160279.
fuliginosporum Fusarium Sibilia, Ann. Reale. Ist. Super. Agrar.
Forest., ser. 2, 1: 77. 1925.
Holotypus: Not located.
Type locality:Italy.
Type substrate: Forest containing mostly Cedrus deodara.
Note: Mentioned by Wollenweber & Reinking (1935), but no
additional records of this species could be located.
fungicola Fusarium (Har. & P. Karst.) Sacc., Syll. Fung. 10: 730.
1892.
?Alysidium hypophleodes (Corda) Bonord., Handb. Allg.
Mykol.: 35. 1851.
Basionym:Fusidium hypophleodes Corda, Icon. Fung. 1: 3, tab.
1, fig. 50. 1837.
Synonym:Fusamen fungicola Har. & P. Karst. (as ‘fungicolum’),
Rev. Mycol. (Toulouse) 12: 129. 1890.
Holotypus: Not located.
Type locality:Finland, Mustiala.
Type substrate:Lenzites betulina.
Note: Synonyms fide Wollenweber & Reinking (1935).
funicola Fusarium Tassi, Bull. Lab. Orto Bot. Reale Univ. Siena 3:
131. 1900.
(See Fusarium graminearum)
Holotypus: ?SIENA.
Type locality:Italy.
Type substrate: Rotten string.
Note: Synonym fide Wollenweber & Reinking (1935).
fusarioides Fusarium (Gonz. Frag. & Cif.) C. Booth, The Genus
Fusarium: 88. 1971.
Basionym:Dactylium fusarioides Gonz. Frag. & Cif., Bol. Real
Soc. Esp. Hist. Nat. 27: 280. 1927.
(See Fusarium chlamydosporum)
Holotypus: ?MA-Funhist: 7609-1.
Type locality:Dominican Republic, Moca.
Type substrate: leaves of Crotalaria sp.
Note: Synonym fide Gerlach & Nirenberg (1982).
fuscum Fusarium (Bonord.) Sacc., Syll. Fung. 4: 699. 1886.
Basionym:Selenosporium fuscum Bonord., Handb. Mykol.: 135.
1851.
FUSARIUM REDELIMITED
www.studiesinmycology.org 115

(See Fusarium citrulli Sartory)
Holotypus: Not preserved fide Holubov
a-Jechov
aet al. (1994).
Type locality:Germany.
Type substrate: Bark.
Note: Synonym fide Wollenweber & Reinking (1935).
gaditjirrii Fusarium Phan et al., Stud. Mycol. 50: 265. 2004.
Synonym:Gibberella gaditjirrii Phan et al., Stud. Mycol. 50: 264.
2004.
Holotypus: DAR 76663.
Ex-type culture: CBS 116011 = F15048 = NRRL 53678.
Type locality:Australia, Queensland, Walkamin Research
Station.
Type substrate:Heteropogon triticeus.
Descriptions and illustrations: See Phan et al. (2004).
Diagnostic DNA barcodes:rpb2: HQ662690; tef1: AY639636.
gallinaceum Fusarium Cooke & Harkn., Grevillea 9: 8. 1880.
(See Fusarium merismoides)
Holotypus: BPI 452133.
Type locality:USA, California, Sausalito.
Type substrate: Feathers of Gallus sp. (chicken).
Note: Synonym fide Wollenweber & Reinking (1935).
gamsii Fusarium Torbati et al., Mycol. Progr. 18: 127. 2018
[2019].
Holotypus: CBS H-23561.
Ex-type culture: CBS 143610 = CPC 30862.
Type locality:Iran, West Azerbaijan Province, Orumieh-Salmas.
Type substrate:Agaricus bisporus.
Descriptions and illustrations: See Torbati et al. (2019).
Diagnostic DNA barcodes:rpb2: LT970760; tef1: LT970788.
gaudefroyanum Fusarium Sacc., Michelia 2: 132. 1880.
(See Fusarium avenaceum)
Holotypus: In PAD.
Type locality:France, Paris.
Type substrate:Cyperaceae.
Note: Synonym fide Wollenweber & Reinking (1935).
gemmiperda Fusarium Aderh., Z. Pflanzenkrankh. 11: 70. 1901.
(See Fusarium lateritium)
Lectotypus (hic designatus, MBT 10000687): Germany,Prunus
cerasus, 1901, R. Aderhold, in Z. Pflanzenkrankh. 11: pl. II, figs
1–4.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
genevense Fusarium Dasz., Bull. Soc. Bot. Gen
eve, s
er. 2, 4:
305. 1912.
(See Fusarium sambucinum)
Lectotypus (hic designatus, MBT 10000688): Switzerland,
Geneva, from soil, 1912, M. Daszewska, in Bull. Soc. Bot.
Gen
eve, s
er. 2, 4: 306, fig. 27.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
georginae Fusarium Corda, Icon. Fung. 2: 4. 1838.
(See Fusarium cymbiferum)
Typus: In PRM fide Pilat (1938).
Type locality:Czech Republic, Prague.
Type substrate: Dahlia sp.
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in PRM.
gerlachii Fusarium T. Aoki et al., Fungal Genet. Biol. 44: 1202.
2007.
Holotypus: BPI 871657.
Ex-type culture: LRG 00-551 = NRRL 36905.
Type locality:USA, Minnesota, Polk County, Climax.
Type substrate:Triticum aestivum.
Descriptions and illustrations: See Starkey et al. (2007).
Diagnostic DNA barcodes:rpb1: KM361646; rpb2: KM361664;
tef1: DQ459742.
gibbosum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 190. 1910 [1913].
(See Fusarium equiseti)
Holotypus: ?BPI 452135.
Type locality:Germany, Berlin
Type substrate:Solanum tuberosum
Note: Synonym fide Booth (1971).
gigas Fusarium Speg. Anales Soc. Ci. Argent. 22: 221. 1886.
Holotypus: In LPS fide Farr (1973).
Type locality:Paraguay.
Type substrate:Bambusa sp.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971) and Gerlach & Nirenberg (1982).
Notes: This species requires epitypification. Wollenweber &
Reinking (1935),Booth (1971), and Gerlach & Nirenberg
(1982) accepted this species, although limited information is
available.
glandicola Fusarium Cooke & W.R. Gerard, Grevillea 7: 14.
1878.
Tubercularia glandicola (Cooke & W.R. Gerard) Wollenw. &
Reinking, Fusarien: 325. 1935.
Holotypus: In K(M), Gerard s.n. fide Index Fungorum.
Type locality:USA, New York.
Type substrate: Acorns of Quercus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
glandicola Fusarium Allesch., Ber. Bot. Vereines Landshut 12:
130. 1892, nom. illegit., Art. 53.1.
Replacing synonym.Fusarium allescheri Sacc. & P. Syd., Syll.
Fung. 14: 1128. 1899.
(See Fusarium melanochlorum)
Authentic material:InM.
Original locality:Germany, München.
Original substrate: Fruits of Quercus robur (syn. Q. pedunculata).
Note: Synonyms fide Wollenweber & Reinking (1935).
gleditschiae Fusarium Therry (as ‘gledrischiae’), in Roumegu
ere,
Fungi Sel. Gall. Exs.: no. 5496. 1890, nom. nud., Art. 38.1(a).
Gloeosporium gleditschiae Therry ex Wollenw., Z. Parasitenk.
(Berlin) 3: 437. 1931.
Note: Synonym fide Wollenweber & Reinking (1935).
gleditschiicola Fusarium Dearn. & Barthol. (as ‘gleditsiaecolum’),
Mycologia 9: 363. 1917.
(See Fusarium lateritium)
Holotypus: JD 4379 in DAOM.
Type locality:USA, Kansas, Stockton.
Type substrate:Gleditsia triacanthos.
Note: Synonym fide Wollenweber & Reinking (1935).
CROUS ET AL.
116

globosum Fusarium Rheeder et al., Mycologia 88: 509. 1996.
Holotypus: BPI 802834.
Ex-type culture: CBS 428.97 = DOAM 214966 = FRC M-
8014 = IMI 375330 = MRC 6647 = NRRL 26131 = PREM 51878.
Type locality:South Africa, Eastern Cape Province, Butterworth
district, Teko Experimental Farm.
Type substrate:Zea mays.
Descriptions and illustrations: See Rheeder et al. (1996) and
Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: KF466396; rpb2: KF466406;
tef1: KF466417.
globulosum Fusarium Pass., in Rabenhorst, Fungi Eur. Exs. no.
2262. 1877.
Syntypes: In BPI, CUP, ILL & S (Fungi Eur. Exs. # 2262).
Type locality:Italy, Parma.
Type substrate:Salvia verticillata.
Note: Not Fusarium fide Wollenweber & Reinking (1935).
gloeosporioides Fusarium Speg. (as ‘gloeosporoide’), Anales
Mus. Nac. Hist. Nat. Buenos Aires 6: 350. 1898 [1899].
(See Fusarium incarnatum)
Holotypus: In LPS fide Farr (1973).
Type locality:Argentina, La Plata.
Type substrate: Fruits of Passiflora tweediana.
Note: Synonym fide Wollenweber & Reinking (1935).
gloeosporioides Fusarium (Speg.) Sacc. & Trotter, Syll. Fung. 22:
1482. 1913, nom. illegit., Art. 53.1.
Basionym:Selenosporium gloeosporioides Speg. (as ‘gloes-
porioides’), Anales Mus. Nac. Hist. Nat. Buenos Aires 13: 458.
1911.
(See Fusarium lateritium)
Holotypus: In LPS (Myc. Argent. ser. 5, no. 1167) fide Farr
(1973).
Type locality:Argentina, Buenos Aires.
Type substrate:Pircunia dioica.
Note: Synonym fide Wollenweber & Reinking (1935).
glumarum Fusarium Sacc., Syll. Fung. 4: 706. 1886.
Replaced synonym:Fusarium pallens Berk. & M.A. Curtis,
Grevillea 3: 99. 1875, nom. illegit., Art. 53.1, non Fusarium
pallens Nees & T. Nees 1818.
(See Fusarium incarnatum)
Syntype: CBRU00007755.
Type locality:USA.
Type substrate: Juncus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
glycines Fusarium L. Lombard et al., Persoonia 41: 25. 2018
[2019].
Holotypus: CBS H-23614.
Ex-type culture: CBS 144746 = CPC 25808.
Type locality:South Africa, North West Province.
Type substrate:Glycine max.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb1: MW928809; rpb2: MH484942;
tef1: MH485033.
goolgardi Fusarium D.M. Robinson et al., Fungal Diversity 77:
357. 2015 [2016].
Holotypus: RGB5411.
Ex-type culture: NRRL 66250 = RGB5411.
Type locality:Australia, New South Wales, Bungonia State
Conservation Area.
Type substrate:Xanthorrhoea glauca.
Descriptions and illustrations: See Laurence et al. (2016).
Diagnostic DNA barcodes:rpb1: KP083270; rpb2: KP083280;
tef1: KP101123.
gossypinum Fusarium L. Lombard & Crous, Persoonia 41: 26.
2018 [2019].
Holotypus: CBS H-23615.
Ex-type culture: CBS 116613.
Type locality:Ivory Coast, Bouak
e.
Type substrate:Gossypium hirsutum.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb2: MH484909; tef1: MH485000.
gracile Fusarium McAlpine, Proc. Linn. Soc. New South Wales
28: 554. 1903.
(See Fusarium avenaceum)
Holotypus: VPRI 2564.
Type locality:Australia, Victoria, Sandringham.
Type substrate: Flowering stem of Lobelia gibbosa.
Note: Synonym fide Wollenweber & Reinking (1935).
gracilipes Fusarium J.W. Xia et al., Persoonia 43: 205. 2019.
Holotypus: CBS H-24059.
Ex-type culture: NRRL 43635.
Type locality:USA, Nebraska.
Type substrate:Equus sp. (horse).
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb1: HM347188; rpb2: GQ505840;
tef1: GQ505662.
graminearum Fusarium Schwabe, Fl. Anhalt. 2: 285. 1839.
Synonyms:Sphaeria zeae Schwein., Schriften Naturf. Ges.
Leipzig 1: 48. 1822, non Fusarium zeae (Westend.) Sacc. 1886.
Dothidea zeae (Schwein.) Schwein., Trans. Amer. Philos. Soc.,
n.s., 4: 230. 1832.
Hendersoniopsis zeae (Schwein.) Woron., Fungal and Bacterial
Diseases of Agricultural Plants: 255. 1922.
Gibberella zeae (Schwein.) Petch, Ann. Mycol. 34: 260. 1936.
Fusarium stictoides Durieu & Mont., Explor. Sci. Alg
erie 1: 334.
1848.
Sphaeria saubinetii Durieu & Mont., Explor. Sci. Alg
erie 1: 479.
1849.
Gibbera saubinetii (Durieu & Mont.) Mont., Syll. Gen. Sp. Crypt.:
252. 1856.
Botryosphaeria saubinetii (Durieu & Mont.) Niessl, Verh. Naturf.
Vereins Brünn 10: 195. 1872.
Gibberella pulicaris subsp. saubinetii (Durieu & Mont.) Sacc.,
Michelia 1: 317. 1878.
Gibberella saubinetii (Durieu & Mont.) Sacc., Michelia 1: 513.
1879.
Fusisporium insidiosum Berk., Gard. Chron. 1860: 480. 1860.
Fusarium insidiosum (Berk.) Sacc., Syll. Fung. 4: 707. 1886,
nom. illegit., Art. 53.1.
Gibberella saubinetii var. coronillae Sacc., Michelia 1: 513. 1879.
Fusarium mollerianum Thüm., Inst. Coimbra 28: 263. 1881.
Gibberella saubinetii subsp. pachyspora Sacc., Michelia 2: 74.
1880.
FUSARIUM REDELIMITED
www.studiesinmycology.org 117

Gibberella saubinetii var. pachyspora (Sacc.) Sacc., Syll. Fung.
2: 555. 1883.
Fusarium caricis Oudem., Verslagen Meded. Afd. Natuurk. Kon.
Akad. Wetensch., ser. 3, 7: 325. 1890.
Fusarium graminearum var. caricis (Oudem.) Wollenw., Z. Par-
asitenk. (Berlin) 3: 365. 1931.
?Fusarium rhoicola Fautrey, Rev. Mycol. (Toulouse) 17: 171.
1895.
Fusarium funicola Tassi, Bull. Lab. Orto Bot. Reale Univ. Siena 3:
131. 1900.
Gibberella saubinetii f.acuum Feltgen, Vorstud. Pilzfl. Luxem-
burg, Nachtr. III: 303. 1903.
Gibberella saubinetii var. acuum (Feltgen) Sacc. & D. Sacc., Syll.
Fung. 17: 813. 1905.
Gibberella saubinetii var. tetraspora Feltgen, Vorstud. Pilzfl.
Luxemburg, Nachtr. III: 302. 1903.
Gibberella saubinetii var. calami Henn., Beibl. Hedwigia 42: (79).
1903.
Gibberella saubinetii var. mate Speg., Anales Mus. Nac. Hist.
Nat. Buenos Aires 17: 129. 1908.
?Selenosporium bufonicola Speg., Anales Mus. Nac. Hist. Nat.
Buenos Aires, ser. 3, 13: 458. 1910.
?Fusarium bufonicola (Speg.) Sacc. & Trotter, Syll. Fung. 22:
1486. 1913.
Fusarium rostratum Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 30. 1910 [1913].
Gibberella saubinetii var. flacca Wollenw., Z. Parasitenk. (Berlin)
3: 433. 1931.
Lectotypus (hic designatus, MBT 10000689): Germany,inflo-
rescence of Triticum sp., 1839, S.H. Schwabe, in Flora Anhaltina
2, tab. VI. fig. 7.
Epitypus (hic designatus, MBT 10000690): Germany,Hordeum
vulgare, 1988, L. Niessen, CBS 136009 (preserved as meta-
bolically inactive culture).
Ex-epitype culture: CBS 136009.
Descriptions and illustrations: See Booth (1971),Gerlach &
Nirenberg (1982) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: MW928810; rpb2: MW928826;
tef1: MW928838.
Notes: This well-known and economically important pathogen of
gramineous hosts has a global distribution and is accepted as
originally circumscribed. However, no type material is available
for taxonomic reference. Therefore, a lectotype based on an
illustration from the original protologue and an epitype is desig-
nated here to provide taxonomic stability for this species.
graminum Fusarium Corda, Icon. Fung. 1: 3. 1837.
Synonym:Fusarium herbarum var. graminum (Corda) Wollenw.,
Fusaria Autogr. Delin. 3: 891. 1930.
Fusarium avenaceum var. graminum (Corda) Raillo, Fungi of the
Genus Fusarium: 188. 1950.
Fusarium corallinum Sacc., Nuovo Giorn. Bot. Ital. 8: 196. 1876.
Lectotypus (hic designatus, MBT 10000691): Germany,
gramineous plant, 1837, A.C.J Corda, in Icon. Fung. 1, tab. I, fig.
59.
Descriptions and illustrations: See Wollenweber & Reinking
(1935) and Gerlach & Nirenberg (1982).
Notes: This species is recognised by Wollenweber & Reinking
(1935) and Gerlach & Nirenberg (1982). Recollection from the
type host and locality is required. No holotype specimen could be
located and therefore an illustration is designated as lectotype.
granulare Fusarium Kalchbr., Crypt. Austro-Afric., no. 1068.
1874.
(See Fusarium sambucinum)
Holotypus: ?B 70 0100191 (Crypt. Austro-Afric., no. 1068).
Type locality:South Africa, Eastern Cape Province, Somerset-
East.
Type substrate:Datura stramonium (syn. Datura tatula).
Note: Synonym fide Wollenweber & Reinking (1935).
granulosum Fusarium Ellis & Everh., Proc. Acad. Nat. Sci.
Philadelphia 45: 466. 1894 [1893].
(See Fusarium avenaceum)
Holotypus: Commons 2091 in NY.
Type locality:USA, Delaware, New Castle, Mount Cuba.
Type substrate:Smilax hispida.
Note: Synonym fide Wollenweber & Reinking (1935).
grosmichelii Fusarium Maryani et al., Stud. Mycol. 92: 176.
2018 [2019].
Holotypus: InaCC F833 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F833.
Type locality:Indonesia, West Java, Bogor, Suakarya
(Megamendung).
Type substrate: Pseudostem of Musa acuminata var. Pisang
Ambon Lumut.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb1: LS479548; rpb2: LS479295;
tef1: LS479744.
guilinense Fusarium M.M. Wang et al., Persoonia 43: 80. 2019.
Holotypus: HAMS 248037.
Ex-type culture: CGMCC 3.19495 = LC12160.
Type locality:China, Guangxi Province, Guilin.
Type substrate: Leaf of Musa nana.
Descriptions and illustrations: See Wang et al. (2019).
Diagnostic DNA barcodes:rpb1: MK289831; rpb2: MK289747;
tef1: MK289594.
guttiforme Fusarium Nirenberg & O'Donnell, Mycologia 90:
446. 1998.
Holotypus: B 70 0001690.
Ex-type culture: BBA 69661 = CBS 409.97 = IMI 376113 = NRRL
25295.
Type locality:Brazil.
Type substrate:Ananas comosus.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998).
Diagnostic DNA barcodes:rpb1: MT010938; rpb2: MT010967;
tef1: KC514066.
gymnosporangii Fusarium Jaap, Ann. Mycol. 14: 44. 1916.
Nectria gymnosporangii (Jaap) Rossman, Mycotaxon 8: 515.
1979.
Basionym:Calonectria gymnosporangii Jaap, Ann. Mycol. 14:
10. 1916.
Synonyms:Bactridium gymnosporangii (Jaap) Wollenw., Fusaria
Autogr. Delin. 1: 458. 1916.
Cylindrocarpon gymnosporangii (Jaap) Rossman, Mycol. Pap.
150: 31. 1983.
Holotypus: In HBG fide Rossman (1979).
Type locality:Croatia, Dalmatia, Lapad near Ragusa.
Type substrate: Parasitic on Gymnosporangium confusum on
Juniperus phoenicea branches.
CROUS ET AL.
118

haematococcum Fusarium Nalim et al., Mycologia 103: 1322.
2011.
Neocosmospora haematococca (Berk. & Broome) Samuels
et al., Mycologia 103: 1322. 2011.
Basionym:Nectria haematococca Berk. & Broome, J. Linn. Soc.,
Bot. 14: 116. 1875.
Synonyms:Dialonectria haematococca (Berk. & Broome) Cooke,
Grevillea 12: 110. 1884.
Cucurbitaria haematococca (Berk. & Broome) Kuntze, Revis.
Gen. Pl. 3: 461. 1898.
Hypomyces haematococcus (Berk. & Broome) Wollenw., Angew.
Bot. 8: 191. 1926.
Haematonectria haematococca (Berk. & Broome) Samuels &
Nirenberg, Stud. Mycol. 42: 135. 1999.
?Nectria lanata Pat., Bull. Soc. Mycol. France 8: 52. 1892 (fide
Samuels 1976).
?Nectria aurantiella Speg., Anales Mus. Nac. Hist. Nat. Buenos
Aires 6: 287. 1898.
?Nectria episphaerioides Penz. & Sacc., Malpighia 11: 511. 1898
[1897].
?Nectria cinnabarina var. jaraguensis Höhn., Denkschr. Kaiserl.
Akad. Wiss. Wien, Math.-Naturwiss. Kl. 83: 18. 1907.
?Nectria bogoriensis C. Bernard, Bull. D
ep. Agric. Indes N
eerl.
11: 45. 1907.
?Nectria victoriae Henn., in Rehm, Ann. Mycol. 5: 81. 1907, nom.
inval., Art. 38.1(a).
?Nectria calonectricola Henn., Hedwigia 48: 105. 1908.
?Nectria citri Henn., Hedwigia 48: 104. 1908.
?Nectria luteococcinea Höhn., Sitzungsber. Kaiserl. Akad. Wiss.
Wien, Math.-Naturwiss. Cl., Abt. 1. 118: 299. 1909.
?Nectria bainii var. hypoleuca Sacc., Nuovo Giorn. Bot. Ital. 23:
205. 1916.
?Nectria confluens Seaver, Sci. Surv. Porto Rico & Virgin Islands
8: 44. 1926, nom. illegit., Art. 53.1.
Lectotypus: K(M) 252877, designated in Samuels (1976).
Lectotype locality:Sri Lanka.
Lectotype substrate: Unknown
Epitypus: BPI 871363, designated in Nalim et al. (2011).
Ex-epitype culture: CBS 119600 = FRC S-1832.
Epitype locality:Sri Lanka, Sabaragamuwa Province, Sinharaja
Man and Biosphere Reserve, Morningside, vicinity Bungalow in
forested slope.
Epitype substrate: Dying tree.
Descriptions and illustrations: See Nalim et al. (2011).
Diagnostic DNA barcodes:rpb2:LT960561; tef1: KM231926.
hainanense Fusarium M.M. Wang et al., Persoonia 43: 82.
2019.
Holotypus: HAMS 248038.
Ex-type culture: CGMCC 3.19478 = LC11638.
Type locality:China, Hainan Province.
Type substrate: Stem of Oryza sp.
Descriptions and illustrations: See Wang et al. (2019).
Diagnostic DNA barcodes:rpb1: MK289833; rpb2: MK289735;
tef1: MK289581.
hakeae Fusarium Henn., Verh. Bot. Vereins Prov. Brandenburg
40: 175. 1899.
Gloeosporium hakeae (Henn.) Wollenw., Fusaria Autogr. Delin.
1: 494. 1916.
Holotypus:InBfide Hein (1988).
Type locality:Germany, Berlin.
Type substrate:Hakea salicifolia.
Note: Synonym fide Wollenweber & Reinking (1935).
heidelbergense Fusarium Sacc., Ann. Mycol. 8: 346. 1910.
(See Fusarium culmorum)
Holotypus: In PAD.
Type locality:Germany, Heidelberg.
Type substrate:Cymbidium sp.
Note: Synonym fide Wollenweber & Reinking (1935).
helgardnirenbergiae Fusarium O'Donnell et al., Index Fungorum
440: 2. 2020.
Neocosmospora nirenbergiana Sand.-Den. & Crous, Persoo-
nia 43: 143. 2019.
Holotypus: CBS H-23988.
Ex-type culture: BBA 65023 = CBS 145469 = G.J.S. 87-
127 = NRRL 22387.
Type locality:French Guiana.
Type substrate: Bark of unidentified tree.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb2: EU329505; tef1: AF178339.
helianthi Fusarium (Schwein.) Wollenw., Fusaria Autogr. Delin. 2:
555. 1924.
Basionym:Vermicularia subeffigurata helianthi Schwein., Trans.
Amer. Philos. Soc., n.s., 4: 228. 1832.
(See Fusarium tricinctum)
Holotypus: PH00078405.
Type locality:Unknown.
Type substrate:Helianthus annuus.
Note: Synonyms fide Wollenweber & Reinking (1935).
helotioides Fusarium Berk. & M.A. Curtis, in Berkeley, Grevillea
3: 98. 1875.
Holotypus: ?K(M).
Type locality:USA, Alabama.
Type substrate:Ilex decidua (syn. Ilex prinoides).
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
hengyangense Fusarium (Z.Q. Zeng & W.Y. Zhuang) O'Donnell
et al., Index Fungorum 440: 2. 2020.
Neocosmospora hengyangensis Z.Q. Zeng & W.Y. Zhuang,
Phytotaxa 319: 179. 2017.
Holotypus: HMAS 254518.
Ex-type culture: HMAS 248884.
Type locality:China, Hunan, Hengyang, Gouloufeng.
Type substrate: Twigs.
Descriptions and illustrations: See Zeng & Zhuang (2017b).
Diagnostic DNA barcodes:tef1: KY829448.
herbarum Fusarium (Corda) Fr., Summa Veg. Scand. 2: 472.
1849.
Basionym:Selenosporium herbarum Corda, Icon. Fung. 3: 34,
tab. 6, fig. 88. 1839.
(See Fusarium avenaceum)
Typus: PRM 155731.
Type locality:Czech Republic, Prague.
Type substrate: Gramineous plant part.
Note: Synonyms fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in PRM.
heteronemum Fusarium Berk. & Broome (as ‘heteronema’), Ann.
Mag. Nat. Hist., ser. 3, 15: 402. 1865.
(See Fusarium candidum (Link) Sacc.)
FUSARIUM REDELIMITED
www.studiesinmycology.org 119

Holotypus: ?K(M).
Type locality:UK, Batheaston.
Type substrate: Decaying Pyrus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
heterosporioides Fusarium Fautrey, in Roumegu
ere, Fungi Sel.
Gall. Exs. No. 5399. 1890 and Rev. Mycol. (Toulouse) 12: 126.
1890.
Syntype: ILL00219542 (Roumegu
ere, Fungi Sel. Gall. Exs no.
5399).
Type locality:France, Charny
Type substrate:Sclerotium clavus on Glyceria fluitans.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
heterosporum Fusarium Nees & T. Nees, Nova Acta Phys.-
Med. Acad. Caes. Leop.-Carol. Nat. Cur. 9: 235. 1818.
Synonyms:?Fusarium leucoconium Corda, Icon. Fung. 1: 4.
1837. [fide Booth (1971)].
Sphaeria cyanea Sollm., Bot. Zeitung (Berlin) 21: 193. 1863.
Botryosphaeria cyanea (Sollm.) Weese, Sitzungsber. Kaiserl.
Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1, 128: 707. 1919.
Gibberella cyanea (Sollm.) Wollenw., Fusaria Autogr. Delin. 1:
39. 1919.
Fusarium secalis F
ee, M
em. Soc. Mus. Hist. Nat. Strassbourg 3:
35. 1843.
Fusarium eleocharidis Rostr. (as ‘heleocharidis’), in Thümen,
Mycoth. Univ., Cent. 22, no. 2185. 1883.
Fusisporium lolii Wm.G. Sm., Diseases of field and garden crops,
chiefly as are caused by fungi: 213. 1884.
Fusarium lolii (Wm.G. Sm.) Sacc., Syll. Fung. 11: 652. 1895.
Fusarium heterosporum var. lolii (Wm.G. Sm.) Wollenw., Z.
Parasitenk. (Berlin) 3: 349. 1931.
Fusarium heterosporum f. paspali Ellis & Everh., in Ellis, North
Amer. Fung., Ser. 2, no. 2395. 1886.
Fusarium parasiticum Ellis & Kellerm., J. Mycol. 3: 127. 1887,
nom. illegit., Art. 53.1.
Fusarium pucciniophilum Sacc. & P. Syd., Syll. Fung. 14: 1128.
1899.
Fusarium stromaticum Delacr., Bull. Soc. Mycol. France 9: 186.
1893.
Fusarium paspalicola Henn., Monsunia 1: 38. 1899 [1900].
Fusarium heterosporum var. paspalicola (Henn.) Wollenw., Z.
Parasitenk. (Berlin) 3: 349. 1931.
Fusarium congoense Wollenw., Fusaria Autogr. Delin. 1: 307. 1916.
Fusarium heterosporum var. congoense (Wollenw.) Wollenw., Z.
Parasitenk. (Berlin) 3: 350. 1931.
Fusarium heterosporum f.aleuritis Saccas & Drouillon (as
‘aleuritidis’), Agron. Trop. 6: 251. 1951.
Gibberella gordonii C. Booth, The Genus Fusarium: 177. 1971.
Lectotypus (hic designatus, MBT 10000692): Germany, sclero-
tium of Claviceps purpurea on a spike of Triticum sp., 1818,
G.C.D. Nees von Esenbeck, in Nova Acta Phys.-Med. Acad.
Caes. Leop.-Carol. Nat. Cur., tab. V. fig. 5.
Epitypus (hic designatus, MBT 10000693): Germany, Rotenburg
near Bremen, sclerotium of Claviceps purpurea on Lolium per-
enne, Aug. 1967, U.G. Schlösser, CBS 391.68 (preserved as
metabolically inactive culture).
Ex-epitype culture: CBS 391.68 = NRRL 25798.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971),Gerlach & Nirenberg (1982) and Leslie
& Summerell (2006).
Diagnostic DNA barcodes:rpb1: MW928811; rpb2: MW928827;
tef1: MW928839.
Notes: This species is recognised by Wollenweber & Reinking
(1935),Gerlach & Nirenberg (1982),Booth (1971), and Leslie
& Summerell (2006). Index Fungorum indicates that the cor-
rect name for this species is F. lolii. However, this name is not
commonly used and considered as a synonym of
F. heterosporum. Additionally, the epithet ‘heterosporum’is older
than the epithet ‘lolii’and should have priority. No holotype
specimen is available and therefore an illustration is designated
as lectotype.
heveae Fusarium Vincens, Bull. Soc. Pathol. V
eg. France 2: 19.
1915.
(See Fusarium incarnatum)
Holotypus: ?PC.
Type locality:Brazil, Para.
Type substrate:Hevea brasiliensis.
Note: Synonym fide Wollenweber & Reinking (1935).
hexaseptatum Fusarium Maryani et al., Stud. Mycol. 92: 183.
2018 [2019].
Holotypus: InaCC F866 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F866.
Type locality:Indonesia, West Java, Sukabumi, Parakan Lima.
Type substrate:Musa acuminata var. Pisang Ambon Kuning.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb2: LS479359; tef1: LS479805.
hibernans Fusarium Lindau, Rabenh. Krypt.-Fl., ed. 2, 1(9): 542.
1909, nom. superfl., Art. 52.1.
Basionym:Fusarium nivale Ces. ex Berl. & Voglino, in Saccardo,
Syll. Fung., Addit. I–IV: 390. 1886, non (Fr.) Sorauer, 1901.
(See Fusarium nivale)
Authentic material: Klotzsch, Herb. Viv. Mycol. no. 1439 in HAL.
Original locality:Italy, Vercelli.
Original substrate: Leaves of overwintered crop.
Note: Synonyms fide Wollenweber & Reinking (1935).
hippocastani Fusarium (Corda) Sacc., Syll. Fung. 4: 703. 1886.
Basionym:Selenosporium hippocastani Corda, Icon. Fung. 2: 7.
1838.
(See Fusarium acuminatum)
Lectotypus (hic designatus, MBT 10000694): Czech Republic,
Prague, Aesculus hippocastanum, 1836, A.C.J. Corda, in Icon.
Fung. 2: tab. IX. fig. 31.
Notes: According to Pilat (1938) and Holubov
a-Jechov
aet al.
(1994), no material was preserved in PRM. Therefore, an illus-
tration is selected as lectotype.
hoodiae Fusarium L. Lombard et al., Persoonia 41: 27. 2018
[2019].
Holotypus: CBS H-23616.
Ex-type culture: CBS 132474.
Type locality:South Africa, Northern Cape Province, Prieska.
Type substrate: Root of Hoodia gordonii.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb2: MH484929; tef1: MH485020.
hordearium Fusarium Ducomet, Rech. D
evel. Champ. Parasit.:
87. 1907.
Holotypus: ?MPA.
Type locality:France.
CROUS ET AL.
120

Type substrate: Unknown.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
hordei Fusarium (Wm.G. Sm.) Sacc., Syll. Fung. 11: 652. 1895.
Basionym:Fusisporium hordei Wm.G. Sm., Diseases of field and
garden crops, chiefly as are caused by fungi: 212. 1884.
(See Fusarium sambucinum)
Lectotypus (hic designatus, MBT 10000695): Denmark,Hor-
deum sp., 1884, W. G. Smith, in Diseases of field and garden
crops, chiefly as are caused by fungi: 211, fig. 94.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype material could be located and therefore an illustration is
designated as lectotype.
hostae Fusarium Geiser & Juba, Mycologia 93: 672. 2001.
Synonym:Gibberella hostae Geiser & Juba, Mycologia 93: 672.
2001.
Holotypus: BPI 748169.
Ex-type culture: FRC O-2074 = NRRL 29889.
Type locality:USA, South Carolina.
Type substrate:Hosta sp.
Descriptions and illustrations: See Geiser et al. (2001).
Diagnostic DNA barcodes:rpb1: JX171527; rpb2: JX171640;
tef1: AY329034.
humi Fusarium (Reinking) Nirenberg & Hagedorn, Nach-
richtenbl. Deutsch. Pflanzenschutzdienstes 60: 215. 2008.
Basionym:Fusarium tumidum var. humi Reinking, Zentralbl.
Bakteriol., 2. Abth. 89: 513. 1934.
Lectotypus (hic designatus, MBT 10000706): Honduras, soil,
1931, O.A. Reinking, in Wollenweber's Fusaria Autogr. Delin. no.
1152 of type culture 5236.
Notes: This species is recognised by Wollenweber & Reinking
(1935),Gerlach & Nirenberg (1982), and Nirenberg &
Hagedorn (2008). Recollection from the type host and locality
is required. No holotype material could be located and therefore
an illustration is designated as lectotype.
humicola Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4:
191. 2019.
Holotypus: CBS H-24016.
Ex-type culture: ATCC 24372 = CBS 124.73 = IMI
128101 = NRRL 25535.
Type locality:Pakistan.
Type substrate: Soil.
Descriptions and illustrations: See Lombard et al. (2019a).
Diagnostic DNA barcodes:rpb1: MN120718; rpb2: MN120738;
tef1: MN120757.
humuli Fusarium M.M. Wang et al., Persoonia 43: 83. 2019.
Holotypus: HAMS 248039.
Ex-type culture: CGMCC 3.19374 = CQ1039.
Type locality:China, Jiangsu Province.
Type substrate: Leaves of Humulus scandens.
Descriptions and illustrations: See Wang et al. (2019).
Diagnostic DNA barcodes:rpb1: MK289840; rpb2: MK289724;
tef1: MK289570.
hydnicola Fusarium Ellis & Everh. (as ‘hydnicolum’), J. Mycol.
4(4–5): 45. 1888.
Alysidium hypophleodes (Corda) Bonord., Handb. Mykol.: 35.
1851.
Basionym:Fusidium hypophleodes Corda, Icon. Fung. 1: 3, tab.
1, fig. 50. 1837.
Holotypus:NY(fide Index Fungorum).
Type locality:USA, Missouri, Concordia.
Type substrate: Bark of dead Hydnum membranaceum.
Note: Synonym fide Wollenweber & Reinking (1935).
hymenula Fusarium Pound & Clem., Bot. Surv. Nebraska 4: 7.
1896.
Gloeosporium intermedium var. brevipes Sacc., Syll. Fung. 3:
703. 1884.
Holotypus: NEB0040541.
Type locality:USA, Nebraska.
Type substrate:Helianthus sp.
Notes: Synonym fide Wollenweber & Reinking (1935). The name
is misspelled as ‘lymenula’in the NEB database.
hyperoxysporum Fusarium Wollenw., J. Agric. Res. 2: 268. 1914.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:USA.
Type substrate:Ipomoea batatas.
Note: Synonym fide Wollenweber & Reinking (1935).
hypocreoideum Fusarium Cooke & Massee, Grevillea 16: 76.
1888.
Aschersonia hypocreoidea (Cooke & Massee) Petch, Ann.
Roy. Bot. Gard. (Peradeniya) 7: 255. 1922.
Holotypus: K(M) 127920.
Type locality:Australia, Queensland.
Type substrate:Ficus aspera.
hypodermium Fusarium (Link) Link, in Willdenow, Sp. Pl., ed. 4,
6: 96. 1825.
Basionym:Fusidium hypodermium Link, Mag. Neuesten
Entdeck. Gesammten Naturk. Ges. Naturf. Freunde Berlin 8: 31.
1816 [1815].
Marssonina aurantiaca (Link) Magnus, Hedwigia 45: 90. 1906.
Basionym:Cryptosporium aurantiacum Link, in Willdenow, Sp.
Pl., ed 4, 6: 96. 1825, nom. sanct. (Fries, Syst. Mycol. 3:
481. 1832).
Synonyms:Fusidium aurantiacum (Link) Fr., Syst. Mycol. 3: 481.
1832.
Gloeosporium aurantiacum (Link) Sacc., Syll. Fung. 3: 717.
1884.
Marssonia aurantiaca (Link) Rostr., Bot. Tidsskr. 19: 217. 1895.
Note: Synonyms fide Wollenweber & Reinking (1935).
hypothenemi Fusarium (Sand.-Den. & Crous) O'Donnell et al.,
Index Fungorum 440: 2. 2020.
Neocosmospora hypothenemi Sand.-Den. & Crous, Persoonia
43: 132. 2019.
Holotypus: CBS H-23982.
Ex-type culture: ARSEF 5878 = CBS 145464 = NRRL 52782.
Type locality:Benin, Niaouli.
Type substrate: Adult Hypothenemus hampei (coffee borer
beetle).
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218117; rpb2: JF741176;
tef1: JF740850.
idahoanum Fusarium O.A. Pratt, J. Agric. Res. 13: 86. 1918.
(See Fusarium flocciferum)
FUSARIUM REDELIMITED
www.studiesinmycology.org 121

Lectotypus (hic designatus, MBT 10000707): USA, Idaho, soil,
1918, O.A. Pratt, in J. Agric. Res. 13: 87, fig. 2.
Notes: Synonyms fide Wollenweber & Reinking (1935). No ho-
lotype material could be located and therefore an illustration is
designated as lectotype.
illosporioides Fusarium Sacc., Harriman Alaska Exped. 5: 15.
1904.
(See Fusarium lateritium)
Holotypus: In PAD.
Type locality:USA, Alaska, Sitka.
Type substrate:Ribes sp.
Note: Synonym fide Wollenweber & Reinking (1935).
illudens Fusarium C. Booth, The Genus Fusarium: 54. 1971.
Neocosmospora illudens (Berk.) L. Lombard & Crous, Stud.
Mycol. 80: 227. 2015.
Basionym:Nectria illudens Berk., in Hooker, Bot. Antarct. Voy. II
(Fl. Nov.-Zel.): 203. 1855.
Synonyms:Cucurbitaria illudens (Berk.) Kuntze, Revis. Gen. Pl.
3: 461. 1898.
Haematonectria illudens (Berk.) Samuels & Nirenberg, Stud.
Mycol. 42: 136. 1999.
Neotypus: PAD S00012, designated in Forin et al. (2020)
Neotype locality:New Zealand.
Neotype substrate: Bark of unknown host plant,
“inaequale Fusarium”Auersw. Bot. Zeitung (Berlin) 8: 439.
1850, typographic error (see Notes).
Ramularia rosea (Fuckel) Sacc., Fungi Ital. Del., Tab. 1001.
1881.
Basionym:Fusidium roseum Fuckel, Fungi Rhen. Fasc. III, no.
219. 1863.
Synonyms:Ovularia rosea (Fuckel) Massee, Brit. Fung.-Fl. 3:
323. 1893.
Cylindrospora rosea (Fuckel) J. Schröt., in Cohn, Krypt.-Fl.
Schles., Pilze II: 493. 1897.
Fusidium inaequale Auersw., in Rabenh., Klotzschii Herb. Viv.
Mycol., Cent. 14: no. 1383. 1850.
Ramularia lucidae Davis, Trans. Wis. Acad. Sci. Art. Lett. 19:
687. 1919.
Authentic material: Rabenh., Klotzschii Herb. Viv. Mycol. 1383 in
HAL.
Original locality:Germany, Leipzig.
Original substrate:Salix amygdalina.
Notes: Not Fusarium fide Wollenweber & Reinking (1935). This
species was first published as Fusidium inaequale Auersw., in
Rabenh., Klotzschii Herb. Viv. Mycol., Cent. 14: no. 1383, 1850.
The description was repeated in Bot. Zeitung 8: 439, 1850 and
Flora 33: 283, 1850 (in the latter publication also under Fusi-
dium), so that in the simultaneous publication in “Botanische
Zeitung”the “F.”was undoubtedly also meant to be Fusidium and
not Fusarium. Syntype material deposited at HAL has recently
been examined, and Fusidium inaequale turned out to be a
heterotypic synonym of Ramularia rosea (Fuckel) Sacc (see
Braun 1998).
incarcerans Fusarium (Berk.) Sacc., Syll. Fung. 4: 713. 1886.
Basionym:Fusisporium incarcerans Berk., Intellectual Observ. 2:
11. 1863.
(See Fusarium avenaceum)
Holotypus: ?K(M).
Type locality:UK, Northamptonshire, Fotheringhay Castle.
Type substrate:Orthotrichum sp.
Note: Synonym fide Wollenweber & Reinking (1935).
incarnatum Fusarium (Roberge ex Desm.) Sacc., Syll. Fung. 4:
712. 1886.
Basionym:Fusisporium incarnatum Roberge ex Desm., Ann.
Sci. Nat., Bot., s
er. 3, 11: 274. 1849.
Synonyms:Fusarium semitectum Berk. & Ravenel, Grevillea 3:
98. 1875.
Pseudofusarium semitectum (Berk. & Ravenel) Matsush., Icon.
Microfung. Matsush. Lect. (Kobe): 119. 1975.
Fusarium pallens Berk. & M.A. Curtis, Grevillea 3: 99. 1875,
nom. illegit., Art. 53.1, non Fusarium pallens Nees & T. Nees
1818.
Fusarium glumarum Sacc., Syll. Fung. 4: 706. 1886 (nom. nov.
for F. pallens Berk. & M.A. Curtis).
Fusisporium pallidoroseum Cooke, Grevillea 6: 139. 1878.
Fusarium pallidoroseum (Cooke) Sacc., Syll. Fung. 4: 720. 1886.
Fusarium asparagi Briard, Rev. Mycol. (Toulouse) 12: 142. 1890.
Fusarium gloeosporioides Speg. (as ‘gloeosporioide’), Anales
Mus. Nac. Hist. Nat. Buenos Aires 6: 350. 1899.
Fusarium juglandinum Peck, Bull. Torrey Bot. Club 36: 157.
1909.
Fusarium heveae Vincens, Bull. Soc. Pathol. V
eg. France 2: 19.
1915.
Fusarium tenuistipes Sacc., Atti Mem. Reale Accad. Sci. Lett.
Arti, Padova 33: 195. 1917.
Fusarium semitectum var. majus Wollenw., Fusaria Autogr.
Delin. 3: 907–910. 1930.
Fusarium semitectum var. violaceum Batikyan & Abramyan (as
‘violaceae’), Biol. Zhurn. Armenii 22: 58. 1969, nom. inval., Art.
39.1.
Lectotypus:(hic designatus, MBT 10001327) France, from
Tagetes erecta, 1848, M. Roberge in Desmazi
eres, Pl. Crypt. N.
France, 
ed 2, No. 1303, in PC.
Epitypus:(hic designatus, MBT 10001328) Malawi,onTricho-
santhes dioica, date unknown, H.M. Phiri, CBS H-24060.
Ex-epitype culture: ATCC 24387 = CBS 132.73 = IMI
128222 = NRRL 25478.
Descriptions and illustrations: See Booth (1971),Gerlach &
Nirenberg (1982) and Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170409; tef1: MN170476.
Note: The epitypification of Fusarium incarnatum by Xia et al.
(2019) was not effective as the holo- or lectotype was not
correctly indicated (Art. 9.9). Here, a lectotype is selected and
the epitypification is validated.
inflexum Fusarium R. Schneid., in Schneider & Dalchow,
Phytopathol. Z. 82: 80. 1975.
Holotypus: DSM 63203.
Ex-type culture: ATCC 32213 = BBA 63203 = CBS
716.74 = DAOM 225130 = DSM 63203 = IMI 375336 = NRRL
20433.
Type locality:Germany, Hamburg, Vierlanden.
Type substrate: Stem of Vicia faba.
Descriptions and illustrations: See Schneider & Dalchow (1975)
and Gerlach & Nirenberg (1982).
Diagnostic DNA barcodes:rpb1: JX171469; rpb2: JX171583;
tef1: AF008479.
inseptatum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s.,
4: 302. 1832 [1834].
Holotypus: PH00062493.
Type locality:USA, Pennsylvania, Bethlehem.
CROUS ET AL.
122

Type substrate:Daphne mezereum.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
insidiosum Fusarium Roum., Michelia 2: 132. 1880.
(See Fusarium lateritium)
Syntypes: In BR, CUP & ILL (Roum., Fungi Sel. Gall. Exs. No.
57).
Type locality:France, Pyr
en
ees-Orientales, Environs de
Perpignan.
Type substrate:Phytolacca decandra.
Note: Synonym fide Wollenweber & Reinking (1935).
insidiosum Fusarium (Berk.) Sacc., Syll. Fung. 4: 707. 1886,
nom. illegit., Art. 53.1.
Basionym:Fusisporium insidiosum Berk., Gard. Chron. 1860:
480. 1860.
(See Fusarium graminearum)
Holotypus: ?K(M).
Type locality:UK.
Type substrate:Agrostis pulchella.
Note: Synonyms fide Wollenweber & Reinking (1935).
ipomoeae Fusarium M.M. Wang et al., Persoonia 43: 83. 2019.
Holotypus: HAMS 248040.
Ex-type culture: CGMCC 3. 19496 = LC12165.
Type locality:China, Jiangsu Province.
Type substrate: Leaves of Ipomoea aquatica.
Descriptions and illustrations: See Wang et al. (2019).
Diagnostic DNA barcodes:rpb1: MK289859; rpb2: MK289752;
tef1: MK289599.
iranicum Fusarium Torbati et al., Mycol. Progr. 18: 129. 2018
[2019].
Holotypus: CBS H-23560.
Ex-type culture: CBS 143608 = CPC 30860.
Type locality:Iran, West Azerbaijan Province, Orumieh-Salmas.
Type substrate:Agaricus bisporus.
Descriptions and illustrations: See Torbati et al. (2019).
Diagnostic DNA barcodes:rpb2: LT970757; tef1: LT970785.
iridis Fusarium Oudem., Ned. Kruidk. Arch., 2 s
er. 5: 515. 1889.
(See Fusarium avenaceum)
Holotypus: ?L.
Type locality:Netherlands.
Type substrate:Iris pseudacorus.
Note: Synonym fide Wollenweber & Reinking (1935).
irregulare Fusarium M.M. Wang et al., Persoonia 43: 84. 2019.
Holotypus: HAMS 248041.
Ex-type culture: CGMCC 3.19489 = LC7188.
Type locality:China, Guangdong Province.
Type substrate:Bambusoideae.
Descriptions and illustrations: See Wang et al. (2019).
Diagnostic DNA barcodes:rpb1: MK289863; rpb2: MK289783;
tef1: MK289629.
japonicum Fusarium Allesch., Beibl. Hedwigia 36: (164). 1897.
(See Fusarium tortuosum)
Syntype: S-F45631 (Sydow, Mycoth. March. no. 4592).
Type locality:Germany, Berlin.
Type locality:Prunus japonica.
Note: Synonym fide Wollenweber & Reinking (1935).
javanicum Fusarium Koord., Verh. Kon. Akad. Wetensch., Afd.
Natuurk., Sect. 2, 13: 247. 1907.
Holotypus: Not located.
Type locality:Indonesia, Central Java, Purworejo.
Type substrate:Ficus elastica.
Note: Status unclear fide Sandoval-Denis et al. (2019).
juglandinum Fusarium Peck, Bull. Torrey Bot. Club 36: 157. 1909.
(See Fusarium incarnatum)
Holotypus: NYSf1607.
Type locality:USA, Kansas, Rooks, Stockton.
Type substrate:Juglans nigra.
Note: Synonym fide Wollenweber & Reinking (1935).
junci Fusarium P. Crouan & H. Crouan, Fl. Finist
ere: 14. 1867.
Holotypus: ?CO.
Type locality:France, Paris.
Type substrate:Juncus effusus.
Note:?Fusidium fide Wollenweber & Reinking (1935).
jungiae Fusarium Pat., Bull. Soc. Mycol. France 11: 234. 1895.
(See Fusarium avenaceum)
Holotypus: FH00965356.
Type locality:Argentina, San Jorge.
Type substrate: Parasitic on Puccinia sp. on Jungia sp.
Note: Synonym fide Wollenweber & Reinking (1935).
juruanum Fusarium Henn., Hedwigia 43: 398. 1904.
(See Fusarium coccidicola)
Holotypus:InB.
Type locality:Brazil, Rio Jurua.
Type substrate:Annonaceae sp.
Note: Synonym fide Gerlach & Nirenberg (1982).
kalimantanense Fusarium Maryani et al., Stud. Mycol. 92: 187.
2018 [2019].
Holotypus: InaCC F917 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F917.
Type locality:Indonesia, Central Kalimantan, Katingan, Pulau
Malan.
Type substrate:Musa acuminata var. Pisang Ambon.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb1: LS479497; rpb2: LS479241;
tef1: LS479690.
kelerajum Fusarium Samuels et al., Mycologia 103: 1326. 2011.
Neocosmospora keleraja Samuels et al., Mycologia 103: 1326.
2011.
Holotypus: BPI 871413.
Ex-type culture: FRC S-1839 = G.J.S. 02-122.
Type locality:Sri Lanka, Minneriya Natl. Forest.
Type substrate: Trunk of Yakuda marang.
Descriptions and illustrations: See Nalim et al. (2011).
Diagnostic DNA barcode:tef1: DQ247518.
keratoplasticum Fusarium Geiser et al., Fung. Gen. Biol. 53: 68.
2013.
Neocosmospora keratoplastica (Geiser et al.) Sand.-Den. &
Crous, Persoonia 41: 120. 2018.
Synonyms:Cephalosporium keratoplasticum T. Morik., Myco-
pathologia 2: 66. 1939, nom. inval., Art. 39.1.
Hyalopus keratoplasticum T. Morik. ex M.A.J. Barbosa, Sub-
sidios Para o Estudo Parasitologico do Genero Hyalopus Corda,
1838: 19. 1941, nom. inval., Art. 39.1.
Fusarium sedimenticola M.M. Wang et al., Botanica Marina 63:
174. 2020.
FUSARIUM REDELIMITED
www.studiesinmycology.org 123

Holotypus: FRC S-2477.
Ex-type culture: CBS 490.63 = FRC S-2477 = NRRL 22661.
Type locality:USA, Virginia, Winchester.
Type substrate: Indoor plumbing.
Descriptions and illustrations: See Nalim et al. (2011).
Diagnostic DNA barcodes:rpb1: MW218121; rpb2: JN235897;
tef1: JN235712.
konzum Fusarium Zeller et al., Mycologia 95: 947. 2003.
Synonym:Gibberella konza Zeller et al., Mycologia 95: 947.
2003.
Holotypus: DAR 76034.
Ex-type culture: CBS 119849 = KSU 10653 = NRRL 53394.
Type locality:USA, Kansas, Manhattan, Konza Praire Biological
Station.
Type substrate:Sorghastrum nutans.
Descriptions and illustrations: See Zeller et al. (2003) and Leslie
& Summerell (2006).
Diagnostic DNA barcodes:rpb1: LT996200; rpb2: LT996148;
tef1: LT996098.
kotabaruense Fusarium Maryani et al., Persoonia 43: 65. 2019.
Holotypus: InaCC F963 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F963.
Type locality:Indonesia, South Kalimantan, Kota Baru, Keca-
matan Pamukan Barat, Desa Sungai Birah.
Type substrate:Musa var. Pisang Hawa.
Descriptions and illustrations: See Maryani et al. (2019b).
Diagnostic DNA barcodes:rpb1: LS479875; rpb2: LS479859;
tef1: LS479445.
kuehnii Fusarium (Fuckel) Sacc., Syll. Fung. 4: 714. 1886.
Basionym:Fusisporium kuehnii Fuckel, Fungi Rhen. Exs.,
Suppl., Fasc. 5, no. 1920. 1867.
?Athelia arachnoidea (Berk.) Jülich, Willdenowia 7: 53.
1972. (fide Gerlach & Nirenberg 1982)
Basionym:Corticium arachnoideum Berk., Ann. Mag. Nat. Hist.,
ser. 1, 13: 345. 1844.
Synonym:Fusisporium devastans J.G. Kühn, Krankh. Kultur-
gew.: 32. 1858, nom. inval., Art. 38.1(a).
Syntype: Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 5, 1920 (e.g.,
HAL).
Type locality:Germany.
Type substrate: Lichens and mosses.
Notes: Status doubtful. Considered a possible synonym of
F. dimerum by Booth (1971).
kurdicum Fusarium Petr., Sydowia 13: 96. 1959.
Cosmospora kurdica (Petr.) Rossman & Samuels, Stud. Mycol.
42: 122. 1999.
Basionym:Calonectria kurdica Petr., Sydowia 13: 95. 1959.
Synonyms:Nectria kurdica (Petr.) Rossman, Mycol. Pap. 150:
35. 1983.
?Stagonopsis sclerotioides Höhn., Ann. K. K. Naturhist. Hofmus.
20: 368. 1905.
?Botryocrea sclerotioides (Höhn.) Petr., Sydowia 3: 141. 1949.
?Fusarium sclerotioides (Höhn.) Samuels & Rossman, Mycol.
Pap. 164: 23. 1991.
Holotypus: K.H. Rechinger, 31 Jul. 1957, in W.
Type locality:Iran, Kurdistan.
Type substrate:Astragalus sp.
Note: Synonyms fide Rossman et al. (1999).
kuroshium Fusarium F. Na et al., Plant Disease 102: 1159. 2018,
nom. inval., Art. 40.7.
Neocosmospora kuroshio F. Na et al. ex Sand.-Den. & Crous,
Persoonia 43: 137. 2019.
Holotypus: BPI 910340.
Ex-type culture: CBS 142642 = UCR 3641.
Type locality:USA, California, San Diego, El Cajon.
Type substrate:Euwallacea sp. galleries in Platanus racemosa.
Descriptions and illustrations: See Na et al. (2018).
Diagnostic DNA barcodes:rpb1: KX262236; rpb2: KX262256;
tef1: KX262216.
kurunegalense Fusarium Samuels et al., Mycologia 103: 1323.
2011.
Neocosmospora kurunegalensis Samuels et al., Mycologia
103: 1324. 2011.
Holotypus: BPI 871391.
Ex-type culture: CBS 119599 = G.J.S. 02-94.
Type locality:Sri Lanka, Wagamba Province, Kurunegala.
Type substrate: Recently felled tree.
Descriptions and illustrations: See Nalim et al. (2011).
Diagnostic DNA barcodes:rpb1: MW834228; rpb2: LR583838;
tef1: DQ247511.
kyushuense Fusarium O'Donnell & T. Aoki, Mycoscience 39: 2.
1998.
Holotypus: NIAES99701.
Ex-type culture: ATCC 56750 = FRC T-346A = MAFF
237645 = MRC 1767 = NRRL 3509.
Type locality:Japan, Kumamoto.
Type substrate: Seed of Triticum aestivum.
Descriptions and illustrations: See Aoki & O'Donnell (1998).
Diagnostic DNA barcodes:rpb2: MH582098; tef1: MH582292.
laboulbeniae Fusarium C
ep
ede, Arch. Parasitol. 16: 373. 1914.
(See Fusarium larvarum)
Holotypus: Not located.
Type locality:France, Pas-de-Calais, Wimereux.
Type substrate:Demetrias unipunctata.
Note: Synonym fide Wollenweber & Reinking (1935).
lacertarum Fusarium Subrahm. (as ‘laceratum’), Mykosen 26:
478. 1983.
Holotypus: IMI 300797.
Ex-type culture: ATCC 42771 = CBS 130185 = IMI
300797 = NRRL 20423.
Type locality:India, Poona, Pimpri.
Type substrate: Skin of lizard.
Descriptions and illustrations: See Subrahmanyam (1983).
Diagnostic DNA barcodes:rpb1: JX171467; rpb2: JX171581;
tef1: GQ505593.
lactis Fusarium Pirotta, Arch. Lab. Bot. Crittog. Univ. Pavia 2 &
3: 316. 1879.
Synonyms:?Fusarium pyrinum Schwein., Trans. Amer. Philos.
Soc., n.s. 4: 302. 1834.
?Fusarium apiogenum Sacc., Syll. Fung. 4: 717. 1886.
Fusarium rubrum Parav., Ann. Mycol. 16: 311. 1918.
Lectotypus: Arch. Lab. Bot. Crittog. Univ. Pavia 2 & 3, Tab. 21,
figs 1–6, designated by Yilmaz et al. (2021).
Lectotype locality:Italy, Pavia.
Lectotype substrate: Clotted milk.
Epitypus: B 70 0001686, designated by Yilmaz et al. (2021).
CROUS ET AL.
124

Ex-epitype culture: BBA 68590 = CBS 411.97 = IMI
375351 = NRRL 25200.
Epitype locality:USA, California.
Epitype substrate:Ficus carica.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998)
and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: LT996201; rpb2: LT996149;
tef1: AF160272.
lagenariae Fusarium (Schwein.) Sacc., Syll. Fung. 4: 724. 1886.
Basionym:Fusisporium lagenariae Schwein., Trans. Amer.
Philos. Soc., n.s., 4: 275. 1834.
(See Fusarium oxysporum)
Holotypus: PH00062516
Type locality:USA, Pennsylvania, Bethlehem.
Type substrate:Lagenaria siceraria.
lagenarium Fusarium Pass., Erb. Critt. Ital., ser. 2: no. 148. 1871.
Synonym:Gloeosporium lagenarium (Pass.) Sacc. & Roum.,
Rev. Mycol., Toulouse 2(8): 201. 1880.
(See Fusarium cyclogenum)
Holotypus: In PAD.
Type locality:Italy, Parma.
Type substrate:Lagenaria sp.
Note: Synonym fide Wollenweber & Reinking (1935).
lanceolatum Fusarium O.A. Pratt, J. Agric. Res. 13: 83. 1918.
(See Fusarium acuminatum)
Lectotypus (hic designatus, MBT 10000709): USA, Idaho, from
soil, 1918, O.A. Pratt, in J. Agric. Res. 13: 82, fig. 1A–E.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
langsethiae Fusarium Torp & Nirenberg, Int. J. Food Microbiol.
95: 248. 2004.
Holotypus: B 70 0012234.
Ex-type culture: BBA 70945 = CBS 113234.
Type locality:Norway.
Type substrate: Kernal of Avena sativa.
Descriptions and illustrations: See Torp & Nirenberg (2004).
Diagnostic DNA barcodes:rpb1: MW928812; rpb2: MW928828;
tef1: AB674298.
languescens Fusarium L. Lombard & Crous, Persoonia 43: 28.
2018 [2019].
Holotypus: CBS H-23617.
Ex-type culture: CBS 645.78 = NRRL 36531.
Type locality:Morocco.
Type substrate:Solanum lycopersicum.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb1: MW928813; rpb2: MH484880;
tef1: MH484971.
laricis Fusarium Sawada, Bull. Gov. Forest Exp. Sta., Meguro
46: 130. 1950.
Holotypus: TFM:FPH 00771.
Type locality:Japan, Aomori, Kamikita, Noheji
Type substrate:Larix kaempferi.
larvarum Fusarium Fuckel, Jahrb. Nassauischen Vereins Naturk.
23–24: 369. 1870.
Microcera larvarum (Fuckel) Gr€
afenhan et al., Stud. Mycol. 68:
105. 2011.
Synonyms:Fusarium nivale var. larvarum (Fuckel) Bilaĭ, Fusarii
(Biologija i sistematika): 295. 1955, nom. inval., Art. 41.1
Fusarium cryptum McAlpine, Fungus Diseases of Citrus trees in
Australia: 106. 1899.
Fusarium epicoccum McAlpine, Fungus Diseases of Citrus trees
in Australia: 113. 1899.
Microcera parlatoriae Trab., Bull. Agric. Alg
erie Tunisie 13: 33.
1907.
Microcera curta Sacc., Ann. Mycol. 7: 437. 1909.
Microcera tonduzii Pat., Bull. Soc. Mycol. France 28: 142. 1912.
Fusarium aspidioti Sawada, Bot. Mag. (Tokyo) 28: 312. 1914.
Fusarium laboulbeniae C
ep
ede, Arch. Parasitol. 16: 373. 1914.
Fusarium acremoniopsis Vincens, Bull. Soc. Mycol. France 31:
26. 1915.
?Fusarium meliolicola F. Stevens, Bot. Gaz. 65: 245. 1918.
?Nectria meliolicola F. Stevens, Bot. Gaz. 65: 231. 1918.
Microcera aurantiicola Petch, Trans. Brit. Mycol. Soc. 7: 158.
1921.
Lectotypus: G 00111015, selected in Gr€
afenhan et al. (2011).
Lectotype locality:Germany, Hessen, Rheingau, near Oestrich-
Winkel.
Lectotype substrate: Larva cuticles of insects on Malus
domestica.
Epitypus: BBA 62239, designated in Gr€
afenhan et al. (2011).
Ex-epitype culture: BBA 62239 = CBS 738.79 = MUCL
19033 = NRRL 20473.
Epitype locality:Iran, Gilan Province, near Rasht.
Epitype substrate: Parasitic on Quadraspidiotus perniciosus
(scale) on Prunus domestica.
Diagnostic DNA barcodes:rpb1: KM232252; rpb2: KM232387;
tef1: KM231957.
lateritium Fusarium Nees, Syst. Pilze: 31. 1817.
Synonyms:Selenosporium lateritium (Nees) Desm., Fl. Cryptog.
Flandres 2: 99. 1867.
Fusarium microsporum Schltdl., Fl. Berol. 2: 139. 1824.
Fusarium fructigenum Fr., Syst. Mycol. 3: 471. 1832.
Fusarium lateritium var. fructigenum (Fr.) Wollenw., Fusaria
Autogr. Delin. 3: 959. 1930.
Sphaeria baccata Wallroth, Fl. Crypt. Germ. 2: 838. 1833.
Gibbera baccata (Wallr.) Fuckel, Jahrb. Nassauischen Vereins
Naturk. 23–24: 167. 1870.
Gibberella pulicaris subsp. baccata (Wallr.) Sacc., Michelia 1 (3):
317. 1878.
Gibberella baccata (Wallr.) Sacc., Syll. Fung. 2: 553. 1883.
Fusarium lateritium var. mori Desm., Ann. Sci. Nat. Bot., ser. 2, 8:
10. 1837.
Selenosporium urticarum Corda (as ‘urticearum’), Icon. Fung. 2:
7. 1838.
Fusarium urticarum (Corda) Sacc., Syll. Fung. 4: 698. 1886.
?Fusarium protractum L
ev., Ann. Sci. Nat., Bot., s
er. 3, 9: 246.
1848.
Gloeosporium berkeleyi Mont., Ann. Sci. Nat., Bot., s
er. 3, 12:
296. 1849.
Fusarium berkeleyi (Mont.) Berk. & Broome, N. Amer. Fung.:
108. 1875.
Botryosphaeria moricola Ces. & De Not., Hedwigia 4: 27.
1865.
Gibberella moricola (Ces. & De Not.) Sacc., Syll. Fung. 2: 553.
1883.
Gibbera euonymi Fuckel, Jahrb. Nassauischen Vereins Naturk.
23–24: 167. 1870.
Gibberella euonymi (Fuckel) Sacc., Michelia 1: 318. 1878.
Hendersonia euonymi (Fuckel) Sacc., Syll. Fung. 2: 556. 1883.
FUSARIUM REDELIMITED
www.studiesinmycology.org 125

Selenosporium cydoniae Schulzer, Verh. K.K. Zool.-Bot. Ges.
Wien 21: 1240. 1871.
Fusarium cydoniae (Schulzer) Sacc. & Traverso, Syll. Fung. 19:
724. 1910, nom. illegit., Art. 53.1.
Fusarium sticticum Berk. & M.A. Curtis, Grevillea 3: 99. 1875.
Fusisporium zavianum Sacc., Michelia 1: 83. 1877.
Fusarium zavianum (Sacc.) Sacc., Syll. Fung. 4: 709. 1886.
Fusarium cydoniae Roum. & Fautrey, Rev. Mycol. (Toulouse) 14:
170. 1892, nom. illegit., Art. 53.1.
Fusarium salicis Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 7, no.
2110. 1868.
Fusarium salicis var. minus Wollenw., Fusaria Autogr. Delin. 2:
582. 1924.
Fusarium sambucinum var. minus Wollenw., Fusaria Autogr.
Delin. 3: 941. 1930.
Gibbera mori Fuckel, Jahrb. Nassauischen Vereins Naturk.
23–24: 168. 1870.
Fusarium semitectum Berk. & Ravenel, in Berkeley, Grevillea 3:
98. 1875.
Fusisporium cinnabarinum Berk. & M.A. Curtis, Grevillea 3: 146.
1875.
Fusarium cinnabarinum (Berk. & M.A. Curtis) Sacc., Syll. Fung.
4: 722. 1886.
Fusisporium miniatum Berk. & M.A. Curtis, Grevillea 3: 147.
1875.
Fusarium miniatum (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4:
722. 1886, nom. illegit., Art. 53.1.
Fusisporium putaminum Thüm., Oesterr. Bot. Z. 27: 272. 1877.
Fusarium putaminum (Thüm.) Sacc., Syll. Fung. 4: 703. 1886.
Fusisporium leguminum Cooke, Grevillea 6: 139. 1878.
Fusarium leguminum (Cooke) Sacc., Syll. Fung. 4: 712. 1886.
Fusarium limonis Briosi, Att. Staz. Chim. Agrar. Rome. 1878.
Fusarium yuccae Cooke, Grevillea 7: 34. 1878, nom. inval., Art.
36.1(a).
Fusisporium azedarachinum Thüm., Mycoth. Univ., cent. 14: no.
1379. 1879.
Fusarium azedarachinum (Thüm.) Sacc., Syll. Fung. 4: 704.
1886.
Fusarium insidiosum Roum., Michelia 2: 132. 1880.
Fusarium roumeguerei Sacc. (as ‘roumegueri’), Syll. Fung. 4:
702. 1886, nom. illegit., Art. 52.1.
Fusarium albertii Roum., Fungi Sel. Gall. Exs., Cent. 19: no.
1867. 1881.
Fusarium rimicola Sacc. (as ‘rimicolum’), Michelia 2: 297. 1881.
Fusarium ziziphinum Pass., Rev. Mycol., (Toulouse) 4: 22. 1882.
Fusarium acaciae Cooke & Harkn., Grevillea 12: 96. 1884.
Fusarium longisporum Cooke & Massee, Grevillea 16: 4. 1887.
Fusarium sphaeroideum Pass., Atti Reale Accad. Lincei, Ren-
diconti Cl. Sci. Fis., s
er. 4, 4: 105. 1888.
Fusarium parasiticum Fautrey, Rev. Mycol. (Toulouse) 11: 153.
1889, nom. illegit., Art. 53.1.
Fusarium fautreyi Sacc., Syll. Fung. 10: 934. 1892.
Fusarium carneoroseum Cooke, Grevillea 19: 4. 1890.
Fusarium celtidis Ellis & Tracy, J. Mycol. 6: 76. 1890.
Fusarium nucicola P. Karst. & Har., Rev. Mycol. (Toulouse) 12:
131. 1890.
Fusarium discoideum Fautrey & Roum., Rev. Mycol. (Toulouse)
13: 173. 1891.
Fusarium cydoniae Allesch., Ber. Bot. Vereines Landshut 12:
130. 1892.
?Fusarium luteum Clem., Bot. Surv. Nebraska 3: 12. 1894.
Fusarium asclepiadeum Fautrey, Rev. Mycol. (Toulouse) 18: 68.
1896.
Fusarium samararum Allesch., Ber. Bayer. Bot. Ges. 4: 39. 1896.
Fusarium sophorae Allesch., Beibl. Hedwigia 36: (164). 1897.
Fusarium ailanthinum Speg., Anales Mus. Nac. Hist. Nat. Bue-
nos Aires 6: 350. 1899.
Fusarium euonymi Syd., Beibl. Hedwigia 39: (6). 1900.
Fusarium gemmiperda Aderh., Z. Pflanzenkrankh. 11: 70. 1901.
Fusarium euonymi-japonici Henn., Hedwigia 41: 139. 1902.
Fusarium illosporioides Sacc., in Saccardo et al., Harriman
Alaska Expedition 5: 15. 1904.
Fusarium schawrowi Speschnew, Arbeiten Kaukas. Stat. Seid-
enzucht 10: 30–41. 1906.
Selenosporium gloeosporioides Speg. (as ‘gloesporioides’),
Anales Mus. Nac. Hist. Nat. Buenos Aires 13: 458. 1911.
Fusarium gloeosporioides (Speg.) Sacc. & Trotter, Syll. Fung. 22:
1482. 1913, nom. illegit., Art. 53.1.
Fusarium briosianum Ferraris, Fl. Ital. Crypt. Fungi Fasc. 13:
857. 1912.
Fusarium pseudacaciae Rapaics, Z. Pflanzenkrankh. 25: 208.
1915.
Fusarium gleditschiicola Dearn. & Barthol. (as ‘gleditschicola’),
Mycologia 9: 363. 1917.
Gibberella briosiana Turconi & Maffei, Atti Ist. Bot. Univ. Pavia,
s
er. 2, 15: 148. 1918.
Botryosphaeria briosiana (Turconi & Maffei) Weese, Sitzungsber.
Akad. Wiss. Wien, Math.-Naturwiss. Kl., Abt. 1, 128: 708. 1919.
Fusarium uncinatum Wollenw., Ann. Mycol. 15(1/2): 54. 1917.
Fusarium blackmannii W. Br. & A.S. Horne (as ‘blackmanni’),
Ann. Bot. (London) 38: 379. 1924.
Fusarium entomophilum Petch, Trans. Brit. Mycol. Soc. 11: 260.
1925.
Fusarium lateritium var. tenue Wollenw., Fusaria Autogr. Delin. 3:
955. 1930.
Gibberella saubinetii var. flacca Wollenw., Z. Parasitenk. (Berlin)
3: 433. 1931.
Fusarium anisophilum Picado, J. Dept. Agric. Porto Rico 16: 391.
1932.
Lectotypus (hic designatus, MBT 10000710): Germany, un-
known host, 1817, G.C.D. Nees von Esenbeck, in System der
Pilze und Schw€
amme: 31, tab. 2, fig. 26.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971),Gerlach & Nirenberg (1982),Nelson
et al. (1983) and Leslie & Summerell (2006).
Notes: Re-collection from the type host and locality is required.
No holotype specimen could be located and therefore an illus-
tration was designated as lectotype.
laxum Fusarium Peck, Bull. New York State Mus. Nat. Hist. 67:
30. 1903.
(See Fusarium oxysporum)
Holotypus: NYS-F-001667.
Type locality:USA, New York, Albany, Delmar.
Type substrate:Equisetum hyemale.
Note: Synonym fide Wollenweber & Reinking (1935).
leguminum Fusarium (Cooke) Sacc., Syll. Fung. 4: 712. 1886.
Basionym:Fusisporium leguminum Cooke, Grevillea 6: 139.
1878.
(See Fusarium lateritium)
Syntypes: In CUP, ISC, NEB & PH (Fungi Amer. Exs. no. 298).
Type locality:USA, South Carolina, Aiken.
CROUS ET AL.
126

Type substrate:Acacia sp.
Note: Synonym fide Wollenweber & Reinking (1935).
leucoconium Fusarium Corda, Icon. Fung. 1: 4. 1837.
(See Fusarium heterosporum and F. reticulatum)
Typus: In PRM fide Pilat (1938).
Type locality:Czech Republic, Prague.
Type substrate: Rotten plants.
Note: Synonym fide Wollenweber & Reinking (1935) and Booth
(1971). Lectotypification pending study of material lodged in PRM.
libertatis Fusarium L. Lombard & Crous, Persoonia 43: 29.
2018 [2019].
Holotypus: CBS H-23618.
Ex-type culture: CBS 144749 = CPC 28465.
Type locality:South Africa, Western Cape Province, Robben
Island, Van Riebeeck's Quarry.
Type substrate: Rock surface.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb2: MH484944; tef1: MH485035.
lichenicola Fusarium C. Massal., in Maire & Saccardo, Ann.
Mycol. 1: 223. 1903.
Neocosmospora lichenicola (C. Massal.) Sand.-Den. & Crous,
Persoonia 41: 120. 2018.
Synonyms:Bactridium lichenicola (C. Massal.) Wollenw. (‘as
lichenicolum’), Fusaria Autogr. Delin. 1: 456. 1916.
Cylindrocarpon lichenicola (C. Massal.) D. Hawksw., Bull. Brit.
Mus. (Nat. Hist.), Bot. 6: 273. 1979.
Selenosporium lichenicola Speg., Anales Mus. Nac. Hist. Nat.
Buenos Aires, ser. 3, 13: 459. 1911.
Fusarium lichenicola (Speg.) Sacc. & Trotter, Syll. Fung. 22:
1486. 1913, nom. illegit., Art. 53.1.
Monacrosporium tedeschii A. Agostini (as ‘tedeschi’), Atti Ist. Bot.
Univ. Lab. Crittog. Pavia, ser. 3, 4: 195. 1933.
Euricoa dominguiesii Bat. & H. Maia, Anais Soc. Biol. Pernam-
buco 13: 152. 1955.
Hyaloflorea ramosa Bat. & H. Maia, Anais Soc. Biol. Pernam-
buco 13: 155. 1955.
Neocosmospora ramosa (Bat. & H. Maia) L. Lombard & Crous,
Stud. Mycol. 80: 227. 2015.
Mastigosporium heterosporum R.H. Petersen, Mycologia 51:
729. 1959.
Holotypus: In PAD.
Epitypus: CBS H-23983, designated in Sandoval-Denis et al.
(2019).
Ex-epitype culture: CBS 623.92.
Epitype locality:Germany, Göttingen.
Epitype substrate: Necrotic wounds of Homo sapiens under
chemotherapy.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb2: LR583845; tef1: LR583620.
limonis Fusarium Briosi, Ann. R. Staz. Chim.-Agrar. Sper. Roma.
1878.
(See Fusarium lateritium)
Holotypus: Not located.
Type locality:Italy, Sicily.
Type substrate:Citrus limon.
Notes: Synonym fide Wollenweber & Reinking (1935). Proto-
logue not located.
limosum Fusarium Rostr., Bot. Tidsskr. 22: 263. 1899.
(See Fusarium avenaceum)
Holotypus: C-F-111719.
Type locality:Sweden.
Type substrate: Mixture of lime and sugar.
Note: Synonym fide Wollenweber & Reinking (1935).
lineare Fusarium Moesz, Bot. Közlem. 19: 57. 1920.
(See Fusarium obtusisporum)
Holotypus: ?BP.
Type locality:Hungary.
Type substrate:Staphylea pinnata.
Note: Synonym fide Wollenweber & Reinking (1935).
lini Fusarium Bolley, Proc. Annual Meeting Soc. Promot. Agric.
Sci. 22: 42. 1901.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:USA.
Type substrate:Linum usitatissimum.
lini Fusarium Remer, Jahresber.Schles. Ges. Vaterl. Cult. 80: 25.
1903, nom. illegit., Art. 53.1
Holotypus: Not located.
Type locality:Poland.
Type substrate:Linum sp.
liriodendri Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index
Fungorum 440: 2. 2020.
Neocosmospora liriodendri Sand.-Den. & Crous, Persoonia
43: 139. 2019.
Holotypus: CBS H-23984.
Ex-type culture: BBA 67587 = CBS 117481 = G.J.S 91-
148 = NRRL 22389.
Type locality:USA, Maryland.
Type substrate:Liriodendron tulipifera.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218124; rpb2: EU329506;
tef1: AF178340.
loliaceum Fusarium Ducomet, Ann. 
Ecole Natl. Agric. Rennes 2:
14. 1909.
(See Fusarium nivale)
Holotypus: ?MPA.
Type locality:France.
Type substrate: Unknown.
Note: Synonym fide Wollenweber & Reinking (1935).
lolii Fusarium (Wm.G. Sm.) Sacc., Syll. Fung. 11: 652. 1895.
Basionym:Fusisporium lolii Wm.G. Sm., Diseases of field and
garden crops, chiefly as are caused by fungi: 213. 1884.
(See Fusarium heterosporum)
Lectotypus (hic designatus, MBT 10000711): UK,Lolium per-
enne, date unknown, W.G. Smith, in W.G. Smith, Diseases of
field and garden crops, chiefly as are caused by fungi: 213, fig.
96.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
loncheceras Fusarium Sideris, Phytopathology 14: 213. 1924.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000712): USA, California,
Stockton, roots of Allium cepa, 1924, C.P. Sideris,in Phytopa-
thology 14, pl. XI, fig. of F. loncheceras.
FUSARIUM REDELIMITED
www.studiesinmycology.org 127

Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
longicaudatum Fusarium J.W. Xia et al., Persoonia 43: 208.
2019.
Holotypus: CBS H-24061.
Ex-type culture: ATCC 24370 = CBS 123.73 = IMI
160825 = NRRL 25477.
Type locality:Tanzania, Tropical Products Research Inst.
Type substrate: Unknown.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170414; tef1: MN170481.
longicornicola Fusarium Sand.-Den., et al., Persoonia 46: 149.
2021.
Holotypus: CBS H-24661.
Ex-type culture: ARSEF 6455 = CBS 147247 = NRRL 52706.
Type locality:Ethiopia, Kobo, Welo.
Type substrate:Aiolopus longicornis.
Descriptions and illustrations: See Yilmaz et al. (2021).
Diagnostic DNA barcodes:rpb2: JF741114; tef1: JF740788.
longifundum Fusarium J.W. Xia et al., Persoonia 43: 208.
2019.
Holotypus: CBS H-24062.
Ex-type culture: CBS 235.79 = NRRL 36372.
Type locality:Netherlands Antilles, Curaçao.
Type substrate: Air.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: GQ505827; tef1: GQ505649.
longipes Fusarium Wollenw. & Reinking, Phytopathology 15:
160. 1925.
Synonyms:Fusarium scirpi var. longipes (Wollenw. & Reinking)
Wollenw., Z. Parasitenk. (Berlin) 3: 337. 1931.
Fusarium equiseti var. longipes (Wollenw. & Reinking) Joffe,
Mycopathol. Mycol. Appl. 53: 221. 1974.
Neotypus (hic designatus, MBT 10000713): USA, Florida, soil,
1977, W. Gams, CBS 476.77 (preserved as metabolically inac-
tive culture).
Ex-neotype culture: CBS 476.77 = NRRL 20695.
Descriptions and illustrations: See Gerlach & Nirenberg (1982),
Nelson et al. (1983).
Diagnostic DNA barcodes:rpb1: MW233244; rpb2: GQ915493;
tef1: GQ915509.
Notes: This species is recognised by Gerlach & Nirenberg
(1982),Nelson et al. (1983), and Leslie & Summerell (2006).
No holotype specimen could be located and no illustration
accompanied the original protologue. Although an illustration of
the original culture (O.A. Reinking no. R34) is provided in Wol-
lenweber's Fusaria Autogr. Delin. no. 937 (1924), this cannot be
used to designate a lectotype as it does not form part of the
original protologue. Therefore, isolate CBS 476.77 is designated
as neotype here to provide taxonomic stability to this species, as
it appears to have a paraphyletic phylogenetic structure
(O'Donnell et al. 2013).
longisporum Fusarium Cooke & Massee, Grevillea 16: 4. 1887.
(See Fusarium lateritium)
Holotypus: K(M) 159680.
Type locality:Australia, Queensland, Brisbane.
Type substrate: Twigs of Passiflora sp.
Note: Synonym fide Wollenweber & Reinking (1935).
longissimum Fusarium Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899.
Replaced synonym:Fusarium elongatum De Wild., Ann. Soc.
Belge Microscop. 17: 43. 1893, nom. illegit., Art. 53.1, non
Fusarium elongatum Cooke 1890.
(See Fusarium elongatum De Wild.)
Holotypus: Not located.
Type locality:Belgium, Brussels, Botanical Garden.
Type substrate: Submerged plant material.
Note: Synonymy fide Rossman et al. (2016).
longum Fusarium (Wallr.) Sacc., Syll. Fung. 4: 719. 1886.
Basionym:Fusisporium longum Wallr., Fl. Crypt. Germ. 2: 283.
1833.
Holotypus: ?STR.
Type locality:Germany, Berlin.
Type substrate: Dead branch.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
louisianense Fusarium L.R. Gale et al., Fungal Genet. Biol.48:
1105. 2011.
Holotypus: BPI 881005.
Ex-type culture: CBS 127525 = NRRL 54197.
Type locality:USA, Louisiana.
Type substrate: Seeds of Triticum sp.
Descriptions and illustrations: See Sarver et al. (2011).
Diagnostic DNA barcodes:rpb1: KM889655; rpb2: KM889657;
tef1: KM889633.
lucidum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6:
157. 1915.
(See Fusarium avenaceum)
Typus: ?CUP-007473.
Type locality:USA, New York.
Type substrate:Solanum tuberosum.
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in CUP.
lucumae Fusarium Henn., Hedwigia 48: 116. 1908.
Ascochyta lucumae (Henn.) Wollenw., Fusaria Autogr. Delin. 1:
504. 1916.
Syntypes: In BPI, ILL, MIN & WIS (Baker 218).
Type locality:Brazil, Par
a.
Type substrate:Lucuma rivicoa
Note: Synonym fide Wollenweber & Reinking (1935).
luffae Fusarium M.M. Wang et al., Persoonia 43: 85. 2019
Holotypus: HAMS 248042.
Ex-type culture: CGMCC 3.19497 = LC12167.
Type locality:China, Fujian.
Type substrate:Luffa aegyptiaca.
Descriptions and illustrations: See Wang et al. (2019).
Diagnostic DNA barcodes:rpb1: MK289869; rpb2: MK289754;
tef1: MK289601.
lumajangense Fusarium Maryani et al., Persoonia 43: 59.
2019.
Holotypus: InaCC F872 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F872.
Type locality:Indonesia, East Java, Lumajang, Kecamatan
Senduro, Desa Kandang Kepus.
Type substrate:Musa acuminata var. Pisang Mas Kirana.
Descriptions and illustrations: See Maryani et al. (2019b).
CROUS ET AL.
128

Diagnostic DNA barcodes:rpb2: LS479850; tef1: LS479441.
lunatum Fusarium (Ellis & Everh.) Arx, Verh. Kon. Ned. Akad.
Wetensch., Afd. Natuurk., Sect. 2, 51: 101. 1957.
Bisifusarium lunatum (Ellis & Everh.) L. Lombard & Crous,
Stud. Mycol. 80: 225. 2015.
Basionym:Gloeosporium lunatum Ellis & Everh., Proc. Acad.
Nat. Sci. Philadelphia 43: 82. 1891.
Synonyms:Microdochium lunatum (Ellis & Everh.) Arx, Trans.
Brit. Mycol. Soc. 83: 374. 1984.
Fusarium dimerum var. violaceum Wollenw., Fusaria Autogr.
Delin. 3: 854. 1930.
Holotypus: NY00883039.
Type locality:USA, Texas, San Antonio.
Type substrate: Living leaves of Opuntia sp.
Notes: This species requires epitypification. Gerlach & Nirenberg
(1982) designated CBS 632.76 (= NRRL 20690) as neotype of
F. dimerum var. violaceum, which was originally collected in
Germany. However, Schroers et al. (2009) showed that
F. lunatum is paraphyletic and needs further investigation.
Therefore, CBS 632.76 cannot be designated as epitype for
B. lunatum at this time.
lunulosporum Fusarium Gerlach, Phytopathol. Z. 88: 283.
1977.
Holotypus: BBA 62459.
Ex-type culture: ATCC 36747 = BBA 62459 = CBS 636.76 = IMI
322097 = NRRL 13393.
Type locality:South Africa.
Type substrate:Citrus paradisi.
Descriptions and illustrations: See Gerlach (1977b),Gerlach &
Nirenberg (1982) and Nelson et al. (1983).
Diagnostic DNA barcodes:rpb1: KM361637; rpb2: KM361655;
tef1: AF212467.
luteum Fusarium Clem., Bot. Surv. Nebraska 3: 12. 1894.
(See Fusarium lateritium)
Holotypus: NEB00040542.
Type locality:USA, Nebraska, Lincoln.
Type substrate: Decaying wood.
Note: Synonym fide Wollenweber & Reinking (1935).
luteum Fusarium Parav., Ann. Mycol. 16: 302. 1918, nom. illegit.,
Art. 53.1.
(See Fusarium candidum)
Authentic material: In Ann. Mycol. 16, pl. 4., figs 1–22.
Original locality:Switzerland.
Original substrate:Pyrus sp.
Notes: Synonym fide Wollenweber & Reinking (1935).
lutulatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 209. 1915.
(See Fusarium oxysporum)
Typus: CUP-007458.
Type locality:USA, Iowa.
Type substrate:Solanum tuberosum.
Note: Synonym fide Wollenweber & Reinking (1935). Lectotypi-
fication pending study of material lodged in CUP.
lyarnte Fusarium J.L. Walsh, Sangal., L.W. Burgess, E.C.Y.
Liew & Summerell, sp. nov.MycoBank MB 837697.
Synonym:Fusarium lyarnte J.L. Walsh, Sangal., L.W. Burgess,
E.C.Y. Liew & Summerell, Fungal Diversity 44: 153. 2010, nom.
inval., Art. 40.7.
Etymology.‘Lyarnte’, meaning circle in eastern and central
Arrernte Aboriginal language (Henderson & Dobson 1994), in
reference to the conspicuous globose microconidia.
For diagnosis see Walsh et al., Fungal Diversity 44: 153. 2010.
Holotypus: CBS 125536 (preserved as metabolically inactive
culture).
Ex-type culture: CBS 125536 = NRRL 54252 = RBG 5331.
Type locality:Australia, Northern Territory, Litchfield.
Type substrate: Soil.
Descriptions and illustrations: See Walsh et al. (2010).
Diagnostic DNA barcodes:rpb1: JX171549; rpb2: JX171661;
tef1: EF107118.
Notes:Walsh et al. (2010) failed to indicate the holotype for
F. lyarnte, thereby rendering the species name invalid (Art. 40.7).
Here we validate the name.
lycopersici Fusarium (Sacc.) Mussat, Syll. Fung. 15: 144. 1901,
nom. inval., Art. 36.1(a), (c).
Basionym:Fusarium oxysporum subsp. lycopersici Sacc., Syll.
Fung. 4: 705. 1886.
(See Fusarium oxysporum)
Authentic material: Not located.
Original locality:Italy.
Original substrate:Solanum lycopersicum.
lycopersici Fusarium Bruschi, Atti Reale Accad. Lincei, Rendi-
conti Cl. Sci. Fis., ser. 5, 21: 298. 1912.
(See Fusarium oxysporum)
Synonym:Fusarium bulbigenum var. lycopersici (Bruschi) Wol-
lenw. & Reinking, Fusarien: nos. 996–997. 1935.
Holotypus: Not located.
Type locality:Italy.
Type substrate:Solanum lycopersicum.
Note: Synonym fide Wollenweber & Reinking (1935).
lycopersici Fusarium (Sacc.) Wollenw., Phytopathology 3: 29.
1913, nom. illegit., Art. 53.1.
Basionym:Fusarium oxysporum subsp. lycopersici Sacc., Syll.
Fung. 4: 705. 1886.
(See Fusarium oxysporum)
Authentic material: Not located.
Original locality:Italy.
Original substrate:Solanum lycopersicum.
macounii Fusarium Dearn., Mycologia 9: 363. 1917.
(See Fusarium expansum)
Holotypus: DAOM 223428b.
Type locality:Canada, Vancouver Island.
Type substrate:Acer sp.
Note: Synonym fide Wollenweber & Reinking (1935).
macroceras Fusarium Wollenw. & Reinking, Phytopathology
15: 166. 1925.
Holotypus: CBS 146.25 (preserved as metabolically inactive
culture).
Ex-type culture: CBS 146.25 = NRRL 13958.
Type locality:Honduras.
Type substrate:Phaseolus vulgaris.
Descriptions and illustrations: See Wollenweber & Reinking
(1925,1935) and Gerlach & Nirenberg (1982).
Notes: Phylogenetic inference (not shown) revealed that the ex-
type culture housed at CBS clustered within the N. petroliphila
clade, indicating a possible strain transposition or contamination
of the culture in the past. These species are not morphologically
FUSARIUM REDELIMITED
www.studiesinmycology.org 129

conspecific based on the original protologue (Wollenweber &
Reinking 1925)ofF. macroceras.
macrosporum Fusarium (Sand.-Den. et al.)O'Donnell et al., In-
dex Fungorum 440: 2. 2020.
Neocosmospora macrospora Sand.-Den. et al., Persoonia 40:
21 2017 [2018].
Holotypus: CBS H-23023.
Ex-type culture: CBS 142424 = CPC 28191.
Type locality:Italy, Sicily, Catania, Guardia.
Type substrate:Citrus sinensis.
Descriptions and illustrations: See Sandoval-Denis et al.
(2018a).
Diagnostic DNA barcodes:rpb1: MW218125; rpb2: LT746331;
tef1: LT746218.
macroxysporum Fusarium Lindf., Meddel. Centralanst. För-
söksv€
as. Jordbruksomr. Avd. Lantbruksbot. 25: 8. 1922.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:Sweden.
Type substrate:Pinus sylvestris.
Note: Synonym fide Wollenweber & Reinking (1935).
maculans Fusarium B
erenger, Atti Riunione Sci. Ital. 6: 474.
1845.
Neophloeospora maculans (B
erenger) Videira & Crous, Stud.
Mycol. 87: 338. 2017.
Synonyms:Phloeospora maculans (B
erenger) Allesch., Rabenh.
Krypt.-Fl., ed. 2, 1: 935. 1900.
Phloeosporella maculans (B
erenger) Ho€hn., Mitt. Bot. Inst.
Techn. Hochsch. Wien 4: 77. 1927.
Cercosporella maculans (B
erenger) F.A. Wolf, J. Elisha Mitchell
Sci. Soc. 51: 165. 1935.
Septoria mori L
ev., Ann. Sci. Nat., Bot., ser. 3, 5: 279. 1846.
Cheilaria mori (L
ev.) Desm., Ann. Sci. Nat., Bot., ser. 3, 8: 27.
1847.
Phloeospora mori (L
ev.) Sacc., Michelia 1: 175. 1878.
Septogloeum mori (L
ev.) Briosi & Cavara, Fung. Paras. Piante
Colt. Util., Fasc. 1: no. 21. 1888.
Cylindrosporium mori (L
ev.) Berl., Riv. Patol. Veg. 5: 205. 1896.
Sphaeria mori Nitschke, Fungi Rhen. Exs. no. 1784. 1866, nom.
inval., Art. 38.1(a).
Sphaerella mori Fuckel, Jahrb. Nassauischen Vereins Naturk.
23–24: 106. 1870.
Mycosphaerella mori (Fuckel) F.A. Wolf, J. Elisha Mitchell Sci.
Soc. 51: 165. 1935.
Sphaerella morifolia Pass., Erb. Critt. Ital., Ser. 2, Fasc. 30, no.
1464. 1885.
Mycosphaerella morifolia (Pass.) Cruchet, Bull. Soc. Vaud. Sci.
Nat. 55: 43. 1923.
Cercospora pulvinulata f.angulosa S
avul. & Sandu, Herb. Mycol.
Roman. no. 188. 1931.
Holotypus: Not located.
Type locality:Italy.
Type substrate: Leaves of Morus sp.
madaense Fusarium Ezekiel et al., MycoKeys 67: 112. 2020.
Holotypus: CBS H-24346.
Ex-type culture: CBS 146669 = CPC 38344.
Type locality:Nigeria, Nasarawa, Mada Station.
Type substrate:Arachis hypogaea.
Descriptions and illustrations: See Ezekiel et al. (2020).
Diagnostic DNA barcodes:rpb1: LR792575; rpb2: LR792589;
tef1: LR792625.
magnoliae-champaca Fusarium R.H. Perera et al., Myco-
sphere 11: 2140. 2020.
Holotypus: MFLU 18-2736.
Ex-type culture: MFLUCC 18-0580.
Type locality:Thailand, Chiang Rai, Mae Fah Luang University
garden.
Type substrate: Dried fruits of Magnolia champaca.
Descriptions and illustrations: See Perera et al. (2020).
Diagnostic DNA barcode:rpb2: MT212198.
magnusianum Fusarium Allesch., Fungi Bav. no. 400. 1895.
(See Fusarium aquaeductuum)
Holotypus:InM.
Type locality:Germany, München.
Type substrate:Salix incana.
Note: Synonym fide Wollenweber & Reinking (1935).
mahasenii Fusarium Samuels et al., Mycologia 103: 1325. 2011.
Neocosmospora mahasenii Samuels et al., Mycologia 103:
1325. 2011.
Holotypus: BPI 881228.
Ex-type culture: CBS 119594 = FRC S-1845 = G.J.S. 02-105.
Type locality:Sri Lanka, North Central Province, Giritale. Giritale
Forest Training Center.
Type substrate: Small branch of live tree.
Descriptions and illustrations: See Nalim et al. (2011).
Diagnostic DNA barcodes:rpb1: MW834231; rpb2: LT960563;
tef1: DQ247513.
mali Fusarium Allesch., Ber. Bot. Vereines Landshut 12: 130.
1892.
(See Fusarium candidum)
Holotypus:InM.
Type locality:Germany, München.
Type substrate:Malus pumila.
Note: Synonym fide Wollenweber & Reinking (1935).
malli Fusarium Taubenh., Bull. Texas Agric. Exp. Sta. 273: 25.
1921.
(See Fusarium solani)
Holotypus: ?CUP-011254.
Type locality:USA, Texas, Brazos, College Station.
Type substrate:Allium cepa.
Note: Typification pending study of material lodged in CUP.
malvacearum Fusarium Taubenh., Bull. Texas Agric. Exp. Sta.
260: 27. 1920.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000714): USA, Texas,
Abelmoschus esculentus, 1920, J.J. Taubenhhaus, in Tau-
benhaus, Bull. Texas Agric. Exp. Sta. 260: 30, fig. 8g.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration
was designated as lectotype.
mangiferae Fusarium Britz et al., Mycologia 94: 725. 2002.
Holotypus: PREM 57299.
Ex-type culture: CBS 120994 = KSU 11781 = MRC
7559 = MUCL 54671 = NRRL 53980.
CROUS ET AL.
130

Type locality:Israel, Bet Dagan, Volcani Center.
Type substrate:Mangifera indica.
Descriptions and illustrations: See Britz et al. (2002).
Diagnostic DNA barcodes:rpb1: MW402530; rpb2: LT575059;
tef1: LT574978.
marasasianum Fusarium Herron et al., Stud. Mycol. 80: 146.
2015.
Holotypus: PREM 60899.
Ex-type culture: CBS 137238 = CMW 25261.
Type locality:Colombia, Vivero Pe~
nas Negra, Valle del Cauca.
Type substrate:Pinus patula.
Descriptions and illustrations: See Herron et al. (2015).
Notes: Comparisons of recently generated sequences for the
living ex-type (CBS 137238 = CMW 25261) of F. marasasianum
indicate a strain transposition or contamination by another
Fusarium species. Therefore, this species needs to be recol-
lected from the type locality and substrate or sequences need to
be generated from the holotype specimen.
marginatum Fusarium Berk. & M.A. Curtis, Grevillea 3: 97. 1875.
Holotypus: ?K(M).
Type locality:USA, Alabama, Beaumont.
Type substrate:Smilax sp.
Note: Not Fusarium fide Wollenweber & Reinking (1935).
martiellae-discolorioides Fusarium Batikyan, Biol. Zhurn. Armenii
22: 87. 1969, nom. inval., Art. 39.1.
Authentic material: Not located.
Original locality:Armenia.
Original substrate: Soil of wheatfield.
Notes: Published without Latin diagnosis fide Gerlach &
Nirenberg (1982). Also described in Biol. Zhurn. Armenii 26(2):
73. 1973, but also not in Latin.
martii Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst.
Land- Forstw. 8: 83. 1913.
Neocosmospora martii (Appel & Wollenw.) Sand.-Den. &
Crous, Persoonia 43: 137. 2019.
Synonyms:Fusarium solani var. martii (Appel & Wollenw.)
Wollenw., Fusaria Autogr. Delin. 3: 1034. 1930.
Neocosmospora croci Guarnaccia et al., Persoonia 40: 17. 2017
[2018].
Lectotypus: BPI 452385, selected in Sandoval-Denis et al.
(2019).
Epitypus: CBS H-23986, designated in Sandoval-Denis et al.
(2019).
Ex-epitype culture: CBS 115659 = FRC S-0679 = MRC 2198.
Lecto- and epitype locality:Germany, Berlin.
Lecto- and epitype substrate:Solanum tuberosum.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834232; rpb2: JX435256;
tef1: JX435156.
massalimae Fusarium A.D. Cavalcanti et al., Mycol. Progr. 19:
1137. 2020.
Holotypus: URM 94324.
Ex-type culture: URM 8239.
Type locality:Brazil, Alagoas, Quebrangulo, Pedra Talhada
Biological Reserve.
Type substrate:Handroanthus chrysotrichus.
Descriptions and illustrations: See Cavalcanti et al. (2020).
Diagnostic DNA barcodes:rpb2: MN939767; tef1: MN939763.
matuoi Fusarium Hosoya & Tubaki, Mycoscience 45: 264. 2004.
Fusicolla matuoi (Hosoya & Tubaki) Gr€
afenhan & Seifert, Stud.
Mycol. 68: 101. 2011.
Synonyms:Fusarium splendens Matuo & Takah. Kobay., Trans.
Mycol. Soc. Japan 2(4): 13. 1960, nom. inval., Art. 39.1.
Cosmosporamatuoi Hosoya & Tubaki, Mycoscience 45: 262. 2004.
Holotypus: TNS F-11127.
Ex-type culture: MAFF 410976.
Type locality:Japan, Honshu.
Type substrate: Twigs of Albizia julibrissin.
Descriptions and illustrations: See Hosoya & Tubaki (2004).
mauroi Fusarium Av.-Sacc
a, Revista Agric. (Piracicaba) 8: 93.
1933.
Macronectria jungneri (Henn.) Salgado & P. Chaverri, Fungal
Diversity 80: 448. 2016.
Basionym:Nectria jungneri Henn., Bot. Jahrb. Syst. 22: 75. 1895.
Synonyms:Cucurbitaria jungneri (Henn.) Kuntze, Revis. Gen. Pl.
3: 461. 1898.
Neonectria jungneri (Henn.) Samuels & Brayford (as ‘Nenectria’),
Mycologia 96: 580. 2004.
Thelonectria jungneri (Henn.) P. Chaverri & Salgado, Stud.
Mycol. 68: 76. 2011.
Nectria eustoma Penz. & Sacc., Malpighia 11: 509. 1898 [1897].
Nectria leucocoma Starb€
ack, Bih. Kongl. Svenska Vetensk.-
Akad. Handl. 25: 28. 1899.
Nectria cinereopapillata Henn. & E. Nyman, inWarburg, Mon-
sunia 1: 161. 1900 [1899].
Nectria striatospora Zimm., Centralbl. Bakteriol. II, 7: 105. 1901.
Nectria theobromae Massee, Bull. Misc. Inform. Kew 1908: 218.
1908.
Cylindrocarpon victoriae Wollenw., Z. Parasitenk. (Berlin) 1: 161.
1928.
Nectria azureo-ostiolata Doi, Mem. Nat. Sci. Mus. Tokyo 10: 23.
1977.
Holotypus: Not located.
Type locality:Brazil.
Type substrate:Caconema radicicola.
Note: Synonyms fide Wollenweber & Reinking (1935) and
Salgado-Salazar et al. (2016).
maydiperdum Fusarium Bub
ak, Centralbl. Bakteriol. 2. Abth. 31:
497. 1911.
(See Fusarium poae)
Holotypus: BPI 452399.
Type locality:Czech Republic, Tabor.
Type substrate: Seeds of Zea mays.
Note: Synonym fide Wollenweber & Reinking (1935).
maydis Fusarium Kalchbr., Math. Term. Közlem. 3: 285. 1865.
(See Fusarium sambucinum)
Holotypus: BRACR33140.
Type locality:Hungary.
Type substrate:Zea mays.
Note: Synonym fide Wollenweber & Reinking (1935).
melanochlorum Fusarium (Casp.) Sacc., Syll. Fung. 4: 725. 1886.
Basionym:Fusisporium melanochlorum Casp., Ber.
Bekanntm. Verh. Königl. Preuss. Akad. Wiss. Berlin 1855:
309, 314. 1855.
Cosmospora flavoviridis (Fuckel) Rossman & Samuels, Stud.
Mycol. 42: 121. 1999.
Basionym:Sphaerostilbe flavoviridis Fuckel, Jahrb. Nassaui-
schen Vereins Naturk. 25–26: 310. 1871.
FUSARIUM REDELIMITED
www.studiesinmycology.org 131

Synonyms:Nectria flavoviridis (Fuckel) Wollenw. Angew. Bot. 8:
186. 1926.
Fusarium celtidis Pass., Atti Reale Accad. Lincei, Rendiconti Cl.
Sci. Fis., 4 s
er. 7: 51. 1891, nom. illegit., Art. 53.1.
Fusarium sphaeriiforme Sacc. (as ‘sphaeriaeforme’), Syll. Fung.
10: 723. 1892.
Fusarium glandicola Allesch., Ber. Bot. Vereines Landshut12:
130. 1892, nom. illegit., Art. 53.1, non Cooke & W.R. Gerard,
1878.
Fusarium allescheri Sacc. & P. Syd., Syll. Fung. 14: 1128. 1899.
Holotypus: Not located.
Type locality:Germany, Berlin.
Type substrate: Rotten aquatic plants.
meliolicola Fusarium F. Stevens (as ‘meliolicolum’), Bot. Gaz. 65:
245. 1918.
(See Fusarium larvarum)
Holotypus: ILL00011251.
Type locality:Puerto Rico, Mayagüez.
Type substrate: Parasitic on Meliola paulliniae on Casearia
sylvestris.
Note: Synonym fide Wollenweber & Reinking (1935).
meridionale Fusarium T. Aoki et al., Fungal Genet. Biol. 41:
618. 2004.
Holotypus: BPI 843474.
Ex-type culture: CBS 110247 = FRC R-5329 = NRRL 28436.
Type locality:New Caledonia.
Type substrate:Citrus sinensis.
Descriptions and illustrations: See O'Donnell et al. (2004).
Diagnostic DNA barcodes:rpb1: KM361642; rpb2: KM361660;
tef1: AF212435.
merismoides Fusarium Corda, Icon. Fung. 2: 4. 1838.
Fusicolla merismoides (Corda) Gr€
afenhan et al., Stud. Mycol.
68: 101. 2011.
Synonyms:Fusisporium georginae Klotzsch, Herb. Viv. Mycol.,
Cent. 2: 186. 1832, nom. nud., Art. 38.1 (a).
Fusarium rhizophilum Corda, Icon. Fung. 2: 3. 1838.
Pionnotes rhizophila (Corda) Sacc., Syll. Fung. 4: 727. 1886.
?Fusisporium arachnoideum Corda, Icon. Fung. 1: 11. 1837.
?Fusarium arachnoideum (Corda) Sacc., Syll. Fung. 4: 721.
1886.
?Fusarium biasolettianum Corda, Icon. Fung. 2: 3. 1838.
?Fusisporium biasolettianum (Corda) Sacc., Mycoth. Ven. no.
1040. 1877.
?Pionnotes biasolettiana (Corda) Sacc., Syll. Fung. 4: 725. 1886.
Fusisporium udum Berk., Ann. Mag. Nat. Hist. 6: 438. 1841.
Pionnotes uda (Berk.) Sacc., Syll. Fung. 4: 726. 1886.
Fusarium udum (Berk.) Wollenw., Phytopathology 3: 38. 1913,
nom. illegit., Art. 53.1.
Fusidium udum Berk., in Trotter, Syll. Fung. 25: 979. 1931, nom.
inval., Art. 36.1.
Fusisporium foeni Berk. & Broome, Ann. Mag. Nat. Hist., ser. 2,
7: 179. 1851.
Fusarium foeni (Berk. & Broome) Sacc., Syll. Fung. 4: 699. 1886.
Fusisporium roseolum H.O. Stephens ex Berk. & Broome, Ann.
Mag. Nat. Hist., ser. 2, 7: 178. 1851.
Fusarium roseolum (H.O. Stephens ex Berk. & Broome) Sacc.,
Syll. Fung. 4: 710. 1886.
Fusisporium rimosum Peck, Rep. (Annual) New York State Mus.
Nat. Hist. 30: 58. 1878.
Fusarium rimosum (Peck) Sacc., Syll. Fung. 4: 713. 1886.
Fusarium roesleri Thüm., Pilze Weinst.: 51. 1878.
Fusarium arvense Speg., Anales Soc. Ci. Argent. 10: 60. 1880.
Fusarium gallinaceum Cooke & Harkn., Grevillea 9: 8. 1880.
Fusarium nicotianae Oudem., Ned. Kruidk. Arch., s
er. 3, 2: 777.
1902.
Fusarium udum var. pusillum Wollenw., Phytopathology 1: 206.
1913, nom. nud.
Fusarium udum var. solani Sherb., Mem. Cornell Univ. Agric.
Exp. Sta. 6: 131. 1915.
Fusarium merismoides f.nicotianae (Oudem.) Subram.,
Hyphomycetes: 676. 1971.
Fusarium oxysporum f. sp. nicotianae (Oudem.) Subram.,
Hyphomycetes: 676. 1971.
Fusarium pelargonii P. Crouan & H. Crouan, Fl. Finist
ere: 14.
1867.
Fusarium albiziae Woron., Vestn. Tiflissk. Bot Sada 48: 34. 1920.
Fusarium merismoides var. majus Wollenw., Fusaria Autogr.
Delin. 3: 857a. 1930.
Fusarium merismoides var. chlamydosporale Wollenw., Z. Par-
asitenk. (Berlin) 3: 308. 1931.
Fusarium merismoides var. artocarpi X.H. Fu & Q.T. Chen, Acta
Mycol. Sin. 8: 42. 1989.
Fusarium merismoides var. persicicola X.H. Fu & Q.T. Chen,
Acta Mycol. Sin. 8: 44. 1989.
Typus: PRM 155493.
Type locality:Czech Republic, Prague.
Type substrate: Wet shards of a plant pot.
Note: Lectotypification pending study of material lodged in PRM.
mesentericum Fusarium Cooke & Harkn., Grevillea 9: 128. 1881.
Holotypus: ?K(M).
Type locality:USA, California, San Francisco Masonic Cemetery.
Type substrate:Eucalyptus sp.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
mesoamericanum Fusarium T. Aoki et al., Fungal Genet. Biol.
41: 619. 2004.
Holotypus: BPI 843476.
Ex-type culture: CBS 415.86 = FRC R-8506 = IMI
309346 = NRRL 25797.
Type locality:Honduras.
Type substrate:Musa sp.
Descriptions and illustrations: See O'Donnell et al. (2004).
Diagnostic DNA barcodes:rpb1: KM361639; rpb2: KM361657;
tef1: AF212441.
metachroum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 141. 1910 [1913].
(See Fusarium avenaceum)
Holotypus: BPI 452408.
Type locality:Poland, Pozna
n, Slivno Manor.
Type substrate:Triticum aestivum.
Note: Synonym fide Wollenweber & Reinking (1935).
metavorans Fusarium Al-Hatmi et al., Medical Mycol. 56: S147.
2018.
Neocosmospora metavorans (Al-Hatmi et al.) Sand.-Den. &
Crous, Persoonia 41: 121. 2018.
Holotypus: CBS 135789 (preserved as metabolically inactive
culture).
Ex-type culture: CBS 135789.
Type locality:Greece, Athens.
Type substrate: Pleural effusion of Homo sapiens.
CROUS ET AL.
132

Descriptions and illustrations: See Al-Hatmi et al. (2018) and
Sandoval-Denis & Crous (2018).
Diagnostic DNA barcodes:rpb1: MW218127; rpb2: LR583849;
tef1: LR583627.
mexicanum Fusarium T. Aoki et al., Phytopathology 100: 1180.
2010.
Holotypus: BPI 879150.
Ex-type culture: NRRL 53147.
Type locality:Mexico, Nueva Italia, Michoac
an.
Type substrate:Mangifera indica.
Descriptions and illustrations: See Otero-Colina et al. (2010).
Diagnostic DNA barcodes:rpb1: MG838088; rpb2: MN724973;
tef1: MG838032.
microcera Fusarium Bilaĭ, Fusarii (Biologija i sistematika): 292.
1955, nom. inval., Art. 39.1.
(See Fusarium coccidicola)
Note: This species was invalidly published without Latin
diagnosis.
microconidium Fusarium L. Lombard & Crous, Fungal Syst.
Evol. 4: 192. 2019.
Holotypus: CBS H-24017.
Ex-type culture: CBS 119843 = MRC 8391 = KSU 11396.
Type locality:Unknown.
Type substrate: Unknown.
Descriptions and illustrations: See Lombard et al. (2019a).
Diagnostic DNA barcodes:rpb1: MN120721; tef1: MN120759.
microphlyctis Fusarium Mont., Ann. Sci. Nat., Bot., s
er. 3, 12:
297. 1849.
Holotypus: ?PC.
Type locality:France.
Type substrate: Fruit of Olea sp.
Note:Gloeosporium fide Wollenweber & Reinking (1935).
micropus Fusarium Sacc., Philipp. J. Sci. 18: 605. 1921.
Infrafungus micropus (Sacc.) Cif., Mycopathol. Mycol. Appl. 6:
26. 1951.
Holotypus: In PAD.
Type locality:China, Guangdong Province.
Type substrate: Parasitic on Cladosporium herbarum on leaf of
Morus alba.
microspermum Fusarium Berk. & M.A. Curtis, Grevillea 3: 98.
1875.
Holotypus: ?K(M).
Type locality:USA, South Carolina, Santee River.
Type substrate: Ficus sp.
Note:Hymenula fide Wollenweber & Reinking (1935).
microsporum Fusarium Schltdl., Fl. Berol. 2: 139. 1824.
(See Fusarium lateritium)
Holotypus: HAL 1615 F.
Type locality:Germany, Berlin.
Type substrate:Robinia pseudoacaciae.
Note: Synonym fide Wollenweber & Reinking (1935).
mikaniae Fusarium Berk. & M.A. Curtis, Grevillea 3: 98. 1875.
Holotypus: ?K(M).
Type locality:USA, South Carolina, Santee River.
Type substrate: Stems and leaves of Mikania scandens.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
mindoanum Fusarium Petr., Sydowia 4: 576. 1950.
Holotypus: In W as no. 03550 (Petrak, Pilzherbarium no. 32229).
Type locality:Ecuador, Pichincha, Mindo.
Type substrate:Dryopteris diplazioides.
Notes: No living material available to confirm taxonomic status.
Requires recollection from type locality and substrate.
miniatulum Fusarium Sacc., Syll. Fung. 10: 727. 1892.
Replaced synonym:Fusarium miniatum Prill. & Delacr., Bull.
Soc. Mycol. France 7: 117. 1891, nom. illegit., Art. 53.1
(See Fusarium nivale)
Holotypus: Not located.
Type locality:France, Paris.
Type substrate:Secale cereale.
Note: Synonym fide Wollenweber & Reinking (1935).
miniatum Fusarium Sacc., Michelia 1: 83. 1877.
Synonym:Fusarium detonianum Sacc., Syll. Fung. 4: 708. 1886,
nom. illegit., Art. 52.1.
Holotypus: In PAD.
Type locality:Italy.
Type substrate: Sporangium of Cyathus vernicosa.
Note: Status unclear. Requires further investigation.
miniatum Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4:
722. 1886, nom. illegit., Art. 53.1.
Basionym:Fusisporium miniatum Berk. & M.A. Curtis, Grevillea
3: 147. 1875.
(See Fusarium lateritium)
Holotypus: ?K(M).
Type locality:USA, North Carolina.
Type substrate:Cornus florida.
Note: Synonym fide Wollenweber & Reinking (1935).
miniatum Fusarium Prill. & Delacr., Bull. Soc. Mycol. France 7:
117. 1891, nom. illegit., Art. 53.1.
Replacing synonym:Fusarium miniatulum Sacc., Syll. Fung. 10:
727. 1892
(See Fusarium nivale)
Authentic material: Not located.
Original locality:France, Paris.
Original substrate:Secale cereale.
Note: Synonym fide Wollenweber & Reinking (1935).
minimum Fusarium Fuckel, Fungi Rhen. Exs., Fasc. 3, no. 213.
1863.
(See Fusarium nivale)
Syntypes: In BPI, MICH, MU & S (Fungi Rhen. Exs., Fasc. 3, no.
213).
Type locality:Germany, Oestrich, Nassau region.
Type substrate: Dry leaves of Poaceae (mainly Zea mays)
Note: Synonym fide Wollenweber & Reinking (1935).
minutissimum Fusarium (Desm.) Sacc., Syll. Fung. 4: 703. 1886.
Passalora minutissima (Desm.) U. Braun & Crous, CBS
Biodiversity Ser. 1: 276. 2003.
Basionym:Selenosporium minutissimum Desm., Pl. Crypt.
France, ed. 3, Fasc. 10: no. 456. 1857.
Phaeoramularia minutissima (Desm.) U. Braun, Nova Hedwigia
55: 214. 1992.
Ramularia geranii-sanguinei C. Massal., Atti Ist. Veneto Sci. Lett.
Arti 59: 688. 1900.
Cercospora geranii-sanguinei Henn., Nytt Mag. Naturvidensk.
42: 33. 1904.
FUSARIUM REDELIMITED
www.studiesinmycology.org 133

Lectotypus: Desm., Pl. Crypt. France, Fasc. X, no. 456 in PC fide
Braun (1998).
Lectotype locality:France, Louvigny, Caen.
Lectotype substrate:Geranium molle.
minutulum Fusarium Corda, Icon. Fung. 2: 4. 1838.
?Clonostachys solani (Harting) Schroers & W. Gams, Stud.
Mycol. 46: 111. 2001.
Basionym:Spicaria solani Harting, Nieuwe Verh. Eerste Kl. Kon.
Ned. Inst. Wetensch. Amsterdam, ser. 2, 12: 226. 1846.
Synonyms:?Gliocladium solani (Harting) Petch, Trans. Brit.
Mycol. Soc. 27: 149. 1945.
?Hypomyces solani Reinke & Berthold, Untersuch. Bot. Lab.
Univ. Göttingen 1: 27. 1879.
?Hypolyssus solani (Reinke & Berthold) Kuntze, Revis. Gen. Pl.
3: 488. 1898.
?Hyphonectria solani (Reinke & Berthold) Petch, Bot. J. (London)
74: 220. 1937 [1936].
?Nectriopsis solani (Reinke & Berthold) C. Booth, Mycol. Pap.
74: 8. 1960.
?Bionectria solani (Reinke & Berthold) Schroers, Stud. Mycol.
46: 111. 2001.
?Gliocladium nigrovirens J.F.H. Beyma, Verh. Kon. Akad.
Wetensch., Afd. Natuurk., Sect. 2, 29: 30. 1931.
?Clonostachys solani f. nigrovirens (J.F.H. Beyma) Schroers,
Stud. Mycol. 46: 115. 2001.
Typus: In PRM fide Pilat (1938).
Type locality:Czech Republic, Prague.
Type substrate: Wood splinters of Corylus sp.
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in PRM.
miscanthi Fusarium W. Gams et al., Mycologia 91: 264. 1999.
Holotypus: CBS H-6063.
Ex-type culture: CBS 577.97 = NRRL 26231.
Type locality:Denmark, Zealand, Højbakkegård Experimental
field.
Type substrate:Miscanthus sinensis.
Descriptions and illustrations: See Gams et al. (1999).
Diagnostic DNA barcodes:rpb1: JX171521; rpb2: JX171634;
tef1: MN193878.
mollerianum Fusarium Thüm., Inst. Coimbra 28: 263. 1881.
(See Fusarium graminearum)
Holotypus: ?S-F45644.
Type locality:Portugal, Coimbra.
Type substrate:Melia azedarach.
Note: Synonym fide Wollenweber & Reinking (1935).
moniliforme Fusarium J. Sheld., Annual Rep. Nebraska Agric.
Exp. Sta. 17: 23. 1904.
(See Fusarium verticillioides)
Syntypes: BPI 452450 & BPI 452452.
Type locality:USA, Nebraska.
Type substrate:Zea mays.
Note: Typification pending further study of the syntypes.
monophialidicum Fusarium J.W. Xia et al., Persoonia 43: 211.
2019.
Holotypus: CBS H-24063.
Ex-type culture: NRRL 54973 = UTHSC 06-1473.
Type locality:USA, Ohio.
Type substrate: Eye of Rhinocerotidae (rhinoceros).
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb1: KC808299; rpb2: KC808362;
tef1: MN170483.
mori Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index
Fungorum 440: 2. 2020.
Neocosmospora mori Sand.-Den. & Crous, Persoonia 43: 143.
2019.
Holotypus: CBS H-23987.
Ex-type culture: ATCC 44934 = CBS 145467 = MAFF
238539 = NRRL 22230.
Type locality:Japan, Miyazaki.
Type substrate: Twigs of Morus alba.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834235; rpb2: EU329499;
tef1: AF178358.
moronei Fusarium Curzi, Revista Biol. (Lisbon) 10: 141. 1928.
(See Fusarium acuminatum)
Holotypus:?PAV.
Type locality:Italy.
Type substrate: Vesicle on skin of Canis lupus familiaris (dog).
Note: Synonym fide Wollenweber & Reinking (1935).
moschatum Fusarium (Kitasato) Sacc., Syll. Fung. 10: 729.
1892.
Basionym:Fusisporium moschatum Kitasato, Centralbl. Bakter-
iol. Parasitenk., 1. Abth. 5: 365. 1889.
(See Fusarium aquaeductuum)
Holotypus: Not located.
Type locality:Germany.
Type substrate: Metallic medical equipment.
Note: Synonym fide Wollenweber & Reinking (1935).
mucidum Fusarium J.W. Xia et al., Persoonia 43: 211. 2019.
Holotypus: CBS H-24064.
Ex-type culture: CBS 102395.
Type locality:El Salvador, Cooperaci
on Coralama.
Type substrate: Mouldy nut of Anacardium occidentale.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170418; tef1: MN170485.
muentzii Fusarium Delacr. (as ‘müntzii’), Bull. Soc. Mycol. France
8: 192. 1892.
(See Fusarium tricinctum)
Lectotypus (hic designatus, MBT 10000715): France, Paris, on
animal waste, May 1891, G. Delacroix, Bull. Soc. Mycol. France
8, pl. XVII, fig. V.
multiceps Fusarium J.W. Xia et al., Persoonia 43: 212. 2019.
Holotypus: CBS H-24065.
Ex-type culture: CBS 130386 = NRRL 43639 = UTHSC 04-135.
Type locality:USA, Florida.
Type substrate:Trichechus sp.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb1: HM347190; rpb2: GQ505844;
tef1: GQ505666.
mundagurra Fusarium M.H. Laurence et al., Fungal Diversity
77: 359. 2015 [2016].
Holotypus: RBG5717.
Ex-type culture: NRRL 66235 = RBG5717.
Type locality:Australia, Queensland, Carnarvon Gorge National
Park.
Type substrate: Soil.
Descriptions and illustrations: See Laurence et al. (2016).
CROUS ET AL.
134

Diagnostic DNA barcodes:rpb1: KP083272; rpb2: KP083276;
tef1: KP083256.
musae Fusarium Van Hove et al., Mycologia 103: 579. 2011.
Synonym:Gibberella musae Van Hove et al., Mycologia 103:
577. 2011.
Holotypus: MUCL 52574.
Ex-type culture: CBS 624.87 = MUCL 52574 = NRRL 25059.
Type locality:Honduras.
Type substrate:Musa sp.
Descriptions and illustrations: See Van Hove et al. (2011).
Diagnostic DNA barcodes:rpb1: MW402689; rpb2: FN552108;
tef1: FN552086.
musarum Fusarium Logrieco & Marasas, Mycologia 90: 510.
1998.
Holotypus: BPI 802928.
Ex-type culture: FRC R-9400 = MRC 6240 = NRRL 28507.
Type locality:Panama.
Type substrate:Musa sapientum.
Descriptions and illustrations: See Marasas et al. (1998).
Diagnostic DNA barcodes:rpb1: MW233265; rpb2: MW928829;
tef1: MW233094.
mycophilum Fusarium (P. Karst.) Sacc., Syll. Fung. 10: 730. 1892.
Basionym:Leptosporium mycophilum P. Karst., Meddel. Soc.
Fauna Fl. Fenn. 16: 24. 1888.
Holotypus: ?H.
Type locality:Finland, Merimasku.
Type substrate:Myxogastria.
Note:Hymenula fide Wollenweber & Reinking (1935).
mucophytum Fusarium (W.G. Sm.) Massee, Brit. Fung.-Fl. 3:
483. 1893.
Basionym:Fusisporium mucophytum W.G. Sm., Gard. Chron.
n.s., 22: 245. 1884.
(See Fusarium scirpi)
Holotypus: ?K(M).
Type locality:UK.
Type substrate:Agaricus arvensis.
Note: Synonym fide Wollenweber & Reinking (1935).
myosotidis Fusarium Cooke, Grevillea 16: 49. 1887.
(See Fusarium oxysporum)
Holotypus: In K(M).
Type locality:UK, Forden.
Type substrate:Myosotis sp.
Note: Synonym fide Wollenweber & Reinking (1935).
nanum Fusarium M.M. Wang et al., Persoonia 43: 85. 2019.
Holotypus: HAMS 248043.
Ex-type culture: CGMCC 3.19498 = LC12168.
Type locality:China, Guangxi Province, Guilin.
Type substrate: Leaves of Musa nana.
Descriptions and illustrations: See Wang et al. (2019).
Diagnostic DNA barcodes:rpb1: MK289871; rpb2: MK289755;
tef1: MK289602.
napiforme Fusarium Marasas et al., Mycologia 79: 910. 1988
[1987].
Holotypus: DAOM 196924.
Ex-type culture: BBA 69861 = CBS 748.97 = DAOM
196924 = DAOM 225147 = FRC M-3563 = IMI 375353 = MRC
4144 = NRRL 13604.
Type locality:Namibia, Ovambo.
Type substrate:Pennisetum typhoides.
Descriptions and illustrations: See Marasas et al. (1987).
Diagnostic DNA barcodes:rpb1: HM347136; rpb2: EF470117;
tef1: AF160266.
nectriae-palmicolae Fusarium Henn., Bot. Jahrb. Syst. 23: 290.
1896.
(See Fusarium equiseti)
Holotypus:InBfide Hein (1988).
Type locality:Samoa, Upolu.
Type substrate: Leaves of Areca sp.
Note: Synonym fide Wollenweber & Reinking (1935).
nectriae-turraeae Fusarium Henn., Bot. Jahrb. Syst. 22: 82. 1895.
(See Fusarium coccophilum)
Holotypus:InBfide Hein (1988).
Type locality:Tanzania, Marangu.
Type substrate:Turraea volkensii.
Note: Synonym fide Wollenweber & Reinking (1935).
nectricreans Fusarium Kirschst., Ann. Mycol. 37: 138. 1939.
Holotypus: B 70 0100202.
Type locality:Germany, Berlin.
Type substrate: Rotting stem of garden plant.
Note: No living material was available for confirmation of taxo-
nomic status.
nectrioides Fusarium (Wollenw.) Schroers et al., Mycologia 101:
59. 2009.
Bisifusarium nectrioides (Wollenw.) L. Lombard & Crous, Stud.
Mycol. 80: 225. 2015.
Basionym:Fusarium dimerum var. nectrioides Wollenw., Fusaria
Autogr. Delin. 3: 855. 1930.
Lectotypus: No. 855 in Wollenweber, Fusaria Autogr. Delin.
(1930), designated in Schroers et al. (2009).
Ex-type culture: CBS 176.31 = NRRL 20689.
Lectotype and ex-type locality:Honduras.
Lectotype and ex-type substrate: Soil.
Descriptions and illustrations: See Schroers et al. (2009).
Diagnostic DNA barcodes:rpb1: JX171477; rpb2: JX171591;
tef1: EU926312.
neglectum Fusarium Jacz., Bull. Trimestriel Soc. Mycol. France
28: 348. 1912.
(See Fusarium culmorum)
Holotypus: Not located.
Type locality:Ukraine,Poltava.
Type substrate:Zea mays.
Note: Synonym fide Wollenweber & Reinking (1935).
negundinis Fusarium Sherb., in Hubert, J. Agric. Res. 26: 451.
1923.
(See Fusarium reticulatum)
Holotypus: Not located.
Type locality:USA, Wisconsin, Madison.
Type substrate:Acer negundo.
Note: Synonym fide Wollenweber & Reinking (1935).
nelsonii Fusarium Marasas & Logrieco, Mycologia 90: 508.
1998.
Holotypus: BPI 802927.
Ex-type culture: CBS 119876 = FRC R-8670 = MRC
4570 = NRRL 28505 = NRRL 53945.
Type locali ty:South Africa, Western Cape Province, Malmesbury.
FUSARIUM REDELIMITED
www.studiesinmycology.org 135

Type substrate: Plant debris in Triticum soil.
Descriptions and illustrations: See Marasas et al. (1998).
Diagnostic DNA barcodes:rpb1: MN120722; rpb2: GQ505468;
tef1: GQ505404.
nematophilum Fusarium Nirenberg & Hagedorn, Nachrichtenbl.
Deutsch. Pflanzenschutzdienstes 60: 214. 2008.
Luteonectria nematophila (Nirenberg & Hagedorn) Sand.-Den.
& L. Lombard, Stud. Mycol. 98 (no. 100116): 60. 2021.
Holotypus: BBA 72279 in B.
Ex-type culture: BBA 72279 = NRRL 54600.
Type locality:Germany, Berlin.
Type substrate: Isolated from soil with roots of Hedera helix.
Descriptions and illustrations: See Nirenberg & Hagedorn (2008).
Diagnostic DNA barcodes:rpb1: JX171552; rpb2: JX171664;
tef1: JABFFA010003988.
neoceras Fusarium Wollenw. & Reinking, Phytopathology 15:
164. 1925.
(See Fusarium sacchari)
Holotypus: CBS 147.25 (preserved as metabolically inactive
culture).
Ex-type culture: BBA 69863 = CBS 147.25 = DAOM
225410 = IMI 375345= NRRL 20471.
Type locality:Honduras.
Type substrate: Rotting Musa sapientum.
Descriptions and illustrations: See Gerlach & Nirenberg (1982).
Diagnostic DNA barcodes:rpb1: MT010941; rpb2: MT010962;
tef1: MT010988.
neocosmosporiellum Fusarium O'Donnell & Geiser, Phytopa-
thology 103: 405. 2013.
Neocosmospora vasinfecta E.F. Sm., Bull. Div. Veg. Physiol.
Pathol. U.S.D.A. 17: 45. 1899.
Synonyms:Nectriella tracheiphila E.F. Sm., Proc. Amer. Assoc.
Advancem. Sci. 44: 190. 1896, nom. inval.fide Cannon &
Hawksworth 1984.
Neocosmospora vasinfecta var. nivea E.F. Sm., Bull. Div. Veg.
Physiol. Pathol. U.S.D.A. 17: 45. 1899.
Neocosmospora vasinfecta var. tracheiphila E.F. Sm., Bull. Div.
Veg. Physiol. Pathol. U.S.D.A. 17: 45. 1899.
Fusarium tracheiphilum (E.F. Sm.) Wollenw., Phytopathology 3:
29. 1913.
Fusarium vasinfectum var. pisi C.J.J. Hall, Ber. Deutsch. Bot.
Ges. 21: 4. 1903.
Neocosmospora vasinfecta var. pisi (C.J.J. Hall) Sacc., Syll.
Fung. 20: 192. 1911.
Neocosmospora africana Arx, Antonie van Leeuwenhoek 21:
161. 1955.
Neocosmospora vasinfecta var. africana (Arx) P.F. Cannon & D.
Hawksw., Trans. Brit. Mycol. Soc. 82: 676. 1984.
?Pseudonectria ornata Bat. & Maia, Anais Soc. Biol. Pernam-
buco 13: 74. 1955 (fide Cannon & Hawksworth 1984).
Neocosmospora vasinfecta var. major P. Rama Rao, Mycopa-
thol. Mycol. Appl. 21: 218. 1963.
Neocosmospora ornamentata M.A.F. Barbosa, Garcia de Orta
13: 17. 1965.
Fusarium ornamentatum (M.A.F. Barbosa) O'Donnell et al., Index
Fungorum 440: 3. 2020.
Neocosmospora vasinfecta f. conidiifera Kamyschko, Novosti
Sist. Nizsh. Rast. 1965: 115. 1965.
Neocosmospora boninensis Udagawa et al., Sydowia 41: 350.
1989.
Lectotypus: Pl. V, figs 1–2 (Smith, Bull. Div. Veg. Physiol. Pathol.
U.S.D.A. 17, 1899), designated in Sandoval-Denis et al. (2019).
Lectotype locality:USA.
Lectotype substrate:Gossypium sp.
Epitypus: BPI 910920, designated in Aoki et al. (2020).
Ex-epitype culture: ATCC 62199 = NRRL 22166.
Epitype locality:USA, Illinois, southern area.
Epitype substrate: A cyst of Heterodera glycines in a soil sample
from soybean field.
Diagnostic DNA barcodes:rpb1: SSHR01002742; rpb2:
EU329497; tef1: AF178350.
neoscirpi Fusarium L. Lombard et al., Persoonia 43: 213. 2019.
Holotypus: CBS H-24066.
Ex-type culture: CBS 610.95 = NRRL 26861 = NRRL 26922.
Type locality:France.
Type substrate: Soil.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: GQ505779; tef1: GQ505601.
neosemitectum Fusarium L. Lombard et al., Persoonia 43:
214. 2019.
Holotypus: CBS H-24067.
Ex-type culture: CBS 189.60.
Type locality:Democratic Republic of the Congo.
Type substrate:Musa sapientum.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170422; tef1: MN170489.
nepalense Fusarium T. Aoki et al., Fungal Genet. Biol. 48: 1105.
2011.
Holotypus: BPI 881006.
Ex-type culture: CBS 127503 = NRRL 54222.
Type locality:Nepal.
Type substrate:Oryza sativa.
Descriptions and illustrations: See Sarver et al. (2011).
Diagnostic DNA barcodes:rpb1: KM361650; rpb2: KM361668;
tef1: KM889631.
nervisequum Fusarium (Fuckel) Fuckel, Jahrb. Nassauischen
Vereins Naturk. 23–24: 369. 1870.
Basionym:Labrella nervisequa Fuckel, Fungi Rhen. Exs., Fasc.
5, no. 427. 1863.
Apiognomonia platani (L
ev.) L. Lombard, comb. nov.Myco-
Bank MB 837698.
Basionym:Hymenula platani L
ev., Ann. Sci. Nat., Bot., s
er. 3, 9:
128. 1848.
Synonyms:Fusarium platani (L
ev.) Mont., Ann. Sci. Nat., Bot.,
s
er. 3, 11: 55. 1849.
Fusarium nervisequum f. platani (L
ev.) Fuckel, Jahrb. Nassaui-
schen Vereins Naturk. 23–24: 369. 1870.
Gloeosporidium platani (L
ev.) Höhn., Sitzungsber. Kaiserl. Akad.
Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1, 125: 95. 1916.
Myxosporina platani (L
ev.) Höhn., Hedwigia 62: 48. 1920, nom.
inval., Art. 35.1.
Gloeosporium nervisequum (Fuckel)Sacc.,Syll.Fung.3:711.1884.
Discula nervisequa (Fuckel) M. Morelet, Bull. Soc. Sci. Nat.
Arch
eol. Toulon & Var 203: 12. 1973.
Gloeosporium platani Oudem., Ned. Kruidk. Arch., s
er. 2, 1: 258.
1873.
Laestadia veneta Sacc. & Speg., Michelia 1: 351. 1878.
Carlia veneta (Sacc. & Speg.) Kuntze, Revis. Gen. Pl. 2: 846.
1891.
CROUS ET AL.
136

Apiospora veneta (Sacc. & Speg.) Sacc. ex Kleb., Z. Pflan-
zenkrankh. 12: 258. 1902.
Gnomonia veneta (Sacc. & Speg.) Kleb., Jahrb. Wiss. Bot. 41:
533. 1905, nom. illegit., Art. 53.1.
Gnomonia platani Kleb., Verhandl. Deutsch. Bot. Ges. 1: 28. 1914.
Guignardia veneta (Sacc. & Speg.) Traverso, Fl. Ital. Crypt. 1:
392. 1907.
Apiosporopsis veneta (Sacc. & Speg.) Traverso, Syll. Fung. 22:
78. 1913.
Apiognomonia veneta (Sacc. & Speg.) Höhn., Ann. Mycol. 16:
51. 1918.
Laestadia veneta var. cylindrasca Sacc. & Speg., Michelia 1:
369. 1878.
Laestadia cylindrasca (Sacc. & Speg.) Sacc., Syll. Fung. 1: 422.
1882.
Carlia cylindrasca (Sacc. & Speg.) Kuntze, Revis. Gen. Pl. 2:
846. 1891.
Guignardia cylindrasca (Sacc. & Speg.) Lindau (as ‘cylin-
dracea’), in Engler & Prantl, Nat. Pflanzenfam., Teil. I, 1(1): 422.
1897.
Diaporthe veneta Sacc. & Speg., Michelia 1: 383. 1878.
Discella platani Peck, Rep. (Annual) New York State Mus. Nat.
Hist. 29: 49. 1878, nom. illegit., Art. 53.1.
Discula platani Sacc., Syll. Fung. 3: 674. 1884.
Sporonema platani B€
aumler, Oesterr. Bot. Z. 40: 17. 1890.
Placosphaeria platani (B€
aumler) Limber, Mycologia 47: 398.
1955.
Myxosporium platanicola Ellis & Everh. (as ‘platanicolum’), Proc.
Acad. Nat. Sci. Philadelphia 46: 372. 1894.
Cryptosporiopsis platanicola (Ellis & Everh.) G.F. Laundon, CBS
List of Cultures (Baarn): (1). 1975.
Gloeosporidina platani Butin & Kehr, Eur. J. Forest Pathol. 28:
299. 1998.
Lectotypus: BPI (Fuckel, Fungi Rhen. 427) of Labrella nervise-
qua Fuckel, designated in Sogonov et al. (2007).
Lectotype locality:Germany, Reichartshausen.
Lectotype substrate:Plantanus orientalis.
Epitypus: BPI 871953, designated in Sogonov et al. (2007).
Epitype locality:Switzerland, Geneva.
Epitype substrate:Plantanus orientalis.
Notes: Based on priority and synonymies proposed by Sogonov
et al. (2007), the name Hymenula platani L
ev. (1848) takes
precedence over Laestadia veneta Sacc. & Speg. (1878).
Therefore, a new combination is proposed here applying the
older name.
newnesense Fusarium M.H. Laurence et al., Fungal Diversity
77: 360. 2015 [2016].
Holotypus: RBG 610.
Ex-type culture: NRRL 66241 = RBG 610.
Type locality:Australia, New South Wales, Newnes State
Forest.
Type substrate: Soil.
Descriptions and illustrations: See Laurence et al. (2016).
Diagnostic DNA barcodes:rpb1: JABCJW010000176; rpb2:
JABCJW010000963; tef1: KP083261.
ngaiotongaense Fusarium O'Donnell et al., Index Fungorum 440:
3. 2020.
Neocosmospora longissima Sand.-Den. & Crous, Persoonia
43: 141 (2019).
Holotypus: CBS H-23985.
Ex-type culture: CBS 126407 = G.J.S. 85-72.
Type locality:New Zealand, Russell State Forest, Ngaiotonga
Scenic Reserve.
Type substrate: From tree bark.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834230; rpb2: LR583846;
tef1: LR583621.
nicotianae Fusarium Oudem., Ned. Kruidk. Arch., s
er. 3, 2: 777.
1902.
(See Fusarium merismoides)
Holotypus: ?L.
Type locality:Netherlands, Noord-Holland Province, Bussum.
Type substrate:Nicotiana tabacum.
nigrum Fusarium O.A. Pratt, J. Agric. Res. 13: 90. 1918.
(See Fusarium flocciferum)
Lectotypus (hic designatus, MBT 10000716): USA, Idaho, from
soil, 1918, O.A. Pratt, in J. Agric. Res. 13: 82, fig. 1J–L.
Notes: Synonym fide Wollenweber & Reinking (1935). As the
holotype specimen was not located, an illustration accompanying
the original protologue is designated here as lectotype.
nirenbergiae Fusarium L. Lombard & Crous, Persoonia 43: 29.
2018 [2019].
Holotypus: CBS H-23619.
Ex-type culture: CBS 840.88.
Type locality:Netherlands, Noord-Holland Province, Aalsmeer.
Type substrate:Dianthus caryophyllus.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb2: MH484887; tef1: MH484978.
nisikadoi Fusarium T. Aoki & Nirenberg, Mycoscience 38: 330.
1997.
Holotypus: BBA 69015 in B.
Ex-type culture: BBA 69015 = CBS 456.97 = MAFF
237506 = NRRL 25205 = NRRL 25308.
Type locality:Japan, Oita, Hita.
Type substrate:Triticum aestivum.
Descriptions and illustrations: See Nirenberg & Aoki (1997).
Diagnostic DNA barcodes:rpb1: MG282391; rpb2: MG282421;
tef1: KR909358.
nitidum Fusarium Berk. & M.A. Curtis, Grevillea 3: 98. 1875.
Holotypus: ?K(M).
Type locality:USA, Pennsylvania, Michener.
Type substrate:Aralia spinosa.
Note: Doubtful species fide Wollenweber & Reinking (1935).
nivale Fusarium Ces. ex Berl. & Voglino, Syll. Fung., Addit. I–IV:
390. 1886.
Microdochium nivale (Fr.) Samuels & I.C. Hallett, Trans. Brit.
Mycol. Soc. 81: 479. 1983.
Basionym:Lanosa nivalis Fr., Summa Veg. Scand. 2: 495. 1849.
Synonyms:Fusarium nivale (Fr.) Sorauer, Z. Pflanzenkrankh. 11:
220. 1901, nom. illegit., Art. 53.1.
Fusarium hibernans Lindau, Rabenh. Krypt.-Fl., ed. 2, 1(9): 542.
1909, nom. superfl., Art. 52.1.
Gerlachia nivalis (Ces. ex Berl. & Voglino) W. Gams & E. Müll.,
Netherlands J. Pl. Pathol. 86: 49. 1980.
Fusarium minimum Fuckel, Fungi Rhen. Exs., Fasc. 3, no. 213.
1863.
FUSARIUM REDELIMITED
www.studiesinmycology.org 137

Fusarium ustilaginis Rostr., Bot. Foren. Festskr. 54: 137. 1890,
nom. illegit., Art. 53.1.
Fusarium miniatum Prill. & Delacr., Bull. Soc. Mycol. France 7:
117. 1891, nom. illegit., Art. 53.1.
Fusarium tritici Erikss., Fungi Paras. Scand. Exs. no. 400. 1891,
nom. illegit., Art. 53.1.
Fusarium miniatulum Sacc., Syll. Fung. 10: 727. 1892.
Nectria pseudograminicola Weese, Ann. Mycol. 8: 466. 1910,
nom. inval., Art. 38.1.
Fusarium loliaceum Ducomet, Ann. 
Ecole Natl. Agric. Rennes 2:
14. 1909.
Fusarium secalis Jacz., Bull. Trimestriel Soc. Mycol. France 28:
346. 1912, nom. illegit., Art. 53.1.
Sphaerulina divergens Rehm, Ann. Mycol. 11: 397. 1913.
Monographella divergens (Rehm) Petr., Ann. Mycol. 22: 144. 1924.
Calonectria nivalis Schaffnit, Mycol. Centralbl. 2: 257. 1913.
Griphosphaeria nivalis (Schaffnit) E. Müll. & Arx, Phytopathol. Z.
24: 356. 1955.
Micronectriella nivalis (Schaffnit) C. Booth, The Genus Fusarium:
42. 1971.
Monographella nivalis (Schaffnit) E. Müll., Rev. Mycol. (Paris) 41:
132. 1977.
Calonectria graminicola F. Stevens, Bot. Gaz. 65: 232. 1918,
nom. illegit., Art. 53.1.
Melioliphila graminicola Speg., Bol. Acad. Ci. (C
ordoba) 26: 344.
1921.
Calonectria graminicola var. neglecta Krampe, Angew. Bot. 8:
252. 1926.
Monographella nivalis var. neglecta (Krampe) Gerlach,
Netherlands J. Pl. Pathol. 86: 49. 1980.
Fusarium nivale var. oryzae Zambett., Mitt. Inst. Colombo-Ale-
man Invest. Ci. 30: 489. 1950, nom. inval., Art. 39.1.
Syntypes: In HAL & ILL [Rabenhorst, Klotzschii Herb. Viv. Mycol.
no. 1439 (sub F. oxysporum)].
Type locality:Italy.
Type substrate:Poaceae.
niveum Fusarium E.F. Sm., Proc. Amer. Assoc. Advancem. Sci.
43: 289. 1894, nom. inval., Art. 36.1(a).
(See Fusarium oxysporum)
Authentic material: Not located.
Original locality:USA.
Original substrate:Citrullus vulgaris.
niveum Fusarium McAlpine, Australas. J. Pharm. 17: 3. 1902.
Note: Unable to locate protologue.
nodosum Fusarium L. Lombard & Crous, Fungal Syst. Evol. 4:
193. 2019.
Holotypus: CBS H-24018.
Ex-type culture: CBS 201.63.
Type locality:Portugal, Lisbon.
Type substrate: Seed of Arachis hypogaea.
Descriptions and illustrations: See Lombard et al. (2019a).
Diagnostic DNA barcodes:rpb1: MN120725; rpb2: MN120743;
tef1: MN120763.
noneumartii Fusarium (Sand.-Den. & Crous) O'Donnell et al.,
Index Fungorum 440: 3. 2020.
Neocosmospora noneumartii Sand.-Den. & Crous, Persoonia
43: 145. 2019.
Holotypus: CBS H-23989.
Ex-type culture: CBS 115658 = FRC S-0661.
Type locality:Israel, Palestine.
Type substrate:Solanum tuberosum.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218129; rpb2: MW446618;
tef1: LR583630.
nucicola Fusarium P. Karst. & Har., Rev. Mycol. (Toulouse) 12:
131. 1890.
(See Fusarium lateritium)
Holotypus: ?UPS fide Wollenweber, Fusaria Autogr. Delin. 1:
236. 1916.
Type locality:France.
Type substrate: Epicarp of nut.
Note: Synonym fide Wollenweber & Reinking (1935).
nurragi Fusarium (Summerell & L.W. Burgess) Benyon et al.,
Mycol. Res. 104: 1171. 2000.
Basionym:Fusarium avenaceum subsp. nurragi Summerell &
L.W. Burgess, Mycol. Res. 99: 289. 1995.
Holotypus: DAR 69502.
Ex-type culture: CBS 393.96 = DAR 69501 = F10108 = F11121.
Type locality:Australia, Victoria, Wilson's Promontory National
Park.
Type substrate: Soil.
Descriptions and illustrations: See Sangalang et al. (1995).
Diagnostic DNA barcodes:rpb1: MW928814; rpb2: MW928830;
tef1: MW928840.
nygamai Fusarium L.W. Burgess & Trimboli, Mycologia 78: 223.
1986.
Synonym:Gibberella nygamai Klaasen & P.E. Nelson, Mycologia
88: 967. 1997.
Holotypus: FRC-M-1375.
Ex-type culture: ATCC 58555 = BBA 69862 = CBS 749.97 = FRC
M-1375 = IMI 375354 = NRRL 13448.
Type locality:Australia, New South Wales, Narrabri.
Type substrate: Necrotic roots of Sorghum sp.
Descriptions and illustrations: See Burgess & Trimboli (1986).
Diagnostic DNA barcodes:rpb1: LT996202; rpb2: KU604262;
tef1: MT011009.
obliquiseptatum Fusarium, T. Aoki et al., Mycologia 111: 929.
2019.
Neocosmospora obliquiseptata (T. Aoki et al.) L. Lombard &
Sand.-Den., comb. nov.MycoBank MB 837699.
Basionym:Fusarium obliquiseptatum, T. Aoki et al., Mycologia
111: 929. 2019.
Holotypus: BPI 910970.
Ex-type culture: MAFF 246845 = NRRL 62611.
Type locality:Australia, Queensland, Beerwah.
Type substrate: A gallery wall of an ambrosia beetle (Euwallacea
sp.) infecting Persea americana.
Descriptions and illustrations: See Aoki et al. (2019).
Diagnostic DNA barcodes:rpb1: KC691606; rpb2: KC691637,
KC691666; tef1: KC691535.
Note: A new combination is provided in the genus Neo-
cosmospora based on the phylogenetic relationship (Aoki et al.
2019) and morphology.
oblongum Fusarium (Sand.-Den. & Crous) O'Donnell et al., In-
dex Fungorum 440: 3. 2020.
Neocosmospora oblonga Sand.-Den. & Crous, Persoonia 43:
148. 2019.
Holotypus: CBS H-23990.
Ex-type culture: CBS 130325 = CDC B-4701= NRRL 28008.
CROUS ET AL.
138

Type locality:USA.
Type substrate: Eye of Homo sapiens.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834239; rpb2: LR583853;
tef1: LR583631.
obtusatum Fusarium Corda, Icon. Fung. 1: 3. 1837.
(See Fusarium tortuosum)
Typus: In PRM fide Pilat (1938).
Type locality:Czech Republic, Liberec (Reichenberg).
Type substrate: Branches of trees and shrubs.
Note: Not Fusarium fide Wollenweber & Reinking (1935). Lec-
totypification pending study of material lodged in PRM.
obtusisporum Fusarium Cooke & Harkn., Grevillea 12: 97. 1884.
Neonectria obtusispora (Cooke & Harkn.) Rossman et al.,
Phytopathol. Medit. 53: 529. 2014.
Synonyms:Cylindrocarpon obtusisporum (Cooke & Harkn.)
Wollenw., Fusaria Autogr. Delin. 1: 465. 1916.
Ramularia obtusispora (Cooke & Harkn.) Wollenw., Fusaria
Autogr. Delin. 1: 465. 1916.
Fusarium lineare Moesz, Bot. Közlem. 19: 57. 1920.
Holotypus: K(M) 128869.
Type locality:USA, California.
Type substrate: Twigs of Acacia sp.
obtusiusculum Fusarium Sacc., Michelia 2: 297. 1881.
(See Fusarium candidum Ehrenb.)
Holotypus: In PAD.
Type locality:Italy, Padua.
Type substrate:Nelumbium sp.
obtusum Fusarium (Cooke) Sacc., Syll. Fung. 4: 708. 1886.
Basionym:Fusisporium obtusum Cooke, Grevillea 5: 58. 1876.
Mycogloea macrospora (Berk. & Broome) McNabb, Trans. Brit.
Mycol. Soc. 48: 187. 1965.
Basionym:Dacrymyces macrosporus Berk. & Broome, Ann.
Mag. Nat. Hist., ser. 4, 11: 343. 1873.
Holotypus: In K(M) fide Index Fungorum.
Type locality:UK, Scotland, Forres.
Type substrate:Diatrype sp.
ochraceum Fusarium (Mont.) Sacc., Syll. Fung. 4: 722. 1886.
Basionym:Fusisporium ochraceum Mont., Ann. Sci. Nat., Bot.,
s
er. 2, 3: 355. 1835.
Holotypus: In ?PC.
Type locality:Chile, Juan Fern
andez Islands.
Type substrate: Bark.
Note: Not Fusarium fide Wollenweber & Reinking (1935).
odoratissimum Fusarium Maryani et al., Stud. Mycol. 92: 159.
2019.
Synonym:Fusarium purpurascens Maryani et al., Stud. Mycol.
92: 160. 2018 [2019a].
Holotypus: InaCC F822 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F822.
Type locality:Indonesia, East Kalimantan, Kampung Salak
Martadinata.
Type substrate:Musa sp. cv. Pisang Kepok.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb1: LS479618; rpb2: LS479386;
tef1: LS479828.
Notes: Re-analysis of the sequence data set of Maryani et al.
(2019a) revealed that the ex-type strain of F. purpurascens
(InaCC F971) clustered within the F. odoratissimum clade.
Therefore, we consider F. purpurascens a synonym of
F. odoratissimum.
oidioides Fusarium Speg., Rev. Mycol. (Toulouse) 8: 183. 1886.
Holotypus: In LPS (Fungi Japon. No. 2) fide Farr (1973).
Type locality:Japan, Tokyo.
Type substrate:Fallopia multiflora.
Note: Not Fusarium fide Wollenweber & Reinking (1935).
oligoseptatum Fusarium T. Aoki et al., Fung. Syst. Evol. 1: 29.
2018.
Neocosmospora oligoseptata (T. Aoki et al.) Sand.-Den. &
Crous, Persoonia 43: 149. 2019.
Holotypus: BPI 910525.
Ex-type culture: CBS 143241 = FRC S-2581 = MAFF
246283 = NRRL 62579.
Type locality:USA, Pennsylvania, Dauphin.
Type substrate: From a live female ambrosia beetle (Euwallacea
validus), extracted from a gallery in a tree-of-heaven (Ailanthus
altissima).
Descriptions and illustrations: See Aoki et al. (2018).
Diagnostic DNA barcodes:rpb1: KC691596; rpb2: KC691627,
KC691656; tef1: KC691538.
ophioides Fusarium A. Jacobs, et al., Persoonia 46: 149. 2021.
Holotypus: CBS H-24659.
Ex-type culture: CBS 118512 = FCC 2979 = FCC 2980 = MRC
6744.
Type locality:South Africa, Mpumulanga Province, Ngodwana.
Type substrate:Panicum maximum.
Descriptions and illustrations: See Yilmaz et al. (2021).
Diagnostic DNA barcodes:rpb2: MN534303; tef1: EU921239.
opuli Fusarium Oudem., Hedwigia 37: 318. 1898.
Holotypus: ?L.
Type locality:Netherlands, Gelderland Province, Nunspeet.
Type substrate:Viburnum opulus.
Note: Not Fusarium fide Wollenweber & Reinking (1935).
opuntiarum Fusarium Speg., Anales Mus. Nac. Hist. Nat. Buenos
Aires 6: 350. 1898 [1899].
(See Fusarium oxysporum)
Holotypus: In LPS (Fungi Argent. n.v.c. no. 866) fide Farr (1973).
Type locality:Argentina, La Plata.
Type substrate: Branches of Opuntia sp.
Note: Synonym fide Wollenweber & Reinking (1935).
orchidis Fusarium Petch, Ann. Roy. Bot. Gard. (Peradeniya) 6:
256. 1917.
(See Fusarium reticulatum)
Holotypus: PDA 4798.
Type locality:Sri Lanka.
Type substrate: Leaves of Orchidaceae.
Note: Synonym fide Wollenweber & Reinking (1935).
ornamentatum Fusarium (M.A.F. Barbosa) O'Donnell et al., Index
Fungorum 440: 3. 2020.
(See Fusarium neocosmosporiellum)
Holotypus: CBS 562.70 (preserved as metabolically inactive
culture).
Ex-type culture: ATCC 32363 = CBS 562.70 = IMI 251387.
Type locality:Guinea-Bissau.
Type substrate: Stored nuts of Arachis hypogaea.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
FUSARIUM REDELIMITED
www.studiesinmycology.org 139

Diagnostic DNA barcodes:rpb2: LR583901; tef1: DQ247606.
Note: Synonym fide Sandoval-Denis et al. (2019).
orobanches Fusarium Jacz., Ezhegodnik Svedeniy Boleznykh i
Povrezhdeniyakh Kult'turnykh i Dikorastushchikh Poleznykh
Rasteniy. Pertograd. 6: 190. 1910 [1912].
Holotypus: Not located.
Type locality:Russia, Saratov.
Type substrate:Orobanche sp.
Notes: Status unclear. Could be a synonym of F. oxysporum.
orthoceras Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 155. 1910.
(See Fusarium oxysporum)
Syntypes: B 70 0100192 & B 70 0100193.
Type locality:Germany, Berlin, Dahlem.
Type substrate:Solanum tuberosum.
Note: Typification pending further study of the syntypes in B.
orthoconium Fusarium Wollenw., Fusaria Autogr. Delin. 2: 637.
1926.
Mycogloea orthospora (Syd.) McNabb ex Dingley, Mem. New
York Bot. Gard. 49: 206. 1989.
Basionym:Microcera orthospora Syd., Ann. Mycol. 22: 317.
1924, non Fusarium orthosporum Sacc. 1902.
Synonyms:Fusarium microcera var. orthoconium (Wollenw.)
Bilaĭ, Mikrobiol. Zhurn. 49: 7. 1987, nom. inval., Arts. 35.1, 41.4.
Holotypus: Not located.
Type locality:New Zealand, Wellington, York Bay.
Type substrate:Nothofagus sp.
orthosporum Fusarium Sacc. & P. Syd., Syll. Fung. 16: 1100.
1902.
Cylindrodendrum orthosporum (Sacc. & P. Syd.) L. Lombard,
comb. nov.MycoBank MB 837700.
Basionym:Fusarium orthosporum Sacc. & P. Syd., Syll. Fung.
16: 1100. 1902.
Synonyms:Cylindrocarpon orthosporum (Sacc. & P. Syd.)
Wollenw., Fusaria Autogr. Delin. 1: 462. 1916.
Ramularia orthospora (Sacc. & P. Syd.) Wollenw., Fusaria
Autogr. Delin. 1: 462. 1916.
Neonectria hubeiensis W.Y. Zhuang et al., Fungal Diversity 24:
351. 2007.
Ilyonectria hubeiensis (W.Y. Zhuang et al.) Z.Q. Zeng & W.Y.
Zhuang, Phytotaxa 85: 17. 2013.
Cylindrodendrum hubeiense (W.Y. Zhuang et al.) L. Lombard &
Crous, Phytopathol. Medit. 53: 523. 2014.
Holotypus: In PAD.
Type locality:France.
Type substrate:Juglans nigra.
Descriptions and illustrations: See Zhuang et al. (2007) and
Lombard et al. (2014).
Notes: The epithet of Fusarium orthosporum Sacc. & P. Syd
(1902) predates that of Neonectria hubeiensis W.Y. Zhuang et al.
(2007). Therefore, a new combination is proposed here with the
older epithet.
oryzae Fusarium Vincens, Rev. Pathol. Veg. Entomol. Agric.
France 10: 126. 1923.
Holotypus: ?PC.
Type locality:Vietnam.
Type substrate:Oryza sativa.
Notes: Status unclear. Could be a synonym of F. fujikuroi.
osiliense Fusarium Bres. & Vestergr., Bot. Not. 1900: 33. 1900.
Septogloeum oxysporum Sacc. et al., Bull. Soc. Roy. Bot.
Belgique 29: 294. 1890.
Syntypes: In BPI, NEB, S & UPS.
Type locality:Estonia, Osilia.
Type substrate:Briza media.
Notes: Synonym fide Wollenweber & Reinking (1935). Typifica-
tion pending further study of the syntypes.
ossicola Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4:
714. 1886.
Basionym:Fusisporium ossicola Berk. & M.A. Curtis, Grevillea 3:
147. 1875.
(See Fusarium equiseti)
Holotypus: ?K(M).
Type locality:USA.
Type substrate: Old decaying bones.
Note: Synonyms fide Wollenweber & Reinking (1935).
osteophilum Fusarium Speg., Anales Soc. Ci. Argent. 10: 60.
1880.
(See Fusarium scirpi)
Holotypus: In LPS (Fungi Argent. pug. 2, no. 155) fide Farr
(1973).
Type locality:Argentina, Rio de la Plata, La Recoleta.
Type substrate: Decayed bones of Gallus sp. (chicken).
Note: Synonym fide Wollenweber & Reinking (1935).
otomycosis Fusarium Y.N. Ming & T.F. Yu, Acta Microbiol. Sin.
12: 178. 1966.
Holotypus: Not located.
Type locality:China, Beijing.
Type substrate: Ear of Homo sapiens.
Notes: Status unclear. Requires further investigation.
oxydendri Fusarium Ellis & Everh., Bull. Torrey Bot. Club 24: 477.
1897.
(See Fusarium cavispermum)
Syntypes: In BPI, BRU, CLEM, CUP, F, FLAS, ILL, ILLS, ISC,
MICH, MSC, MU, NEB, OSC, PH, PUL, UC & WIS.
Type locality:USA, West Virginia.
Type substrate:Oxydendrum arboreum.
Notes: Synonym fide Wollenweber & Reinking (1935). Typifica-
tion pending further study of the syntypes.
oxysporum Fusarium Schltdl., Fl. Berol. 2: 139. 1824.
Synonyms:Fusisporium aurantiacum Link, Mag. Ges. Naturf.
Freunde Berlin 3: 19. 1809.
Fusarium aurantiacum (Link) Sacc., Syll. Fung. 4: 720. 1886,
nom. illegit., Art. 53.1.
Fusarium aurantiacum Corda, in Sturm, Deutschl. Fl., 3 Abt.
(Pilze Deutschl.) 2: 19. 1829.
Fusarium oxysporum var. aurantiacum (Corda) Rabenh.,
Deutschl. Krypt.-Fl., 1: 51. 1844.
Atractium aurantiacum (Corda) Bonord., Abh. Naturf. Ges. Halle
8: 135. 1851.
Fusisporium lagenariae Schwein., Trans. Amer. Philos. Soc., n.s.
4: 275. 1834.
Fusarium lagenariae (Schwein.) Sacc., Syll. Fung. 4: 724. 1886.
Hymenula equiseti Lib., Pl. Crypt. Arduenna Fasc. 3: no. 236.
1834.
Fusarium equisetorum (Lib.) Desm., Pl. Crypt. N. France no.
1546/1846? 1843.
Fusarium parasiticum Thüm., Nuovo Giorn. Bot. Ital. 12: 198.
1880, nom. illegit., Art. 53.1.
CROUS ET AL.
140

Fusarium thuemenii Sacc., Syll. Fung. 4: 722. 1886.
Fusisporium calcareum Thüm., Inst. Coimbra 28: 262. 1881.
Fusarium calcareum (Thüm.) Sacc., Syll. Fung. 4: 712. 1886.
Fusarium eucalyptorum Cooke & Harkn., Grevillea 9: 128.
1881.
Fusarium oxysporum f.eucalypti (Cooke & Harkn.) Arya & G.L.
Jain, Phytopathology 52: 641. 1962.
Fusarium oxysporum f.lycopersici Sacc., Syll. Fung. 4: 705. 1886.
Fusarium lycopersici (Sacc.) Mussat, Syll. Fung. 15: 144. 1901,
nom. inval., Art. 36.1(a), (c).
Fusarium lycopersici (Sacc.) Wollenw., Phytopathology 3: 29.
1913, nom. illegit., Art. 53.1.
Fusarium bulbigenum Cooke & Massee, Grevillea 16: 49. 1887.
Fusarium myosotidis Cooke, Grevillea 16: 49. 1887.
Leptosporium mycophilum P. Karst., Meddel. Soc. Fauna Fl.
Fenn. 16: 24. 1888.
Fusarium mycophilum (P. Karst.) Sacc., Syll. Fung. 10: 730. 1892.
?Selenosporium cuticola R. Blanch., Compt. Rend. Hebd.
S
eances Acad. Sci., Ser. D. 111: 479. 1890.
?Fusarium cuticola (R. Blanch.) Gu
eg., Champ. Paras. Homme:
262. 1904.
Fusarium sclerodermatis Peck, Rep. (Annual) Regents Univ.
State New York New York State Mus. 43: 77. 1890, nom. illegit.,
Art. 53.1.
Fusarium peckii Sacc., Syll. Fung. 10: 727. 1892, nom. illegit.,
Art. 53.1 [pro. p. fide Wollenweber & Reinking (1935)].
Fusarium saccardoanum P. Syd., Syll. Fung. 14: 1128. 1899.
Fusarium vasinfectum G.F. Atk., Bull. Alabama Agric. Exp. Sta.
41: 28. 1892.
Fusarium cordae Massee, Brit. Fung.-Fl. 3: 481. 1893.
Fusarium niveum E.F. Sm., Proc. Amer. Assoc. Advancem. Sci.
43: 289. 1894, nom. inval., Art. 36.1(a).
Fusarium bulbigenum var. niveum E.F. Sm. ex Wollenw.,
Fusarien: 117. 1931.
Fusarium blasticola Rostr. (as ‘blasticolum’), Gartn.-Tidende
1895: 122. 1895.
Fusoma blasticola (Rostr.) Sacc. & Traverso, Syll. Fung. 20:
1241. 1911.
Fusarium bulbigenum var. blasticola (Rostr.) Wollenw., Z. Par-
asitenk. (Berlin) 3: 412. 1931.
Fusarium beticola A.B. Frank, Kampfbuch gegen die Sch€
adlinge
unserer Feldfrüchte: 137. 1897.
Fusarium dianthi Prill. & Delacr., Compt. Rend. Hebd. S
eances
Acad. Sci. 129: 745. 1899.
Fusarium oxysporum f.dianthi (Prill. & Delacr.) W.C. Snyder &
H.N. Hansen, Amer. J. Bot. 27: 66. 1940.
Fusarium oxysporum var. dianthi (Prill. & Delacr.) Raillo, Fungi of
the Genus Fusarium: 255. 1950.
Fusarium opuntiarum Speg., Anales Mus. Nac. Hist. Nat. Buenos
Aires 6: 350. 1898 [1899].
Fusoma pini Hartig, Lehrb. Pflanzenkrankh., Bot., Forstl., Landw.
G€
art.: 116. 1900.
Fusarium laxum Peck, Bull. New York State Mus. Nat. Hist. 67:
30. 1903.
Fusarium lini Bolley, Proc. Annual Meeting Soc. Promot. Agric.
Sci. 22: 42. 1902.
Fusarium oxysporum f.lini (Bolley) W.C. Snyder & H.N. Hansen,
Amer. J. Bot. 27: 66. 1940.
Fusarium tabacivorum Delacr., Ann. Inst. Natl. Rech. Agron., ser.
2, 5: 207. 1906.
Fusarium candidulum Sacc., Ann. Mycol. 6: 567. 1908.
Fusarium cubense E.F. Sm., Science, N.Y. 31: 754. 1910.
Fusarium oxysporum var. cubense (E.F. Sm.) Wollenw., Fusar-
ien: 119. 1935.
Fusarium oxysporum f.cubense (E.F. Sm.) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 27: 66. 1940.
Fusarium orthoceras Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 155. 1910.
Fusarium oxysporum var. orthoceras (Appel & Wollenw.) Bilaĭ,
Microbiol. Zhurn. 49: 7. 1987.
?Fusarium violae F.A. Wolf, Mycologia 2: 21. 1910.
Fusarium albidoviolaceum Dasz. (as ‘albido-violaceum’), Bull.
Soc. Bot. Gen
eve, s
er. 2, 4: 293. 1912.
Fusarium orthoceras var. albidoviolaceum (Dasz.) Wollenw.,
Fusaria Autogr. Delin. 1: 361. 1916.
Fusarium lycopersici Bruschi, Atti Reale Accad. Lincei, Rendi-
conti Cl. Sci. Fis., ser. 5, 21: 298. 1912.
Fusarium bulbigenum var. lycopersici (Bruschi) Wollenw. &
Reinking, Fusarien: 114. 1935.
Fusarium citrinum Wollenw., in Lewis, Bull. Maine Agric. Exp.
Sta. 219: 256. 1913.
Fusarium conglutinans var. citrinum (Wollenw.) Wollenw., Z.
Parasitenk. (Berlin) 3: 407. 1931.
Fusarium conglutinans Wollenw., Ber. Deutsch. Bot. Ges. 31: 34.
1913.
Fusarium orthoceras var. conglutinans (Wollenw.) Padwick, In-
dian J. Agric. Sci. 10: 282. 1940.
Fusarium oxysporum f. conglutinans (Wollenw.) W.C. Snyder &
H.N. Hansen, Amer. J. Bot. 27: 66. 1940.
Fusarium elegans Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst.
Land- Forstw. 8: 94. 1913, nom.inval., Art. 36.1(a) (non Fusa-
rium elegans W. Yamam. & Maeda 1962).
Fusarium batatas Wollenw. (as ‘batatae’), J. Agric. Res. 2: 268.
1914.
Fusarium bulbigenum var. batatas (Wollenw.) Wollenw., Z. Par-
asitenk. (Berlin) 3: 414. 1931.
Fusarium oxysporum f.batatas (Wollenw.) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 27: 66. 1940.
Fusarium cepae Hanzawa, Mycol. Centralbl. 5(1): 5. 1914.
Fusarium oxysporum f.cepae (Hanzawa) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 27: 66. 1940.
Fusarium oxysporum var. cepae (Hanzawa) Raillo, Fungi of the
Genus Fusarium: 253. 1950.
Fusarium hyperoxysporum Wollenw., J. Agric. Res. 2: 268. 1914.
Fusarium angustum Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 203. 1915.
Fusarium lutulatum Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 209. 1915.
Fusarium vasinfectum var. lutulatum (Sherb.) Wollenw., Fusaria
Autogr. Delin. 3: 1019. 1930.
Fusarium lutulatum var. zonatum Sherb., Mem. Cornell Univ.
Agric. Exp. Sta. 6: 214. 1915.
Fusarium zonatum (Sherb.) Wollenw., Fusaria Autogr. Delin. 1:
392. 1916.
Fusarium vasinfectum var. zonatum (Sherb.) Wollenw., Fusaria
Autogr. Delin. 3: 1020. 1930.
Fusarium oxysporum var. asclerotium Sherb., Mem. Cornell
Univ. Agric. Exp. Sta. 6: 222. 1915.
Fusarium asclerotium (Sherb.) Wollenw., Fusaria Autogr. Delin.
1: 364. 1916.
Fusarium sclerotioides Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 214. 1915.
Fusarium sclerotioides var. brevius Sherb., Mem. Cornell Univ.
Agric. Exp. Sta. 6: 218. 1915.
FUSARIUM REDELIMITED
www.studiesinmycology.org 141

Fusarium trifolii Jacz., Jahrb. Pflanzenkrankh. Russl. VII-VIII:
Abt. 6. 1917.
Fusarium citrulli Taubenh., Bull. Texas Agric. Exp. Sta. 260: 27.
1920.
Fusarium malvacearum Taubenh., Bull. Texas Agric. Exp. Sta.
260: 27. 1920.
Fusarium poolense Taubenh., Bull. Texas Agric. Exp. Sta. 260:
27. 1920.
Fusarium macroxysporum Lindf., Meddel. Centralanst. För-
söksv€
as. Jordbruksomr. Avd. Lantbruksbot. 25: 8. 1922.
Fusarium spinaciae Hungerf., Phytopathology 13: 209. 1923.
Fusarium cromyophthoron Sideris, Phytopathology 14: 212.
1924.
Fusarium loncheceras Sideris, Phytopathology 14: 213. 1924.
Fusarium loncheceras var. microsporon Sideris, Phytopathology
14: 213. 1924.
Fusarium rhizochromatistes Sideris, Phytopathology 14: 212.
1924.
Fusarium sclerostromaton Sideris, Phytopathology 14: 213.
1924.
Fusarium zonatum f. 1 Link & Bailey, J. Agric. Res. 33: 941.
1926.
Fusarium zonatum f. 2 Link & Bailey, J. Agric. Res. 33: 941.
1926.
Fusarium conglutinans var. betae D. Stewart, Phytopathology 21:
67. 1931.
Fusarium oxysporum f.betae (D. Stewart) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 27: 66. 1940.
Fusarium oxysporum f. 7 Wollenw., Fusaria Autogr. Delin. 4:
1176. 1935
Fusarium apii P.E. Nelson & Sherb., Techn. Bull. Michigan Agric.
Exp. Sta 155: 42. 1937.
Fusarium orthoceras var. apii (R. Nelson & Sherb.) Wollenw. &
Reinking, Fusarien: 112. 1935.
Fusarium oxysporum f. apii (R. Nelson & Sherb.) W.C. Snyder &
H.N. Hansen, Amer. J. Bot. 27: 66. 1940.
Fusarium apii var. pallidum R. Nelson & Sherb., Techn. Bull.
Michigan Agric. Exp. Sta. 155: 42. 1937.
Fusarium bulbigenum var. apii (R. Nelson & Sherb.) Raillo, Fungi
of the Genus Fusarium: 251. 1950.
Cylindrophora albedinis Kill. & Maire, Bull. Soc. Hist. Nat. Afrique
N. 21: 97. 1930, nom. inval., Art. 36.1(b).
Fusarium oxysporum var. albedinis Kill. & Maire ex
Malençon, Rev. Mycol. (Paris) 15: 45–60. 1950, nom. inval., Art.
36.1(b).
Fusarium oxysporum f. sp. albedinis Kill. & Maire ex W.L. Gor-
don, Canad. J. Bot. 43: 1310. 1965.
Fusarium perniciosum Hepting, Circ. U.S.D.A. 535: 7. 1939.
Fusarium oxysporum f. perniciosum (Hepting) Toole, Phytopa-
thology 31: 599. 1941.
Fusarium vasinfectum var. perniciosum (Hepting) Carrera, Rev.
Fac. Agron. Buenos Aires 13(3): 483 1955
?Fusarium retusum Wellman, Phytopathology 33: 957. 1943.
Holotypus: HAL 1612 F.
Epitypus: CBS H-23620, designated in Lombard et al. (2019b).
Ex-epitype culture:CBS 144134.
Type locality:Germany, Berlin.
Type substrate:Solanum tuberosum.
Descriptions and illustrations: See Lombard et al. (2019b)
Diagnostic DNA barcodes:rpb2: MH484953; tef1: MH485044.
palczewskii Fusarium Jacz., Bull. Soc. Mycol. France 28: 345.
1912.
(See Fusarium avenaceum)
Lectotypus (hic designatus, MBT 10000717): Russia, Ussur-
iysk, Primorsky krai (Far East Territory), grain of Lolium sp.,
1912, A.A. Jaczewski, in Bull. Soc. Mycol. France 28: 345,
fig. 1.
Notes: Synonyms fide Wollenweber & Reinking (1935).Asno
holotype specimen could be located; an illustration accompa-
nying the original protologue is designated here as lectotype.
pallens Fusarium Berk. & M.A. Curtis, Grevillea 3: 99. 1875,
nom. illegit., Art. 53.1.
Replacing synonym:Fusarium glumarum Sacc., Syll. Fung. 4:
706. 1886.
(See Fusarium incarnatum)
Authentic material: Car. Inf. no. 3799, in K(M).
Original locality:USA.
Original substrate:Juncus sp.
Note: Synonyms fide Wollenweber & Reinking (1935).
pallens Fusarium (Nees & T. Nees) Link, Sp. pl. 6(2): 104. 1825.
Basionym:Atractium pallens Nees & T. Nees, Nova Acta Phys.-
Med. Acad. Caes. Leop.-Carol. Nat. Cur. 9: 237. 1818.
Synonyms:Volutella pallens (Nees & T. Nees) Fr., Syst. Mycol. 3:
468. 1832.
Selenosporium pallens (Nees & T. Nees) Corda, Icon. Fung. 1: 7.
1837.
Holotypus:InB.
Type locality:Germany.
Type substrate: Fallen branch.
Notes: The type material of Atractium pallens is deposited at B
and examined by Gr€
afenhan et al. (2011), identifying it as a
coelomycete.
pallidoroseum Fusarium (Cooke) Sacc., Syll. Fung. 4: 720. 1886.
Basionym:Fusisporium pallidoroseum Cooke, Grevillea 6: 139.
1878.
(See Fusarium incarnatum)
Holotypus: S. Car. no. 2279 in ?K(M).
Type locality:USA, South Carolina, Aiken.
Type substrate:Chenopodium anthelminticum.
Note: Synonyms fide Wollenweber & Reinking (1935).
pallidulum Fusarium Sacc. & Trotter, Syll. Fung. 22: 1483. 1913.
Replaced synonym:Atractium pallidum Bonord., Handb. Mykol.:
135. 1851.
Synonym:Fusarium pallidum (Bonord.) Sacc. & Traverso, Syll.
Fung. 19: 727. 1910, nom. illegit., Art. 53.1.
Lectotypus (hic designatus, MBT 10000718): Germany, decay-
ing bark, 1913, H.F. Bonorden, in Handb. Mykol., tab. 10, fig.
219.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935). As no holotype specimen could be located,
an illustration accompanying the original protologue is desig-
nated here as lectotype.
pallidum Fusarium Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10:
359. 1869.
Holotypus: In K(M).
Type locality:Cuba.
Type substrate: Dead twigs.
CROUS ET AL.
142

Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
palustre Fusarium W.H. Elmer & Marra, sp. nov.MycoBank
MB 837702.
Synonym:Fusarium palustre W.H. Elmer & Marra, Mycologia
103(4): 815. 2011, nom. inval., Art. 40.7.
Etymology.‘palustre’, from Latin palus, referring to marsh habitat
in which this fungus is found.
For diagnosis see Elmer & Marra, Mycologia 103(4): 815.
2011.
Holotypus: CBS 126795 (preserved as metabolically inactive
culture).
Ex-type culture: CBS 126796 = NRRL 54056.
Type locality:USA, Connecticut, Madison, Hammonasset Beach
State Park.
Type substrate:Spartina alterniflora.
Descriptions and illustrations: See Elmer & Marra (2011).
Diagnostic DNA barcodes:rpb1: KT597718; rpb2: KT597731;
tef1: GQ856941.
Notes:Elmer & Marra (2011) failed to indicate the holotype for
F. palustre, rendering the species name invalid (Art. 40.7). Here
we validate the name.
pampini Fusarium Thüm. & Pass., Pilze Weinst.: 50. 1878.
Gloeosporium physalosporae Cavara, Rev. Mycol. (Toulouse)
10: 99. 1888.
Holotypus: Not located.
Type locality:Italy, Parma.
Type substrate:Vitis vinifera.
Note: Synonym fide Wollenweber & Reinking (1935).
pandani Fusarium (Corda) Sacc., Syll. Fung. 4: 724. 1886.
Basionym:Fusisporium pandani Corda, Icon. Fung. 1: 11. 1837.
Lectotypus (hic designatus, MBT 10000719): Czech Republic,
Liberec (Reichenberg), Pandanus sp., 1837, A.C.J. Corda, in
Icon. Fung. 1, tab. 2, fig. 162.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935). As no holotype specimen could be located,
an illustration accompanying the original protologue is desig-
nated here as lectotype.
pannosum Fusarium Massee, Bull. Misc. Inform. Kew 1898: 117.
1898.
(See Fusarium sambucinum)
Holotypus: K(M) 191093.
Type locality:India, Punjab.
Type substrate:Cornus macrophylla.
Note: Synonym fide Wollenweber & Reinking (1935).
paraeumartii Fusarium (Sand.-Den. & Crous) O'Donnell et al.,
Index Fungorum 440: 3. 2020.
Neocosmospora paraeumartii Sand.-Den. & Crous, Persoonia
43: 149. 2019.
Holotypus: CBS H-23991.
Ex-type culture: BBA 62215 = CBS 487.76 = NRRL 13997.
Type locality:Argentina.
Type substrate: Decaying stem base of Solanum tuberosum.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834240; rpb2: LR583855;
tef1: DQ247549.
paranaense Fusarium S.S. Costa et al., Fungal Biology 120: 55.
2015 [2016].
(See Fusarium falciforme)
Holotypus: CML 1830.
Ex-type culture: CBS 141593 = CML 1830.
Type locality:Brazil, Goi
as State, Cristalina.
Type substrate: Diseased tissue of Glycine max.
Descriptions and illustrations: See Costa et al. (2016).
Diagnostic DNA barcodes:rpb2: KF680011; tef1: KF597797.
Note: Synonym fide Sandoval-Denis et al. (2019).
parasiticum Fusarium Westend., Bull. Acad. Roy. Sci. Belgique,
Cl. Sci., s
er. 2, 11: 652. 1861.
(See Fusarium ciliatum)
Holotypus: BR5020140791441.
Type locality:Belgium, Louette-Saint-Pierre.
Type substrate:Sphaeria gigaspora.
Note: Synonym fide Wollenweber & Reinking (1935).
parasiticum Fusarium Thüm., Nuovo Giorn. Bot. Ital. 12: 198.
1880, nom. illegit., Art. 53.1.
Replacing synonym:Fusarium thuemenii Sacc., Syll. Fung. 4:
722. 1886.
(See Fusarium oxysporum)
Authentic material: Not located.
Original locality:Russia, Orenburg.
Original substrate:Betula pendula.
Note: Synonyms fide Wollenweber & Reinking (1935).
parasiticum Fusarium Ellis & Kellerm., J. Mycol. 3: 127. 1887,
nom. illegit., Art. 53.1.
Replacing synonym:Fusarium pucciniophilum Sacc. & P. Syd.,
Syll. Fung. 14: 1128. 1899.
(See Fusarium heterosporum)
Authentic material: Kellerman & Swingle 1104 in NY.
Original locality:USA, Manhattan.
Original substrate: Parasitic on Puccinia seymeriae on Swietenia
macrophylla.
Note: Synonyms fide Wollenweber & Reinking (1935).
parasiticum Fusarium Fautrey, Rev. Mycol. (Toulouse) 11: 153.
1889, nom. illegit., Art. 53.1.
Replacing synonym:Fusarium fautreyi Sacc., Syll. Fung. 10:
934. 1892.
(See Fusarium lateritium)
Authentic material: BR5020140789424.
Original locality:France, Noidan.
Original substrate:Vitis vinifera.
Note: Synonyms fide Wollenweber & Reinking (1935).
parceramosum Fusarium (Sand.-Den. & Crous) O'Donnell et al.,
Index Fungorum 440: 3. 2020.
Neocosmospora parceramosa Sand.-Den. & Crous, Persoonia
43: 151. 2019.
Holotypus: CBS H-23992.
Ex-type culture: CBS 115695 = CPC 1246.
Type locality:South Africa.
Type substrate: Soil.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb2: JX435249; tef1: JX435149.
parvisorum Fusarium Herron et al., Stud. Mycol. 80: 146. 2015.
Holotypus: PREM 60897.
Ex-type culture: CBS 137236 = CMW 25267.
Type locality:Colombia, Vivero, Pe~
nas Negra, Valle del Cauca.
Type substrate:Pinus patula.
Descriptions and illustrations: See Herron et al. (2015).
FUSARIUM REDELIMITED
www.studiesinmycology.org 143

Notes: Comparisons of recently generated sequences for the
living ex-type (CBS 137236 = CMW 25267) of F. pa r v i s o r um
indicate a strain transposition or contamination by another Fusa-
rium species. Therefore, this species needs to be recollected from
the type locality and substrate or sequences need to be generated
from the holotype specimen to confirm that it is indeed distinct.
paspali Fusarium Henn., Bot. Jahrb. Syst. 38: 129. 1905.
(See Fusarium avenaceum)
Syntype: In B as Zenker, Georg August, no. 2152 fide Hein
(1988).
Type locality:Cameroon, Bipindi.
Type locality:Paspalum sp.
Notes: Synonym fide Wollenweber & Reinking (1935). Typifica-
tion pending further study of the syntype in B.
paspalicola Fusarium Henn., in Warburg, Monsunia 1: 38. 1899
[1900].
(See Fusarium heterosporum)
Holotypus:InBfide Wollenweber, Fusaria Autogr. Delin. 1: 299.
(1916) & Hein (1988).
Type locality:Philippines, Mindanao, Davao.
Type substrate:Paspalum sp.
Note: Synonym fide Wollenweber & Reinking (1935).
patouillardii Fusarium Sacc. (as ‘patouillardi’), Syll. Fung. 10:
729. 1892.
Replaced synonym:Fusarium uredinicola Pat. & Gaillard, Bull.
Soc. Mycol. France 4: 127. 1888, nom. illegit., Art. 53.1.
Holotypus: ?PC or FH.
Type locality:Venezuela, Caracas.
Type substrate: Parasitic on Sphaerellopsis filum on Puccinia
pallidissima.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
peckii Fusarium Sacc., Syll. Fung. 4: 713. 1886.
Replaced synonym:Fusisporium parasiticum Peck, Rep.
(Annual) New York State Mus. Nat. Hist. 29: 53. 1878, non
Fusarium parasiticum Westend. 1861.
Holotypus: NYSf2260.
Type locality:USA, New York, Albany.
Type substrate:Sphaeria collinsii.
Notes: Status unclear. Not treated by Wollenweber & Reinking
(1935) or Booth (1971).
peckii Fusarium Sacc., Syll. Fung. 10: 727. 1892, nom. illegit.,
Art. 53.1.
Replaced synonyms:Fusarium sclerodermatis Peck, Rep.
(Annual) Regents Univ. State New York New York State Mus. 43:
77. 1890, nom. illegit., Art. 53.1, non Fusarium sclerodermatis
Oudem. 1889.
Fusarium saccardoanum Syd., Syll. Fung. 13: 1130. 1898.
(See Fusarium oxysporum pr. p. & Fusarium avenaceum pr.
p.)
Authentic material: NYSf2731.
Original locality:USA, New York, Suffolk.
Original substrate:Scleroderma vulgaris.
Note: Synonyms fide Wollenweber & Reinking (1935).
pelargonii Fusarium P. Crouan & H. Crouan, Fl. Finist
ere: 14.
1867.
(See Fusarium merismoides)
Holotypus: ?PC.
Type locality:France, Finist
ere.
Type substrate:Pelargonium sp.
Note: Synonym fide Wollenweber & Reinking (1935).
peltigerae Fusarium Westend., Herb. Crypt. Belg. Fasc. 9: no.
414. 1849.
(See Fusarium ciliatum)
Syntypes: In BR & PH (Herb. Crypt. Belg. 9: no. 414).
Type locality:Belgium.
Type substrate:Peltigera rufescens.
Notes: Synonym fide Wollenweber & Reinking (1935). Typifica-
tion pending further study of the syntypes.
penicillatum Fusarium (Harz) Sacc., Syll. Fung. 4: 710. 1886.
Basionym:Menispora penicillata Harz, Bull. Soc. Imp. Natural-
istes Moscou 44: 127. 1871.
(See Fusarium avenaceum)
Lectotypus (hic designatus, MBT 10000720): Germany, Berlin,
decaying Sclerotium clavus, 1886, C. Harz, in Bull. Soc. Imp.
Naturalistes Moscou 44, tab. 1, fig. 4.
Notes: Synonym fide Wollenweber & Reinking (1935).As
no holotype specimen could be located, an illustration accom-
panying the original protologue is designated here as lectotype.
pentaclethrae Fusarium Henn., Hedwigia 44: 71. 1905.
(See Fusarium coccidicola)
Syntype: In B (Ule no. 3011) fide Hein (1988).
Type locality:Brazil, Manaus, Rio Nigro.
Type substrate: Leaves of Pentaclethra sp.
Notes: Synonym fide Wollenweber & Reinking (1935). Typifica-
tion pending further study of the syntype in B.
penzigii Fusarium Schroers et al., Mycologia 101: 61. 2009.
Bisifusarium penzigii (Schroers et al.) L. Lombard & Crous,
Stud. Mycol. 80: 225. 2015.
Holotypus: CBS H-20125.
Ex-type culture: CBS 317.34 = NRRL 22109.
Type locality:UK, Surrey.
Type substrate: Decayed wood of Fagus sylvatica.
Descriptions and illustrations: See Schroers et al. (2009).
Diagnostic DNA barcodes:rpb1: KM232211; rpb2: KM232362;
tef1: EU926324.
pernambucanum Fusarium A.C.S. Santos et al., Mycologia
111: 253. 2019.
Holotypus: URM 91193.
Ex-type culture: MUM 1862 = URM 7559.
Type locality:Brazil, Pernambuco, Paudalho.
Type substrate:Aleurocanthus woglumi.
Descriptions and illustrations: See Santos et al. (2019).
Diagnostic DNA barcodes:rpb1: MH668869; rpb2: LS398519;
tef1: LS398489.
perniciosum Fusarium Hepting, Circul. U.S.D.A. 535: 7. 1939.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:USA.
Type substrate:Albizia julibrissin.
persicae Fusarium (Sacc.) G.F. Atk., J. Elisha Mitchell Sci. Soc.
8: 41. 1892.
Basionym:Cercospora persicae Sacc. (as ‘persica’), Hedwigia
15: 119. 1876.
Mycosphaerella pruni-persicae Deighton, Trans. Brit. Mycol.
Soc. 50: 328. 1967.
CROUS ET AL.
144

Synonyms:Cercosporella persicae (Sacc.) Sacc. (as ‘persica’),
Michelia 2: 20. 1880.
Clasterosporium persicae (Sacc.) Tsuji, Ann. Phytopathol. Soc.
Japan 1(2): 33. 1919.
Miuraea persicae (Sacc.) Hara, Byogaichu-Hoten (Manual of
Pests and Diseases): 224. 1948.
Mycosphaerella persicae B.B. Higgins & F.A. Wolf (as ‘persica’),
Phytopathology 27: 695. 1937.
Syntype: In HAL, ILL & NEB (Saccardo, Mycoth. Ven. no. 598).
Type locality:Italy.
Type substrate:Prunus persica.
persicinum Fusarium J.W. Xia et al., Persoonia 43: 215 2019.
Holotypus: CBS H-24068.
Ex-type culture: CBS 479.83.
Type locality:Unknown.
Type substrate: Unknown.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170428; tef1: MN170495.
personatum Fusarium Cooke, in Harkness, Grevillea 7: 12. 1878.
(See Fusarium allescherianum)
Holotypus: ?K(M).
Type locality:USA, California.
Type substrate:Oreodaphne californica.
Note: Synonym fide Wollenweber & Reinking (1935).
perseae Fusarium (Sand.-Den. & Guarnaccia) O'Donnell et al.,
Index Fungorum 440: 3. 2020.
Neocosmospora perseae Sand.-Den. & Guarnaccia, Fungal
Syst. Evol. 1: 136. 2018.
Holotypus: CBS H-23433.
Ex-type culture: CBS 144142 = CPC 26829.
Type locality:Italy, Catania, San Leonardello.
Type substrate: Trunk canker lesions on Persea americana.
Descriptions and illustrations: See Guarnaccia et al. (2018).
Diagnostic DNA barcodes:rpb1: MW218130; rpb2: LT991909;
tef1: LT991902.
peruvianum Fusarium L. Lombard & Crous, Fungal Syst. Evol.
4: 194. 2019.
Holotypus: CBS H-24019.
Ex-type culture: CBS 511.75.
Type locality:Peru.
Type substrate: Seedlings of Gossypium sp.
Descriptions and illustrations: See Lombard et al. (2019a).
Diagnostic DNA barcodes:rpb1: MN120728; rpb2: MN120746;
tef1: MN120767.
pestis Fusarium Sorauer, Atlas Pfl.-Krankh. 4: 19, pl. XXV. 1890.
(See Fusarium azukiicola)
Holotypus: Not located.
Type locality:Germany.
Type substrate:Solanum tuberosum.
Note: Synonym fide Wollenweber & Reinking (1935).
petersiae Fusarium L. Lombard, Persoonia 39: 457. 2017.
Holotypus: CBS H-23233.
Ex-type culture: CBS 143231.
Type locality:Netherlands, Gelderland Province, Arnhem.
Type substrate: Soil.
Descriptions and illustrations: See Crous et al. (2017).
Diagnostic DNA barcodes:rpb1: MG386139; rpb2: MG386150;
tef1: MG386160.
petroliphilum Fusarium (Q.T. Chen & X.H. Fu) Geiser et al.,
Fungal Genet. Biol. 53: 69. 2013.
Neocosmospora petroliphila (Q.T. Chen & X.H. Fu) Sand.-
Den. & Crous, Persoonia 41: 121. 2018.
Basionym:Fusarium solani var. petroliphilum Q.T. Chen & X.H.
Fu, Acta Mycol. Sin., Suppl. 1: 330. 1987.
Synonyms:Fusarium solani f. sp.cucurbitae (Race 2) W.C.
Snyder & H.N. Hansen, Amer. J. Bot. 28: 740. 1941.
Holotypus: HMAS 43748.
Ex-type culture: FRC S-2176 = NF4475 = NRRL 22268.
Type locality:China, Beijing.
Type substrate: Deteriorated petroleum.
Descriptions and illustrations: See Sandoval-Denis & Crous
(2018).
peziziforme Fusarium Berk. & M.A. Curtis (as ‘pezizaeforme’), J.
Linn. Soc., Bot. 10: 360. 1869.
Holotypus: In K(M).
Type locality:Cuba.
Type substrate:Poaceae.
Note: Not Fusarium fide Wollenweber & Reinking (1935).
pezizoides Fusarium Desm., Ann. Sci. Nat., Bot., s
er. 3, 18: 373.
1852.
Trochila craterium (DC.) Fr., Summa Veg. Scand. 2: 367. 1849.
Basionym:Sphaeria craterium DC., Fl. Franç., ed. 3, 2: 298.
1805.
Synonyms:Phacidium craterium (DC.) Gillet, Champ. France
Discomyc. (7): 167. 1886.
Sphaeria punctiformis var. hederae Pers., Syn. Meth. Fung. 1:
90. 1801.
Myxosporium paradoxum De Not., Mem. Reale Accad. Sci.
Torino, ser. 2, 3: 81. 1841.
Gloeosporium paradoxum (De Not.) Mont., in Berkeley &
Broome, Ann. Mag. Nat. Hist. 5: 455. 1850.
Gloeosporidium paradoxum (De Not.) Petr., Ann. Mycol. 20: 14.
1922.
Cryptocline paradoxa (De Not.) Arx, Verh. Kon. Ned. Akad.
Wetensch., Afd. Natuurk. 51: 115. 1957.
Gloeotrochila paradoxa (De Not.) Petr., Sydowia 1: 50. 1947.
Trochila craterium var. nucleata Rehm, Ber. Bayer. Bot. Ges. 13:
125. 1912.
Ceuthospora hederae Grove, Bull. Misc. Inform. Kew 1923: 355.
1923.
Holotypus: ?PC.
Type locality:France.
Type substrate:Peziza insidiosa.
Note: Synonyms fide Wollenweber & Reinking (1935).
pezizoideum Fusarium (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4:
711. 1886.
Basionym:Fusisporium pezizoideum Berk. & M.A. Curtis, Gre-
villea 3: 147. 1875.
(See Fusarium sambucinum)
Holotypus: ?K(M).
Type locality:USA, Pennsylvania.
Type substrate: Stems of herbaceous plants.
Note: Synonyms fide Wollenweber & Reinking (1935).
phacidioideum Fusarium Dearn., Mycologia 21: 331. 1929.
Holotypus: JD 4303 in DAOM.
Type locality:Canada, Vancouver, Stanley Park.
Type substrate: Dead branches of Pseudotsuga taxifolia.
FUSARIUM REDELIMITED
www.studiesinmycology.org 145

Note: Status unclear; requires recollection from type locality and
substrate.
pharetrum Fusarium L. Lombard & Crous, Persoonia 43: 32.
2018 [2019].
Holotypus: CBS H-23621.
Ex-type culture: CBS 144751 = CPC 30824.
Type locality:South Africa.
Type substrate:Aloidendron dichotomum.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb1: MW928815; rpb2: MH484952;
tef1: MH485043.
phaseoli Fusarium (Burkh.) T. Aoki & O'Donnell, Mycologia 95:
671. 2003.
Basionym:Fusarium martii f. phaseoli Burkh., Mem. Cornell Univ.
Agric. Exp. Sta. 26: 1007. 1919.
(See Fusarium azukiicola)
Lectotypus (hic designatus, MBT 10000721): USA, New York,
roots of Phaseolus vulgaris, 1919, W.H. Burkholder, in Mem.
Cornell Univ. Agric. Exp. Sta. 26: 1009, fig. 134.
Notes: Synonym fide Sandoval-Denis et al. (2019). Although
Burkholder deposited several specimens in CUP, none are
directly linked to the original protologue (Burkholder 1919).
Several of these specimens appear to have been isolated from
greenhouse assays undertaken by Burkholder. Therefore, an
illustration accompanying the original protologue is designated
here as lectotype.
phialophorum Fusarium Maryani et al., Stud. Mycol. 92: 169.
2018 [2019].
Holotypus: InaCC F971 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F971.
Type locality:Indonesia, South Kalimantan, Tanah Bumbu,
Kampung Betung.
Type substrate:Musa var. Pisang Awak.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb1: LS479545; rpb2: LS479292;
tef1: LS479741.
phormii Fusarium Henn., Verh. Bot. Vereins Prov. Brandenburg
40: 175. 1898 [1899].
Colletotrichum phormii (Henn.) D.F. Farr & Rossman, Mycol.
Res. 110: 1403. 2006.
Synonym:Gloeosporium phormii (Henn.) Wollenw., Fusaria
Autogr. Delin. No. 498. 1916, nom. illegit., Art. 53.1, non
Gloeosporium phormii Sacc. 1915.
Holotypus: B 70 0005220.
Epitypus: CBS H-20720, designated in Damm et al. (2012).
Ex-epitype: A.R. 3546 = CBS 118194.
Type locality:Germany, Berlin.
Type substrate:Phormium tenax.
phragmiticola Fusarium Kirschst., Ann. Mycol. 34: 183. 1936,
nom. inval., Art. 39.1.
Authentic material: B 70 0100199, B 70 0100200, B 70010020.
Original locality:Germany.
Original substrate:Phragmites communis.
phragmitis Fusarium Matsush., Icon. Microfung. Matsush. Lect.:
72. 1975, nom. inval., Art. 40.1.
Authentic material: Not indicated.
Original locality:Japan.
Original substrate: Rotten wood of Fagus crenata.
phyllachorae Fusarium Henn., in de Wildeman, Mission E.
Laurent, Fasc. 4: 363. 1907.
Syntype: Laurent in B fide Hein (1988).
Type locality:Democratic Republic of Congo, between Kin-
shasa and Kwamouth.
Type substrate:Panicum maximum.
Notes: Not Fusarium fide Wollenweber & Reinking (1935).
Typification pending further study of the syntype in B.
phyllogenum Fusarium (Cooke & Peck) Sacc., Syll. Fung. 4: 703.
1886.
Basionym:Fusisporium phyllogenum Cooke & Peck, Rep.
(Annual) New York State Mus. Nat. Hist. 29: 53. 1878.
Syntype: NYSf2335.
Type locality:USA, New York, Albany, Bethlehem.
Type substrate:Erigeron annuum.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935). Typification pending further study of the syn-
type in NYS.
phyllophilum Fusarium Nirenberg & O'Donnell, Mycologia 90:
447. 1998.
Holotypus: IMI 202874.
Ex-type culture: BBA 63625 = CBS 216.76 = DAOM
225132 = IMI 375338 = NRRL 13617.
Type locality:Italy.
Type substrate:Dracaena deremensis.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998).
Diagnostic DNA barcodes:rpb1: KF466399; rpb2: KF466410;
tef1: KF466421.
phyllostachydicola Fusarium W. Yamam., Trans. Mycol. Soc.
Japan 3: 118. 1962.
Basionym:Gibberella phyllostachydicola W. Yamam., Hyogo
Univ. Agric. ser. Agric. Biol. 3: 15. 1957.
Lectotypus (hic designatus, MBT 10000722): Japan, Tamba,
Sasayama-cho, culms of Phyllostachys bambusoides, 31 Aug.
1956, W. Yamamoto, in Hyogo Univ. Agric. ser. Agric. Biol. 3: 17,
figs 16–18.
Descriptions and illustrations: See Yamamoto et al. (1957).
Notes: This species requires recollection from the type host and
locality. As no holotype specimen could be located, an illustration
accompanying the original protologue is designated here as
lectotype.
pilosicola Fusarium Yilmaz et al., Persoonia 46: 152. 2021.
Holotypus: PREM 63216.
Ex-type culture: CMWF 1183 = NRRL 29124 = NY007.H7.
Type locality:USA, Florida.
Type substrate:Bidens pilosa.
Descriptions and illustrations: See Yilmaz et al. (2021).
Diagnostic DNA barcodes:rpb2: MN534248; tef1: MN534055.
pininemorale Fusarium Herron et al., Stud. Mycol. 80: 146.
2015.
Holotypus: PREM 60901.
Ex-type culture: CBS 137240 = CMW 25243.
Type locality:Colombia, Risaralda, Angela Maria (Santa Rosa).
Type substrate:Pinus tecunumanii.
Descriptions and illustrations: See Herron et al. (2015).
Notes: Comparisons of recently generated sequences from the
living ex-type (CBS 137240 = CMW 25243) of F. pininemorale
indicate a strain transposition or contamination by another
Fusarium species. Therefore, this species needs to be
CROUS ET AL.
146

recollected from the type locality and substrate or sequences
need to be generated from the holotype specimen to confirm its
phylogenetic affiliation.
piperis Fusarium (F.C. Albuq.) O'Donnell et al., Index Fungorum
440: 3. 2020.
Neocosmospora piperis (F.C. Albuq.) Sand.-Den. & Crous,
Persoonia 43: 152. 2019.
Basionym:Fusarium solani f. piperis F.C. Albuq., Circ. Inst.
Agron. N. 5: 19. 1961.
Holotypus: IAN 825 in the herbarium of Embrapa Amazo^nia
Oriental.
Epitypus: CBS H-23993, designated in Sandoval-Denis et al.
(2019).
Ex-epitype culture: CBS 145470 = CML 1888 = G.J.S. 89-
14 = NRRL 22570.
Type locality:Brazil.
Type substrate:Piper nigrum.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834241; rpb2: EU329513;
tef1: AF178360.
pisi Fusarium (F.R. Jones) A. 
Si
si
cet al., Sci. Rep. 8(no. 1252):
2. 2018, nom. inval., Art. F.5.1.
Neocosmospora pisi (F.R. Jones) Sand.-Den. & Crous, Per-
soonia 43: 154. 2019.
Basionym:Fusarium martii var. pisi F.R. Jones, J. Agric. Res. 26:
459. 1923.
Synonyms:Fusarium solani f.pisi (F.R. Jones) W.C. Snyder &
H.N. Hansen, Amer. J. Bot. 28: 740. 1941.
Fusarium vanettenii O'Donnell et al., Index Fungorum 440: 5.
2020.
Fusarium solani var. martii ‘f2’Wollenw., Z. Parasitenk. (Berlin)
3: 290. 1931.
Hypomyces solani f. sp. pisi Reichle, W.C. Snyder & Matuo,
Nature 203: 664. 1964.
Lectotypus: Jones (1923; fig. 1 on p. 463), designated in
Sandoval-Denis et al. (2019).
Epitypus: CBS H-23994, designated in Sandoval-Denis et al.
(2019).
Ex-epitype culture: ATCC MYA-4622 = CBS 123669 = NRRL
45880 = Vanetten 77-13-4.
Type locality:USA.
Type substrate: Sexual cross of parents from Pisum sativum and
soil from a potato field.
Descriptions and illustrations: See 
Si
si
cet al. (2018b) and
Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: JX171543; rpb2: EU329640;
tef1: FJ240352.
plagianthi Fusarium (Dingley) O'Donnell & Geiser, Phytopa-
thology 103: 404. 2013.
Neocosmospora plagianthi (Dingley) L. Lombard & Crous,
Stud. Mycol. 80: 227. 2015.
Basionym:Nectria plagianthi Dingley, Trans. Roy. Soc. New
Zealand 79: 196. 1951.
?Nectria pulverulenta Dingley, Trans. Roy. Soc. New Zealand 83:
657. 1956.
Holotypus: PDD 10916.
Type locality:New Zealand, Fiordland, Hollyford Valley.
Type substrate:Plagianthus betulinus.
Descriptions and illustrations: See Dingley (1951) and Samuels
& Brayford (1994).
platani Fusarium (L
ev.) Mont., Ann. Sci. Nat., Bot., s
er. 3, 11: 55.
1849.
Basionym:Hymenula platani L
ev., Ann. Sci. Nat., Bot., s
er. 3, 9:
128. 1848
(See Fusarium nervisequum)
Holotypus: ?PC.
Type locality:France.
Type substrate:Platanus orientalis.
platanoidis Fusarium Oudem., Ned. Kruidk. Arch., s
er. 3, 2: 1131.
1904.
Holotypus: ?L.
Type locality:Netherlands, Gelderland Province, Nunspeet.
Type substrate:Acer platanoides.
Note: Not Fusarium fide Wollenweber & Reinking (1935).
poae Fusarium (Peck) Wollenw., in Lewis, Bull. Maine. Agric.
Exp. Sta. 219: 254. 1913 [1914].
Basionym:Sporotrichum poae Peck, Bull. New York State Mus.
67: 29. 1904 [1903].
Synonyms:Fusarium tricinctum f.poae (Peck) W.C. Snyder &
H.N. Hansen, Amer. J. Bot. 32: 663. 1945.
Fusarium sporotrichiella var. poae (Peck) Bilaĭ, Yadovitye griby
na zerne khlebnykh zlakov (Poisonous fungi on cereal seed): 86.
1953, nom. inval., Art. 39.1.
Fusarium sporotrichiella var. poae (Peck) Bilaĭ, Microbiol. Zhurn.
49: 6. 1987, nom. inval., Arts. 35.1, 41.4.
Sporotrichum anthophilum Peck, Bull. New York State Mus. 105:
28. 1906.
Fusarium maydiperdum Bub
ak, Centralbl. Bakteriol. Parasitenk.,
2. Abth. 31: 497. 1911.
Holotypus: NYSf2393.
Type locality:USA, New York, Geneva.
Type substrate: Sheaths and culms of Poa pratensis.
Epitypus (hic designatus, MBT 10000723): USA, North Dakota,
Minot, from infected barley kernel, date and collector unknown,
NRRL 26941 (preserved as metabolically inactive culture).
Ex-epitype culture: NRRL 26941.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971),Gerlach & Nirenberg (1982) and Leslie
& Summerell (2006).
Diagnostic DNA barcodes:rpb1: KU171686; rpb2: KU171706;
tef1: JABFFD010000730.1
Note: No living material linked to the holotype is available for this
important mycotoxin producing species, and therefore, an epi-
type is designated here to provide taxonomic stability for this
species.
poincianae Fusarium Pass., Atti Reale Accad. Lincei, Rendiconti
Cl. Sci. Fis., s
er. 4, 4: 105. 1888.
Holotypus: Not located.
Type locality:Italy, Parma.
Type substrate:Poinciana gilliesii.
Note: Not Fusarium fide Wollenweber & Reinking (1935).
polymorphum Fusarium Matr., Rech. D
evel. Muc
ed.: 84. 1892.
(See Fusarium sambucinum)
Lectotypus (hic designatus, MBT 10000724): France, horse
dung, 1892, L. Matruchot, in Rech. D
evel. Muc
ed., Pl. 7, figs
6–14.
Notes: Synonym fide Wollenweber & Reinking (1935).Asno
holotype specimen could be located, an illustration accompa-
nying the original protologue is designated here as lectotype.
FUSARIUM REDELIMITED
www.studiesinmycology.org 147

polymorphum Fusarium Marchal, Bull. Soc. Roy. Bot. Belgique
34: 145. 1895, nom. illegit., Art. 53.1.
(See Fusarium aderholdii)
Authentic material: Not located.
Original locality:Belgium, Brussels.
Original substrate:Homo sapiens.
Notes: Synonym fide Wollenweber & Reinking (1935).
polyphialidicum Fusarium Marasas et al., Mycologia 78: 678.1986.
(See Fusarium concolor)
Holotypus: DAOM 192986.
Ex-type culture: ATCC 60096 = CBS 961.87 = DAR
52851 = FRC M-2405 = MRC 3389 = NRRL 13459.
Type locality:South Africa, Mpumalanga Province, Nelspruit.
Type substrate: Plant debris in soil.
Descriptions and illustrations: See Marasas et al. (1986).
Diagnostic DNA barcodes:rpb1: JX171455; rpb2: JX171569;
tef1: MH742681.
poncetii Fusarium Guiart (as ‘ponceti’), Compt.-Rend. S
eances
M
em. Soc. Biol. 73: 271. 1912, nom. inval., Art. 36.1(a).
Authentic material: Not located.
Original locality:?France.
Original substrate:Homo sapiens granuloma teleangiectaticum.
Notes: Status unclear. Not treated by any of Wollenweber &
Reinking (1935),Booth (1971),orGerlach & Nirenberg (1982).
poolense Fusarium (as ‘poolensis’) Taubenh., Bull. Texas Agric.
Exp. Sta. 260: 27. 1920.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000725): USA,Citrullus
lanatus, 1920, J.J. Taubenhaus, in Bull. Texas Agric. Exp. Sta.
260: 30, fig. 8i.
Notes: Synonym fide Wollenweber & Reinking (1935).Asno
holotype specimen could be located, an illustration accompa-
nying the original protologue is designated here as lectotype.
praegraminearum Fusarium Gr€
afenhan & O'Donnell, Mycolo-
gia 108: 1232. 2016.
Holotypus: PDD 47563.
Ex-type culture: CBS 141369 = ICMP 8996 = NRRL 39664.
Type locality:New Zealand, North Island, Levin (near
Wellington).
Type substrate: Litter in maize paddock.
Descriptions and illustrations: See Gr€
afenhan et al. (2016).
Diagnostic DNA barcodes:rpb1: KX260125; rpb2: KX260126;
tef1: KX260120.
prieskaense Fusarium G.J. Marais & Sand.-Den., Stud. Mycol.
98 (no. 100116): 50. 2021.
Holotypus: CBS H-24660.
Ex-type culture: CAMS 001176 = CBS 146498 = CPC 30826.
Type locality:South Africa, Northern Cape Province, Prieska.
Type substrate:Prunus spinosa.
Descriptions and illustrations: See this study.
Diagnostic DNA barcodes:rpb1: MW834190; rpb2: MW834007;
tef1: MW834275.
proliferatum Fusarium (Matsush.) Nirenberg ex Gerlach &
Nirenberg, Mitt. Biol. Bundesanst. Land- Forstw. 209: 309. 1982.
Basionym:Cephalosporium proliferatum Matsush., Microfungi of
the Solomon Islands and Papua-New Guinea: 11. 1971.
Synonyms:Fusarium proliferatum (Matsush.) Nirenberg, Mitt.
Biol. Bundesanst. Land- Forstw. 169: 38. 1976, nom. inval., Art.
41.3.
Fusarium proliferatum var. minus Nirenberg, Mitt. Biol. Bunde-
sanst. Land- Forstw. 169: 43. 1976. nom. inval., Art. 41.3.
Lectotypus: Microfungi of the Solomon Islands and Papua-New
Guinea: 11, fig 121.2, designated by Yilmaz et al. (2021).
Lectotype locality:Papua New Guinea.
Lectotype substrate: Forest soil.
Epitypus: CBS 480.96 (preserved as metabolically inactive cul-
ture), designated by Yilmaz et al. (2021).
Epitype locality:Papua New Guinea, Morobe Province, Bulolo.
Epitype substrate: Forest soil.
Ex-epitype culture: CBS 480.96 = IAM 14682 = NRRL
26427 = NY007.B6.
Descriptions and illustrations: See Matsushima (1971),Yilmaz
et al. (2021).
Diagnostic DNA barcodes:rpb2: MN534272; tef1: MN534059.
protoensiforme Fusarium (Sand.-Den. & Crous) O'Donnell et al.,
Index Fungorum 440: 3. 2020.
Neocosmospora protoensiformis Sand.-Den. & Crous, Per-
soonia 43: 156. 2019.
Holotypus: CBS H-23995.
Ex-type culture: CBS 145471 = G.J.S. 90-168 = NRRL 22178.
Type locality:Venezuela.
Type substrate: Bark of dicot tree.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834244; rpb2: EU329498;
tef1: AF178334.
protractum Fusarium L
ev., Ann. Sci. Nat., Bot., s
er. 3, 9: 246.
1848.
(See Fusarium lateritium)
Holotypus: ?PC.
Type locality:France, Romainville.
Type substrate: Dead shoots of Solanum dulcamara.
Note: Synonym fide Wollenweber & Reinking (1935).
prunorum Fusarium McAlpine, Fungus Diseases of stone-fruit
trees in Australia: 91. 1902.
(See Fusarium candidum (Link) Sacc.)
Lectotypus (hic designatus, MBT 10000726): Australia, Victoria,
Melbourne, Burnley, from shriveled and blackened apricot fruit,
Jun. 1900, D. McAlpine, in Fungus Diseases of stone-fruit trees
in Australia (1902), pl. XX, fig. 42.
Notes: Synonym fide Wollenweber & Reinking (1935).Asno
holotype specimen could be located, an illustration accompa-
nying the original protologue is designated here as lectotype.
pseudacaciae Fusarium Rapaics, Z. Pflanzenkrankh. 25: 208.
1915.
(See Fusarium lateritium)
Holotypus: Not located.
Type locality:Hungary, Debrecen.
Type substrate:Robinia pseudoacaciae.
Note: Synonym fide Wollenweber & Reinking (1935).
pseudensiforme Fusarium Samuels et al., Mycologia 103: 1323.
2011.
Neocosmospora pseudensiformis Samuels et al., Mycologia
103: 1323. 2011.
Holotypus: BPI 881226.
Ex-type culture: CBS 125729 = FRC S-1834 = G.J.S 02-
95 = G.J.S 9318 = NRRL 46517.
Type locality:Sri Lanka, Wagamba, Kurunegala, Arangakele.
Type substrate: Bark of tree.
CROUS ET AL.
148

Descriptions and illustrations: See Nalim et al. (2011).
Diagnostic DNA barcodes:rpb1: KC691615; rpb2: KC691645;
tef1: KC691555.
pseudoanthophilum Fusarium Nirenberg et al., Mycologia 90:
461. 1998.
Holotypus:InB.
Ex-type culture: BBA 69002 = CBS 414.97 = IMI 376112 = NRRL
25211.
Type locality:Zimbabwe, Gambiza.
Type substrate:Zea mays.
Descriptions and illustrations: See Nirenberg et al. (1998).
Diagnostic DNA barcodes:rpb1: MT010949; rpb2: MT010980;
tef1: MK639073.
pseudocircinatum Fusarium O'Donnell & Nirenberg, Mycolo-
gia 90: 448. 1998.
Holotypus: B 70 0001689.
Ex-type culture: BBA 69636 = CBS 126.73= CBS
449.97 = DAOM 225117 = IMI 375316 = NRRL 22946.
Type locality:Ghana.
Type substrate:Solanum sp.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998).
Diagnostic DNA barcodes:rpb1: MG838070; rpb2: MN724939;
tef1: MG838023.
pseudoeffusum Fusarium Murashk., Proc. Siberian Agric. Acad.
Omsk 3: 106. 1924.
(See Fusarium acuminatum)
Holotypus: Not located.
Type locality:Russia, Siberia.
Type substrate:Triticum polonicum.
Note: Synonym fide Wollenweber & Reinking (1935).
pseudograminearum Fusarium O'Donnell & T. Aoki, Mycologia
91: 604. 1999.
Holotypus: BPI 746087.
Ex-type culture: FRC R-5291 = NRRL 28062.
Type locality:Australia, New South Wales, Young.
Type substrate:Hordeum vulgare.
Descriptions and illustrations: See Aoki & O'Donnell (1999).
Diagnostic DNA barcodes:rpb1: JX171524; rpb2: JX171637;
tef1: AF212468.
pseudoheterosporum Fusarium Jacz., Bull. Soc. Mycol. France
28: 347. 1912.
(See Fusarium avenaceum)
Holotypus: Not located.
Type locality:France.
Type substrate:Lolium sp. and Triticum sp.
Note: Synonym fide Wollenweber & Reinking (1935).
pseudonectria Fusarium Speg., Anales Mus. Nac. Hist. Nat.
Buenos Aires 6: 351. 1898 [1899].
(See Fusarium avenaceum)
Holotypus: In LPS (Fungi Argent. n.v.c. no. 867) fide Farr (1973).
Type locality:Ecuador, San Salvador Island.
Type substrate: Dead culms of Poaceae.
Note: Synonym fide Wollenweber & Reinking (1935).
pseudonygamai Fusarium O'Donnell & Nirenberg, Mycologia
90: 449. 1998.
Holotypus: B 70 0001688.
Ex-type culture: BBA 69552 = CBS 417.97 = DAOM
225136 = FRC M-1166 = IMI 375342 = NRRL 13592.
Type locality:Nigeria.
Type substrate:Pennisetum typhoides.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998).
Diagnostic DNA barcodes:rpb1: LT996205; rpb2: LT996152;
tef1: AF160263.
pseudoradicicola Fusarium (Sand.-Den. & Crous) O'Donnell
et al., Index Fungorum 440: 3. 2020.
Neocosmospora pseudoradicicola Sand.-Den. & Crous, Per-
soonia 43: 157. 2019.
Holotypus: CBS H-23996.
Ex-type culture: ARSEF 2313 = CBS 145472 = NRRL 25137.
Type locality:Papua New Guinea, East New Britain, Keravat,
Lowlands Agricultural Experiment Station.
Type substrate: Diseased pods of Theobroma cacao.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218133; rpb2: JF741084;
tef1: JF740757.
pseudotonkinense Fusarium (Sand.-Den. & Crous) O'Donnell
et al., Index Fungorum 440: 3. 2020.
Neocosmospora pseudotonkinensis Sand.-Den. & Crous,
Persoonia 43: 159. 2019.
Holotypus: CBS H-23997.
Ex-type culture: CBS 143038.
Type locality:Netherlands, Zuid-Holland Province, Leiden.
Type substrate: Cornea of Homo sapiens.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb2: LR583867; tef1: LR583640.
pteridis Fusarium Ellis & Everh., Proc. Acad. Nat. Sci. Phila-
delphia 45: 466. 1894.
Septogloeum pteridis (Ellis & Everh.) Wollenw., Fusaria Autogr.
Delin. 1: 446. 1916.
Syntypes: In BPI, BRU, CUP, FLAS, ILL, ISC, MICH, MSC, MU,
NEB, NY, OSC, PH, PUL, WIS & WSP.
Type locality:USA, New Jersey, Gloucester, Newfield.
Type substrate:Phyllachora flabella on Pteris aquilina.
pucciniophilum Fusarium Sacc. & P. Syd., Syll. Fung. 14: 1128.
1899.
Replaced synonym:Fusarium parasiticum Ellis & Kellerm., J.
Mycol. 3 (11): 127. 1887, nom. illegit., Art. 53.1.
(See Fusarium heterosporum)
Holotypus: Kellerman & Swingle no. 1104 in NY.
Type locality:USA, Kansas, Manhattan.
Type substrate: Parasitic on Puccinia seymeriae on leaves of
Solidago macrophylla.
Note: Synonym fide Wollenweber & Reinking (1935).
pulvinatum Fusarium (Link) Nees, Syst. Pilze: 32. 1817.
Basionym:Atractium pulvinatum Link, Mag. Ges. Naturf.
Freunde Berlin 8: 32. 1816.
Holotypus: Not located.
Type locality:Poland,Wrocław.
Type substrate: Hanging scrub branches.
Notes: Status unclear. Not treated by any of Wollenweber &
Reinking (1935),Booth (1971),orGerlach & Nirenberg (1982).
pulvinatum Fusarium (Berk. & Broome) Sacc., Syll. Fung. 4: 699.
1886, nom. illegit., Art. 53.1.
Basionym:Fusisporium pulvinatum Berk. & Broome, J. Linn.
Soc., Bot. 14: 102. 1873 [1875].
(See Fusarium sambucinum)
Holotypus: In K(M).
FUSARIUM REDELIMITED
www.studiesinmycology.org 149

Type locality:Sri Lanka.
Type substrate: Bark.
Note: Synonym fide Wollenweber & Reinking (1935).
punctiforme Fusarium Durieu & Mont., Expl. Sci. Alg
erie 1: 335.
1848.
(See Fusarium reticulatum)
Holotypus: Not located.
Type locality:Algeria.
Type substrate:Citrus aurantium.
Note: Synonym fide Wollenweber & Reinking (1935).
purpurascens Fusarium Maryani et al., Stud. Mycol.92: 160.
2018 [2019].
(see Fusarium odoratissimum)
Holotypus: InaCC F886 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F886.
Type locality:Indonesia, East Kalimantan, Kampung Salak
Martadinata.
Type substrate:Musa var. Pisang Kepok.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb2: LS479385; tef1: LS479827.
pusillum Fusarium Wollenw., Fusaria Autogr. Delin. 2: 550. 1924.
(See Fusarium dimerum)
Lectotypus (hic designatus, MBT 10000727): Germany,Sola-
num tuberosum, 1919, H.W. Wollenweber, in Fusaria Autogr.
Delin. 2: 550. 1924.
Note: As no holotype specimen could be located, an illustration
accompanying the original protologue is designated here as
lectotype.
putaminum Fusarium (Thüm.) Sacc., Syll. Fung. 4: 703. 1886.
Basionym:Fusisporium putaminum Thüm., Oesterr. Bot. Z. 27:
272. 1877.
(See Fusarium lateritium)
Holotypus: Not located.
Type locality:Austria, Klosterneuburg.
Type substrate:Prunus domestica.
Note: Synonyms fide Wollenweber & Reinking (1935).
putrefaciens Fusarium Osterw., Mitth. Thurgauischen Naturf.
Ges. 16: 123. 1904.
(See Fusarium avenaceum)
Lectotypus (hic designatus, MBT 10000728): Switzerland,
Zürich, fruit and seeds of Pyrus sp., 1904, collector unknown, in
Osterwalder, Mitth. Thurgauischen Naturf. Ges. 16, tab. 2, figs
10–30.
Notes: Synonym fide Wollenweber & Reinking (1935).Asno
holotype specimen could be located, an illustration accompa-
nying the original protologue is designated here as lectotype.
pyrinum Fusarium Schwein., Trans. Amer. Philos. Soc., n.s. 4:
302. 1834, unavailable, see Art. F.3.4.
(See Fusarium lactis)
pyrinum Fusarium (Fr.) Sacc., Syll. Fung. 4: 720. 1886.
Basionym:Fusisporium pyrinum Fr., Syst. Mycol. 3: 445. 1832,
nom. sanct.
(See Fusarium avenaceum)
Holotypus: Not located.
Type locality:Sweden.
Type substrate: Rotten fruit of Pyrus communis.
Note: Synonym fide Wollenweber & Reinking (1935).
pyrochroum Fusarium (Desm.) Sacc., Michelia 1: 534. 1879.
Calonectria pyrochroa (Desm.) Sacc., Michelia 1: 308. 1878.
Basionym:Selenosporium pyrochroum Desm., Ann. Sci. Nat.,
Bot., s
er. 3, 14: 111. 1850.
Synonyms:Nectria pyrochroa Desm., Pl. Crypt. N. France, ed. 2:
no. 372. 1856.
Calonectria daldiniana De Not., Comment. Soc. Crittog. Ital. 2:
477. 1867.
Fusarium pyrochroum var. diatrypellicola P. Syd., Mycoth.
March., Cent. 41: no. 4063. 1893.
Nectria abnormis Henn., Hedwigia 36: 219. 1897.
Holotypus: In ?PAD or PC.
Type locality:France.
Type substrate:Sambucus nigra.
quercicola Fusarium Oudem., Ned. Kruidk. Arch., s
er. 3, 2: 777.
1902.
Holotypus: ?L.
Type locality:Netherlands, Noord-Holland Province, Bussum.
Type substrate:Quercus rubra.
Note: Not Fusarium fide Wollenweber & Reinking (1935).
quercinum Fusarium O'Donnell et al., Index Fungorum 440: 4.
2020.
Neocosmospora quercicola Sand.-Den. & Crous, Persoonia
43: 159. 2019.
Holotypus: CBS H-23998.
Ex-type culture: CBS 141.90 = NRRL 22652.
Type locality:Italy.
Type substrate:Quercus cerris.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834247; rpb2: LR583869;
tef1: DQ247634.
radicicola Fusarium Wollenw., J. Agric. Res. 2: 257. 1914.
(See Fusarium solani)
Lectotypus: Plate XVI, fig. K, in Wollenweber (1914), designated
in Sandoval-Denis et al. (2019).
Lectotype locality:USA, Washington.
Lectotype substrate:Solanum tuberosum.
Note: Synonym fide Wollenweber & Reinking (1935) &Sandoval-
Denis et al. (2019).
ramigenum Fusarium O'Donnell & Nirenberg, Mycologia 90:
451. 1998.
Holotypus: B 70 0001687.
Ex-type culture: BBA 68592 = CBS 418.97 = DAOM
225137 = IMI 375343 = NRRL 25208.
Type locality:USA, California.
Type substrate:Ficus carica.
Descriptions and illustrations: See Nirenberg & O'Donnell (1998).
Diagnostic DNA barcodes:rpb1: KF466401; rpb2: KF466412;
tef1: AF160267.
ramosum Fusarium (Batista & H. Maia) O'Donnell et al., Index
Fungorum 440: 4. 2020.
Basionym:Hyaloflorea ramosa Bat. & H. Maia, Anais Soc. Biol.
Pernambuco 13: 155. 1955.
Synonyms:Neocosmospora ramosa (Bat. & H. Maia) L.
Lombard & Crous, Stud. Mycol. 80: 227. 2015.
(See Fusarium lichenicola C. Massal.)
Holotypus: IMUR 410.
Ex-type culture: CBS 509.63 = IMUR 410 = MUCL 8050.
Type locality:Brazil.
CROUS ET AL.
150

Type substrate: Air.
Diagnostic DNA barcodes:rpb2: LR583843; tef1: LR583618.
Note: Synonymies fide Sandoval-Denis & Crous (2018).
ramulicola Fusarium Sawada, Special Publ. Coll. Agric. Natl.
Taiwan Univ. 8: 228. 1959, nom. inval., Art. 39.1.
Authentic material: Not located.
Original locality:Taiwan.
Original substrate: Branches of Citrus tankan f. koshotankan.
Note: This name is invalid because of missing Latin diagnosis.
rectiphorum Fusarium Samuels et al. (as ‘rectiphorus’), Myco-
logia 103: 1324. 2011.
Neocosmospora rectiphora Samuels et al., Mycologia 103:
1324. 2011.
Neocosmospora bomiensis Z.Q. Zeng & W.Y. Zhuang, Phytotaxa
319: 177. 2017.
Holotypus: BPI 881229.
Ex-type culture: CBS 125727 = FRC S-1831 = G.J.S. 02-89.
Type locality:Sri Lanka, Wagamba Province, vic. Kurunegala,
Arangakele.
Type substrate: Bark.
Descriptions and illustrations: See Nalim et al. (2011).
Diagnostic DNA barcodes:rpb1: MW834249; rpb2: LR583871;
tef1: LR583641.
redolens Fusarium Wollenw., Phytopathology 3: 29. 1913 and
Ber. Deutsch. Bot. Ges. 31: 31. 1913.
Synonyms:Fusarium oxysporum var. redolens (Wollenw.) W.L.
Gordon, Canad. J. Bot. 30: 238. 1952.
Fusarium solani var. redolens (Wollenw.) Bilaĭ, Fusarii (Biologija i
sistematika): 288. 1955.
?Fusarium retusum Wellman, Phytopathology 33: 957. 1943.
Holotypus: Not located.
Type locality:Unknown.
Type substrate:Pisum sativum.
Lectotypus (hic designatus, MBT 10000729): Unknown,Pisum
sativum, 1913, H.W. Wollenweber, in Phytopathology 3: 31, fig.
E.
Epitypus (hic designatus, MBT 10000730): Germany, Berlin-
Dahlem, vascular bundle of Dianthus caryophyllus, 16 May 1959,
D. Hantschke & W. Gerlach, CBS 360.87 (preserved as meta-
bolically inactive culture).
Ex-epitype culture: ATCC 16067 = BBA 9526 = CBS
248.61 = CBS 360.87 = DSM 62390 = NRRL 20426 = NRRL
25600.
Descriptions and illustrations: See Gerlach & Pag (1961),
Gerlach & Nirenberg (1982) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: MT409433; rpb2: MT409443;
tef1: MT409453.
Notes: As both protologue publications occurred more or less
simultaneously for F. redolens, we select the illustration provided
in Phytopathology as lectotype, since no holotype material could
be located. Gerlach & Nirenberg (1983) considered CBS 248.61
(= CBS 360.87) a good representative of F. redolens, which was
initially designated by Gerlach & Pag (1961) as representative of
F. redolens f. sp. dianthi. Therefore, an epitype is designated
here to provide taxonomic stability for this species.
regulare Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index
Fungorum 440: 4. 2020.
Neocosmospora regularis Sand.-Den. & Crous, Persoonia 43:
162. 2019.
Holotypus: CBS H-23999.
Ex-type culture: CBS 230.34
Type locality:Netherlands, Zeeland Province, Zuid Beveland,
near Kloetinge.
Type substrate:Pisum sativum.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb2: LR583873; tef1: LR583643.
rekanum Fusarium Lynn & Marinc., Antonie van Leeuwenhoek
113: 816. 2020.
Neocosmospora rekana (Lynn & Marinc.) L. Lombard & Sand.-
Den., comb. nov.MycoBank MB 837706.
Basionym:Fusarium rekanum Lynn & Marinc., Antonie van
Leeuwenhoek 113: 816. 2020.
Holotypus: PREM 62333.
Ex-type culture: CMW 52862 = PPRI 27163.
Type locality:Indonesia, Sumatra, Riau, Pelalawan.
Type substrate:Acacia crassicarpa infested with Euwallacea
perbrevis.
Descriptions and illustrations: See Lynn et al. (2020).
Diagnostic DNA barcodes:rpb2: MN249137, MN249108; tef1:
MN249151.
Note: Based on the phylogenetic position of this species related
to the ‘ambrosia’clade as illustrated by Lynn et al. (2020),we
provide a new combination in the genus Neocosmospora.
reticulatum Fusarium Mont., Ann. Sci. Nat., Bot., s
er. 2, 20:
379. 1843.
Synonyms:?Fusarium leucoconium Corda, Icon. Fung. 1: 4.
1837. (fide Wollenweber & Reinking 1935).
?Fusarium punctiforme Durieu & Mont., Expl. Sci. Alg
erie 1: 335.
1848.
Fusisporium flavidum Bonord., Bot. Zeitung (Berlin) 19: 194. 1861.
Fusarium flavidum (Bonord.) Sacc., Syll. Fung. 4: 698. 1886.
Fusarium ampelodesmi Fautrey & Roum., in Roumegu
ere, Rev.
Mycol. (Toulouse) 13: 82. 1891.
Fusarium epithele McAlpine, Fungus Diseases of Citrus trees in
Australia: 80. 1899.
Fusarium orchidis Petch, Ann. Roy. Bot. Gard. (Peradeniya) 6:
256. 1917.
Fusarium negundinis Sherb., in Hubert, J. Agric. Res. 26: 451.
1923.
Fusarium reticulatum var. negundinis (Sherb.) Wollenw., Z.
Parasitenk. (Berlin) 3: 351. 1931.
Fusarium heterosporum var. negundinis (Sherb.) Raillo, Fungi of
the Genus Fusarium: 217. 1950.
Fusarium reticulatum var. medium Wollenw., Z. Parasitenk.
(Berlin) 3: 358. 1931.
Lectotypus (hic designatus, MBT 10000731): France, Nouvelle-
Aquitaine, Saint-Sever, Citrullus sp., 1843, L. Dufour, in Mon-
tagne, Ann. Sci. Nat., Bot., 2 s
er. 20: 379: pl. 16, fig. 3.
Epitypus (hic designatus, MBT 10000732): Germany, Rellingen/
Holstein, bark lesion of Sophora japonica, Jun. 1976, R.
Schwarz, CBS 473.76 (preserved as metabolically inactive).
Ex-epitype culture: BBA 63657 = CBS 473.76 = NRRL 20684.
Descriptions and illustrations: See Gerlach & Nirenberg (1982).
Diagnostic DNA barcodes:rpb1: MW928816; tef1: MW928841.
Notes: Gerlach & Nirenberg (1983) considered CBS 473.76 a
good representative of F. reticulatum. As no holotype specimen
could be located, an illustration is designated as lectotype here
and an epitype is designated to provide taxonomic stability for
this species.
retusum Fusarium Wellman, Phytopathology 33: 957. 1943.
FUSARIUM REDELIMITED
www.studiesinmycology.org 151

(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:USA, Indiana.
Type substrate:Solanum lycopersicum.
rhabdophorum Fusarium Berk. & Broome, Ann. Mag. Nat. Hist.,
ser. 4, 17: 142. 1876.
Holotypus: In K(M).
Type locality:UK, Scotland, Forres.
Type substrate: Dead sticks.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
rhizochromatistes Fusarium Sideris, Phytopathology 14: 212.
1924.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000733): USA, California,
Stockton, roots of Allium cepa, 1924, C.P. Sideris, in Phytopa-
thology 14, pl. XI.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration
was designated as lectotype.
rhizogenum Fusarium Pound & Clem., Bot. Surv. Nebraska 3:
12. 1894.
(See Fusarium candidum Ehrenb.)
Holotypus: NEB0040548.
Type locality:USA, Lincoln.
Type substrate: Roots of Malus domestica seedlings.
Note: Synonym fide Wollenweber & Reinking (1935).
rhizogenum Fusarium Aderh., Centralbl. Bacteriol. Parasitenk.,
1. Abth., 6: 623. 1900, nom. illegit., Art. 53.1.
(See Fusarium aderholdii)
Authentic material: Not located.
Original locality:Germany.
Original substrate:Malus domestica.
Notes: Synonym fide Wollenweber & Reinking (1935). The
original publication could not be checked but Sorauer (1923)
clearly stated that Aderhold only used the name Fusarium rhi-
zogenum Pound & Clem. to describe a disease using the latter
name.
rhizophilum Fusarium Corda, Icon. Fung. 2: 3. 1838.
Synonym:Fusisporium georginae Klotzsch, Herb. Viv. Mycol.,
Cent. 2: 186. 1832, nom. nud., Art. 38.1(a).
(See Fusarium merismoides)
Lectotypus (hic designatus, MBT 10000734): Czech Republic,
Prague, roots of garden plants, 1838, A.C.J. Corda, in Icon.
Fung. 2, Tab. VIII, fig. 15.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
rhizophorae Fusarium (Dayar.) O'Donnell et al., Index Fungorum
440: 4. 2020.
Neocosmospora rhizophorae Dayar., Mycosphere 11: 112.
2020.
Holotypus: MFLU 17-2588.
Ex-type culture: MFLUCC 17-2461.
Type locality:Thailand, Krabi Province, Phang Nga.
Type substrate: Submerged wood of Rhizophora.
Descriptions and illustrations: See Dayarathne et al. (2020)
rhodellum Fusarium McAlpine, Proc. Linn. Soc. New South
Wales 24: 122. 1899.
Lectotypus (hic designatus, MBT 10000735): Kerguelen
Islands,Pringlea antiscorbutica, 1899, D. McAlpine, in Proc.
Linn. Soc. New South Wales 24: Pl. XIII, Fig. 7.
Notes: Not Fusarium fide I. Pascoe. No holotype specimen could
be located and therefore an illustration is designated as
lectotype.
rhoicola Fusarium Fautrey, Rev. Mycol. (Toulouse) 17: 171.
1895.
(See Fusarium graminearum)
Holotypus: ?PC.
Type locality:France via USA.
Type substrate:Rhus toxicodendron.
Note: Synonym fide Wollenweber & Reinking (1935).
ricini Fusarium (B
erenger) Bizz., Fl. Ven. Critt. 1: 539. 1885.
Basionym:Fusisporium ricini B
erenger, Mem. Accad. Agric.
Verona 44: 257. 1866.
(See Fusarium sambucinum)
Holotypus: Not located.
Type locality:Italy.
Type substrate:Ricinus communis.
Note: Synonym fide Wollenweber & Reinking (1935).
rigidiusculum Fusarium (Berk. & Broome) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 32: 664. 1945.
Basionym:Nectria rigidiuscula Berk. & Broome, J. Linn. Soc.,
Bot. 14: 116. 1873 [1875].
(See Fusarium colorans)
Holotypus: ?K(M).
Type locality:?Sri Lanka.
Type substrate: Bark.
Note: Synonym fide Wollenweber & Reinking (1935).
rimicola Fusarium Sacc. (as ‘rimicolum’), Michelia 2: 297. 1881.
(See Fusarium lateritium)
Holotypus: Not located.
Type locality:Italy, Padua.
Type substrate:Erythrina crista-galli.
Note: Synonym fide Wollenweber & Reinking (1935).
rimosum Fusarium (Peck) Sacc., Syll. Fung. 4: 713. 1886.
Basionym:Fusisporium rimosum Peck, Rep. (Annual) New York
State Mus. Nat. Hist. 30: 58. 1878.
(See Fusarium merismoides)
Holotypus: NYSf2609.
Type locality:USA, New York, Albany.
Type substrate: Cut ends of stalks of Zea mays.
Note: Synonym fide Wollenweber & Reinking (1935).
riograndense Fusarium Dall
e Rosa et al., J. Mycol. Med. 28: 33.
2018.
Neocosmospora riograndensis (Dall
e Rosa et al.) Sand.-Den.
& Crous, Persoonia 43: 165. 2019.
Holotypus: UFMG-CM F12570.
Ex-type culture: UFMG-CM F12570 = URM-7361.
Type locality:Brazil, Rio Grande do Sul, Porto Alegre, Hospital
de Clínicas de Porto Alegre.
Type substrate: Nasal cavity of Homo sapiens.
Descriptions and illustrations: See Dall
e Rosa et al. (2018).
Diagnostic DNA barcodes:rpb2: KX534003; tef1: KX534002.
CROUS ET AL.
152

robiniae Fusarium Pass., Atti Reale Accad. Lincei, Rendiconti Cl.
Sci. Fis., s
er. 4, 7: 51. 1891.
(See Fusarium sarcochroum)
Holotypus: ?PARMA.
Type locality:Italy, Padua.
Type substrate:Robinia pseudoacacia.
Note: Synonym fide Wollenweber & Reinking (1935).
robustum Fusarium Gerlach, Phytopathol. Z. 88: 36. 1977.
Holotypus:InB.
Isotypus: CBS H-629.
Ex-type culture: BBA 63667 = CBS 637.76 = FRC R-5821 = IMI
322102 = NRRL 13392.
Type locality:Argentina.
Type substrate:Araucaria angustifolia.
Descriptions and illustrations: See Gerlach (1977c).
Diagnostic DNA barcodes:rpb2: MW928831; tef1: MW928842.
roesleri Fusarium Thüm., Pilze Weinst.: 51. 1878.
(See Fusarium merismoides)
Lectotypus (hic designatus, MBT 10000736): Austria, Klos-
terneuburg, Vitis vinifera, 1878, K.A.E.J. Thümen, in Pilze
Weinst. Tab. 3, fig. 7.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
rollandianum Fusarium Sacc., Syll. Fung. 11: 650. 1895.
Replaced synonym:Fusarium cydoniae Roum. & Fautrey, Rev.
Mycol. (Toulouse) 14: 170. 1892, nom. illegit., Art. 53.1, non
Allescher 1892.
Syntype: ILL00220295 (Fautrey, Fungi Sel. Gall. Exs. No. 6120).
Type locality:France.
Type substrate: Fruit of Cydonia vulgaris.
Notes: Not Fusarium fide Wollenweber & Reinking (1935).
Typification pending further study of the syntype lodged in ILL.
rosae Fusarium (Preuss) Sacc., Syll. Fung. 4: 697. 1886.
Basionym:Selenosporium rosae Preuss, Linnaea 24: 150. 1851.
Holotypus: Not located; not preserved in B fide Holubov
a-
Jechov
aet al. (1994).
Type locality:Germany, Hoyerswerda.
Type substrate:Rosa sp.
Notes:Status unclear. Not treated by any of Wollenweber &
Reinking (1935),Booth (1971),orGerlach & Nirenberg (1982).
roseobullatum Fusarium Wollenw. (as ‘roseo-bullatum’), Fusaria
Autogr. Delin. 1: 117. 1916.
Basionym:Fusarium bullatum var. roseum Sherb., Mem. Cornell
Univ. Agric. Exp. Sta. 6: 201. 1915.
(See Fusarium equiseti)
Holotypus:?CUP-007433.
Type locality:USA, Iowa.
Type substrate:Solanum tuberosum.
Note: Synonym fide Wollenweber & Reinking (1935).
roseolum Fusarium (H.O. Stephens ex Berk. & Broome) Sacc.,
Syll. Fung. 4: 710. 1886.
Basionym:Fusisporium roseolum H.O. Stephens ex Berk. &
Broome, Ann. Mag. Nat. Hist., ser. 2, 7: 178. 1851.
(See Fusarium merismoides)
Holotypus: ?K(M).
Type locality:UK, Bristol.
Type substrate: Decayed Solanum tuberosum.
Note: Synonyms fide Wollenweber & Reinking (1935).
roseum Fusarium Link, Mag. Ges. Naturf. Freunde Berlin 3: 10.
1809, nom. rej.
(See Fusarium sambucinum)
Lectotypus: In B, selected in Gams et al. (1997).
Type locality:Germany.
Type substrate:Malvaceae.
Notes:Gams et al. (1997) proposed that the name, F. roseum be
rejected due to ambiguity surrounding the type of this species,
with F. sambucinum taking preference. This proposal was
accepted in 1999 (see Gams 1999).
rostratum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 30. 1910 [1913].
(See Fusarium graminearum)
Lectotypus (hic designatus, MBT 10000737): Germany, Berlin,
Triticum aestivum, 1913, O.A. Appel & H.W. Wollenweber, in
Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 30, Abb. 1, figs
E1–E13.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
roumeguerei Fusarium Sacc. (as ‘roumegueri’), Syll. Fung. 4:
702. 1886, nom. illegit., Art. 52.1.
Replaced synonym:Fusarium insidiosum Roum., Michelia 2 (6):
132. 1880.
(See Fusarium lateritium)
Type material: See Fusarium insidiosum.
Note: Synonym fide Wollenweber & Reinking (1935).
ruberrimum Fusarium Delacr., Bull. Soc. Mycol. France 6: 139.
1890.
(See Fusarium avenaceum)
Holotypus: ?PC.
Type locality:France, Paris.
Type substrate:Onobrychis viciifolia.
Note: Synonym fide Wollenweber & Reinking (1935).
rubi Fusarium (G. Winter) Berl. & Voglino, Add. Syll. Fung. 1–4:
391. 1886.
Basionym:Fusisporium rubi G. Winter, in Rabenh., Fungi Eur.
Extraeur Exs., Ed. Nov., Ser. Sec., Cent. 13 (resp. 33): 3280.
1885.
Synonym:Ramularia rubi (G. Winter) Wollenw., Fusaria Autogr.
Delin. 1: 470. 1916.
Cercosporella rubi (G. Winter) Plakidas, J. Agricultural Research
54: 275. 1937.
Syntypes: In BPI, CHRB, CUP, F, HAL, ISC, LSUM, MSC, MU,
NEB & PH (Fungi Eur. Extraeur. Exs. no. 3280).
Type locality:USA, Illinois, Cobden
Type substrate:Rubus villosus
Note: Status unclear fide Braun (1998).
rubicolor Fusarium Berk. & Broome, Trans. Linn. Soc. London,
Bot. 2: 68. 1883.
Holotypus: ?K(M).
Type locality:Australia, Queensland, Brisbane.
Type substrate: Leaves of Eucalyptus sp.
FUSARIUM REDELIMITED
www.studiesinmycology.org 153

Note: Not Fusarium fide Wollenweber & Reinking (1935).
rubiginosum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 108. 1910 [1913].
(See Fusarium culmorum)
Lectotypus (hic designatus, MBT 10000738): Germany,Sola-
num tuberosum, 1913, O.A. Appel & H.W. Wollenweber, in
Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: Tab. I, figs 31–48.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
rubrum Fusarium Parav., Ann. Mycol. 16: 311. 1918.
(See Fusarium lactis)
Lectotypus (hic designatus, MBT 10000739): Germany, core of
Malus domestica fruit, 1918, E. Paravicini, in Ann. Mycol. 16, pl.
4, figs 23–33.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
rusci Fusarium (Sacc.) O'Donnell & Geiser, Phytopathology 103:
404. 2013.
Basionym:Fusarium roseum var. rusci Sacc., Michelia 2: 294.
1881.
Synonyms:Trichofusarium rusci (Sacc.) Bub
ak, Bull. Herb.
Boissier, s
er. 2, 6: 488. 1906.
Pycnofusarium rusci D. Hawksw. & Punith., Trans. Brit. Mycol.
Soc. 61: 63. 1973.
Syntype: BPI 453152.
Type locality:Italy, Selva.
Type substrate:Ruscus aculeatus.
Notes: Examination of the syntype (BPI 453152) revealed that
this species does not belong to the genus Fusarium, having a
myrothecium-like morphology. Also see notes under Nothofu-
sarium devonianum.
russianum Fusarium Manns, Bull. North Dakota Agric. Exp. Sta.
259: 34. 1932.
(See Fusarium acuminatum)
Holotypus: Not located.
Type locality:USA, North Dakota.
Type substrate:Linum usitatissimum.
Note: Synonym fide Wollenweber & Reinking (1935).
ruticola Fusarium Fautrey & Roum. (as ‘rutaecola’), Rev. Mycol.
(Toulouse) 13: 82. 1891.
(See Fusarium avenaceum)
Syntype: ?PC (Fungi Sel. Gall. Exs. No. 5686).
Type locality:France, Noidan.
Type substrate:Ruta graveolens.
Note: Synonym fide Wollenweber & Reinking (1935).
saccardoanum Fusarium P. Syd., Syll. Fung. 14: 1128. 1899.
Replaced synonym:Fusarium sclerodermatis Peck, Rep.
(Annual) Regents Univ. State New York New York State Mus. 43:
77. 1890, nom. illegit., Art. 53.1, non Fusarium sclerodermatis
Oudem. 1889.
(See Fusarium oxysporum)
Holotypus: NYSf2731.
Type locality:USA, New York, Suffolk, Manor, Long Island.
Type substrate:Scleroderma vulgaris.
Note: Synonym fide Wollenweber & Reinking (1935).
sacchari Fusarium (E.J. Butler) W. Gams, Cephalosporium-
artige Schimmelpilze: 218. 1971.
Basionym:Cephalosporium sacchari E.J. Butler, Mem. Dept.
Agric. India, Bot. Ser. 6: 185. 1913.
Synonyms:Fusarium neoceras Wollenw. & Reinking, Phytopa-
thology 15: 164. 1925.
Gibberella sacchari Summerell & J.F. Leslie, Mycologia 97: 719.
2005, nom. illegit., Art. 53.1, non Gibberella sacchari Speg. 1896.
Fusarium desaboruense N. Maryani et al., Persoonia 43: 59.
2019.
Lectotypus: In Mem. Dept. Agric. India, Bot. Ser. 6: 185, pl. II, figs
1–13. 1913, designated by Yilmaz et al. (2021).
Epitypus: CBS 223.76 (preserved as metabolically inactive cul-
ture), designated by Yilmaz et al. (2021).
Ex-epitype culture: BBA 63340 = CBS 223.76 = DAOM
225138 = IMI 202881 = NRRL 13999.
Lectotype and epitype locality:India.
Lectotype and epitype substrate: Saccharum officinarum.
Descriptions and illustrations: See Butler & Khan (1913),Gams
(1971),Gerlach & Nirenberg (1982),Leslie et al. (2005) and
Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: JX171466; rpb2: JX171580;
tef1: AF160278.
salicicola Fusarium Allesch. (as ‘salicicolum’), Ber. Bayer. Bot.
Ges. 4: 39. 1896.
(See Fusarium avenaceum)
Holotypus:InM.
Type locality:Germany, München, forest near Großhesselohe.
Type substrate: Dead branch of Salix caprea.
Note: Synonym fide Wollenweber & Reinking (1935).
salicinum Fusarium Corda, Icon. Fung. 3: 33. 1839.
Typus: In PRM fide Pilat (1938).
Type locality:Czech Republic, near Prague.
Type substrate: Thin branches of Salix sp.
Notes: Not Fusarium fide Wollenweber & Reinking (1935).
Lectotypification pending study of material lodged in PRM.
salicis Fusarium Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 7, no.
2110. 1868.
(See Fusarium lateritium)
Syntype: S-F267709 (Fungi Rhen. Exs. no. 2110).
Type locality:Germany, Hessen, Münchau, near Hattenheim
Type substrate: Dry branches of Salix triandra.
Notes: Synonym fide Wollenweber & Reinking (1935). Typifica-
tion pending further study of the syntype lodged in S.
salinense Fusarium Sand.-Den. et al., Persoonia 40: 15. 2017
[2018].
Holotypus: CBS H-23019.
Ex-type culture: CBS 142420 = CPC 26973.
Type locality:Italy, Sicily, Messina, Leni.
Type substrate: Twigs of Citrus sinensis.
Descriptions and illustrations: See Sandoval-Denis et al.
(2018a).
Diagnostic DNA barcodes:rpb1: LT746286; rpb2: LT746306;
tef1: LT746193.
salmonicolor Fusarium Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10:
359. 1868 [1869].
Synonym:Fusidium salmonicolor (Berk. & M.A. Curtis) Wollenw.,
Fusaria Autogr. Delin. 1: 478. 1916.
CROUS ET AL.
154

Holotypus: In K(M).
Type locality:Cuba.
Type substrate: Dead twigs of unknown host.
Notes: Synonym fide Wollenweber & Reinking (1935). This taxon
needs to be recombined into the genus Neonectria but requires
further investigation.
samararum Fusarium Allesch., Ber. Bayer. Bot. Ges. 4: 39. 1896.
(See Fusarium lateritium)
Holotypus:InM.
Type locality:Germany, München, Starnberg.
Type substrate: Fallen fruits of Fraxinus excelsior.
Note: Synonym fide Wollenweber & Reinking (1935).
sambucinum Fusarium Fuckel, Fungi Rhen. Exs., Fasc. 3, no.
211. 1863, nom. cons.
Synonyms:Fusarium roseum Link, Mag. Ges. Naturf. Freunde
Berlin 3: 10. 1809, nom. rej.
Fusidium roseum (Link) Link, Mag. Ges. Naturf. Freunde Berlin
8: 31. 1815 [1816].
Gibberella rosea (Link) W.C. Snyder & H.N. Hansen, Amer. J.
Bot. 32: 664. 1945.
Sphaeria pulicaris Fr., Mykol. Hefte 2: 37. 1823.
Gibbera pulicaris (Fr.) Fr., Summa Veg. Scand. 2: 402. 1849.
Botryosphaeria pulicaris (Fr.) Ces. & De Not., Comment. Soc.
Crittog. Ital. 1: 212. 1863.
Nectria pulicaris (Fr.) Tul. & C. Tul., Select. Fung. Carpol. 3: 63.
1865.
Cucurbitaria pulicaris (Fr.) Qu
el., M
em. Soc. 
Emul. Montb
eliard,
s
er. 2, 5: 511. 1875.
Gibberella pulicaris (Fr.) Sacc., Michelia 1: 43. 1877.
Fusarium sulphureum Schltdl., Fl. Berol. 2: 139. 1824, nom. rej.
Fusidium sulphureum (Schltdl.) Link, in Willdenow, Sp. Pl. ed. 4,
6: 98. 1825.
Fusarium discolor var. sulphureum (Schltdl.) Appel & Wollenw.,
Arbeiten Kaiserl. Biol. Anst. Land- Forstw. 8: 115. 1910 [1913].
Sphaeria cyanogena Desm., Ann. Sci. Nat., Bot., s
er. 3, 10: 352.
1848.
Botryosphaeria cyanogena (Desm.) Niessl, Verh. Naturf. Vereins
Brünn 10: 197. 1872.
Gibberella cyanogena (Desm.) Sacc., Syll. Fung. 2: 555. 1883.
Calonectria cyanogena (Desm.) Lar.N. Vassiljeva, Nizshie Ras-
teniya, Griby i Mokhoobraznye
Dalnego Vostoka Rossii, Griby. Tom 4. Pirenomitsety i
Lokuloaskomitsety: 169. 1998.
Fusarium maydis Kalchbr., Math. Term. Közlem. 3: 285. 1865,
nom. rej.
Fusisporium ricini B
erenger, Mem. Accad. Agric. Verona 44: 257.
1866, nom. rej.
Fusarium ricini (B
erenger) Bizz., Fl. Ven. Critt. 1: 539. 1885.
Fusarium subcarneum P. Crouan & H. Crouan, Fl. Finist
ere: 14.
1867, nom. rej.
Fusarium violaceum P. Crouan & H. Crouan, Fl. Finist
ere: 14.
1867, nom. illegit., Art. 53.1.
Fusisporium pezizoideum Berk. & M.A. Curtis, Grevillea 3: 147.
1875.
Fusarium pezizoideum (Berk. & M.A. Curtis) Sacc., Syll. Fung. 4:
711. 1886.
Fusisporium pulvinatum Berk. & Broome, J. Linn. Soc., Bot. 14:
102. 1873 [1875].
Fusarium pulvinatum (Berk. & Broome) Sacc., Syll. Fung. 4: 699.
1886, nom. illegit., Art. 53.1.
Fusarium roseum var. buxi Sacc., Michelia 2: 294. 1881.
Fusarium roseum var. calystegiae Sacc., Michelia 2: 294. 1881.
Fusarium roseum var. cucubali-bacciferi Sacc., Michelia 2: 295.
1881.
Fusarium roseum var. dulcamarae Sacc., Michelia 2: 295. 1881.
Fusarium roseum var. filicis Sacc., Michelia 2: 295. 1881.
Fusarium roseum var. fraxini Therry, Cryptog. Lyonn.: 5717.
1881.
Fusarium roseum var. helianti Sacc., Michelia 2: 295. 1881.
Fusarium roseum var. maydis Sacc., Michelia 2: 295. 1881.
Fusarium roseum var. phytolaccae Sacc., Michelia 2: 294. 1881.
Fusarium roseum var. rosae Sacc., Michelia 2: 295. 1881.
Fusarium roseum var. vitalbae Sacc., Michelia 2: 294. 1881.
Fusarium granulare Kalchbr., Crypt. Austro-Afric., no. 1068.
1874.
Fusarium roseum var. dracaenae Roum., Fungi Sel. Gall. Exs.,
Cent. 19: 1869. 1882.
Fusisporium tenuissimum Peck, Rep. (Annual) New York State
Mus. Nat. Hist. 34: 48. 1883.
Fusarium tenuissimum (Peck) Sacc., Syll. Fung. 4: 711. 1886.
Fusisporium hordei Wm.G. Sm., Diseases of field and garden
crops, chiefly as are caused by fungi: 212. 1884.
Fusarium hordei (Wm.G. Sm.) Sacc., Syll. Fung. 11: 652. 1895.
Gibberella pulicaris f. robiniae P. Syd., Mycoth. March., Cent. 14:
1544. 1887.
Fusarium tenellum Sacc. & Briard, Rev. Mycol. (Toulouse) 7:
212. 1885.
Fusarium asparagi Delacr., Bull. Soc. Mycol. France 6: 99. 1890,
nom. illegit., Art. 53.1.
Fusarium delacroixii Sacc., Syll. Fung. 10: 725. 1892.
Fusarium fraxini Allesch., Ber. Bot. Vereines Landshut 12: 130.
1892.
Fusarium polymorphum Matr., Rech. D
evel. Muc
ed.: 84. 1892.
Fusarium roseum var. lonicerae Allesch., Ber. Bayer. Bot. Ges. 5:
22. 1897.
Fusarium roseum f. visci Brunaud, Actes Soc. Linn. Bordeaux
52: 149. 1897.
Fusarium pannosum Massee, Bull. Misc. Inform. Kew 1898: 117.
1898.
Gibberella pulicaris var. subtropica Rehm, in Theissen, Ann.
Mycol. 9: 63. 1911.
Gibberella subtropica (Rehm) Wollenw., Fusaria Autogr. Delin. 1:
38. 1916.
Botryosphaeria subtropica (Rehm) Weese, Sitzungsber. Akad.
Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1, 128: 708. 1919.
Fusarium genevense Dasz., Bull. Soc. Bot. Gen
eve, s
er. 2, 4:
305. 1912.
Fusarium discolor Appel & Wollenw., Arbeiten Kaiserl. Biol. Anst.
Land- Forstw. 8: 114. 1913.
Fusarium subpallidum Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 230. 1915.
Fusarium roseum var. phaseoli Gonz. Frag., Trab. Mus. Nac.
Cienc. Nat., Ser. Bot. 10: 173. 1916.
Fusarium aridum O.A. Pratt, J. Agric. Res. 13: 89. 1918.
Fusarium elongatum O.A. Pratt, J. Agric. Res. 13: 84. 1918, nom.
illegit., Art. 53.1.
Fusarium roseum var. zeae Cif., Bull. Soc. Bot. Ital. 1921: 73. 1921.
Fusarium sambucinum var. medium Wollenw., Z. Parasitenk.
(Berlin) 3: 358. 1931.
Fusarium sambucinum f2 Wollenw., Z. Parasitenk. (Berlin) 3:
357. 1931.
Fusarium sambucinum f3 Wollenw., Z. Parasitenk. (Berlin) 3:
357. 1931.
FUSARIUM REDELIMITED
www.studiesinmycology.org 155

Fusarium sambucinum f4 Wollenw., Z. Parasitenk. (Berlin) 3:
357. 1931.
Fusarium sambucinum f6 Wollenw., Z. Parasitenk. (Berlin) 3:
358. 1931.
Gibberella pulicaris var. minor Wollenw., Z. Parasitenk. (Berlin) 3:
356. 1931.
Fusarium roseum f. phaseoli N. Barros, Revista Inst. Colomb.
Agropecu. 1: 80. 1966.
Fusarium roseum f. compactum Tivoli, Agronomie 8: 220. 1988,
nom. inval., Arts. 35.1, 39.1.
Fusarium roseum var. lavaterae-arboreae Thüm., Mycoth. Univ.
Cent. 11: no. 1084. 1878.
Lectotypus: G00266369.
Type locality:Germany, Hessen.
Type substrate: Dead branches of Sambucus nigra.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971),Gerlach & Nirenberg (1982),Nelson
et al. (1983), and Leslie & Summerell (2006).
Notes: The taxonomy of F. sambucinum, the type species of the
genus Fusarium, is confusing. Divergent species concepts have
been derived from multiple taxonomic systems and the con-
flicting application of the older name F. roseum (Gams et al.
1997,Leslie & Summerell 2006). After examination of the type
material, a proposal to conserve F. sambucinum against several
earlier names was presented (Gams et al. 1997) and unani-
mously accepted by the committee for fungal taxonomy (Gams
1999). Further older valid synonymous names are in need to
be rejected, notably Sphaeria pulicaris and Sphaeria cyanogena.
samoense Fusarium Gehrm., Arbeiten Kaiserl. Biol. Anst. Land-
Forstw. 9: 24. 1913.
(See Fusarium verticillioides)
Lectotypus (hic designatus, MBT 10000740): Samoa, cortex of
Theobroma cacao, 1913, K. Gehrmann, in Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 9: Abb. 6, figs 1–3.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
sampaioi Fusarium Gonz. Frag., Bol. Soc. Brot. 2: 50. 1924.
Synonym: Illosporium corallinum Roberge, in Desmazi
eres, Pl.
Crypt. N. France, ed. 1, Fasc. 32: no. 1551. 1847 (pr. p. fide
Hawksworth 1979).
Marchandiomyces corallinus (Roberge) Diederich & D. Hawksw.,
Mycotaxon 37: 312. 1990 (pr. p. fide Diederich 1990).
Aegerita physciae Vouaux, Bull. Trimestriel Soc. Mycol. France
30: 314. 1914.
Holotypus: Not indicated. Several syntypes fide Hawksworth
(1979).
Type locality:Portugal, near Gaia, Alto da Bandeira; and near
Tabuaço.
Type substrate: Lichen thallus (on Lasallia pustulata,Parmelia
saxatilis,P. soredians and P. exasperata;Physcia semipinnata,
P. tenella,Phaeophyscia orbicularis and Physconia grisea).
Notes:Hawksworth (1979), after examination of a syntype,
concluded that the Fusarium name should be rejected since the
studied material was based on discordant elements. Neverthe-
less, examination of all available syntypes is required to confirm
these observations or otherwise, to fix the use of this name by
lectotypification.
samuelsii Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index
Fungorum 440: 4. 2020.
Neocosmospora samuelsii Sand.-Den. & Crous, Persoonia 43:
165. 2019.
Holotypus: CBS H-24001.
Ex-type culture: CBS 114067 = G.J.S. 89-70.
Type locality:Guyana, Mount Wokomung, on ridge leading NW
toward summit, 0.5–1 h walk from Base Camp.
Type substrate: Bark.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834252; rpb2: LR583874;
tef1: LR583644.
sangayamense Fusarium Maryani et al., Stud. Mycol. 92: 187.
2018 [2019].
Holotypus: InaCC F960 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F960.
Type locality:Indonesia, South Kalimantan, Kota Baru,
Sengayam.
Type substrate: Pseudostem of Musa var. Pisang Kepok.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb1: LS479537; rpb2: LS479283;
tef1: LS479732.
sanguineum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 193. 1915.
(See Fusarium acuminatum)
Typus: ?CUP-007444.
Type locality:USA, New York, Ithaca
Type substrate:Solanum tuberosum.
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in CUP.
sapindophilum Fusarium Speg., Anales Mus. Nac. Hist. Nat.
Buenos Aires 6: 351. 1898 [1899].
Synonym:Cercoseptoria sapindophila (Speg.) Cif., Mycopathol.
Mycol. Appl. 6: 26. 1951.
Holotypus: In LPS (Fungi Argent. n.v.c. no. 868).
Type locality:Argentina, near Tucum
an.
Type substrate: Living leaves of unknown climbing Sapindaceae.
Note: Synonym fide Wollenweber & Reinking (1935).
sarcochroum Fusarium (Desm.) Sacc., Michelia 1: 534. 1879.
Basionym:Selenosporium sarcochroum Desm., Ann. Sci. Nat.,
Bot., s
er. 3, 14: 112. 1850.
Synonyms:Fusarium diplosporum Cooke & Ellis, Grevillea 7: 38.
1878.
Fusarium desciscens Oudem., Ned. Kruidk. Arch., s
er. 2, 5: 515.
1889.
Fusarium robiniae Pass., Atti Reale Accad. Lincei, Rendiconti Cl.
Sci. Fis., s
er. 4, 7: 51. 1891.
Fusarium sarcochroum var. robiniae (Pass.) Wollenw., Z. Para-
sitenk. (Berlin) 3: 388. 1931.Fusarium sarcochroum f.polygalae-
myrtifoliae Henn., Verh. Bot. Vereins Prov. Brandenburg 40: 174.
1898 [1899].
Fusarium sarcochroum var. casei Loubi
ere, Rech. Muc
edin
ees:
53. 1924.
Gibberella pseudopulicaris Wollenw., Z. Parasitenk. (Berlin) 3:
387. 1931.
Neotypus (hic designatus, MBT 10000741): Switzerland,Vis-
cum album, 1977, W. Gerlach, CBS 745.79 (preserved as
metabolically inactive culture).
Ex-neotype culture: BBA 63714 = CBS 745.79 = NRRL 20472.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Raillo (1950), Bilaĭ(1955), Gerlach & Nirenberg (1982).
CROUS ET AL.
156

Diagnostic DNA barcodes:rpb1: JX171472; rpb2: JX171586;
tef1: JABEXW010000634.
Notes: No type material could be located. Therefore, CBS 745.79
is designated as neotype here. Both Gerlach & Nirenberg (1982)
and O'Donnell et al. (2013) considered this isolate an authentic
representation of this species.
schawrowii Fusarium Speschnew (as ‘schawrovi‘), Arbeiten
Kaukas. Stat. Seidenzucht 10: 1906.
(See Fusarium lateritium)
Holotypus: Not located.
Type locality:Turkey, Anatolia.
Type substrate: Branch of Morus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
schiedermayeri Fusarium (Thüm.) Sacc., Syll. Fung. 4: 712.
1886.
Basionym:Fusisporium schiedermayeri Thüm., Fungi Austr. Exs.
Cent. 1: no. 78. 1871.
(See Fusarium avenaceum)
Syntypus: In HAL.
Type locality:Austria, Linz.
Type substrate: Ovaries of Luzula pilosa, in association with
Ustilago luzulae.
Note: Synonyms fide Wollenweber & Reinking (1935).
schnablianum Fusarium Allesch., Hedwigia 34: 289. 1895.
(See Fusarium avenaceum)
Holotypus:InM.
Type locality:Germany, Großhesselohe, near München.
Type substrate: Decorticated branch of Acer pseudoplatanus.
Note: Synonym fide Wollenweber & Reinking (1935).
schribauxii Fusarium Delacr., Bull. Soc. Mycol. France 6: 99.
1890.
(See Fusarium culmorum)
Holotypus: ?PC.
Type locality:France.
Type substrate: Seeds of Triticum sativum, in association with
Trichothecium roseum.
Note: Synonym fide Wollenweber & Reinking (1935).
schweinitzii Fusarium Ellis & Harkn., Bull. Torrey Bot. Club 8: 27.
1881.
Colletotrichum crassipes (Speg.) Arx, Verh. Kon. Akad.
Wetensch., Afd. Natuurk., Sect. 2, 51: 77. 1957.
Basionym:Gloeosporium crassipes Speg., Rivista Vitic. Enol. 2:
405. 1878.
Syntypes: In CHRB, CUP, ILL, MICH, MU, NEB, NYS, PH, PUL &
WIS (Ellis, N. Amer. Fungi no. 539).
Type locality:USA, New Jersey, Newfield.
Type substrate:Vitis sp. vine
Note: Synonym fide Wollenweber & Reinking (1935).
scirpi Fusarium Lambotte & Fautrey, Fautrey, Fungi Sel. Gall.
Exs. no. 6540. 1893.
Synonyms:?Fusoma helminthosporii Corda, Icon. Fung. 1: 7.
1837.
?Fusoma filiferum Preuss, Linnaea 25: 73. 1852.
?Fusarium filiferum (Preuss) Wollenw., Fusaria Autogr. Delin. 1:
220. 1916.
?Fusarium scirpi var. filiferum (Preuss) Wollenw., Fusaria Autogr.
Delin. 3: 936. 1930.
?Fusisporium chenopodinum Thüm., Mycoth. Univ., Cent. 14: no.
1378. 1879.
?Fusarium chenopodinum (Thüm.) Sacc., Syll. Fung. 4: 701.
1886.
?Fusarium aloes Kalchbr. & Cooke (as ‘alo€
es’), Grevillea 9: 23.
1880.
?Fusarium osteophilum Speg., Anales Soc. Ci. Argent. 10: 60. 1880.
?Fusisporium mucophytum W.G. Sm., Gard. Chron. n.s. 22: 245.
1884.
?Fusarium mucophytum (W.G. Sm.) Massee, Brit. Fung.-Fl. 3:
483. 1893.
Fusarium equiseticola Allesch., Hedwigia 34: 289. 1895.
Fusarium sclerotium Wollenw., Ber. Deutsch. Bot. Ges. 31: 301.
1913.
Fusarium caudatum Wollenw., J. Agric. Res. 2: 262. 1914.
Fusarium sclerodermatis var. lycoperdonis Picb., Bull. Ecol. Sup.
Agron., Brno, R.C.S. Fac. Silvicult. 13: 27. 1929.
Fusarium scirpi var. comma Wollenw., Fusaria Autogr. Delin. 3:
922. 1930.
Fusarium scirpi var. nigrantum F.T. Benn. (as ‘nigrans’), Ann.
Appl. Biol. 19: 26. 1932.
Fusarium scirpi var. pallens F.T. Benn., Ann. Appl. Biol. 19: 21.
1932.
Lectotypus (hic designatus, MBT 10000742): France,Schoe-
noplectus lacustris (= Scirpus lacustris), 1893, F. Fautrey,
ILL00220730 (Fautrey, Fungi Sel. Gall. Exs. No. 6540).
Epitypus (hic designatus, MBT 10000743): Australia, New
South Wales, near Broken Hill, pasture soil, 1981, P.E. Nelson,
CBS H-24069.
Ex-epitype culture: CBS 447.84 = FRC R-6252 = NRRL 36478.
Descriptions and illustrations: See Wollenweber (1916–1935),
Wollenweber & Reinking (1935),Burgess et al. (1985) and Leslie
& Summerell (2006).
Diagnostic DNA barcodes:rpb2: GQ505832; tef1: GQ505654.
Notes: The epitypification of Fusarium scirpi by Xia et al. (2019)
was not Code compliant as the holo- or lectotype was not
correctly indicated (Art. 9.9). Here, the lectotype is clearly indi-
cated, making the epitypification valid.
sclerodermatis Fusarium Oudem., Ned. Kruidk. Arch., s
er. 2, 5:
516. 1889.
(See Fusarium torulosum)
Holotypus: ?L.
Type locality:Netherlands, Zuid-Holland Province,
Scheveningen.
Type substrate: Rotten Scleroderma vulgaris.
Note: Synonym fide Nirenberg (1995).
sclerodermatis Fusarium Peck, Rep. (Annual) Regents Univ.
State New York New York State Mus. 43: 77. 1890, nom. illegit.,
Art. 53.1.
(See Fusarium oxysporum)
Authentic material: NYSf2731.
Original locality:USA, New York, Suffolk.
Original substrate: Peridium of Scleroderma vulgaris.
Notes: A later homonym of F. sclerodermatis Oudem. Saccardo
(1892) published F. peckii as a replacement name which was
again an illegitimate homonym; the taxon was later synonymised
with F. oxysporum var. aurantiacum (Wollenweber & Reinking
1935).
sclerostromaton Fusarium Sideris, Phytopathology 14: 213.
1924.
(See Fusarium oxysporum)
Holotypus: Not located.
FUSARIUM REDELIMITED
www.studiesinmycology.org 157

Type locality:USA, California, Delta, near Stockton.
Type substrate: Roots of Allium sp. with symptoms of pink root
disease.
Note: Synonym fide Wollenweber & Reinking (1935).
sclerotioides Fusarium Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. 6: 214. 1915.
(See Fusarium oxysporum)
Typus: ?BPI 452971.
Type locality:USA, New York, Ithaca.
Type substrate:Solanum tuberosum.
Notes: Synonym fide Wollenweber & Reinking (1935). Typifica-
tion pending further study of the specimen lodged in BPI.
sclerotioides Fusarium (Höhn.) Samuels & Rossman, Mycolog-
ical Papers 164: 23. 1991, nom. illegit., Art. 53.1
Basionym:Stagonopsis sclerotioides Höhn., in Penther &
Zederbauer, Ann. K. K. Naturhist. Hofmus. 20: 368. 1905.
(See Fusarium kurdicum)
Holotypus: FH00965353.
Type locality:Turkey, near Erciyes Da
gı.
Type substrate: Thin twigs of Astragalus sp.
sclerotium Fusarium Wollenw., Ber. Deutsch. Bot. Ges. 31: 30.
1913.
(See Fusarium scirpi)
Holotypus: Not located.
Type locality:USA.
Type substrate:Citrullus vulgaris and Lycopersicon esculentum.
Note: Synonym fide Nirenberg (1995).
scolecoides Fusarium Sacc. & Ellis, Miscellanea Mycologia 2:
18. 1885.
(See Fusarium ciliatum)
Holotypus: In PAD.
Type locality:USA, Pennsylvania, Bethlehem.
Type substrate: Branch of Robinia sp.
Note: Synonym fide Wollenweber & Reinking (1935).
secalis Fusarium F
ee, M
em. Soc. Mus. Hist. Nat. Strassbourg 3:
35. 1843.
(See Fusarium heterosporum)
Holotypus: Not located.
Type locality:France.
Type substrate: Spikes of Secale cereale.
Note: Synonym fide Wollenweber & Reinking (1935).
secalis Fusarium Jacz., Bull. Trimestriel Soc. Mycol. France 28:
346. 1912, nom. illegit., Art. 53.1.
(See Fusarium nivale)
Authentic material: Not located.
Original locality:Russia, near Moscow.
Original substrate: Grain of Secale sp.
Note: Synonym fide Wollenweber & Reinking (1935).
secorum Fusarium Secor et al., Fungal Biology 118: 767. 2014.
Holotypus: BPI 892692.
Ex-type culture: NRRL 62593.
Type locality:USA, Minnesota, Sabin.
Type substrate: Root of Beta vulgaris.
Descriptions and illustrations: See Secor et al. (2014).
Diagnostic DNA barcodes:rpb1: JABEEM010001657; rpb2:
JABEEM010001483; tef1: KJ189225.
sedimenticola Fusarium M.M. Wang et al., Botanica Marina 63:
174. 2020.
(See Fusarium keratoplasticum)
Holotypus: HAMS 248044.
Ex-type culture: CGMCC 3.19499 = LC12845.
Type locality:China, South-West Indian Ocean.
Type substrate: Deep-sea sediments.
Descriptions and illustrations: See Jones et al. (2020).
Diagnostic DNA barcodes:rpb2: MK190729; tef1: MK190727.
Notes:Fusarium sedimenticola was recently introduced by Jones
et al. (2020) in the FSSC (=Neocosmospora) isolated from deep-
sea sediment in the Indian Ocean. However, based on com-
parisons of both protologues and sequences using a larger
sampling of N. keratoplastica isolates (results not shown), we
consider F. sedimenticola a synonym under N. keratoplastica.
seemenianum Fusarium Henn., in Seemen, Allg. Bot. Z. Syst. 2:
83. 1896.
(See Fusarium avenaceum)
Holotypus: B 70 0100194.
Type locality:Germany, Borkum.
Type substrate: Leaves of Platanthera bifolia var. robusta.
Note: Synonym fide Wollenweber & Reinking (1935).
semitectum Fusarium Berk. & Ravenel, Grevillea 3: 98. 1875.
(See Fusarium incarnatum)
Holotypus: ?K(M).
Type locality:USA, Pennsylvania, Philadelphia.
Type substrate: Petioles of Musa sp.
serjaniae Fusarium Syd. & P. Syd., Beibl. Hedwigia 40: (2). 1901.
Synonym:Cercospora serjaniae (Syd. & P. Syd.) Wollenw., Z.
Parasitenk. (Berlin) 3: 496. 1931.
Holotypus: S-F45658.
Type locality:Mexico, Puebla, Tehuac
an.
Type substrate: Leaves of Serjania racemosa.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935) and not Cercospora fide Crous & Braun (2003).
serpentinum Fusarium J.W. Xia et al., Persoonia 43: 217.
2019.
Holotypus: CBS H-24070.
Ex-type culture: BBA 62209 = CBS 119880 = MRC 1813.
Type locality:Unknown.
Type substrate: Unknown.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170432; tef1: MN170499.
setosum Fusarium Nirenberg & Samuels, Canad. J. Bot. 67:
3372. 1989.
Setofusarium setosum (Samuels & Nirenberg) Sand.-Den. &
Crous, Stud. Mycol. 98 (no. 100116): 75. 2021.
Synonym:Nectria setofusarii Samuels & Nirenberg (as ‘setofu-
sariae’), Canad. J. Bot. 67: 3372. 1989.
Holotypus: NY00927992.
Type locality:French Guiana, Piste de Saint-Elie, Km 16 on
road between Sinnamary and St. Elie, ORSTOM research area,
"ECEREX".
Type substrate: Bark of living liana.
Epitypus: CBS H-24723, designated in this study.
Ex-epitype culture: CBS 635.92 = G.J.S. 88-12 = NRRL 36526.
Epitype locality:French Guiana, Cayenne, 15 km from Remise,
trail to Vidal-old farm, secondary forest.
Epitype substrate: Bark.
Descriptions and illustrations: See Samuels & Nirenberg (1989).
Diagnostic DNA barcodes:rpb1: JX171539; rpb2: JX171651;
tef1: MW834294.
CROUS ET AL.
158

sibiricum Fusarium Gagkaeva et al., Int. J. Food Microbiol. 147:
64. 2011.
Holotypus: LEP 12652.
Ex-type culture: MFG 11013 = NRRL 53430.
Type locality:Russia, Khabarovsk.
Type substrate: Grain of Avena sativa.
Descriptions and illustrations: See Yli-Mattila et al. (2011).
Diagnostic DNA barcodes:rpb1: MW233302; rpb2: HQ154472;
tef1: HM744684.
siculi Fusarium Sand.-Den. et al., Persoonia 40: 17. 2017
[2018].
Holotypus: CBS H-23021.
Ex-type culture: CBS 142422 = CPC 27188.
Type locality:Italy, Sicily, Catania, Patern
o.
Type substrate:Citrus sinensis.
Descriptions and illustrations: See Sandoval-Denis et al.
(2018a).
Diagnostic DNA barcodes:rpb1: LT746299; rpb2: LT746327;
tef1: LT746214.
silvicola Fusarium (Sand.-Den. & Crous) O'Donnell et al., Index
Fungorum 440: 4. 2020.
Neocosmospora silvicola Sand.-Den. & Crous, Persoonia 43:
167. 2019.
Synonyms:Fusarium solani f. robiniae Matuo & Y. Sakurai, Ann.
Phytophathol. Soc. Japan 30: 35. 1965.
Hypomyces solani f.robiniae Matuo & Y. Sakurai, Ann. Phyto-
phathol. Soc. Japan 30: 35. 1965.
Nectria solani f. robiniae (Matuo & Y. Sakurai) G.R.W. Arnold, Z.
Pilzk. 37: 193. 1972.
Holotypus: CBS H-24002.
Ex-type culture: CBS 123846 = G.J.S. 04-147.
Type locality:USA, Tennessee, Great Smoky Mountains National
Park.
Type substrate: Fallen trunk of Liriodendron tulipifera.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834254; rpb2: LR583876;
tef1: LR583646.
sinense Fusarium Z.H. Zhao & G.Z. Lu (as ‘sinensis’), Myco-
logia 100: 747. 2008.
Holotypus: IBE 000007.
Ex-type culture: CBS 122710.
Type locality:China, Shandong Province, Jinan.
Type substrate: Seed of Triticum aestivum.
Descriptions and illustrations: See Zhao & Lu (2008).
Diagnostic DNA barcode: tef1: EF531235.
socium Fusarium Sacc., Atti Ist. Veneto Sci. Lett. Arti, s
er. 6, 2:
450. 1884.
(See Fusarium expansum)
Holotypus: Not located.
Type locality:France, Troyes.
Type substrate: Cortex of Carpinus sp. in association with Stil-
bospora sp. and Nectria stilbosporae.
Note: Synonym fide Wollenweber & Reinking (1935).
solani Fusarium (Mart.) Sacc., Michelia 2: 296. 1881.
Neocosmospora solani (Mart.) L. Lombard & Crous, Stud.
Mycol. 80: 228. 2015.
Basionym:Fusisporium solani Mart., Die Kartoffel-Epidemie der
letzten Jahre oder die Stockf€
aule und R€
aude der Kartoffeln: 20.
1842.
Synonyms:Fusisporium solani-tuberosi Desm., Ann. Sci. Nat.,
Bot., s
er. 3, 3: 359. 1845.
Fusarium solani-tuberosi (Desm.) Sacc., Syll. Fung. 4: 189.
1886.
Pionnotes solani-tuberosi (Desm.) Sacc., Syll. Fung. 4: 727.
1886.
Fusisporium rhizophilum var. solani-tuberosi (Desm.) Westend.,
Bull. Acad. Roy. Sci. Belgique, Cl. Sci. 18(2): 413. 1852.
Fusisporium candidum Bonord., Handb. Allg. Mykol.: 96. 1851,
nom. illegit., Art. 53.1, non Fusarium candidum (Link) Sacc. 1886
Fusarium commutatum Sacc., Syll. Fung. 4: 710. 1886.
Fusarium allii-sativi Allesch., Ber. Bot. Vereines Landshut 12:
131. 1892.
Hymenula affinis (Fautrey & Lambotte) Wollenw., Fusaria Autogr.
Delin. 1: 484. 1916 [pr. p. fide Booth (1971)].
Pionnotes viridis Lechmere, Compt. Rend. Hebd. S
eances Acad.
Sci. 155: 178. 1912.
Fusarium viride (Lechmere) Wollenw., Fusaria Autogr. Delin. 1:
418. 1916.
Fusarium radicicola Wollenw., J. Agric. Res. 2: 257. 1914.
Fusarium javanicum var. radicicola (Wollenw.) Wollenw., Z.
Parasitenk. (Berlin) 3: 286. 1931.
Fusarium solani f.radicicola (Wollenw.) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 28: 740. 1941.
Fusarium eumartii C.W. Carp., J. Agric. Res. 5: 204. 1915.
Fusarium solani var. eumartii (C.W. Carp.) Wollenw., Z. Para-
sitenk. (Berlin) 3: 452. 1931.
Fusarium solani f. eumartii (C.W. Carp.) W.C. Snyder & H.N.
Hansen, Amer. J. Bot. 28: 740. 1941.
Fusarium malli Taubenh., Bull. Texas Agric. Exp . Sta. 273: 25. 1921.
Fusarium alluviale Wollenw. & Reinking, Phytopathology 15: 167.
1925.
Fusarium aduncisporum Weimer & Harter, J. Agric. Res. 32: 312.
1926.
Fusarium solani var. aduncisporum (Weimer & Harter) Wollenw.,
Fusaria Autogr. Delin. 3: 1035. 1930.
Neocosmospora rubicola L. Lombard & Crous, Stud. Mycol. 80:
227. 2015.
Lectotypus: Illustration tab. III, fig. 29 in von Martius (1842),
designated in Schroers et al. (2016).
Epitypus: CBS H-22335, designated in Schroers et al. (2016).
Ex-epitype culture: CBS 140079 = FRC S-2364 = NRRL 66304.
Epitype locality:Slovenia, Doljenska, Radohova.
Epitype substrate: Rotten tuber of Solanum tuberosum.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Leslie & Summerell (2006), and Schroers et al. (2016).
Diagnostic DNA barcodes:rpb1: MW218134; rpb2: KT313623;
tef1: KT313611.
solani-melongenae Fusarium O'Donnell et al., Index Fungorum
440: 4. 2020.
Neocosmospora ipomoeae (Halst.) L. Lombard & Crous, Stud.
Mycol. 80: 227. 2015.
Basionym:Nectria ipomoeae Halst., Rep. (Annual) New Jersey
Agric. Exp. Sta. 12: 281. 1891.
Synonyms:Cucurbitaria ipomoeae (Halst.) Kuntze, Revis. Gen.
Pl. 3: 461. 1898.
Creonectria ipomoeae (Halst.) Seaver, N. Amer. Fl. 3: 22. 1910.
Hypomyces ipomoeae (Halst.) Wollenw., Phytopathology 3: 34.
1913.
Haematonectria ipomoeae (Halst.) Samuels & Nirenberg, Stud.
Mycol. 42: 136. 1999.
FUSARIUM REDELIMITED
www.studiesinmycology.org 159

Nectria ipomoeae f.ipomoeae Halst., Rep. (Annual) New Jersey
Agric. Exp. Sta. 12: 281. 1891.
Nectria ipomoeae var. ipomoeae Halst., Rep. (Annual) New
Jersey Agric. Exp. Sta. 12: 281. 1891.
Hypomyces ipomoeae var. ipomoeae (Halst.) Wollenw., Phyto-
pathology 3: 34. 1913.
Hypomyces ipomoeae var. major Wollenw., Fusaria Autogr.
Delin. 3: 826. 1930.
?Fusarium striatum Sherb., Cornell Univ. Agric. Exp. Sta. Mem.
6: 255. 1915
?Fusarium solani var. striatum (Sherb.) Wollenw., Z. Parasitenk.
(Berlin) 3: 451. 1931.
Holotypus: BPI 552416.
Type locality:USA, New Jersey, Mickleton.
Type substrate:Solanum melongena.
Note: This species requires epitypification from the type locality
and host.
solani-tuberosi Fusarium (Desm.) Sacc., Syll. Fung. 4: 189.
1886.
Basionym:Fusisporium solani-tuberosi Desm., Ann. Sci. Nat.,
Bot., s
er. 3, 3: 359. 1845.
(See Fusarium solani)
Holotypus: ?PC.
Type locality:France.
Type substrate: Rotten tuber of Solanum tuberosum.
Note: Synonyms fide Wollenweber & Reinking (1935).
sophorae Fusarium Allesch., Beibl. Hedwigia 36: (164). 1897.
(See Fusarium lateritium)
Holotypus:InM.
Type locality:Germany, Berlin, Sp€
ath'sche Baumschulen.
Type substrate:Sophora japonica.
Note: Synonym fide Wollenweber & Reinking (1935).
sorghi Fusarium Henn., Ann. Mus. Congo Belge, Bot., s
er. 5, 2:
105. 1907.
(See Fusarium avenaceum)
Syntype: Vanderyst 171 in B fide Hein (1988).
Type locality:Democratic Republic of the Congo, Kisantu.
Type substrate: Spikelet of Sorghum vulgare (= Sorghum
bicolor).
Note: Synonym fide Wollenweber & Reinking (1935).
sororula Fusarium Herron et al., Stud. Mycol. 80: 146. 2015.
Holotypus: PREM 60903.
Ex-type culture: CBS 137242 = CMW 40578.
Type locality:Colombia, Risaralda, Angela Maria (Santa Rosa).
Type substrate: Stem cankers of Pinus patula.
Descriptions and illustrations: See Herron et al. (2015).
Notes: Comparisons of recently generated sequences from the
living ex-type culture (CBS 137242 = CMW 40578) of F. sororula
indicate a strain transposition or contamination by another
Fusarium species. Therefore, this species needs to be recol-
lected from the type locality and substrate or sequences need to
be generated from the holotype specimen.
spartinae Fusarium Ellis & Everh., J. Mycol. 8: 14. 1902.
Septogloeum spartinae (Ellis & Everh.) Wollenw. & Reinking,
Fusarien: 336. 1935.
Holotypus:NY(fide Index Fungorum).
Type locality:USA, California, Pacific Grove.
Type substrate: Leaves of Spartina stricta.
Note: Synonym fide Wollenweber & Reinking (1935).
spartum Fusarium S. Gargouri et al., Mycologia 112: 799. 2020.
Holotypus: BPI 911207.
Ex-type culture: NRRL 66896.
Type locality:Tunisia, Kasserine Governorate.
Type substrate: Rhizosphere of Macrochloa tenacissima.
Descriptions and illustrations: See Gargouri et al. (2020).
Diagnostic DNA barcodes:rpb1: MT409439; rpb2: MT409449;
tef1: MT409459.
spathulatum Fusarium (Sand.-Den. & Crous) O'Donnell et al.,
Index Fungorum 440: 4. 2020.
Neocosmospora spathulata Sand.-Den. & Crous, Persoonia
43: 171. 2019.
Holotypus: CBS H-24003.
Ex-type culture: CBS 145474 = NRRL 28541 = UTHSC 98-1305.
Type locality:USA, New England.
Type substrate: Synovial fluid from Homo sapiens.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218137; rpb2: EU329542;
tef1: DQ246882.
speiranthae Fusarium Henn. (as ‘speiranthis’), Verh. Bot. Vereins
Prov. Brandenburg 40: 174. 1898.
Colletotrichum dematium (Pers.) Grove, J. Bot. 56: 341. 1918.
Basionym:Sphaeria dematium Pers., Syn. Meth. Fung.: 88.
1801.
Synonyms:Exosporium dematium (Pers.) Link, in Willdenow, Sp.
pl., Ed. 4, 6: 122. 1825.
Vermicularia dematium (Pers.) Fr., Syst. Mycol. 3: 255. 1829.
Lasiella dematium (Pers.) Qu
el., M
em. Soc. 
Emul. Montb
eliard
s
er. 2, 5: 518. 1875.
Gloeosporium speiranthae (Henn.) Wollenw., Fusaria Autogr.
Delin. 1: 500. 1916.
Holotypus:InBfide Hein (1988).
Type locality:Germany, Berlin, botanical garden.
Type substrate: Leaves of Speirantha convallarioides.
Notes:Wollenweber (1916) studied and illustrated authentic
material of this species, recombining it in Gloeosporium. The
shape of the conidia is similar to species in the Colletotrichum
dematium species complex. However, the conidia are slightly
broader than those of the ex-type strain of C. dematium (3.5–4.5
vs 3–4μm, Damm et al. 2009); the synonymy needs to be
confirmed. Publication data cited in name repositories (Allg. Bot.
Z. Syst. 2: 83. 1896.) are incorrect and instead refer to the
protologue of F. seemenianum (syn. F. avenaceum), an unrelated
taxon.
speiseri Fusarium Lindau, Rabenh. Krypt.-Fl. Ed. 2, 1(9): 580.
1909.
(See Fusarium avenaceum).
Holotypus: B 70 0100195.
Type locality:Poland, Karthaus, Nýdek.
Type substrate: Dead Auchenorrhyncha (cicada).
Note: Synonym fide Wollenweber & Reinking (1935).
spermogoniopsis Fusarium Jul. Müll., Ber. Deutsch. Bot. Ges. 3:
394. 1885.
Hymenella spermogoniopsis (Jul. Müll.) L. Lombard & Sand.-
Den., comb. nov. MycoBank MB 837721.
Basionym:Fusarium spermogoniopsis Jul. Müll., Ber. Deutsch.
Bot. Ges. 3: 394. 1885.
Synonym:Hymenula spermogoniopsis (Jul. Müll.) Wollenw.,
Fusaria Autogr. Delin. 1: 483. 1916.
Syntypes: ?B 70 0100196, B 70 0100197 & B 700100198.
CROUS ET AL.
160

Type locality:Germany
Type substrate: Sporocarps of Phragmidium subcorticium (=
Phragmidium mucronatum) and on the uredo- and teliospores of
Phragmidium rubi (= Phragmidium barclayi).
Notes: Wollenweber (1916) provided a new combination for
F. spermogoniopsis in the genus Hymenula. However, the
generic name Hymenella (1822) predates the generic name
Hymenula (1828) and therefore we provide a new combination in
the latter genus.
sphaeriae Fusarium Fuckel, Fungi Rhen. Exs., Fasc. 3, no. 212.
1863.
(See Fusarium clematidis)
Lectotypus: G00111017, designated in Gr€
afenhan et al. (2011).
Lectotype locality:Germany, Hessen, Reichartshausen near
Oestrich-Winkel.
Lectotype substrate: Parasitic on Leptosphaeria (Sphaeria)dio-
ica,onUrtica dioica.
sphaeriiforme Fusarium Sacc. (as ‘sphaeriaeforme’), Syll. Fung.
10: 723. 1892.
Replaced synonym:Fusarium celtidis Pass., Atti Reale Accad.
Lincei, Rendiconti Cl. Sci. Fis., s
er. 4, 7: 51. 1891, nom. illegit.,
Art. 53.1.
(See Fusarium melanochlorum)
Holotypus: ?PARMA.
Type locality:Italy, Parma, Vigheffio.
Type substrate: Dead branches of Celtis australis.
Note: Synonyms fide Wollenweber & Reinking (1935).
sphaeroideum Fusarium Pass., Atti Reale Accad. Lincei, Ren-
diconti Cl. Sci. Fis., s
er. 4, 4: 105. 1888.
(See Fusarium lateritium)
Holotypus: ?PARMA.
Type locality:Italy, Parma.
Type substrate: Branch of Ficus carica.
Note: Synonym fide Wollenweber & Reinking (1935).
sphaerosporum Fusarium Q.T. Chen & X.H. Fu, Acta Mycol. Sin.,
Suppl. 1: 331. 1987.
Neocosmospora sphaerospora (Q.T. Chen & X.H. Fu) Sand.-
Den. & Crous, Persoonia 43: 173. 2019.
Holotypus: HMAS 43749.
Ex-type culture: NF 5840.
Type locality:China, Guangdong Province, Maoming.
Type substrate: Water from underground pipes of oilfield.
Descriptions and illustrations: See Chen et al. (1987).
spinaciae Fusarium Hungerf., Phytopathology 13: 209. 1923.
(See Fusarium oxysporum)
Lectotypus (hic designatus, MBT 10000744): USA, Idaho, roots
of Spinacia oleracea, 1923, C.W. Hungerford, in Phytopathology
13: 208, fig. 4.
Notes: Synonym fide Booth (1971). No holotype specimen could
be located and therefore an illustration was designated as
lectotype.
spinosum Fusarium L. Lombard et al., Fungal Syst. Evol. 4:
195. 2019.
Holotypus: CBS H-24020.
Ex-type culture: CBS 122438.
Type locality:Brazil.
Type substrate: Galia melon imported into the Netherlands.
Descriptions and illustrations: See Lombard et al. (2019a).
Diagnostic DNA barcodes:rpb1: MN120729; rpb2: MN120747;
tef1: MN120768.
spinulosum Fusarium (Pfenning) O'Donnell et al., Index Fun-
gorum 440: 4. 2020.
Neocosmospora spinulosa Pfenning, Sydowia 47: 66. 1995.
Holotypus: CBS H-5452a.
Ex-type culture: CBS 321.93.
Type locality:Brazil, Par
a, Capit~
ao Poço.
Type substrate: Soil under Theobroma cacao.
Descriptions and illustrations: See Pfenning (1995).
splendens Fusarium Matuo & Takah. Kobay., Trans. Mycol. Soc.
Japan 2(4): 13. 1960, nom. inval., Art. 39.1.
(See Fusarium matuoi)
Authentic material: Not located.
Original locality:Japan.
Original substrate: Twigs of Albizzia julibrissin.
Descriptions and illustrations: See Matuo & Kobayashi (1960)
and Hosoya & Tubaki (2004).
sporodochiale Fusarium L. Lombard & Crous, Fungal Syst.
Evol. 4: 196. 2019.
Holotypus: CBS H-12681.
Ex-type culture: ATCC 14167 = CBS 220.61 = MUCL
8047 = NRRL 20842.
Type locality:South Africa, Gauteng Province, Johannesburg.
Type substrate: Soil.
Descriptions and illustrations: See Lombard et al. (2019a).
Diagnostic DNA barcodes:rpb1: MN120731; rpb2: MN120749;
tef1: MN120770.
sporotrichiella Fusarium Bilaĭ, Yadovitye griby na zerne khleb-
nykh zlakov: 86. 1953, nom. inval., Art. 39.1.
(See Fusarium sporotrichioides)
Authentic material: Not located.
Original locality:Ukraine.
Original substrate: Unknown.
Descriptions and illustrations: See Bilaĭ(1955).
Notes: This taxon was published as a new name for all the taxa
in section Sporotrichiella. However, it is invalid as no type and
Latin diagnosis were provided. Synonym fide Gerlach &
Nirenberg (1982).
sporotrichioides Fusarium Sherb., Mem. Cornell Univ. Agric.
Exp. Sta. 6: 183. 1915.
Synonyms:Fusarium sporotrichiella var. sporotrichioides
(Sherb.) Bilaĭ,Yadovitye griby na zerne khlebnykh zlakov
(Poisonous fungi on cereal seed), Kiev: 87. 1953, nom.inval.,
Art. 39.1.
Fusarium sporotrichiella Bilaĭ,Yadovitye griby na zerne khleb-
nykh zlakov (Poisonous fungi on cereal seed), Kiev: 86. 1953,
nom.inval., Art. 39.1.
Fusarium sporotrichioides var. minus Wollenw., Fusaria Autogr.
Delin. 3: 886. 1930.
Fusarium sporotrichioides subsp. minus (Wollenw.) Raillo, Fungi
of the Genus Fusarium: 196. 1950.
Lectotypus (hic designatus, MBT 10000745): USA, New York,
rotten tubers of Solanum tuberosum, together with F. solani and
F. oxysporum, 1915, C.D. Sherbakoff, in Mem. Cornell Univ.
Agric. Exp. Sta. 6: 184, fig. 22.
Notes: This economically important species requires epi-
typification from the type locality and substrate. No holotype
FUSARIUM REDELIMITED
www.studiesinmycology.org 161

specimen could be located and therefore an illustration was
designated as lectotype.
staphyleae Fusarium Samuels & Rogerson, Brittonia 36: 84.
1984.
Geejayessia atrofusca (Schwein.) Schroers & Gr€
afenhan, Stud.
Mycol. 68: 126. 2011.
Basionym:Sphaeria atrofusca Schwein., Trans. Amer. Philos.
Soc., n.s. 4: 206. 1832.
Synonyms:Valsaria atrofusca (Schwein.) Cooke ex Sacc., Syll.
Fung. 9: 759. 1891.
Nectria atrofusca (Schwein.) Ellis & Everh., N. Amer. Pyren.: 99.
1892.
Pseudodiplodia atrofusca (Schwein.) Starb€
ack, Bih. Kongl.
Svenska Vetensk.-Akad. Handl. 19: 94. 1894.
Cucurbitaria atrofusca (Schwein.) Kuntze, Revis. Gen. Pl. 3: 460.
1898.
Creonectria atrofusca (Schwein.) Seaver, Mycologia 1: 186.
1909.
Holotypus:InNY.
Ex-type culture: ATCC 66906 = CBS 502.94 = IMI
345891 = NRRL 22120.
Type locality:USA, Massachusetts, Berkshire, south of Ashley
Falls, Bartholomew's Cobble.
Type substrate: Branches of Staphylea trifolia.
Descriptions and illustrations: See Samuels & Rogerson (1984)
and Schroers et al. (2011).
stercicola Fusarium

Si
si
cet al., Antonie van Leeuwenhoek 111:
1793. 2018.
Neocosmospora stercicola (
Si
si
cet al.) Sand.-Den. & Crous,
Persoonia 43: 173. 2019.
Synonyms:Fusarium martii var. viride Sherb., Mem. Cornell
Univ. Agric. Exp. Sta. 6: 247. 1915.
Fusarium solani var. martii ‘f. 1’Wollenw., Z. Parasitenk. (Berlin)
3: 290. 1931.
Fusarium witzenhausenense

Si
si
cet al., Antonie van Leeu-
wenhoek 111: 1795. 2018.
Fusarium xiangyunense F. Zhang et al. (as ‘xiangyunensis’),
Phytotaxa 450: 278. 2020. nom. inval., Art. 40.8.
Holotypus: CBS H-23352.
Ex-type culture: CBS 142481 = DSM 106211 = FS 89.
Type locality:Germany, Niedersachsen, Hannover.
Type substrate: Compost yard waste plant debris.
Descriptions and illustrations: See 
Si
si
cet al. (2018a).
Diagnostic DNA barcodes:rpb1: MW834255; rpb2: LR583887;
tef1: LR583658.
stercorarium Fusarium Rostr., Meddel. Grønland 18: 74. 1894.
Holotypus: C-F-92401
Type locality:Greenland, Vestfjord.
Type substrate: Dung of Rangifer tarandus (reindeer).
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
stercoris Fusarium Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 5: no.
1921. 1867 [and Jahrb. Nassauischen Vereins Naturk. 23–24:
369. 1870].
(See Fusarium avenaceum)
Lectotypus (hic designatus, MBT 10000746): Germany, Hessen,
Oestrich-Winkel, soil next to Peziza stercoraria, date unknown,
K.W.G.L. Fuckel, Fungi Rhen. Exs., Suppl., Fasc. 5: no. 1921 in
HAL.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore the exsiccate
lodged in HAL is designated as lectotype.
sterilihyphosum Fusarium Britz et al., Mycologia 94: 726.
2002.
Holotypus: PREM 57302.
Ex-type culture: NRRL 25623.
Type locality:South Africa, Limpopo Province, Tzaneen, Let-
sitele area.
Type substrate: Malformed inflorescence of Mangifera indica.
Descriptions and illustrations: See Britz et al. (2002) and Leslie &
Summerell (2006).
Diagnostic DNA barcodes:rpb1: MN193925; rpb2: MN193897;
tef1: MN193869.
sticticum Fusarium Berk. & M.A. Curtis, in Berkeley, Grevillea 3:
99. 1875.
(See Fusarium lateritium)
Holotypus: ?K(M).
Type locality:USA, South Carolina.
Type substrate: Twigs of Prunus persica.
Note: Synonym fide Wollenweber & Reinking (1935).
stictoides Fusarium Durieu & Mont., Explor. Sci. Alg
erie 1: 334.
1848.
(See Fusarium graminearum)
Holotypus: ?PC.
Type locality:Algeria.
Type substrate: Branch of flowering Agave sp.
Note: Synonym fide Wollenweber & Reinking (1935).
stilbaster Fusarium (Link) Link, Sp. pl., Ed. 4, 6: 106. 1825.
Atractium stilbaster Link, Mag. Ges. Naturf. Freunde, Berlin 3:
10. 1809.
Synonyms:Atractium fuscum Sacc., Syll. Fung. 2: 514. 1883.
Stilbella fusca (Sacc.) Seifert, Stud. Mycol. 27: 77. 1985.
Atractium flavoviride Sacc., Syll. Fung. 2: 514. 1883.
Stilbum madidum Peck, Rep. (Annual) New York State Mus. Nat.
Hist. 46: 115. 1894.
Didymostilbe eichleriana Bres. & Sacc., Atti Congr. Bot. Palermo:
59. 1903.
Didymostilbe obovoidea Matsush., Icon. Microfung. Matsush.
lect.: 60. 1975.
Lectotypus: Illustration published in Mag. Ges. Naturf. Freunde,
Berlin 3, tab. I, fig. 11, designated in Gr€
afenhan et al. (2011).
Epitypus: CBS 410.67 (preserved as metabolically inactive cul-
ture), designated in Gr€
afenhan et al. (2011).
Ex-epitype culture: CBS 410.67.
Epitype locality:Germany, Bayerischer Wald, Rachelseewand.
Epitype substrate: Bark.
Descriptions and illustrations: See Seifert (1985) and Gr€
afenhan
et al. (2011).
Diagnostic DNA barcodes:rpb1: KM232206; tef1: KM231920.
stilboides Fusarium Wollenw., Fusaria Autogr. Delin. 2: 615.
1924.
Synonyms:Fusarium lateritium var. stilboides (Wollenw.) Bilaĭ,
Fusarii (Biologija i sistematika): 266. 1955, nom. inval., Art. 41.5.
Fusarium lateritium var. stilboides (Wollenw.) Bilaĭ, Mikrobiol.
Zhurn. 49: 6. 1987.
Fusarium lateritium var. longum Wollenw., Fusaria Autogr. Delin.
1: 385. 1916.
CROUS ET AL.
162

Fusarium fructigenum var. minus Wollenw., Z. Parasitenk.
(Berlin) 3: 386. 1931.
Fusarium stilboides var. minus (Wollenw.) Wollenw., Z. Para-
sitenk. (Berlin) 3: 333. 1931.
Fusarium stilboides ‘f. 1’Raillo, Fungi of the Genus Fusarium:
271. 1950.
Gibberella stilboides W.L. Gordon ex C. Booth, The Genus
Fusarium: 119. 1971.
Lectotypus (hic designatus, MBT 10000747): Philippines, Los
Ba~
nos, living twigs of Citrus sp., invaded by coccids, 1917, O.A.
Reinking, in Fusaria Autogr. Delin. 2: 615.
Epitypus (hic designatus, MBT 10000748): Cook Islands,Citrus
sp., Sep. 1978, G.F. Laundon, CBS 746.79 (preserved as
metabolically inactive culture).
Ex-epitype culture: BBA 63887 = CBS 746.79 = ICMP
10624 = NRRL 25485.
Descriptions and illustrations: See Wollenweber (1924, 1930),
Wollenweber & Reinking (1935),Doidge (1938),Raillo (1950),
Booth (1971), and Gerlach & Nirenberg (1982).
Diagnostic DNA barcodes:rpb1: MW928817; rpb2: MW928832;
tef1: MW928843.
Note: No holotype specimen could be located and therefore an
illustration was designated as lectotype.
stillatum Fusarium De Not. ex Sacc., in Berlese & Voglino, Syll.
Fung., Addit. I–IV: 390. 1886.
Myxosporium stillatum (De Not. ex Sacc.) Wollenw., Fusaria
Autogr. Delin. 1: 490. 1916.
Lectotypus (hic designatus, MBT 10000749): Italy,
Valle Intrasca, at the bridge on Possaccio, dried stems of Genista
tinctoria, 1862, G. de Notaris, S-F45664 [Baglietto, Cesati &
Notaris, Erb. Critt. Ital. Ser. I no. 148 (1148)].
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore the exsiccate
lodged in S is designated as lectotype.
stoveri Fusarium C. Booth, The Genus Fusarium: 37. 1971.
Microdochium stoveri (C. Booth) Samuels & I.C. Hallett, Trans.
Brit. Mycol. Soc. 81: 481. 1983.
Basionym:Micronectriella stoveri C. Booth, Mycol. Pap. 94: 3.
1964.
Synonym:Monographella stoveri (C. Booth) Samuels & I.C.
Hallett, Trans. Brit. Mycol. Soc. 81: 473. 1983.
Holotypus: IMI 92905.
Type locality:Honduras.
Type substrate: Leaf of Musa sp.
Descriptions and illustrations: See Booth (1964,1971),Gerlach
& Nirenberg (1982) and Samuels & Hallet (1983).
striatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta. 6:
255. 1915.
(See Fusarium solani-melongenae)
Typus: ?CUP-007460.
Type locality:USA, Colorado
Type substrate:Solanum tuberosum.
Notes: Synonym fide Nirenberg & Brielmaiers-Liebetanz, 1996
and Sandoval-Denis et al. (2019). Lectotypification pending
study of material lodged in CUP.
strobilinum Fusarium Corda, Icon. Fung. 1: 4. 1837.
Sirococcus conigenus (Pers.) P.F. Cannon & Minter, Taxon 32:
577. 1983.
Basionym:Hysterium conigenum Pers., Ann. Bot. (Usteri) 15: 30.
1795.
Synonyms:Hypoderma conigenum (Pers.) DC., Fl. Franç., ed. 3,
2: 305. 1805.
Hypodermopsis conigena (Pers.) Kuntze, Revis. Gen. Pl. 3: 487.
1898.
Discella conigena (Pers.) Höhn., Mitt. Bot. Inst. T. H. Wien 6: 120.
1929.
Ascochyta strobilina (Corda) Wollenw., Fusaria Autogr. Delin. 1:
505. 1916.
Sphaeria strobilina Holl & J.C. Schmidt, Deutschl. Schw€
amme,
Erste Lieferung: 4. 1815, nom. inval., Art. 38.1(a).
Sphaeria strobilina Holle & J.C. Schmidt ex Fr., Syst. Mycol. 2:
495. 1823.
Dichaena strobilina (Holle & J.C. Schmidt ex Fr.) Fr., Summa
Veg. Scand. 2: 403. 1849.
Sporonema strobilinum Desm., Ann. Sci. Nat., Bot., s
er. 3, 18:
368. 1852.
Plenodomus strobilinus (Desm.) Höhn., Sitzungsber. Kaiserl.
Akad. Wiss. Wien, Math.-Naturwiss. Cl., Abt. 1, 119: 647. 1910.
Discella strobilina (Desm.) Died., Krypt.-Fl. Brandenburg 9: 752.
1914.
Sirococcus strobilinus (Desm.) Petr., Sydowia 1: 155. 1947, nom.
illegit., Art. 53.1.
Sirococcus strobilinus Preuss, Linnaea 26: 716. 1855.
Phoma conigena P. Karst., Rev. Mycol. (Toulouse) 7: 106. 1885.
Septoria parasitica R. Hartig, Z. Forst- Jagdwesen 1890: 1. 1890.
Diplodina parasitica (R. Hartig) Prill., Maladies des Plantes
Agricoles 2: fig. 365. 1897.
Ascochyta parasitica Fautrey, Rev. Mycol. (Toulouse) 13: 79.
1891.
Ascochyta piniperda Lindau, Nat. Pflanzenfam., Teil. I, 1: 367.
1900.
Phoma conigena var. abieticola Sacc., Ann. Mycol. 3: 233. 1905.
Typus: In PRM fide Pilat (1938).
Type locality:Czech Republic, near Liberec (Reichenberg).
Type substrate: Rotten cone scales of Pinus sp.
Note: Typification pending study of material lodged in PRM.
stromaticola Fusarium Henn., Bot. Jahrb. Syst. 28: 280. 1900.
Dialonectria volutella (Ellis & Everh.) L. Lombard & Sand.-
Den., comb. nov.MycoBank MB 837722.
Basionym:Fusarium volutella Ellis & Everh., Proc. Acad. Nat.
Sci. Philadelphia 43: 93. 1891.
Synonyms:Fusarium aquaeductuum var. medium Wollenw.,
Fusaria Autogr. Delin. 3: 844. 1930.
Fusarium aquaeductuum subsp. medium (Wollenw.) Raillo,
Fungi of the Genus Fusarium: 278. 1950.
Dialonectria ullevolea Seifert & Gr€
afenhan, Stud. Mycol. 68: 97.
2011.
Holotypus:InBfide Hein (1988).
Type locality:Japan, Tokyo.
Type substrate: Old stroma of Dothideaceae,onBambusa sp.
branches with Zythia stromaticola.
Notes: Synonym fide Wollenweber & Reinking (1935) and
Gr€
afenhan et al. (2011). The older epithet ‘volutella’(1891) su-
persedes the epithet ‘ullevolea’(2011) and, therefore, a new
combination is provided.
stromaticum Fusarium Delacr., Bull. Soc. Mycol. France 9: 186.
1893.
(See Fusarium heterosporum)
Holotypus: ?PC.
Type locality:France, overseas department of Mayotte, Mayotte
islands.
FUSARIUM REDELIMITED
www.studiesinmycology.org 163

Type substrate: Seeds of unknown Poaceae (= Gramineae).
Note: Synonym fide Wollenweber & Reinking (1935).
subcarneum Fusarium P. Crouan & H. Crouan, Fl. Finist
ere: 14.
1867, nom. rej.
(See Fusarium sambucinum)
Authentic material: ?PC.
Original locality:France, Brittany, Finist
ere, marshes.
Original substrate: Twigs and dead leaves of Ulex sp.
Note: Synonym fide Wollenweber & Reinking (1935).
subcorticale Fusarium Oudem., Ned. Kruidk. Arch., s
er. 3, 3:
135. 1898.
(See Fusarium buxicola)
Holotypus: ?L.
Type locality:Netherlands, Zuid-Holland Province, Zorgvliet.
Type substrate:Buxus sempervirens.
Note: Synonym fide Wollenweber & Reinking (1935).
subglutinans Fusarium (Wollenw. & Reinking) P.E. Nelson
et al.,Fusarium species. An illustrated manual for identification:
135. 1983.
Basionym:Fusarium moniliforme var. subglutinans Wollenw. &
Reinking, Phytopathology 15: 163. 1925.
Synonyms:Fusarium moniliforme f. subglutinans (Wollenw. &
Reinking) C. Moreau, Rev. Mycol. (Paris) 17: 23. 1952.
Fusarium sacchari var. subglutinans (Wollenw. & Reinking) Nir-
enberg, Mitt. Biol. Bundesanst. Land- Forstw. 169: 53. 1976.
Gibberella fujikuroi var. subglutinans (Wollenw. & Reinking) E.T.
Edwards, Agric. Gaz. New South Wales 44: 895. 1933 (Art. F.8.1,
Note 2, Exs. 2).
Gibberella subglutinans (Wollenw. & Reinking) P.E. Nelson et al.,
Fusarium species. An illustrated manual for identification (Uni-
versity Park): 135. 1983.
Neotypus: CBS 747.97 (preserved as metabolically inactive
culture), designated by Yilmaz et al. (2021).
Ex-neotype culture: BBA 62451 = CBS 747.97 = DAOM
225141 = FRC M-36 = MRC 8554 = NRRL 22016 = NRRL
22114.
Neotype locality:USA, Illinois, Saint Elmo.
Neotype substrate:Zea mays.
Descriptions and illustrations: See Booth (1971),Nirenberg
(1976,1981),Nelson et al. (1983),Pascoe (1990),Leslie &
Summerell (2006).
Diagnostic DNA barcodes:rpb1: JX171486; rpb2: JX171599;
tef1: HM057336.
sublunatum Fusarium Reinking, Zentralbl. Bakteriol., 2. Abt.
89: 510. 1934.
Synonyms:Fusarium elongatum Reinking, Zentralbl. Bakteriol.
Parasitenk., Abt. 2, 89: 511. 1934, nom. illegit., Art. 53.1.
Fusarium sambucinum var. sublunatum (Reinking) Bilaĭ, Mikro-
biol. Zhurn. 49: 6. 1987, nom. inval., Art. 41.4, Note 1.
Lectotypus (hic designatus, MBT 10000750): Costa Rica,
Limon, soil in Musa sapientum plantation, 1933, O.A. Reinking,
CBS 189.34 (preserved as metabolically inactive culture).
Ex-type culture: BBA 62431 = CBS 189.34 = DSM
62431 = NRRL 13384 = NRRL 20840.
Descriptions and illustrations: See Gerlach & Nirenberg (1982).
Diagnostic DNA barcodes:rpb1: JX171451; rpb2: KX302935;
tef1: KX302919.
Notes: No holotype specimen could be located for F. sublunatum
and therefore the metabolically inactive culture CBS 189.34 (=
IMB 5238), which represents the ex-type culture (Gerlach &
Nirenberg 1982), is designated as lectotype.
subnivale Fusarium Höhn., in Penther & Zederbauer, Ann. K. K.
Naturhist. Hofmus. 20: 369. 1905.
(See Fusarium dimerum)
Holotypus: FH00965354.
Type locality:Turkey, Anatolia.
Type substrate: Stems and leaves of decayed Astragalus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
subpallidum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp.
Sta. Mem. 6: 230. 1915.
(See Fusarium sambucinum)
Typus: ?CUP-007480.
Type locality:USA, Louisiana, Edgerton.
Type substrate:Solanum tuberosum.
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in CUP.
subtectum Fusarium Roberge ex Desm., Pl. Crypt. N. France,
ed. 1, Fasc. 29, no. 1428. 1845.
Rhodesia subtecta (Roberge ex Desm.) Grove, British Stem-
and Leaf-Fungi (Coelomycetes) 2: 205. 1937.
Synonyms:Myxosporina subtecta (Roberge ex Desm.) Höhn., in
Weese, Ber. Deutsch. Bot. Ges. 37: 155. 1919, nom. inval., Art.
35.1.
Myxosporina subtecta (Roberge ex Desm.) Höhn., Mitt. Bot. Inst.
Tech. Hochsch. Wien 4: 74. 1927.
Hainesia subtecta (Roberge ex Desm.) Grove, J. Bot. 70: 4.
1932.
Hymenula psammae Oudem., Ned. Kruidk. Arch., s
er. 3, 1: 533.
1898. (fide Wollenweber & Reinking 1935).
Syntypes: Pl. Crypt. N. France no. 1428 in ?BRU, PC & PH.
Type locality:France.
Type substrate: Dead leaves of Arundo arenaria.
subtropicale Fusarium C. Pereira et al., Mycologia 110: 864.
2018.
Holotypus: BPI 910644.
Ex-type culture: CBS 144706 = NRRL 66764.
Type locality:Brazil, Paran
a State, Guarapuava.
Type substrate:Hordeum vulgare.
Descriptions and illustrations: See Pereira et al. (2018).
Diagnostic DNA barcodes:rpb1: MH706972; rpb2: MH706973;
tef1: MH706974.
subulatum Fusarium Appel & Wollenw., Arbeiten Kaiserl. Biol.
Anst. Land- Forstw. 8: 131. 1913.
Replaced synonym:Fusarium roseum var. lupini-albi Sacc.,
Michelia 2: 295. 1881.
(See Fusarium avenaceum)
Holotypus: Not located.
Type locality:Italy, Selva.
Type substrate:Lupinus albus.
Note: Synonyms fide Wollenweber & Reinking (1935).
subviolaceum Fusarium Roum. & Fautrey, Fungi Sel. Gall. Exs.
no. 6022. 1892.
(See Fusarium avenaceum)
Syntype: ILL0020193 (Fungi Sel. Gall. Exs. no. 6022).
Type locality:France, Jardin de Noidan.
Type substrate: Dry stems of Asparagus officinalis.
Note: Synonym fide Wollenweber & Reinking (1935).
CROUS ET AL.
164

succisae Fusarium Schröt. ex Sacc., Syll. Fung. 10: 724. 1892.
Synonym:Fusisporium succisae J. Schröt., Hedwigia 13: 180.
1874, nom. inval., Art. 36.1(a).
Lectotypus: ILL00076313 (Thümen, Mycoth. Univ. no. 675),
designated by Yilmaz et al. (2021).
Lectotype locality:Germany, Bavaria, Borussia.
Lectotype substrate:Succisa pratensis.
Epitypus: IMI 202876, designated by Yilmaz et al. (2021).
Ex-epitype culture: BBA 12287 = BBA 63627 = CBS
219.76 = DAOM 225142 = IMI 202876 = IMI 375347 = NRRL
13613.
Epitype locality:Germany.
Epitype substrate:Succisa pratensis.
Descriptions and illustrations: See Nirenberg (1976),Gerlach &
Nirenberg (1982).
Diagnostic DNA barcodes:rpb1: LT996207; rpb2: LT970764.
sudanense Fusarium S.A. Ahmed et al., Antonie van Leeu-
wenhoek 110: 826. 2017.
Holotypus: CBS H-22547.
Ex-type culture: CBS 454.97.
Type locality:Sudan.
Type substrate: Plant debris of Striga hermonthica.
Descriptions and illustrations: See Moussa et al. (2017).
Diagnostic DNA barcodes:rpb1: LT996208; rpb2: LT996155;
tef1: KU711697.
sulawesiense Fusarium Maryani et al. (as ‘sulawense’), Per-
soonia 43: 65. 2019.
Holotypus: InaCC F940 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F940.
Type locality:Indonesia, South Sulawesi, Bone, Kecamatan
Bengo, Desa Selli.
Type substrate: Infected pseudostem of Musa acuminata var.
Pisang Cere (AAA).
Descriptions and illustrations: See Maryani et al. (2019b).
Diagnostic DNA barcodes:rpb2: LS479855; tef1: LS479443.
sulphureum Fusarium Schltdl., Fl. Berol. 2: 139. 1824, nom. rej.
(See Fusarium sambucinum)
Holotypus: HAL 1613 F.
Type locality:Germany, Berlin.
Type substrate: Rotting tuber of Solanum tuberosum.
Note: Synonym fide Wollenweber & Reinking (1935).
suttonianum Fusarium (Sand.-Den. & Crous) O'Donnell et al.,
Index Fungorum 440: 4. 2020.
Neocosmospora suttoniana Sand.-Den. & Crous, Persoonia
41: 123. 2018.
Holotypus: CBS H-23224.
Ex-type culture: CBS 143214 = FRC S-1423 = NRRL 32858.
Type locality:USA, Louisiana.
Type substrate:Homo sapiens.
Descriptions and illustrations: See Sandoval-Denis & Crous
(2018).
Diagnostic DNA barcodes:rpb1: MW218138; rpb2: EU329630;
tef1: DQ247163.
tabacinum Fusarium (J.F.H. Beyma) W. Gams, Persoonia 5: 179.
1968.
Basionym:Cephalosporium tabacinum J.F.H. Beyma, Zentralbl.
Bakteriol. 2. Abt. 89: 240. 1933.
Plectosphaerella cucumerina (Lindf.) W. Gams, in Domsch &
Gams, Fungi in Agricultural Soils: 160. 1972.
Basionym:Venturia cucumerina Lindf., Meddn Centralanst.
Försksv. Jordbruksomr. Bot. Avd. 17: 7. 1919.
Synonyms:Monographella cucumerina (Lindf.) Arx, Trans. Brit.
Mycol. Soc. 83: 374. 1984.
Microdochium tabacinum (J.F.H. Beyma) Arx, Trans. Brit. Mycol.
Soc. 83: 374. 1984.
Plectosporium tabacinum (J.F.H. Beyma) M.E. Palm, W. Gams &
Nirenberg, Mycologia 87: 399. 1995.
Plectosphaerella cucumeris Kleb., Phytopathol. Z. 1: 43. 1929.
Micronectriella cucumeris (Kleb.) C. Booth, The Genus Fusa-
rium: 39. 1971.
Cephalosporium ciferrii Verona, Studio sulle cause microbiche
che danneggiano la carta ed i libri: 30. 1939.
Cephalosporiopsis imperfecta M. Moreau & Moreau, Rev. Mycol.
(Paris) 6: 67. 1941, nom. inval., Art. 39.1.
Neotypus: CBS H-7656, designated in Palm et al. (1995).
Ex-neotype culture: CBS 137.33 = MUCL 9701 = NRRL 22455.
Neotype locality:UK, England, Bristol.
Neotype substrate: Stems of Nicotiana tabacum.
Descriptions and illustrations: See Domsch et al. (2007),Carlucci
et al. (2012),Giraldo & Crous (2019).
tabacivorum Fusarium Delacr., Ann. Inst. Natl. Agron., ser. 2, 5:
207. 1906.
(See Fusarium oxysporum)
Holotypus: ?PC.
Type locality:France,P

erigueux, Razac-sur-l'Isle.
Type substrate:Nicotiana tabacum.
Note: Synonym fide Wollenweber & Reinking (1935).
tanahbumbuense Fusarium Maryani et al., Persoonia 43: 63.
2019.
Holotypus: InaCC F965 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F965.
Type locality:Indonesia, South Kalimantan, Tanah Bumbu,
Kecamatan Kusan Hilir, Desa Betung.
Type substrate: Pseudostem of Musa var. Pisang Hawa.
Descriptions and illustrations: See Maryani et al. (2019b).
Diagnostic DNA barcodes:rpb1: LS479877; rpb2: LS479863;
tef1: LS479448.
tardichlamydosporum Fusarium Maryani et al., Stud. Mycol.
92: 181. 2018 [2019].
Holotypus: InaCC F958 (preserved as metabolically inactive
culture).
Ex-type culture: InaCC F958.
Type locality:Indonesia, East Nusa Tenggara, Sikka Flores,
Desa Kota Uneng Kecamatan Alok.
Type substrate: Pseudostem of Musa acuminata var. Pisang
Barangan.
Descriptions and illustrations: See Maryani et al. (2019a).
Diagnostic DNA barcodes:rpb1: LS479534; rpb2: LS479280;
tef1: LS479729.
tardicrescens Fusarium Maryani et al., Persoonia 43: 69. 2019.
Synonym:Fusarium tardicrescens Maryani et al., Stud. Mycol.
92: 185. 2018 [2019], nom. inval., Art. 40.7.
Holotypus: CBS 102024 (preserved as metabolically inactive
culture).
FUSARIUM REDELIMITED
www.studiesinmycology.org 165

Ex-type culture: CBS 102024 = NRRL 36113.
Type locality:Malawi, Karonga, Misuku Hills.
Type substrate:Musa sapientum cv. Harare.
Descriptions and illustrations: See Maryani et al. (2019b).
Diagnostic DNA barcodes:rpb1: LS479474; rpb2: LS479217;
tef1: LS479665.
tasmaniense Fusarium (McAlpine) Rossman (as ‘tasmanica’),
Mycol. Pap. 150: 54. 1983.
Basionym:Microcera tasmaniensis McAlpine, J. Dept. Agric.
Victoria 2: 647. 1904.
Synonyms:Discofusarium tasmaniense (McAlpine) Petch,
Trans. Brit. Mycol. Soc. 7: 143, 165. 1921.
Microcera myrtilaspis McAlpine, J. Dept. Agric. Victoria 2: 647.
1904.
Calonectria coccidophaga Petch, Trans. Brit. Mycol. Soc. 7: 161.
1921.
Nectria coccidophaga (Petch) Rossman, Mycotaxon 8: 499.
1979.
Holotypus: VPRI 2744.
Type locality:Australia, Tasmania.
Type substrate: Parasitic on Aspidiotus sp. (scale) on Eucalyptus
bark.
Descriptions and illustrations: See Rossman (1983).
Notes: Status unclear. Rossman (1983) studied the specimen in
K(M) and recombined the asexual morph name in Fusarium,
which is not supported by the features of the sexual-morph. This
species most likely belongs to Microcera as originally specified
by McAlpine (1904).
temperatum Fusarium Scaufl. & Munaut, Mycologia 103: 593.
2011.
Holotypus: MUCL 52463-H.
Ex-type culture: MUCL 52463.
Type locality:Belgium, Waals-Brabant Province, Chastre.
Type substrate:Zea mays.
Descriptions and illustrations: See Scauflaire et al. (2011).
Diagnostic DNA barcode:tef1: KM487197.
tenellum Fusarium Sacc. & Briard, Rev. Mycol. (Toulouse) 7:
212. 1885.
(See Fusarium sambucinum)
Holotypus: Not located.
Type locality:France, Troyes.
Type substrate: Rotten stem of Brassica oleracea.
Note: Synonym fide Wollenweber & Reinking (1935).
tenue Fusarium Corda, Icon. Fung. 1: 3. 1837.
(See Fusarium avenaceum)
Typus: In PRM fide Pilat (1938).
Type locality:Czech Republic, near Prague.
Type substrate: Rotting stem of an unidentified host.
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of material lodged in PRM.
tenuicristatum Fusarium (S. Ueda & Udagawa) O'Donnell et al.,
Index Fungorum 440: 4. 2020.
Basionym:Neocosmospora tenuicristata S. Ueda & Udagawa,
Mycotaxon 16: 387. 1983.
Synonym:Acremonium tenuicristatum S. Ueda & Udagawa,
Mycotaxon 16: 387. 1983.
Holotypus: NHL 2911.
Type locality:Japan, Nagasaki.
Type substrate: Marine sludge.
Descriptions and illustrations: See Ueda & Udagawa (1983).
Notes: Status unclear. See Sandoval-Denis et al. (2019).
tenuissimum Fusarium (Peck) Sacc., Syll. Fung. 4: 711. 1886.
Basionym:Fusisporium tenuissimum Peck, Rep. (Annual) New
York State Mus. Nat. Hist. 34: 48. 1883. 1881.
(See Fusarium sambucinum)
Holotypus: NYSf3163.
Type locality:USA, New York, Schenectady.
Type substrate: Dead stem of unidentified host.
Note: Synonyms fide Wollenweber & Reinking (1935).
tenuistipes Fusarium Sacc., Atti Mem. Reale Accad. Sci. Lett.
Arti, Padova 33: 195. 1917.
(See Fusarium incarnatum)
Holotypus: In PAD.
Type locality:Unknown.
Type substrate:Pennisetum spicatum.
Note: Synonym fide Wollenweber & Reinking (1935).
terrestre Fusarium Manns, Bull. North Dakota Agric. Exp. Sta.:
no. 259. 1932.
(See Fusarium equiseti)
Holotypus: Not located.
Type locality:USA, North Dakota.
Type substrate: Soil.
Note: Synonym fide Wollenweber & Reinking (1935).
terricola Fusarium Al-Hatmi et al., Antonie van Leeuwenhoek
110: 826. 2017.
Holotypus: CBS H-22548.
Ex-type culture: CBS 483.94.
Type locality:Australia, Queensland.
Type substrate: Desert soil.
Descriptions and illustrations: See Moussa et al. (2017).
Diagnostic DNA barcodes:rpb1: LT996209; rpb2: LT996156;
tef1: KU711698.
thapsinum Fusarium Klittich et al., Mycologia 89: 644. 1997.
Synonym:Gibberella thapsina Klittich et al., Mycologia 89: 643.
1997.
Holotypus: BPI 737885.
Ex-type culture: ATCC 200522 = CBS 777.96 = FRC M-6564.
Type locality:USA, Kansas.
Type substrate: Stalk of Sorghum sp.
Descriptions and illustrations: See Klittich et al. (1997).
Diagnostic DNA barcodes:rpb1: MW928818; rpb2: MW928833;
tef1: MW928844.
theobromae Fusarium Appel & Strunk, Centralbl. Bacteriol., 2.
Abth., 11: 635. 1904.
Neocosmospora theobromae (Appel & Strunk) Sand.-Den. &
Crous, Persoonia 43: 174. 2019.
Synonyms:Fusarium javanicum var. theobromae (Appel &
Strunk) Wollenw., Z. Parasitenk. (Berlin) 3: 483. 1931.
Neotypus: BPI 453072, designated in Sandoval-Denis et al.
(2019).
Type locality:Cameroon, Victoria.
Type substrate: Fruits and seeds of Theobroma cacao.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcode:tef1: LR583660.
Notes: This Fusarium name was recently resurrected, neo-
typified, and transferred to Neocosmospora by Sandoval-Denis
et al. (2019). DNA barcodes were generated from the neotype
CROUS ET AL.
166

specimen; however, fresh collections are needed for
epitypification.
theobromae Fusarium M.L. Lutz, Bull. Soc. Bot. France 53: L.
1907 [1906], nom. illegit., Art. 53.1.
Diplocladium theobromae Sacc. & Trotter, Syll. Fung. 22:
1309. 1913.
Authentic material: Not located.
Original locality:Democratic Republic of S~
ao Tom
e and
Príncipe.
Original substrate: Fermented beans of Theobroma cacao.
Note: Originally erroneously assigned to the genus Fusarium.
thevetiae Fusarium Tassi, Atti Reale Accad. Fisiocrit. Siena, s
er.
4, 8: 238. 1897.
Holotypus: ?SIENA.
Type locality:India.
Type substrate:Thevetia venenifera.
Notes: Status unclear. A doubtful species fide Wollenweber &
Reinking (1935).
thuemenii Fusarium Sacc., Syll. Fung. 4: 722. 1886.
Replaced synonym:Fusarium parasiticum Thüm., Nuovo Giorn.
Bot. Ital. 12: 198. 1880, nom. illegit., Art. 53.1.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:Russia, Orenburg.
Type substrate: Rotten branches of Betula verrucosa (= Betula
pendula).
Note: Synonym fide Wollenweber & Reinking (1935).
tjaetaba Fusarium T.T.H. Vu et al., Fungal Diversity 77: 361.
2015 [2016].
Holotypus: RBG 5361.
Ex-type culture: FRL14350 = NRRL 66243 = RBG 5361.
Type locality:Australia, Northern Territory, Litchfield National
Park.
Type substrate:Sorghum interjectum.
Descriptions and illustrations: See Laurence et al. (2016).
Diagnostic DNA barcodes:rpb1: KP083267; rpb2: KP083275;
tef1: KP083263.
tjaynera Fusarium J.L. Walsh et al., Fungal Diversity 77: 361.
2015 [2016].
Holotypus: RBG 5367.
Ex-type culture: NRRL 66246 = RBG 5367.
Type locality:Australia, Northern Territory, Litchfield National
Park.
Type substrate:Triodia microstachya.
Descriptions and illustrations: See Laurence et al. (2016).
Diagnostic DNA barcodes:rpb1: KP083268; rpb2: KP083279;
tef1: EF107152.
tomentosum Fusarium Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10:
359. 1868 [1869].
Holotypus: In K(M).
Type locality:Cuba.
Type substrate: Dead sticks.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
tonkinense Fusarium (Bugnic.) O'Donnell et al., Index Fungorum
440: 4. 2020.
Neocosmospora tonkinensis (Bugnic.) Sand.-Den. & Crous,
Persoonia 41: 126. 2018.
Basionym:Cylindrocarpon tonkinense Bugnic., Encyclop.
Mycol.11: 181. 1939.
Synonym:Fusarium ershadii M. Papizadeh et al., Europ. J. Pl.
Pathol. 151: 693. 2018, nom. illegit., Art. 52.1.
Holotypus: IMI 113868.
Ex-type culture: CBS 115.40 = IMI 113868.
Type locality:Vietnam, Tonkin.
Type substrate:Musa sapientum.
Diagnostic DNA barcodes:rpb1: MW218140; rpb2: LT960564;
tef1: LT906672.
torreyae Fusarium T. Aoki et al., Mycologia 105: 314. 2013.
Holotypus: BPI 884050.
Ex-type culture: CBS 133858 = MAFF 243468 = NRRL 54151.
Type locality:USA, Florida, Liberty County, Torreya State Park,
Aspalaga Tract.
Type substrate: Stem tissue of diseased Torreya taxifolia.
Descriptions and illustrations: See Aoki et al. (2013).
Diagnostic DNA barcodes:rpb1: MW928819; rpb2: MW928834;
tef1: MW928845.
tortuosum Fusarium Thüm. & Pass., Pilze Weinst.: 51. 1878.
Neofabraea vagabunda (Desm.) P.R. Johnst., IMA Fungus 5:
103. 2014.
Basionym:Phlyctema vagabunda Desm., Ann. Sci. Nat., Bot.,
s
er. 3, 8: 16. 1847.
Synonyms:Rhabdospora vagabunda (Desm.) Zerov, Viznachnik
gribiv Ukraini. T. 3. Nezaversheni gribi: 501. 1971, nom. inval.,
Art. 41.1.
Rhabdospora vagabunda (Desm.) R.S. Mathur, Coelomycetes of
India: 234. 1979.
Gloeosporium tortuosum (Thüm. & Pass.) Sacc., Michelia 2: 117.
1880.
Myxosporium tortuosum (Thüm. & Pass.) Allesch., Rabenh.
Krypt.-Fl., Ed. 2, 1(7): 534. 1903.
?Fusarium obtusatum Corda, Icon. Fung. 1: 3. 1837.
Fusarium bipunctatum Preuss, Linnaea 25: 741. 1852.
Lituaria riessii Schulzer, Verh. K. K. Zool.-Bot. Ges. Wien 21:
1241. 1871.
Gloeosporium riessii (Schulzer) Schulzer & Sacc., Hedwigia 23:
110. 1884.
Gloeosporium tineum Sacc., Michelia 1: 219. 1878.
Gloeosporium frigidum Sacc., Michelia 2: 168. 1880.
Cylindrosporium frigidum (Sacc.) Vassiljevsky, Fungi Imperfecti
Parasitici 2: 515. 1950.
Gloeosporium pyrenoides Sacc. & Malbr., in Saccardo, Michelia
2: 633. 1882.
Gloeosporium phillyreae Pass., Atti Reale Accad. Lincei, Ren-
diconti Cl. Sci. Fis., s
er. 4, 4: 103. 1888.
Gloeosporium allantosporum Fautrey, Rev. Mycol. (Toulouse) 14:
97. 1892.
Gloeosporium allantoideum Peck, Rep. (Annual) Regents Univ.
State New York New York State Mus. 45: 81. 1893.
Gloeosporium alutaceum Sacc., Malpighia 11: 317. 1897.
Allantozythia alutacea (Sacc.) Höhn., Ann. Mycol. 22: 203. 1924.
Phlyctema alutacea (Sacc.) Petr., Ann. Mycol. 27: 370. 1929.
Fusarium japonicum Allesch., Beibl. Hedwigia 36: (164). 1897.
Gloeosporium unedonis Traverso, R.C. Congr. Bot. Palermo,
1902: 3 (extr.). 1902.
Trichoseptoria fructigena Maubl., Bull. Trimestriel Soc. Mycol.
France 21: 95. 1905.
Gloeosporium beguinotii Sacc., in Potebnia, Ann. Mycol. 5: 20.
FUSARIUM REDELIMITED
www.studiesinmycology.org 167

1907.
Cylindrosporium olivae Petri, Ann. Mycol. 5: 324. 1907.
Gloeosporium olivae (Petri) Foschi, Ann. Sperim. Agrar, n.s. 9:
911. 1955.
Gloeosporium album Osterw., Centralbl. Bacteriol. Parasitenk.,
2. Abth., 18: 826. 1907.
Gloeosporium diervillae Grove, J. Bot. 60: 145. 1922.
Pezicula alba E.J. Guthrie, Trans. Brit. Mycol. Soc. 42: 504. 1959.
Neofabraea alba (E.J. Guthrie) Verkley, Stud. Mycol. 44: 125.
1999.
Holotypus: ?PARMA.
Type locality:Italy, Parma.
Type substrate: Dry twigs of Vitis vinifera.
Note: Synonyms fide Wollenweber & Reinking (1935).
torulosum Fusarium (Berk. & M.A. Curtis) Gruyter & J.H.M.
Schneid., Jaarb. Plantenziektenkundige Dienst, Wageningen
1989/1990, no. 168: 135. 1991, nom. inval., Art. 41.4.
Basionym:Fusidium torulosum Berk. & M.A. Curtis, Grevillea 3:
112. 1875.
(See Fusarium torulosum (Berk. & M.A. Curtis) Nirenberg)
torulosum Fusarium (Berk. & M.A. Curtis) Nirenberg, Myco-
pathologia 129: 136. 1995.
Basionym:Fusidium torulosum Berk. & M.A. Curtis, Grevillea 3:
112. 1875.
Synonyms:Fusoma torulosum (Berk. & M.A. Curtis) Sacc., Syll.
Fung. 4: 220. 1886.
Fusarium torulosum (Berk. & M.A. Curtis) Gruyter & J.H.M.
Schneid., Jaarboek. Plantenziektenkundige Dienst. Wageningen
1989/1990 no. 168: 135. 1991, nom. inval., Art. 41.4.
Fusarium sclerodermatis Oudem., Nederl. Kruidk. Arch. ser. 2, 5:
516. 1889.
Fusarium sambucinum var. coeruleum Wollenw., Ann. Mycol. 15:
55. 1917.
?Gibberella pulicaris var. minor Wollenw., Z. Parasitenk. (Berlin)
3: 356. 1931.
Syntype: ?Car Inf. no. 6034. in K(M).
Type locality:USA, Pennsylvania, Michener.
Type substrate: Decaying Brassica stalks or Pinus.
Descriptions and illustrations: See Nirenberg (1995).
toxicum Fusarium L. Lombard & J.W. Xia, Persoonia 43: 220.
2019.
Holotypus: CBS H-24071.
Ex-type culture: CBS 406.86 = FRC R-8507 = IMI
309347 = NRRL 25796.
Type locality:Germany, Berlin.
Type substrate: Soil.
Descriptions and illustrations: See Xia et al. (2019).
Diagnostic DNA barcodes:rpb2: MN170441; tef1: MN170508.
tracheiphilum Fusarium (E.F. Sm.) Wollenw., Phytopathology 3:
29. 1913.
Basionym:Neocosmospora vasinfecta var. tracheiphila E.F. Sm.,
Bull. Div. Veg. Physiol. Pathol. U.S.D.A. 17: 45. 1899.
(See Fusarium neocosmosporiellum)
Syntypes: IN BPI, F, FLAS, ISC, MICH, PUL, UC & WSP.
Type locality:USA, South Carolina, James Island.
Type substrate: Dead stem of Vigna sinensis.
Note: Published as a new name for the sporodochial morph
found on the authentic material of N. vasinfecta var. tracheiphila.
translucens Fusarium Berk. & Broome, Ann. Mag. Nat. Hist., ser.
4, 17: 141. 1876.
Holotypus: ?K(M).
Type locality:UK, Scotland, Glamis.
Type substrate: Wood.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
transvaalense Fusarium Sand.-Den. et al., MycoKeys 34: 82.
2018.
Holotypus: CBS H-23497.
Ex-type culture: CBS 144211.
Type locality:South Africa, Kruger National Park, Skukuza,
Granite Supersite.
Type substrate: Rhizosphere of Sida cordifolia.
Descriptions and illustrations: See Sandoval-Denis et al.
(2018b).
Diagnostic DNA barcodes:rpb1: LT996210; rpb2: LT996157;
tef1: LT996099.
tremelloides Fusarium Grev., Scott. Crypt. Fl. 1: 10. 1822.
Calloria tremelloides (Grev.) L. Lombard, comb. nov.Myco-
Bank MB 837723.
Basionym:Fusarium tremelloides Grev., Scott. Crypt. Fl. 1: 10.
1822.
Synonyms:Peziza fusarioides Berk., Mag. Zool. Bot. 1: 46. 1837.
Calloria fusarioides (Berk.) Fr., Summa Veg. Scand. 2: 359. 1849.
Callorina fusarioides (Berk.) Korf, Phytologia 21: 203. 1971.
Peziza neglecta Lib., Pl. Crypt. Arduenna Fasc. 1: no. 29. 1830.
Calloria neglecta (Lib.) B. Hein, Beih. Willdenowia 9: 54. 1976.
Holotypus: Not located.
Type locality:UK, Scotland, near Edinburg.
Type substrate: Dead stems of Urtica dioica.
Notes: Synonyms fide Wollenweber & Reinking (1935). As the
epithet of F. tremelloides (1822) takes priority above the epithet
of C. neglecta (1830), a new combination is introduced here.
trichothecioides Fusarium Wollenw., J. Wash. Acad. Sci. 2: 147.
1912.
Synonyms:Fusarium sambucinum var. trichothecioides (Wol-
lenw.) Bilaĭ, Fusarii (Biologija i sistematika): 268. 1955, nom.
inval., Art. 41.1.
Fusarium tuberivorum Wilcox & G.K. Link, Res. Bull. Nebraska
Agric. Exp. Sta. 1: 48. 1913.
Lectotypus (hic designatus, MBT 10000751): USA, rotten tuber
of Solanum tuberosum, Aug. 1912, H.W. Wollenweber, in J.
Wash. Acad. Sci. 2: 150, figs A–F.
Descriptions and illustrations: See Booth (1971) and Gerlach &
Nirenberg (1982).
Notes: A putative synonym of F. sulphureum (Gordon 1959,
Subramanian 1971,Gerlach & Nirenberg 1982)or
F. sambucinum (Nelson et al. 1983,Nirenberg 1995). The tax-
onomy of this potato pathogen has not yet been resolved. As no
holotype specimen was preserved (Gerlach & Nirenberg 1982),
the figures accompanying the original protologue are designated
as lectotype here.
tricinctum Fusarium (Corda) Sacc., Syll. Fung. 4: 700. 1886.
Basionym:Selenosporium tricinctum Corda, Icon. Fung. 2: 7.
1838.
Synonyms:Fusarium sporotrichioides var. tricinctum (Corda)
Raillo, Fungi of the Genus Fusarium: 197. 1950.
CROUS ET AL.
168

Fusarium sporotrichiella var. tricinctum (Corda) Bilaĭ, Yadovitye
griby na zerne khlebnykh zlakov. Kiev: 87. 1953, nom. inval., Art.
39.1.
Fusarium sporotrichiella var. tricinctum (Corda) Bilaĭ, Mikrobiol.
Zhurn. 49: 7. 1987, nom. inval., Art. 35.1.
?Vermicularia subeffigurata γhelianthi Schwein., Trans. Amer.
Philos. Soc., n.s. 4: 228. 1832 [1834].
?Fusarium helianthi (Schwein.) Wollenw., Fusaria Autogr. Delin.
2: 555. 1924.
Fusarium muentzii Delacr. (as ‘müntzii’), Bull. Soc. Mycol. France
8: 192. 1892.
Fusarium citriforme Jamal., Valt. Maatalousk. Julk. 123: 11. 1943.
Gibberella tricincta El-Gholl et al., Canad. J. Bot. 56: 2206. 1978.
Lectotypus: PRM 155623 (designated in Holubov
a-Jechov
aet al.
1994).
Type locality:Czech Republic, near Prague, Chuchle,
Vysko
cilka.
Type substrate: Stem of Umbelliferae.
Epitypus: In PRM, designated in Holubov
a-Jechov
aet al. (1994).
Ex-epitype culture: BBA 64485 = CBS 393.93 = NRRL 25481.
Epitype locality:Germany, Berlin.
Epitype substrate: Culm base of Triticum aestivum.
Descriptions and illustrations: See Holubov
a-Jechov
aet al.
(1994) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: JX171516; rpb2: JX171629;
tef1:MH582379.
trifolii Fusarium Jacz., Jahrb. Pflanzenkrankh. Russlands. VII-
VIII: Abt. 6. 1917.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:Russia, St. Petersburg.
Type substrate: Root crown of Trifolium sp.
Note: Synonym fide Wollenweber & Reinking (1935).
triseptatum Fusarium L. Lombard & Crous, Persoonia 43: 34.
2018 [2019].
Holotypus: CBS H-23622.
Ex-type culture: CBS 258.50 = NRRL 36389.
Type locality:USA.
Type substrate:Ipomoea batatas.
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb1: MW928820; rpb2: MH484873;
tef1: MH484964.
tritici Fusarium Liebman bis, Tidsskr. Landoekon., n.s., 2: 515.
1840.
(See Fusarium avenaceum)
Lectotypus (hic designates, MBT 10000752): Denmark,Triticum
sp., in Tidsskr. Landoekon., n.s., 2: figs B, 1, 2.
Notes: Synonymy fide Rostrup (1894). No holotype specimen
could be located and therefore an illustration is designated as
lectotype.
tritici Fusarium Erikss., Fungi Paras. Scand. Exs. no. 400. 1891,
nom. illegit., Art. 53.1.
(See Fusarium nivale)
Authentic material: CHRB-F-0007556.
Original locality:Sweden, Stockholm.
Original substrate:Triticum durum.
Note: Synonym fide Wollenweber & Reinking (1935).
truncatum Fusarium Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 155. 1915.
(See Fusarium avenaceum)
Typus: ?CUP-007429.
Type locality:USA, New York.
Type substrate:Solanum tuberosum.
Note: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of the material lodged in CUP.
tuaranense Fusarium T. Aoki et al., Mycologia 111: 926. 2019.
Neocosmospora tuaranensis (T. Aoki et al.) L. Lombard &
Sand.-Den., comb. nov.MycoBank MB 837724.
Basionym:Fusarium tuaranense T. Aoki et al., Mycologia 111:
926. 2019.
Holotypus: BPI 910971.
Ex-type culture: ATCC 16563 = MAFF 246842 = NRRL 22231.
Type locality:Malaysia, Sabah State, Tuaran.
Type substrate:Hevea brasiliensis damaged by an unknown
ambrosia beetle.
Descriptions and illustrations: See Aoki et al. (2019).
Diagnostic DNA barcodes:rpb1: KC691600; rpb2: KC691660,
KC691631; tef1: KC691542.
Note: A new combination is provided in the genus Neo-
cosmospora based on the phylogenetic relationship and
morphology of this species (Aoki et al. 2019).
tubercularioides Fusarium (Corda) Sacc., Syll. Fung. 4: 697.
1886.
Basionym:Selenosporium tubercularioides Corda, Icon. Fung. 1:
7. 1837.
(See Fusarium avenaceum)
Typus: PRM 155625.
Type locality:Czech Republic, Liberec, Hamr
stejn (as ‘Sude-
tenland, Reichenberg, Hammerstein’).
Type substrate: Dead branches of Rubus idaeus.
Descriptions and illustrations: See Holubov
a-Jechov
aet al.
(1994).
Note: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of the material lodged in PRM.
tuberis Fusarium Preuss, Linnaea 24: 148. 1851.
Holotypus:InBfide Jülich (1974).
Type locality:Germany, Hoyerswerda.
Type substrate: Tuber of Dahlia sp.
Note: Status unclear. Not Fusarium fide Wollenweber & Reinking
(1935).
tuberivorum Fusarium Wilcox & G.K. Link, Res. Bull. Nebraska
Agric. Exp. Sta. 1: 48. 1913.
(See Fusarium trichothecioides)
Lectotypus (hic designates, MBT 10000753): USA, Nebraska,
Solanum tuberosum, in Res. Bull. Nebraska Agric. Exp. Sta. 1,
Pl. 24.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
tucumaniae Fusarium T. Aoki et al., Mycologia 95: 664. 2003.
(See Fusarium azukiicola)
Holotypus: BPI 841955.
Ex-type culture: MAFF 238418 = MJ-172 = NRRL 31096.
Type locality:Argentina, Tucum
an, San Agustin.
Type substrate:Glycine max.
Descriptions and illustrations: See Aoki et al. (2003).
Diagnostic DNA barcodes:rpb1: MAED01000445; rpb2:
EU329557; tef1: GU170636.
FUSARIUM REDELIMITED
www.studiesinmycology.org 169

tumidum Fusarium Sherb., Phytopathology 18: 148. 1928.
Synonym:Gibberella tumida P.G. Broadh. & P.R. Johnst., Mycol.
Res. 98: 730. 1994.
Syntypes: Krieger, Fungi Saxon. Exs. no. 2499 in BPI & HAL.
Type locality:Germany.
Type substrate: Heads of Sarothamnus scoparius.
Note: Typification pending further study of the syntypes.
tupiense Fusarium C.S. Lima et al., Mycologia 104: 1414. 2012.
Holotypus: CMB-UB 22068.
Ex-type culture: CML 262 = CMM 3655 = KSU 16195 = NRRL
53984.
Type locality:Brazil, Minas Gerais, Lavras.
Type substrate: Diseased tissue of Mangifera indica.
Descriptions and illustrations: See Lima et al. (2012).
Diagnostic DNA barcodes:rpb1: LR792583; rpb2: LR792619;
tef1: GU737404.
udum Fusarium E.J. Butler, Mem. Dept. Agric. India, Bot. Ser.
2(9): 54. 1910.
Synonyms:Fusarium oxysporum f. sp. udum (E.J. Butler) W.C.
Snyder & H.N. Hansen, Amer. J. Bot. 24: 66. 1940.
Fusarium butleri Wollenw., Phytopathology 3: 38. 1913, nom.
illegit., Art. 52.1.
Fusarium lateritium var. uncinatum (Wollenw.) Wollenw., Z.
Parasitenk. (Berlin) 3: 375. 1931.
Fusarium vasinfectum var. crotalariae Kulkarni, Indian J. Agric.
Sci. 4: 994. 1934.
Fusarium udum f. sp. crotalariae (Kulkarni) Subram., The Genus
Fusarium: 114. 1971.
Fusarium udum var. cajani Padwick, Indian J. Agric. Sci. 10: 878.
1940.
Fusarium lateritium f. cajani (Padwick) W.L. Gordon, Canad. J.
Bot. 30: 232. 1952.
Fusarium udum var. crotalariae Padwick, Indian J. Agric. Sci. 10:
877. 1940.
Fusarium lateritium f.crotalariae (Padwick) W.L. Gordon, Canad.
J. Bot. 30: 232. 1952.
Gibberella indica B. Rai & R.S. Upadhyay, Mycologia 74: 343.
1982.
Lectotypus:Butler (1910), Pl. IV, fig. 4, designated in Pfenning
et al. (2019).
Epitypus: UB23905, designated in Pfenning et al. (2019).
Ex-epitype culture: BBA 65058 = CML 3238 = NRRL 25199.
Type locality:India.
Type substrate:Cajanus cajan.
Descriptions and illustrations: See Wollenweber & Reinking
(1935),Booth (1971),Subramanian (1971),Booth (1978),
Gerlach & Nirenberg (1982) and Pfenning et al. (2019).
Diagnostic DNA barcodes:rpb2: KY498875; tef1: MK639096.
udum Fusarium (Berk.) Wollenw., Phytopathology 3: 38. 1913,
nom. illegit., Art. 53.1.
Basionym:Fusisporium udum Berk., Ann. Mag. Nat. Hist. 6: 438.
1841.
(See Fusarium merismoides)
Holotypus: ?K(M).
Type locality:UK,King's Cliffe.
Type substrate: Unidentified tree.
Note: Synonyms fide Wollenweber & Reinking (1935).
ulmi Fusarium P. Crouan & H. Crouan, Fl. Finist
ere: 14. 1867.
(See Fusarium candidum (Link) Sacc.)
Holotypus: ?PC.
Type locality:France, Finist
ere, edge of a stream.
Type substrate: Roots of Ulmus sp.
Note: Synonym fide Wollenweber & Reinking (1935).
ulmicola Fusarium Dearn. & House, Circ. New York Stat. Mus.
24: 60. 1940, nom. inval., Art. 39.1.
Authentic material: NYSf3256.
Original locality:USA, New York, Albany, Ravena.
Original substrate: Dead branches of Ulmus thomasii.
Notes: Lacks a Latin diagnosis. Requires further investigation to
confirm its taxonomic affiliation.
uncinatum Fusarium Wollenw., Ann. Mycol. 15: 54. 1917.
(See Fusarium udum)
Holotypus: Not located.
Type locality:India, Dehli, Pusa.
Type substrate: Dried stem of Cajanus indicus.
Note: Synonym fide Wollenweber & Reinking (1935) and Gerlach
& Nirenberg (1982).
uniseptatum Fusarium Höhn., Ann. Mycol. 1: 409. 1903.
Synonyms:Cylindrocarpon uniseptatum (Höhn.) Wollenw.,
Fusaria Autogr. Delin. 2: 646. 1924.
Ramularia uniseptata (Höhn.) Wollenw., Fusaria Autogr. Delin. 2:
646. 1924.
Holotypus: Not located.
Type locality:Austria, Vienna.
Type substrate: Rotten Gleditsia triacanthos.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935) and not Ramularia fide Braun (1998).
uredinicola Fusarium Jul. Müll., Ber. Deutsch. Bot. Ges. 3: 395.
1885.
(See Fusarium avenaceum)
Holotypus: Not located.
Type locality:Germany.
Type substrate: Aecidium of Phragmidium subcorticium (=
Phragmidium mucronatum) and Phragmidium rubi (= Phragmi-
dium barclayi).
Note: Synonym fide Wollenweber & Reinking (1935).
uredinicola Fusarium Pat. & Gaillard, Bull. Soc. Mycol. France 4:
127. 1888, nom. illegit., Art. 53.1.
Synonym: Fusarium patouillardii Sacc. (as ‘patouillardi’), Syll.
Fung. 10: 729. 1892.
Authentic material: Not located.
Original locality:Venezuela, Caracas.
Original substrate: Parasitic on the bottom of spots of Puccinia
pallidissima, between the perithecia of Darluca filum parasitised
by the Puccinia sp.
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
uredinicola Fusarium Petch, Ann. Roy. Bot. Gard. (Peradeniya)
6: 256. 1917, nom. illegit., Art. 53.1.
Authentic material: PDA 4731.
Original locality:Sri Lanka, Hakgala.
Original substrate: Parasitic on Uredo microglossa on leaves of
Microglossa zeylanica.
Notes: Status unclear. A probable synonym of F. solani var.
minus (syn. Neocosmospora brevicona) according to
Wollenweber & Reinking (1935).
uredinophilum Fusarium Speg. (as ‘urediniphilum’), Anales Mus.
Nac. Hist. Nat. Buenos Aires 31: 445. 1922.
CROUS ET AL.
170

Holotypus: In LPS (Fungi Parag. pp. 93–94, no. 262).
Type locality:Paraguay, near Puerto Sajonia.
Type substrate: Parasitic on the acervuli of Uredo cyclotrauma,
on leaving leaves of Pithecellobium cauliflorum.
Notes: Status unclear. Not treated by any of Wollenweber &
Reinking (1935),Booth (1971),orGerlach & Nirenberg (1982).
uredinum Fusarium Ellis & Everh., N. Amer. Fungi, Ser. II, no.
2799. 1890, nom. inval., Art. 38.1(a).
Ramularia uredinis (W. Voss) Sacc., Syll. Fung. 4: 199. 1886.
Basionym:Cylindrosporium uredinis W. Voss, Verh. Zool.-Bot.
Ges. Wien 29: 684. 1879.
Synonym:Ramularia nambuana Henn., Hedwigia 43: 146. 1904.
Authentic material: NY00928692.
Original locality:USA, Wisconsin, Racine.
Original substrate: Parasitic on uredinia of Melampsora salicina,
on leaf of Salix sp.
Notes:Wollenweber & Reinking (1935) considered F. uredinum a
synonym of Cladosporium herbarum. It is quite possible that this
common saprobic Cladosporium species also occurred on
uredinia in N. Am. Fungi 2799, but it can be ruled out that Ellis &
Everhard confused this dematiaceous hyphomycete charac-
terised by having long conidiophores with thickened and dark-
ened conidiogeneous loci and large catenate conidia with a
colourless Fusarium.Davis (1915) found Ramularia uredinis,a
common mucedinacous hyphomycete on Melampsora spp. on
Populus and Salix, in material authentic for this name. This is
undoubtedly correct.
urticearum Fusarium (Corda) Sacc., Syll. Fung. 4: 698. 1886.
Basionym:Selenosporium urticearum Corda, Icon. Fung. 2: 7.
1838.
(See Fusarium lateritium)
Lectotypus (hic designatus, MBT 10000754): Czech Republic,
Prague, dead branches of Ficus elastica and Morus nigra, 1838.
A.C.J. Corda, in Icon. Fung. 2, Tab. 9, fig. 30.
Notes: Synonym fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
ussurianum Fusarium T. Aoki et al., Mycologia 101: 847. 2009.
Holotypus: BPI 878845.
Ex-type culture: CBS 123752 = NRRL 45681 = TG-2662/0.
Type locality:Russia, Ussuriysk, Primorsky krai (Far East ter-
ritory), agricultural field near the city Ussuriysk.
Type substrate: Seed of Avena sativa.
Descriptions and illustrations: See Yli-Mattila et al. (2009).
Diagnostic DNA barcodes:rpb1: KM361648; rpb2: KM361666;
tef1: FJ240301.
ustilaginis Fusarium Kellerm. & Swingle, Rep. (Annual) Kansas
Agric. Exp. Sta. 2: 285. 1890 [1889].
(See Fusarium avenaceum)
Lectotypus (hic designatus, MBT 10000755): USA, Kansas,
Manhattan, on Ustilago avenae,onAvena sativa, 1890, W.A.
Kellerman & W.T. Swingle, in Rep. (Annual) Kansas Agric. Exp.
Sta. 2, pl. IX, figs 1–13.
Note: Synonym fide Wollenweber & Reinking (1935).
ustilaginis Fusarium Rostr., Bot. Foren. Festskr. 54: 137. 1890,
nom. illegit., Art. 53.1.
(See Fusarium nivale)
Authentic material: C-F-125286.
Original locality:Denmark, Jutland, near Viborg.
Original substrate: Parasitic on Ustilago grandis on Phragmites
communis.
Note: Synonym fide Wollenweber & Reinking (1935).
vanettenii Fusarium O'Donnell et al., Index Fungorum 440: 5.
2020.
Basionym:Fusarium martii var. pisi F.R. Jones, J. Agric. Res. 26:
459. 1923.
(See Fusarium pisi)
vasinfectum Fusarium G.F. Atk., Bull. Alabama Agric. Exp. Sta.
41: 28. 1892.
(See Fusarium oxysporum)
Holotypus: ?CUP-A-(0100)#1.
Type locality:USA, Alabama, Montgomery, Mathews.
Type substrate:Gossypium herbaceum.
Note: Synonym fide Wollenweber & Reinking (1935).
venenatum Fusarium Nirenberg, Mycopathologia 129: 136.
1995.
Misapplied names:Fusarium sambucinum var.
coeruleum Wollenw. sensu Booth, The Genus Fusarium:
171–172. 1971.
Fusarium sambucinum var. coeruleum Wollenw. sensu Gerlach
& Nirenberg, Mitt. Biol. Bundesanst. Land.- Forstw. 209:
213–216. 1982.
Holotypus: CBS 458.93 (preserved as metabolically inactive
culture).
Ex-type culture: BBA 64537 = CBS 458.93 = NRRL 26228.
Type locality:Austria.
Type substrate: Culm of Triticum aestivum.
Descriptions and illustrations: See Nirenberg (1995).
Diagnostic DNA barcodes:rpb2: KM232382; tef1: KM231942.
venerorum Fusarium Dounin & Goldmacher, Index of the plant
diseases in the U.S. 5: 284–298. 1927.
(See Fusarium avenaceum)
Holotypus: Not located.
Type locality:Unknown.
Type substrate: Unknown.
Note: Synonym fide Wollenweber & Reinking (1935).
venezuelense Fusarium O'Donnell et al., Index Fungorum 440:
5. 2020.
Neocosmospora robusta Sand.-Den. & Crous, Persoonia 43:
165. 2019, non Fusarium robustum Gerlach 1977.
Holotypus: CBS H-24000.
Ex-type culture: BBA 65682 = CBS 145473 = NRRL 22395.
Type locality:Venezuela.
Type substrate: Bark.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW834251; rpb2: EU329507;
tef1: AF178341.
ventricosum Fusarium Appel & Wollenw., Phytopathology 3: 32.
1913.
Rectifusarium ventricosum (Appel & Wollenw.) L. Lombard &
Crous, Stud. Mycol. 80: 229. 2015.
Synonyms:Fusarium solani var. ventricosum (Appel & Wollenw.)
Joffe, Pl. & Soil 38: 440. 1973.
Fusarium cuneiforme Sherb., Mem. Cornell Univ. Agric. Exp. Sta.
6: 129. 1915.
Hypomyces solani Reinke & Berth., Untersuch. Bot. Lab. Univ.
Göttingen 1: 27. 1879.
FUSARIUM REDELIMITED
www.studiesinmycology.org 171

Hyponectria solani (Reinke & Berth.) Petch, J. Bot. 75. 220.
1937.
Nectriopsis solani (Reinke & Berth.) C. Booth, Mycol. Pap. 74: 8.
1960.
Nectria ventricosa Booth, The Genus Fusarium: 55. 1971.
Holotypus: B 70 0021849.
Epitypus: CBS H-21947, designated in Lombard et al. (2015).
Ex-epitype culture: BBA 62452 = CBS 748.79 = NRRL
20846 = NRRL 22113.
Type locality:Germany, Berlin.
Type substrate: Tuber of Solanum tuberosum.
Descriptions and illustrations: See Wollenweber (1917),Booth
(1971) and Lombard et al. (2015).
Diagnostic DNA barcodes:rpb1: JX171484; rpb2: JX171597;
tef1: KM231924.
Notes: Contrary to Wollenweber & Reinking (1935),Booth (1971)
considered this species as different from F. argillaceum, which
was later confirmed by Lombard et al. (2015). The same authors
designated an epitype for this taxon and transferred it to the
genus Rectifusarium as R. ventricosum.
veratri Fusarium (Allesch.) Höhn., in Kab
at & Bub
ak, Fungi
Imperf. Exs. No. 349. 1906.
Gloeosporium veratri (Allesch.) Höhn., Mitt. Bot. Inst. Tech.
Hochsch. Wien 4: 112. 1927.
Basionym:Fusoma veratri Allesch., Ber. Bayer. Bot. Ges. 2: 19.
1892.
Synonym:Septogloeum veratri (Allesch.) Wollenw., Fusaria
Autogr. Delin. 1: 439. 1916.
Holotypus: ?M.
Type locality:Germany, Bavaria, Oberammergau.
Type substrate: Leaves of Veratrum lobelianum.
Notes: This species produces acervuli and 1-septate conidia with
truncate basal cells. Therefore, it was transferred to Gloesporium
(Helotiales,Dermataceae).
verrucosum Fusarium (Pat.) O'Donnell & Geiser, Phytopathology
103: 404. 2013.
Albonectria verrucosa (Pat.) Rossman & Samuels, Stud.
Mycol. 42: 108. 1999.
Basionym:Calonectria verrucosa Pat., Bull. Soc. Mycol. France
11: 228. 1895.
Synonym:Nectria astromata Rossman, Mycotaxon 8: 550. 1979,
non N. verrucosa (Schwein.) Sacc.
Holotypus:InFHfide Rossman et al. (1999).
Type locality:Ecuador, San Jorge.
Type substrate:Chusquea sp.
Descriptions and illustrations: See Rossman (1983) and
Rossman et al. (1999).
Notes: Although recently recombined in Fusarium (Geiser et al.
2013), the taxonomy of this species is uncertain. With 5–9( –13)-
septate ascospores, this species cannot be a member of
Fusarium s. str., and the identity of the isolates included in recent
phylogenetic estimates (CBS 102163, originally identified as
F. concolor and NRRL 22566) cannot be confirmed at this stage.
versicolor Fusarium Sacc., Syll. Fung. 16: 1099. 1902.
(See Fusarium culmorum)
Holotypus: In PAD.
Type locality:France,C
^
ote-d’Or.
Type substrate: Cortex of Cucurbita sp.
Note: Synonym fide Wollenweber & Reinking (1935).
versiforme Fusarium Kab
at & Bub
ak, Hedwigia 44: 358. 1905.
Holotypus: BPI 453128.
Type locality:Czech Republic, Bohemia, Turnov.
Type substrate: Living leaves of Hosta sieboldii (syn. Hosta
albomarginata).
Notes:Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
verticillioides Fusarium (Sacc.) Nirenberg, Mitt. Biol. Bunde-
sanst. Land- Forstw. 169: 26. 1976.
Basionym:Oospora verticillioides Sacc., Fung. Ital., Fasc.
17–28: pl. 879. 1881.
Synonyms:Alysidium verticillioides (Sacc.) Kuntze, Revis. Gen.
Pl. 3: 442. 1898.
Fusarium moniliforme J. Sheld., Annual Rep. Nebraska Agric.
Exp. Sta. 17: 23. 1904.
Gibberella moniliformis Wineland, J. Agric. Res. 28: 909. 1924.
Lectotypus: Pl. 879 in Saccardo, Fung. Ital. (1881), designated
by Yilmaz et al. (2021).
Epitypus: CBS 218.76 (preserved as metabolically inactive cul-
ture), designated by Yilmaz et al. (2021).
Ex-epitype culture: BBA 11782 = CBS 218.76 = DSM
62264 = IMI 202875 = NRRL 13993.
Epitype locality:Germany.
Epitype substrate:Zea mays.
Descriptions and illustrations: See Nirenberg (1976,1981),
Gerlach & Nirenberg (1982) and Leslie & Summerell (2006).
Diagnostic DNA barcodes:rpb1: MW402638; rpb2: MW928835;
tef1: KF499582.
veterinarium Fusarium L. Lombard & Crous, Persoonia 43: 35.
2018 [2019].
Holotypus: CBS H-23623.
Ex-type culture: CBS 109898 = NRRL 36153.
Type locality:Netherlands.
Type substrate: Peritoneum of Selachimorpha (shark).
Descriptions and illustrations: See Lombard et al. (2019b).
Diagnostic DNA barcodes:rpb2: MH484899; tef1: MH484990.
victoriae Fusarium Henn., in herb., fide Wollenweber, Fusaria
Autogr. Delin. 1: 66. 1916.
Macronectria jungneri (Henn.) C. Salgado & P. Chaverri,
Fungal Diversity 80: 448. 2016. Basionym:Nectria jungneri
Henn., Bot. Jahrb. Syst. 22: 75. 1895.
Synonyms:Nectria eustoma Penz. & Sacc., Malpighia 11: 509.
1898.
Nectria leucocoma Starb€
ack, Bih. Kongl. Svenska Vetensk.-
Akad. Handl. 25: 28. 1899.
Nectria cinereopapillata Henn. & E. Nyman, Monsunia 1: 161.
1900.
Nectria striatospora Zimm., Centralbl. Bakteriol. Abt. 1, 7: 105.
1901.
Cylindrocarpon victoriae Wollenw., Z. Parasitenk. (Berlin) 1: 161.
1928.
Nectria azureo-ostiolata Yoshim. Doi, Mem. Nat. Sci. Mus. Tokyo
10: 23. 1977.
Authentic material:InBfide Wollenweber, Fusaria Autogr. Delin.
1: 66. 1916.
Original locality:Cameroon.
Original substrate: Trunk of an unknown tree.
vinosum Fusarium Massee, Brit. Fung.-Fl. 3: 479. 1893.
(See Fusarium flocciferum)
Holotypus: ?K(M).
Type locality:UK.
CROUS ET AL.
172

Type substrate: Decaying mast manufactured from Fagus
sylvatica.
Note: Synonym fide Wollenweber & Reinking (1935).
vinosum Fusarium Greco, Origine des Tumeurs (Etiologie du
Cancer. etc.) et Observations de Mycoses (Blastomycoses. etc.)
Argentines (Buenos Aires): 670. 1916, nom. illegit., Art. 53.1.
Authentic material: Not located.
Original locality:Argentina.
Original substrate:Homo sapiens.
Note: A late homonym of F. vinosum Massee.
violaceum Fusarium P. Crouan & H. Crouan, Fl. Finist
ere: 14.
1867, nom. illegit., Art. 53.1.
(See Fusarium sambucinum)
Authentic material: ?PC.
Original locality:France, Brittany, Finist
ere, marshes.
Original substrate: Bark of unknown tree.
Notes: An illegitimate homonym of F. violaceum Fuckel (1863).
Synonym fide Gams et al. (1997).
violaceum Fusarium Fuckel, Fungi Rhen. Exs. No. 209. 1863.
(See Fusarium caeruleum)
Syntypes: In BPI, F, HAL, MICH, S & WSP (Fuckel, Fungi Rhen.
Exs. No. 209).
Type locality:Germany, Hessen, Oestrich.
Type substrate:Solanum tuberosum.
Note: Synonym fide Wollenweber & Reinking (1935) and Booth
(1971).
violae Fusarium F.A. Wolf, Mycologia 2: 21. 1910.
(See Fusarium oxysporum)
Holotypus: Not located.
Type locality:USA, Nebraska, Lincoln.
Type substrate: Stems and roots of Viola tricolor.
Note: Synonym fide Wollenweber & Reinking (1935).
virguliforme Fusarium O'Donnell & T. Aoki, Mycologia 95: 667.
2003.
(See Fusarium azukicola)
Holotypus: BPI 841956.
Ex-type culture: MAFF 238553 = NRRL 31041 = Shuxian Li # 95.
Type locality:USA, Illinois.
Type substrate:Glycine max.
Descriptions and illustrations: See Aoki et al. (2003).
Diagnostic DNA barcodes:rpb1: JX171530; rpb2: JX171643;
tef1: AY220193.
viride Fusarium (Lechmere) Wollenw., Fusaria Autogr. Delin. 1:
418. 1916.
Basionym:Pionnotes viridis Lechmere, Compt. Rend. Hebd.
S
eances Acad. Sci. 155: 178. 1912.
(See Fusarium solani)
Holotypus: Not located.
Type locality:Ivory Coast.
Type substrate: Undetermined wood.
Note: Synonyms fide Wollenweber & Reinking (1935).
viticola Fusarium Thüm. (as ‘viticolum’), Pilze Weinst.: 52. 1878.
Synonym:Fusarium herbarum var. viticola (Thüm.) Wollenw.,
Fusaria Autogr. Delin. 3: 898. 1930.
(See Fusarium avenaceum)
Lectotypus (hic designatus, MBT 10000756): Italy, Liguria,
Genoa, Rapallo, dry twigs of Vitis vinifera, Jul. 1876, G. Pass-
erini, in Thümen, Pilze Weinst. 1878: pl. 3, fig. 3.
Notes: Synonyms fide Wollenweber & Reinking (1935). No ho-
lotype specimen could be located and therefore an illustration is
designated as lectotype.
vogelii Fusarium Henn., Z. Pflanzenkrankh. 12: 16. 1902.
Synonyms:Septosporium curvatum Rabenh. & A. Braun,
Krankh. Pfl.: 14. 1854.
Septoria curvata (Rabenh. & A. Braun) Sacc., Syll. Fung. 3: 484.
1884.
Cercospora curvata (Rabenh. & A. Braun) Wollenw., Fusaria
Autogr. Delin. 1: 451. 1916.
Holotypus: In B (Kab
at & Bub
ak, Fungi Imp. Exs. 248) fide Hein
(1988).
Type locality:Poland,Dąbroszyn (former Tamsel).
Type substrate: Leaf of Robinia pseudoacacia.
Notes: Status unclear. Neither Fusarium fide Wollenweber &
Reinking (1935) nor Cercospora fide Chupp (1954).
volatile Fusarium Al-Hatmi et al., Fungal Syst. Evol. 4: 174.
2019.
Holotypus: CBS H-24004.
Ex-type culture: CBS 143874.
Type locality:French Guiana, Cayenne.
Type substrate: Bronchoalveolar lavage effusion from Homo
sapiens with lung infection.
Descriptions and illustrations: See Al-Hatmi et al. (2019).
Diagnostic DNA barcodes:rpb2: LR596006; tef1: LR596007.
volutella Fusarium Ellis & Everh., Proc. Acad. Nat. Sci. Phila-
delphia 43: 93. 1891.
(See Fusarium stromaticum)
Holotypus: Langlois 1505 in NY fide Index Fungorum.
Type locality:USA, Louisiana, Saint Martinsville.
Type substrate: Dead twigs of Nekemias arborea (syn. Ampe-
lopsis arborea).
Note: Synonym fide Wollenweber & Reinking (1935) and
Gr€
afenhan et al. (2011).
vorosii Fusarium B. T
oth et al., Fungal Genet. Biol. 44: 1202.
2007.
Holotypus: BPI 871658.
Ex-type culture: NRRL 37605.
Type locality:Hungary, Pest, Ipolydam
asd.
Type substrate: Spikelet of Triticum aestivum.
Descriptions and illustrations: See Starkey et al. (2007).
Diagnostic DNA barcodes:rpb1: KM361647; rpb2: KM361665;
tef1: DQ459745.
waltergamsii Fusarium O'Donnell et al., Index Fungorum 440: 5.
2020.
Neocosmospora gamsii Sand.-Den. & Crous, Persoonia 41:
116. 2018.
Holotypus: CBS H-23226.
Ex-type culture: CBS 143207 = NRRL 32323 = UTHSC 99-250.
Type locality:USA, Pennsylvania.
Type substrate: Bronchoalveolar lavage fluid from Homo
sapiens.
Descriptions and illustrations: See Sandoval-Denis & Crous
(2018).
Diagnostic DNA barcodes:rpb1: MW834223; rpb2: KM361665;
tef1: DQ246951.
werrikimbe Fusarium J.L. Walsh, L.W. Burgess, E.C.Y. Liew &
B.A. Summerell, sp. nov.MycoBank MB 837725.
FUSARIUM REDELIMITED
www.studiesinmycology.org 173

Synonym:Fusarium werrikimbe J.L. Walsh, L.W. Burgess, E.C.Y.
Liew & B.A. Summerell, Fungal Diversity 44: 155. 2010, nom.
inval., Art. 40.7.
Etymology: In reference to Werrikimbe National Park, the
geographic origin of the isolates first recognised as belonging to
this species.
For diagnosis see Walsh et al., Fungal Diversity 44: 155. 2010.
Holotypus: CBS 125535 (preserved as metabolically inactive
culture).
Ex-type culture: CBS 125535 = F19350 = RBG 5332.
Type locality:Australia, New South Wales, Werrikimbe National
Park.
Type substrate:Sorghum leiocladum.
Descriptions and illustrations: See Walsh et al. (2010).
Diagnostic DNA barcodes:rpb1: MW928821; rpb2: MN534304;
tef1: MW928846.
Notes:Walsh et al. (2010) did not indicate the holotype for
F. werrikimbe, rendering the name invalid (Art. 40.7). Here we
validate the name.
willkommii Fusarium Lindau, Rabenh. Krypt.-Fl. ed. 2, 1(9): 551.
1910.
Replaced synonym:Fusarium candidum Sacc. & D. Sacc., Syll.
Fung. 18: 674. 1906, nom. illegit., Art. 53.1, non Fusarium
candidum Ehrenb. 1818.
Lectotypus (hic designatus, MBT 10000757): Germany, Saxony,
Fagus sylvatica, 1866, M. Willkomm, in Die mikroskopischen
Feinde des Waldes 1, Tab. VI, figs 11–12.
Notes: Lindau's description of F. willkommii was based on
Willkomm's (1866: 103) description and illustration under the
name Fusidium candidum Link as well as Saccardo's(l.c.)
description under Fusarium candidum. Therefore, the illustration
by Willkomm (1866) is designated as lectotype.
witzenhausenense Fusarium

Si
si
cet al., Antonie van Leeu-
wenhoek 111: 1795. 2018.
(See Fusarium stercicola)
Holotypus: CBS H-23351.
Ex-type culture: CBS 142480 = DSM 106212.
Type locality:Germany, Hessen, Witzenhausen, Neu-
Eichenberg.
Type substrate: Branch of Hibiscus sp.
Descriptions and illustrations: See 
Si
si
cet al. (2018a).
Diagnostic DNA barcodes:rpb1: MG237865; rpb2: LR583886;
tef1: KY556525.
wolgense Fusarium Rodigin, Trudy Bashkir. Sel’. Khoz. Inst. 3:
101. 1942.
Holotypus: Not located.
Type locality:Russia, Volgograd (formerly Stalingrad).
Type substrate: Fruit of Citrullus lanatus (syn. Citrullus vulgaris).
Notes: Status unclear. Not treated by either of Booth (1971) and
Gerlach & Nirenberg (1982).
wollenweberi Fusarium Raillo, Fungi of the Genus Fusarium:
189. 1950, nom. illegit., Art. 52.1.
(See Fusarium anthophilum)
Authentic material: Not located.
Original locality:Azerbaijan.
Original substrate: Seeds and stems of Gossypium sp.
Descriptions and illustrations: See Raillo (1950).
Notes:Fusarium wollenweberi was published as a new combi-
nation, but no basionym was indicated. As a nomen novum,it
can only be based on F. anthophilum, the only cited name, which
is a valid name. Therefore, F. wollenweberi would be illegitimate
(nom. superfl., Art. 52.1.). Additionally, the condition for the
introduction of a new species is also not met as a Latin diag-
nosis, necessary in 1950, is lacking.
xiangyunense Fusarium F. Zhang et al. (as ‘xiangyunensis’),
Phytotaxa 450: 278. 2020, nom. inval., Art. 40.8.
(See Fusarium stercicola)
Authentic material: DLU11-1, School of Agriculture and Biology,
Dali University, China.
Authentic culture: CGMCC 3.19676.
Original locality:China, Yunnan, Xiangyun, Dali, Da-bo-na hot-
spring.
Original substrate: Waterlogged soil.
Descriptions and illustrations: See Zhang et al. (2020).
Diagnostic DNA barcodes:rpb1: MH999281; tef1: MH992629.
Note: Based on phylogenetic and morphological evidence pro-
vided by Zhang et al. (2020), this invalid name (Art. 40.8) belongs
to the genus Neocosmospora and is a synonym of N. stercicola.
xylarioides Fusarium Steyaert, Bull. Soc. Roy. Bot. Belgique
80: 42. 1948.
Synonyms:Gibberella xylarioides (Steyaert) R. Heim & Saccas,
Rev. Mycol. (Paris) 15 (Suppl. Colon.): 97. 1950.
Fusarium oxysporum f.xylarioides (Steyaert) Delassus, Bull. sci.
Minist. Colon., Sect. Agric. trop. 5: 347. 1954.
Lectotypus (hic designatus, MBT 10000758): Central African
Republic, Bangui, trunk of Coffea excelsa, 1939, H. Fr
ed
eric, in
Steyaert, Bull. Soc. Roy. Bot. Belgique 80, pl. I, fig. 8.
Epitypus (hic designatus, MBT 10001275): Ivory Coast, on trunk
of Coffea sp., Feb. 1951, C. & M. Moreau, CBS 258.52 (pre-
served as metabolically inactive culture).
Ex-epitype culture: CBS 258.52 = NRRL 25486.
Descriptions and illustrations: See Steyaert (1948),Booth
(1971),Gerlach & Nirenberg (1982) and Geiser et al. (2005).
Diagnostic DNA barcodes:rpb1: JX171517; rpb2: JX171630;
tef1: AY707136.
Notes: A lectotype is designated here based on an illustration
provided by Steyaert (1948) accompanying the original proto-
logue. All attempts to locate the holotype specimen lodged at the
Universit
e de Bangui (BANG), Central African Republic, as
indicated by Steyaert (1948), failed. In addition, an epitype (CBS
258.52) is designated here to provide taxonomic stability for this
important species.
xyrophilum Fusarium I. Laraba et al., Mycologia 112: 45. 2019
[2020].
Holotypus: BPI 910919.
Ex-type culture: FRC M-8921 = NRRL 62721.
Type locality:Guyana, Cuyuni-Mazaruni, Kamakusa Mountain.
Type substrate:Xyris surinamensis.
Descriptions and illustrations: See Laraba et al. (2020).
Diagnostic DNA barcodes:rpb1: MN193933; rpb2: MN193905;
tef1: MN193877.
yamamotoi Fusarium O'Donnell et al., Index Fungorum 440: 5.
2020.
Replaced synonym:Nectria elegans W. Yamam. & Maeda,
Hyogo Univ. Agric. ser. Agric. Biol. 3: 15. 1957, non Fusarium
elegans Appel & Wollenw. 1910.
Neocosmospora elegans (W. Yamam. & Maeda) Sand.-Den. &
Crous, Persoonia 43: 127. 2019.
Lectotypus: Figs 1–9, page 16, in Yamamoto et al. (1957),
designated in Sandoval-Denis et al. (2019).
CROUS ET AL.
174

Epitypus: CBS H-23980, designated in Sandoval-Denis et al.
(2019).
Ex-epitype culture: ATCC 42366 = CBS 144396 = MAFF
238541 = NRRL 22277 = SUF XV-1.
Type locality:Japan.
Type substrate: Twigs and trunks of Zanthoxylum piperitum.
Descriptions and illustrations: See Sandoval-Denis et al. (2019).
Diagnostic DNA barcodes:rpb1: MW218113; rpb2: FJ240380;
tef1: AF178336.
yuccae Fusarium Cooke, Grevillea 7: 34. 1878, nom. inval., Art.
36.1(a).
(See Fusarium lateritium)
Authentic material: BPI 453149.
Original locality:USA, South Carolina, Aiken.
Original substrate:Yucca aloifolia.
Note: Synonym fide Wollenweber & Reinking (1935).
zanthoxyli Fusarium X. Zhou et al., Mycologia 108: 675. 2016.
Holotypus: HMNWAFU XZ-Fyzs133-20130408
Ex-type culture: CBS 140838 = NRRL 66285.
Type locality:China, Shaanxi, Tongchuan, Yaozhou, Sunyuan.
Type substrate:Zanthoxylum bungeanum.
Descriptions and illustrations: See Zhou et al. (2016).
Diagnostic DNA barcodes:rpb1: KM520383; rpb2: KM236763;
tef1: KM236703.
zavianum Fusarium (Sacc.) Sacc., Syll. Fung. 4: 709. 1886.
Basionym:Fusisporium zavianum Sacc., Michelia 1: 83. 1877.
(See Fusarium lateritium)
Holotypus: In PAD.
Type locality:Italy, Vittorio.
Type substrate:Vitis vinifera.
Note: Synonyms fide Wollenweber & Reinking (1935).
zeae Fusarium (Westend.) Sacc., Syll. Fung. 4: 713. 1886.
Basionym:Fusisporium zeae Westend., Bull. Acad. Roy. Sci.
Belgique, Cl. Sci. 18: 414. 1852. (non Fusisporium zeae Roum.,
Rev. Mycol. (Toulouse) 6: 163. 1884).
(See Fusarium avenaceum)
Holotypus: BR5020141668483.
Type locality:Belgium, Kortrijk railway station.
Type substrate: Rotting stalks of Zea mays.
Note: Synonyms fide Wollenweber & Reinking (1935).
zealandicum Fusarium Nirenberg & Samuels, Canad. J. Bot. 78:
1483. 2000.
Geejayessia zealandica (Cooke) Schroers, Stud. Mycol. 68:
133. 2011.
Basionym:Nectria zealandica Cooke, Grevillea 8: 65. 1879.
Synonyms:Cucurbitaria zelandica (Cooke) Kuntze, Revis. Gen.
Pl. 3: 462. 1898.
Cosmospora zealandica (Cooke) Samuels & Nirenberg, Canad.
J. Bot. 78: 1483. 2000.
Holotypus: BPI 747915.
Ex-type culture: BBA 64792 = CBS 111.93.
Type locality:New Zealand, Auckland, Waitakere Ranges
Regional Park, Cascades Kauri.
Type substrate: Bark of Hoheria populnea.
Descriptions and illustrations: See Nirenberg & Samuels (2000).
Diagnostic DNA barcodes:rpb2: HM626684; tef1: HQ728148.
ziziphinum Fusarium Pass., Erb. Critt. Ital. ser. 2 no. 1084. 1881.
(See Fusarium lateritium)
Syntype: F 982523 ( Erb. Critt. Ital. no. 1048).
Type locality:Italy.
Type substrate: Twigs of Ziziphus sinensis (syn. Ziziphus jujuba).
Note: Synonym fide Wollenweber & Reinking (1935).
zonatum Fusarium (Sherb.) Wollenw., Fusaria Autogr. Delin. 1:
392. 1916.
Basionym:Fusarium lutulatum var. zonatum Sherb., Mem.
Cornell Univ. Agric. Exp. Sta. 6: 214. 1915.
(See Fusarium oxysporum)
Typus: ?CUP-007453.
Type locality:USA, New York, Ithaca.
Type substrate:Solanum tuberosum.
Notes: Synonym fide Wollenweber & Reinking (1935). Lectoty-
pification pending study of the material lodged in CUP.
zygopetali Fusarium Delacr., Bull. Soc. Mycol. France 13: 103.
1897.
Holotypus: ?PC.
Type locality:France, Paris, Luxembourg gardens.
Type substrate: Leaves of Zygopetalum maculatum (syn.
Zygopetalum mackayi).
Notes: Status unclear. Not Fusarium fide Wollenweber &
Reinking (1935).
CONCLUSIONS
The present study is the first to provide an up-to-date morpho-
logical, biochemical, and phylogenetic overview of the 20
fusarioid genera that are presently recognised in Nectriaceae.
Morphological species recognition frequently fails to distinguish
fusarioid taxa that have been described based on genealogical
concordance phylogenetic species recognition (GCPSR sensu
Taylor et al. 2000). To address this issue, we have established a
new database, Fusarioid-ID, with accurate names for species
and genera of fusarioid taxa. Although the phylogenetically most
informative genes remain tef1,rpb1 and rpb2, additional markers
such as act1,CaM,tub2, ITS and LSU are also incorporated.
These genetic fragments can be amplified by PCR and
sequenced using the primers indicated in Table 2. In the future,
new species and other phylogenetically informative orthologous
genes, will be added to resolve isolates at species and genus
level. Researchers interested in obtaining reference strains
should contact the Westerdijk Fungal Biodiversity Institute
(https://wi.knaw.nl/page/Collection), which houses a large
collection of phylogenetically diverse fusarioid taxa.
As we have shown here, the phylogenetically derived argu-
ment that species under the node F1 should be considered
members of “Fusarium”is not practical, as this circumscription
would lead to a genus without apparent synapomorphies, as
lineages outside the genus would also share its characteristics.
However, the F3 node (corresponding to Fusarium s. str.)is
resolved by all genetic markers so far analysed (e.g., see Geiser
et al. 2021) and delineates the morphologically, ecologically, and
biochemically well-delineated genus Fusarium.
Fusarium s. str. does not have different sexual morphs, other
than Gibberella. Fusarioid genera are not only morphologically
distinct, but as we have shown in this study, correlate to different
monophyletic groups and also differ in their biology and myco-
toxin profiles.
One of the reasons for the desire to classify any species
producing conidia with foot-shaped basal cells into a single
genus could be that plant pathologists and clinicians typically
FUSARIUM REDELIMITED
www.studiesinmycology.org 175

isolate conidia or obtain cultures from vegetative mycelium that
inhabits their specimens. Also, Wollenweber and his successors
may have primarily worked with vegetatively proliferating mate-
rials, although it was also Wollenweber (1924,1926) who pro-
duced the first general synopsis of holomorphs in the
Hypocreales. However, mainly Joan M. Dingley (1951,1957),
Colin Booth (1959), and especially Gary J. Samuels (Samuels
1976a,b,1978,1988,Samuels et al. 1991) significantly
changed our points of view by systematically isolating asco-
spores obtained from ascomata, of which a vast majority were
not gathered in agricultural fields but from woody or herbaceous
substrata in forests of pantropical, species-rich regions. The
result of their taxonomic considerations was an infrageneric
subgrouping system in Nectria that was based on sexual and
asexual connections. The classification of species according to
morphological similarities in sexual morphs allowed under-
standing patterns of asexual characteristics that are unique for
the sexually defined subgroups and eventually correlating sexual
groupings with Wollenweber's section system. The diversity of
nectria-like species Samuels looked at is huge and was even-
tually interpreted on the level of families, within which numerous
genera were recognised or newly described (Rossman et al.
1999) with infrageneric, informal species groups of Nectria
accepted at the genus level (e.g., see Chaverri et al. 2011 and
subsequent studies). Applying the generic level to the numerous
nectria-like subgroups producing fusarioid conidia is therefore
another small but unavoidable step towards a taxonomic system
that allows distinguishing natural diversity above the species
level based on morphologically and phylogenetically well-defined
units.
When Colin Booth delivered his Presidential address to the
British Mycological Society in 1977, he chose the title “Do you
believe in genera?”. He addressed this topic based on his
interpretation of Nectriaceae (Booth 1978). Booth subsequently
showed that several “groups”of species formed fusarioid
asexual morphs, namely Gibberella (now Fusarium s. str.),
Haematonectria (now Neocosmospora), Nectria episphaeria
(now Cosmosporella and Dialonectria), and Calonectria rigid-
iuscula (now Albonectria). Booth concluded that the “fusarium
morphs”reflected “terms of convenience”rather than genea-
logical relationships. In moving to the one fungus = one name
nomenclature (Hawksworth et al. 2011,Wingfield et al. 2012),
Fusarium s. str. was chosen over Gibberella (Gr€
afenhan et al.
2011,Schroers et al. 2011,Rossman et al. 2013). As the genus
Fusarium was thus clearly well-defined, other Nectriaceae lin-
eages with a fusarium-like morphology were recognised
(Gr€
afenhan et al. 2011,Schroers et al. 2011,Lombard et al.
2015,Lechat & Fournier 2015). As we have shown here,
taxa are constantly being newly collected and added to the
phylogeny of Nectriaceae. The only stable option forward is to
apply and use the genus name Fusarium (= Gibberella)as
more precisely defined based on its own monophyletic node as
presented here (F3), supported by morphology, biochemistry,
and biology.
DISCLAIMER
The present paper represents a separate initiative to Geiser et al.
(NSF 1655980): A phylogenetic revisionary monograph of the
genus Fusarium.
ACKNOWLEDGEMENTS
The authors are grateful for the open discussions with David Geiser and Kerry
O'Donnell who have also shared their datasets for comparison in this study, as
well as several authors listed on their recent papers. Uwe Braun is thanked for his
contributions in compiling the list of Fusarium names, and checking the names
published on numerous old fungarium exsiccatae sheets.
APPENDIX A. SUPPLEMENTARY DATA
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.simyco.2021.100116.
REFERENCES
Abbas HK, Mirocha CJ (1988). Isolation and purification of a hemorrhagic factor
(wortmannin) from Fusarium oxysporum (N17B). Applied and Environmental
Microbiology 54: 1268–1274.
Abraham WR, Hanssen HP (1992). Fusoxysporone-a new type of diterpene
from Fusarium oxysporum.Tetrahedron 48: 10559–10562.
Al-Hatmi AMS, Ahmed SA, van Diepeningen AD, et al. (2018). Fusarium met-
avorans sp. nov.: The frequent opportunist ‘FSSC6’.Medical Mycology 56:
S144–S152.
Al-Hatmi AMS, Mirabolfathy M, Hagen F, et al. (2016). DNA barcoding, MALDI-
TOF, and AFLP data support Fusarium ficicrescens as a distinct species
within the Fusarium fujikuroi species complex. Fungal Biology 120:
265–278.
Al-Hatmi AMS, Normand AC, van Diepeningen AD, et al. (2015). Rapid iden-
tification of clinical members of Fusarium fujikuroi complex using MALDI-
TOF MS. Future Microbiology 10: 1939–1952.
Al-Hatmi AMS, Sandoval-Denis M, Nabet C, et al. (2019). Fusarium volatile:a
new potential pathogen from a human respiratory sample. Fungal Sys-
tematics and Evolution 4: 171–181.
Aoki T, Kasson MT, Berger MC, et al. (2018). Fusarium oligoseptatum sp. nov., a
mycosymbiont of the ambrosia beetle Euwallacea validus in the Eastern
U.S. and typification of F. ambrosium.Fungal Systematics and Evolution 1:
23–39.
Aoki T, O'Donnell K (1998). Fusarium kyushuense sp. nov. from Japan.
Mycoscience 39:1–6.
Aoki T, O'Donnell K (1999). Morphological and molecular characterization of
Fusarium pseudograminearum sp. nov., formerly recognized as the Group 1
population of F. graminearum.Mycologia 91: 597–609.
Aoki T, O'Donnell K, Ichikawa K (2001). Fusarium fractiflexum sp. nov. and two
other species within the Gibberella fujikuroi species complex recently
discovered in Japan that form aerial conidia in false heads. Mycoscience 42:
461–478.
Aoki T, O'Donnell K, Scandiani MM (2005). Sudden death syndrome of soybean
in South America is caused by four species of Fusarium: Fusarium brasi-
liense sp. nov., F. cuneirostrum sp. nov., F. tucumaniae, and F. virguliforme.
Mycoscience 46: 162–183.
Aoki T, Scandiani MM, O'Donnell K (2012). Phenotypic, molecular phylogenetic,
and pathogenetic characterization of Fusarium crassistipitatum sp. nov.,a
novel soybean sudden death syndrome pathogen from Argentina and Brazil.
Mycoscience 53: 167–186.
Aoki T, Smith JA, Kasson MT, et al. (2019). Three novel Ambrosia Fusarium
Clade species producing clavate macroconidia known (F. floridanum
and F. obliquiseptatum) or predicted (F. tuaranense) to be farmed by
Euwallacea spp. (Coleoptera: Scolytinae) on woody hosts. Mycologia 111:
919–935.
Aoki T, Smith JA, Mount LL, et al. (2013). Fusarium torreyae sp. nov., a
pathogen causing canker disease of Florida torreya (Torreya taxifolia), a
critically endangered conifer restricted to northern Florida and southwestern
Georgia. Mycologia 105: 312–319.
Aoki T, Tanaka F, Suga H, et al. (2012). Fusarium azukicola sp. nov., an exotic
azuki bean root-rot pathogen in Hokkaido, Japan. Mycologia 104: 1068–1084.
Aoki T, Vaughan MM, McCormick SP, et al. (2015). Fusarium dactylidis sp. nov.,
a novel nivalenol toxin-producing species sister to F. pseudograminearum
isolated from orchard grass (Dactylis glomerata) in Oregon and New Zea-
land. Mycologia 107: 409–418.
CROUS ET AL.
176

Aoki T, Vaughan MM, McCormick SP, et al. (2015). Fusarium dactylidis sp. nov.,
a novel nivalenol toxin-producing species sister to F. pseudograminearum
isolated from orchard grass (Dactylis glomerata) in Oregon and New Zea-
land. Mycologia 107: 409–418.
Aoki T, Geiser DM, Kasson M, et al. (2020). Nomenclatural novelties. Index
Fungorum 440:1–5.
Aoki T, O'Donnell K, Homma Y, et al. (2003). Sudden-death syndrome of soy-
bean is caused by two morphologically and phylogenetically distinct species
within the Fusarium solani species complex—F. virguliforme in North
America and F. tucumaniae in South America. Mycologia 95: 660–684.
Arnstein HRV, Cook AH (1947). Production of antibiotics by fungi. 3. Javanicin –
an antibacterial pigment from Fusarium javanicum.Journal of the Chemical
Society 1947: 1021–1028.
Arya HC, Jain GL (1962). Fusarium wilt of Eucalyptus.Phytopathology 52:
638–642.
Bachmann HP, Bobst C, Bütikofer U, et al. (2005). Occurrence and significance
of Fusarium domesticum alias Anticollanti on smear-ripened cheeses. LWT -
Food Science and Technology 38: 399–407.
Bamburg JR, Riggs NV, Strong FM (1968). The structures of toxins from two
strains of Fusarium tricinctum.Tetrahedron 24: 3329–3336.
Benyon FHL, Burgess LW, Sharp PJ (2000). Molecular genetic investigations
and reclassification of Fusarium species in sections Fusarium and Roseum.
Mycological Research 104: 1164–1174.
Berkeley MJ, Broome CE (1876). Notices of British fungi (1501–1630). Annals
and Magazine of Natural History 17: 129–145.
Bezuidenhout SC, Gelderblom WC, Gorst-Allman CP, et al. (1988). Structure
elucidation of the fumonisins, mycotoxins from Fusarium moniliforme.
Journal of the Chemical Society, Chemical Communications 11: 743–745.
BilaĭVI (1955). Fusarii (Biologija i sistematika). Isdatelstvo Akademii Nauk
Ukraniskoi SSE, Kiev, Ukraine (in Russian).
Bills GF, Gloer JB (2017). Biologically active secondary metabolites from the
fungi. In: The Fungal Kingdom (Heitman J, Howlett BJ, Crous PW, et al.,
eds). ASM Press, Washington D.C.: 1087–1119.
Booth C (1959). Studies of Pyrenomycetes: IV. Nectria (part 1). Mycological
papers 73:1–115.
Booth C (1964). Studies on Pyrenomycetes. VII. Mycological Papers 94:1–16.
Booth C (1971). The genus Fusarium. Commonwealth Mycological Institute,
Kew, Surrey, England.
Booth C (1978). Presidential address: Do you believe in genera? Transactions of
the British Mycological Society 71:1–9.
Braun U (1998). A monograph of Cercosporella, Ramularia and allied genera
(phytopathogenic Hyphomycetes):Vol. 2. IHW-Verlag, Munich, Germany.
Brayford D (1987). Fusarium bugnicourtii sp. nov., and its relationship to
F. tumidum and F. tumidum var. coeruleum.Transactions of the British
Mycological Society 89: 347–351.
Britz H, Steenkamp ET, Coutinho TA, et al. (2002). Two new species of
Fusarium section Liseola associated with mango malformation. Mycologia
94: 722–730.
Brown W (1928). Studies in the genus Fusarium. VI. General description of
strains, together with a discussion of the principles at present adopted in the
classification of Fusarium.Annals of Botany 42: 285–304.
Bugnicourt F (1952). Une esp
ece fusarienne nouvelle, parasite du riz. Revue
G
enerale de Botanique 59:13–18.
Burgess LW, Forbes GA, Windels C, et al. (1993). Characterization and distri-
bution of Fusarium acuminatum subsp. armeniacum subsp. nov. Mycologia
85:119–124.
Burgess LW, Nelson PE, Toussoun TA (1982). Characterization, geographic
distribution and ecology of Fusarium crookwellense sp. nov.Transactions of
the British Mycological Society 79: 497–505.
Burgess LW, Nelson PE, Toussoun TA, et al. (1985). Fusarium scirpi: emended
description and notes on geographic distribution. Mycologia 77: 212–218.
Burgess LW, Summerell BA (2000). Taxonomy of Fusarium: Fusarium arme-
niacum stat. & comb. nov.Mycotaxon 75: 347–348.
Burgess LW, Trimboli D (1986). Characterization and distribution of Fusarium
nygamai, sp. nov.Mycologia 78: 223–229.
Burkholder WH (1919). The dry root rot of bean. Memoirs of the Cornell Uni-
versity Agricultural Experimental Station 26:1003–1033.
Butler EJ, Khan AH (1913). Some new sugarcane diseases. Memoirs of the
Department of Agriculture in India.Botanical Series 6: 181–208.
Butler EJ (1910). The wilt disease of pigeon pea and the parasitism of Neo-
cosmospora vasinfecta Smith. Memoirs of the Department of Agriculture in
India 9:1–64.
Carbone I, Kohn LM (1999). A method for designing primer sets for speciation
studies in filamentous ascomycetes. Mycologia 91: 553–556.
Cardoso AMS (2015). Caracterizaç~
ao filogen
etica, biol
ogica e patog^
enica de
esp
ecies do complexo Fusarium solani associadas 
a podrid~
ao do colo do
maracujazeiro. MSc. dissertation. Departamento de Fitopatologia, Uni-
versidade Federal de Lavras, Brazil.
Carlucci A, Raimondo ML, Santos J, et al. (2012). Plectosphaerella species
associated with root and collar rots of horticultural crops in Southern Italy.
Persoonia 28:34–48.
Castell
a G, Bragulat MR, Rubiales MV, et al. (1997). Malachite green agar, a
new selective medium for Fusarium.Mycopathologia 137: 173–178.
Cavalcanti AD, da Silva Santos AC, de Oliveira Ferro L, et al. (2020). Fusarium
massalimae sp. nov. (F. lateritium species complex) occurs endophytically in
leaves of Handroanthus chrysotrichus.Mycological Progress 19:
1133–1142.
Chaverri P, Salgado C, Hirooka Y, et al. (2011). Delimitation of Neonectria and
Cylindrocarpon (Nectriaceae, Hypocreales, Ascomycota) and related genera
with cylindrocarpon-like anamorphs. Studies in Mycology 68:57–78.
Chen FJ (2000). Fusarium catenulatum sp. nov. from China. Mycosystema 19:
459–462.
Chen QT, Fu XH, Chen YD (1987). Two petroliphilous taxa of Fusarium.Acta
Mycologica Sinica Supplement 1: 328–333.
Chupp C (1954). A monograph of the fungus genus Cercospora. Published by
the author, Ithaca, New York.
Ciferri R (1955). Observations on meliolicolous Hyphales from Santo Domingo.
Sydowia 9: 296–335.
Costa MM, Melo MP, Carmo FS, et al. (2021). Fusarium species from tropical
grasses in Brazil and description of two new taxa. Mycological Progress 20:
61–72.
Costa SS, Matos KS, Tessmann DJ, et al. (2016). Fusarium paranaense sp.
nov., a member of the Fusarium solani species complex causes root rot on
soybean in Brazil. Fungal Biology 120:51–60.
Crous PW, Braun U (2003). Mycosphaerella and its anamorphs: 1. Names
published in Cercospora and Passalora.CBS Biodiversity Series 1:1–571.
Crous PW, Luangsa-ard JJ, Wingfield MJ, et al. (2018). Fungal Planet
description sheets: 785–867. Persoonia 41: 238 –417.
Crous PW, Wingfield MJ, Burgess TI, et al. (2016). Fungal Planet description
sheets: 469–557. Persoonia 37: 218 –403.
Crous PW, Shivas RG, Quaedvlieg W, et al. (2014). Fungal Planet description
sheets: 214–280. Persoonia 32: 184 –306.
Crous PW, Summerell BA, Carnegie AJ, et al. (2009). Unravelling Mycos-
phaerella: do you believe in genera? Persoonia 23:99–118.
Crous PW, Verkley GJM, Groenewald JZ, et al. (2019). Fungal Biodiversity. In:
Westerdijk Laboratory Manual Series 1. Westerdijk Fungal Biodiversity
Institute, Utrecht, The Netherlands.
Crous PW, Wingfield MJ, Burgess TI, et al. (2017). Fungal Planet description
sheets: 625–715. Persoonia 39: 270 –467.
Crous PW, Wingfield MJ, Lombard L, et al. (2019). Fungal Planet description
sheets: 951–1041. Persoonia 43: 223 –425.
Cummings MP, Meyer A (2005). Magic bullets and golden rules: Data sampling
in molecular phylogenetics. Zoology 108: 329–336.
Cutler HG, Arrendale RF, Springer JP, et al. (1987). Monorden from a
novel source, Neocosmospora tenuicristata: Stereochemistry and plant
growth regulatory properties. Agricultural and Biological Chemistry 51:
3331–3338.
Dall
eRosa P, Ramirez-Castrillon M, Valente P, et al. (2018). Fusarium riog-
randense sp. nov., a new species in the Fusarium solani species complex
causing fungal rhinosinusitis. Journal de Mycologie M
edicale 28:29–35.
Damm U, Cannon PF, Woudenberg JHC, et al. (2012). The Colletotrichum
acutatum species complex. Studies in Mycology 73:37–113.
Damm U, Cannon PF, Liu F, et al. (2013). The Colletotrichum orbiculare species
complex: important plant pathogens and mycoherbicides. Fungal Diversity
61:29–59.
Damm U, Woudenberg JHC, Cannon PF, et al. (2009). Colletotrichum
species with curved conidia from herbaceous hosts. Fungal Diversity 39:
45–87.
Davis JJ (1915). Notes on parasitic fungi in Wisconsin –I. Transactions of the
Wisconsin Academy of Sciences, Arts and Letters 18:78–92.
Dayarathne MC, Jones EBG, Maharachchikumbura SSN, et al. (2020). Morpho-
molecular characterization of microfungi associated with marine based
habitats. Mycosphere 11:1–188.
de Hoog GS, Gerrits van den Ende AHG (1998). Molecular diagnostics of
clinical strains of filamentous Basidiomycetes. Mycoses 41: 183–189.
Diekmann H (1970). Metabolic products of microorganisms. 81. Occurrence and
structures of coprogen B and dimerum acid. Archiv für Mikrobiologie 73:
65–76.
FUSARIUM REDELIMITED
www.studiesinmycology.org 177

de Vries GA, de Hoog GS, de Bruyn HP (1984). Phialophora cyanescens sp.
nov. with Phaeosclera-like synanamorph, causing white-grain mycetoma in
man. Antonie van Leeuwenhoek 50: 149–153.
Dickinson CH (1968). Gliomastix Gu
eguen. Mycological Papers 115:1–24.
Diederich P (1990). New or interesting lichenicolous fungi 1. Species from
Luxembourg. Mycotaxon 37: 297–330.
Dingley JM (1951). The Hypocreales of New Zealand II. The genus Nectria.
Transactions of the Royal Society of New Zealand 79: 177–202.
Dingley JM (1957). Life-history studies of New Zealand species of Nectria Fr.
Transactions of the Royal Society of New Zealand 83: 643–662.
Doidge EM (1938). Some South African fusaria. Bothalia 3: 331–483.
Domsch KH, Gams W, Anderson T-H (2007). Compendium of soil fungi. IHW-
Verlag, Eching, Germany.
Edwards J, Auer D, de Alwis S-K, et al. (2016). Fusarium agapanthi sp. nov., a
novel bikaverin and fusarubin-producing leaf and stem spot pathogen of
Agapanthus praecox (African lily) from Australia and Italy. Mycologia 108:
981–992.
Elmer WH, Marra RE (2011). New species of Fusarium associated with dieback
of Spartina alterniflora in Atlantic salt marshes. Mycologia 103: 806–819.
Evidente A, Conti L, Altomare C, et al. (1994). Fusapyrone and deoxy-
fusapyrone, two antifungal α-pyrones from Fusarium semitectum.Natural
Toxins 2:4–13.
Ezekiel CN, Kraak B, Sandoval-Denis M, et al. (2020). Diversity and toxigenicity
of fungi and description of Fusarium madaense sp. nov. from cereals, le-
gumes and soils in north-central Nigeria. MycoKeys 67:95–124.
Farr ML (1973). An annotated list of Spegazzini's fungus taxa. Bibliotheca
Mycologica 35: 503–507.
Fawcett HS (1908). Fungi parastic upon Aleyrodes citri. Master of Science
thesis. The University of the State of Florida, USA.
Felsenstein J (1985). Confidence limits on phylogenies: An approach using the
bootstrap. Evolution 39: 783–791.
Fisher NL, Burgess LW, Toussoun TA, et al. (1982). Carnation leaves as a
substrate and for preserving cultures of Fusarium species. Phytopathology
72: 151–153.
Forin N, Vizzini A, Nigris S, et al. (2020). Illuminating type collections of the
“nectriaceous”fungi in Saccardo's fungarium. Persoonia 45: 221–249.
Freeman S, Sharon M, Maymon M, et al. (2013). Fusarium euwallaceae sp. nov.
–a symbiotic fungus of Euwallacea sp., an invasive ambrosia beetle in
Israel and California. Mycologia 105: 1595–1606.
Fuckel KWGL (1863). Fungi Rhenanae Exsiccatae, Fasc. I–VIII.
Furumoto T, Fukuyama K, Hamasaki T, et al. (1995). Neovasipyrones and
neovasifuranones: Four new metabolites related to neovasinin, a phytotoxin
of the fungus, Neocosmospora vasinfecta.Phytochemistry 40: 745–751.
Furumoto T, Hamasaki T, Nakajima H (1997). Vasinfectins A and B: new phyto-
toxins from Neocosmospora vasinfecta.Tetrahedron Letters 38: 5523–5524.
Gargouri S, Balmas V, Burgess L, et al. (2020). An endophyte of Macrochloa
tenacissima (esparto or needle grass) from Tunisia is a novel species in the
Fusarium redolens species complex. Mycologia 112: 792–807.
Gams W (1971). Cephalosporium-artige Schimmelpilze. Fischer, Stuttgart,
Germany.
Gams W (1999). Report of the Committee for Fungi: 8. Taxon 48: 807–810.
Gams W, Gerlach M (1968). Beitr€
age zur Systematic und Biologie von Plec-
tosphaerella cucumeris und der zugehörigen Konidienform. Persoonia 5:
177–188.
Gams W, Klamer M, O'Donnell K (1999). Fusarium miscanthi sp. nov. from
Miscanthus litter. Mycologia 91: 263–268.
Gams W, Nirenberg HI, Seifert KA, et al. (1997). (1275) Proposal to conserve
the name Fusarium sambucinum (Hyphomycetes). Taxon 46:111–113.
Gao J, Radwan MM, Le
on F, et al. (2013). Neocosmospora sp.-derived resor-
cylic acid lactones with in vitro binding affinity for human opioid and
cannabinoid receptors. Journal of Natural Products 76: 824–828.
Geiser DM, Al-Hatmi AMS, Aoki T, et al. (2021). Phylogenomic analysis of a
55.1 kb 19-gene dataset resolves a monophyletic Fusarium that includes the
Fusarium solani species complex. Phytopathology.https://doi.org/10.1094/
PHYTO-08-20-0330-LE.
Geiser DM, Aoki T, Bacon CW, et al. (2013). One fungus, one name: Defining
the genus Fusarium in a scientifically robust way that preserves long-
standing use. Phytopathology 103: 400–408.
Geiser DM, Juba JH, Wang B, et al. (2001). Fusarium hostae sp. nov., a relative
of F. redolens with a Gibberella teleomorph. Mycologia 93: 670–678.
Geiser DM, Lewis Ivey ML, Hakiza G, et al. (2005). Gibberella xylarioides
(anamorph: Fusarium xylarioides), a causative agent of coffee wilt disease in
Africa, is a previously unrecognized member of the G. fujikuroi species
complex. Mycologia 97: 191–201.
Gerlach W (1977). Drei neue Variet€
aten von Fusarium merismoides, F. larvarum
und F. chlamydosporum.Phytopathologische Zeitschrift 90:31–42.
Gerlach W (1977). Fusarium lunulosporum spec. nov. von Grapefruit aus Süda-
frika, ein Fruchtf€
auleerreger. Phytopathologische Zeitschrift 88:280–284.
Gerlach W (1977). Fusarium robustum spec. nov., der Erreger einer Stammf€
aule
an Araucaria angustifolia (Bertol.) O. Kuntze in Argentinien? Phytopatholo-
gische Zeitschrift 88:29–37.
Gerlach W, Nirenberg H (1982). The genus Fusarium –a pictorial atlas. Mit-
teilungen aus der Biologischen Bundesanstalt für Land- und Forstwirtschaft
Berlin-Dahlem 209:1–406.
Gerlach W, Pag H (1961). Fusarium redolens Wr., seine phytopathologische
Bedeutung und eine an Dianthus-Arten gef€
aßparasit€
are Form (F. redolens
Wr. f. dianthi Gerlach). Phytopathologische Zeitschrift 42: 349–361.
German-Fattal M (2001). Fusafungine, an antimicrobial with anti-inflammatory
properties in respiratory tract infections. Clinical Drug Investigation 21:
653–670.
Giraldo A, Crous PW (2019). Inside Plectosphaerellaceae.Studies in Mycology
92: 227–286.
Gonz
alez CD, Chaverri P (2017). Corinectria, a new genus to accommodate
Neonectria fuckeliana and C. constricta sp. nov. from Pinus radiata in Chile.
Mycological Progress 16: 1015–1027.
Gordon WL (1952). The occurrence of Fusarium species in Canada. II. Prev-
alence and taxonomy of Fusarium species in cereal seeds. Canadian
Journal of Botany 30: 209–251.
Gordon WL (1959). The occurrence of Fusarium species in Canada. VI. Tax-
onomy and geographic distribution of Fusarium species in plants, insects,
and fungi. Canadian Journal of Botany 37: 257–290.
Gr€
afenhan T, Johnston PR, Vaughan MM, et al. (2016). Fusarium prae-
graminearum sp. nov., a novel nivalenol mycotoxin-producing pathogen
from New Zealand can induce head blight on wheat. Mycologia 108:
1229–1239.
Gr€
afenhan T, Schroers H-J, Nirenberg HI, et al. (2011). An overview of the
taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora,
Acremonium, Fusarium, Stilbella and Volutella.Studies in Mycology 68:
79–11 3.
Grove JF, Pople M (1979). Metabolic products of Fusarium larvarum Fuckel. The
fusarentins and the absolute configuration of monocerin. Journal of the
Chemical Society, Perkin Transactions 1 1979: 2048 –2051.
Guarnaccia V, Sandoval-Denis M, Aiello D, et al. (2018). Neocosmospora
perseae sp. nov., causing trunk cankers on avocado in Italy. Fungal Sys-
tematics and Evolution 1: 131–140.
Guarnaccia V, Van Niekerk J, Crous PW, et al. (2021). Neocosmospora spp.
associated with dry root rot of citrus in South Africa. Phytopathologia
Mediterranea 60:81–102.
Guo Y, Zhang D, Tang W (2018). Fusarium graminearum double (triple) mutants
generation using sexual crosses. Bio- 101: e2961.
Guu J-R, Ju Y-M, Hsieh H-J (2007). Nectriaceous fungi collected from forests in
Taiwan. Botanical Studies 48: 187–203.
Hall TA (1999). BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series
41:95–98.
Hawksworth DL (1979). The lichenicolous Hyphomycetes. Bulletin of the British
Museum (Natural History), Botany 6: 183–300.
Hawksworth DL, Crous PW, Redhead SA, et al. (2011). The Amsterdam
Declaration on Fungal Nomenclature. IMA Fungus 2:105–112.
Heath TA, Hedtke SM, Hillis DM (2008). Taxon sampling and the accuracy of
phylogenetic analyses. Journal of Systematics and Evolution 46: 239–257.
Hein B (1988). Liste der Arten und infraspecifischen Taxa von P. Hennings mit
Angabe der Typen in den Herbarien des Botanischen Museums Berlin-
Dahlem und des Instituts für Allgemeine Botanik in Hamburg. Englera 10:
1–374.
Henderson J, Dobson V (1994). Eastern & Central Arrernte to English dictionary.
IAD Press, Alice Springs, Australia.
Herron DA, Wingfield MJ, Wingfield BD, et al. (2015). Novel taxa in the
Fusarium fujikuroi species complex from Pinus spp. Studies in Mycology 80:
131–150.
Hirooka Y, Rossman AY, Samuels GJ, et al. (2012). A monograph of Allanto-
nectria, Nectria, and Pleonectria (Nectriaceae, Hypocreales, Ascomycota)
and their pycnidial, sporodochial, and synnematous anamorphs. Studies in
Mycology 71:1–210.
Hoang DT, Chernomor O, von Haeseler A, et al. (2018). UFBoot2: improving the
ultrafast bootstrap approximation. Molecular Biology and Evolution 35:
518–522.
CROUS ET AL.
178

Holubov
a-Jechov
a V, Gams W, Nirenberg HI (1994). Revisiones Generum
Obscurorum Hyphomycetum: a revision of the Selenosporium species
described by A.C.J. Corda. Sydowia 46: 247–256.
Hosoya T, Tubaki K (2004). Fusarium matuoi sp. nov. and its teleomorph
Cosmospora matuoi sp. nov.Mycoscience 45: 261–270.
Hu J, Chen C, Peever T, et al. (2012). Genomic characterization of the
conditionally dispensable chromosome in Alternaria arborescens provides
evidence for horizontal gene transfer. BMC Genomics 13: 171.
Huang SK, Jeewon R, Hyde KD, et al. (2018). Novel taxa within Nectriaceae:
Cosmosporella gen. nov. and Aquanectria sp. nov. from freshwater habitats
in China. Cryptogamie, Mycologie 39: 169–192.
Jacobs A, van Wyk PS, Marasas WFO, et al. (2010). Fusarium ananatum sp.
nov. in the Gibberella fujikuroi species complex from pineapples with fruit rot
in South Africa. Fungal Biology 114: 515–527.
Jacobs-Venter A, Laraba I, Geiser D, et al. (2018). Molecular systematics of two
sister clades, the Fusarium concolor and F. babinda species complexes, and
the discovery of a novel microcycle macroconidium-producing species from
South Africa. Mycologia 110: 1189–1204.
Jamalainen EA (1943). Über die fusarien Finnlands II. Valtion Maatalouskoe-
toiminnan Julkaisuja 123:1–24.
Jang JH, Asami Y, Jang JP, et al. (2011). Fusarisetin A, an acinar morpho-
genesis inhibitor from a soil fungus, Fusarium sp. FN080326. Journal of the
American Chemical Society 133: 6865–6867.
Jiang Z, Barret MO, Boyd KG, et al. (2002). JM47, a cyclic tetrapeptide HC-toxin
analogue from a marine Fusarium species. Phytochemistry 60:33–38.
Jim
enez M, Huerta T, Mateo R (1997). Mycotoxin production by Fusarium
species isolated from bananas. Applied and Environmental Microbiology 63:
364–369.
Joffe AZ (1974). A modern system of Fusarium taxonomy. Mycopathologia et
Mycologia Applicata 53: 201–228.
Jones EBG, Devadatha B, Abdel-Wahab MA, et al. (2020). Phylogeny of new
marine Dothideomycetes and Sordariomycetes from mangroves and deep-
sea sediments. Botanica Marina 63: 155–181.
Kalyaanamoorthy S, Minh BQ, Wong TKF, et al. (2017). ModelFinder: Fast
model selection for accurate phylogenetic estimates. Nature Methods 14:
587–589.
Katoh K, Rozewicki J, Yamada KD (2019). MAFFT online service: multiple
sequence alignment, interactive sequence choice and visualization. Briefings
in Bioinformatics 20: 1160–1166.
Kearse M, Moir R, Wilson A, et al. (2012). Geneious Basic: an integrated and
extendable desktop software platform for the organization and analysis of
sequence data. Bioinformatics 28: 1647–1649.
Ker
enyi Z, Moretti A, Waalwijk C, et al. (2004). Mating type sequences in
asexually reproducing Fusarium species. Applied and Environmental
Microbiology 70: 4419–4423.
Ker
enyi Z, Zeller KA, Hornok L, et al. (1999). Standardization of mating type
terminology in the Gibberella fujikuroi species complex. Applied and Envi-
ronmental Microbiology 65: 4071–4076.
Kim W, Cavinder B, Proctor RH, et al. (2019). Comparative genomics and
transcriptomics during sexual development gives insight into the life history
of the cosmopolitan fungus Fusarium neocosmosporiellum.Frontiers in
Microbiology 10: 1247.
Kimura Y, Hamasaki T, Nakajima H (1981). Isolation, identification and biological
activities of 8-O-methyl-javanicin produced by Fusarium solani.Agricultural
and Biological Chemistry 45: 2653–2654.
Kirk PM, Stalpers JA, Braun U, et al. (2013). A without-prejudice list of generic
names of fungi for protection under the International Code of Nomenclature
for algae, fungi, and plants. IMA Fungus 4: 381–443.
Klittich C, Leslie JF (1988). Nitrate reduction mutants of Fusarium moniliforme.
Genetics 118: 417 –423.
Klittich CJR, Leslie JF, Nelson PE, et al. (1997). Fusarium thapsinum (Gibberella
thapsina): a new species in section Liseola from sorghum. Mycologia 89:
643–652.
Komada H (1975). Development of a selective medium for quantitative isolation
of Fusarium oxysporum from natural soil. Review of Plant Protection
Research 8:114–124.
Kulkarni GB, Sajjan S, Koregrudar JB (2011). Pathogenicity of indole-acetic acid
producing fungus Fusarium delphinoides strain GPK towards chick pea and
pigeon pea. European Journal of Plant Pathology 131: 355–369.
Kulkarni GB, Sanjeevkumar C, Kirankumar B, et al. (2013). Indole-3-acetic acid
biosynthesis in Fusarium delphinoides strain GBK, a causal agent of wilt in
chick pea. Applied Biochemistry and Biotechnology 169: 1292–1305.
Kurobane I, Vining LC, Mcinnes AG, et al. (1980). Metabolites of
Fusarium solani related to dihydrofusarubin. Journal of Antibiotics 33:
1376–1379.
Kurtzman CP, Robnett CJ (1997). Identification of clinically important ascomy-
cetous yeasts based on nucleotide divergence in the 5' end of the large-
subunit (26S) ribosomal DNA gene. Journal of Clinical Microbiology 35:
1216–1223.
Kyekyeku JO, Kusari S, Adosraku RK, et al. (2017). Antibacterial secondary
metabolites from an endophytic fungus. Fusarium solani JK10. Fitoterapia
119: 108 –114.
Laraba I, Keddad A, Boureghda H, et al. (2017). Fusarium algeriense, sp. nov.,
a novel toxigenic crown rot pathogen of durum wheat from Algeria is
nested in the Fusarium burgessii species complex. Mycologia 109:
935–950.
Laraba I, Kim HS, Proctor RH, et al. (2020). Fusarium xyrophilum, sp. nov., a
member of the Fusarium fujikuroi species complex recovered from pseu-
doflowers on yellow-eyed grass (Xyris spp.) from Guyana. Mycologia 112:
39–51.
Laurence MH, Summerell BA, Burgess LW, et al. (2011). Fusarium burgessii sp.
nov. representing a novel lineage in the genus Fusarium.Fungal Diversity
49: 101–11 2.
Laurence MH, Walsh JL, Shuttleworth LA, et al. (2016). Six novel species of
Fusarium from natural ecosystems in Australia. Fungal Diversity 77:
349–366.
Lechat C, Fournier J (2015). Varicosporella, a new aquatic genus in the Nec-
triaceae from France. Ascomycete.org 7:1–8.
Lechat C, Fournier J, Nord
en B (2015). Stylonectria norvegica (Nectriaceae), a
new species from Norway. Ascomycete.org 7: 220–224.
Lee HS, Lee C (2012). Structural analysis of a new cytotoxic demethylated
analogue of neo-n-methylsansalvamide with a different peptide sequence
produced by Fusarium solani isolated from potato. Journal of Agricultural
and Food Chemistry 60: 4342–4347.
Leslie JF, Summerell BA (2006). The Fusarium laboratory manual. Blackwell
Publishing Professional, USA.
Leslie JF, Summerell BA, Bullock S, et al. (2005). Description of Gibberella
sacchari and neotypification of its anamorph Fusarium sacchari.Mycologia
97: 718–724.
Lima CS, Pfenning LH, Costa SS, et al. (2012). Fusarium tupiense sp. nov., a
member of the Gibberella fujikuroi complex that causes mango malformation
in Brazil. Mycologia 104: 1408–1419.
Lindegg G (1935). Cancro picciolare dell’acanto “Acanthus mollis”L. Rivista di
Patologia Vegetale 25: 229–235.
Link HF (1809). Observationes in ordines plantarum naturales. Dissertatio I
Magazin der Gesellschaft Naturforschenden Freunde Berlin 3:3–42.
Liu D, Li XM, Li CS, et al. (2013). Sesterterpenes and 2H-pyran-2-ones (=
α-pyrones) from the mangrove-derived endophytic fungus Fusarium pro-
liferatum MA-84. Helvetica Chimica Acta 96: 437–444.
Liu Q, Li JQ, Wingfield MJ, et al. (2020). Reconsideration of species boundaries
and proposed DNA barcodes for Calonectria.Studies in Mycology 97:
100106.
Liu YJ, Whelen S, Hall BD (1999). Phylogenetic relationships among ascomy-
cetes: evidence from an RNA polymerase II subunit. Molecular Biology and
Evolution 16: 1799–1808.
Lombard L, Houbraken J, Decock C, et al. (2016). Generic hyper-diversity in
Stachybotriaceae.Persoonia 36: 156–246.
Lombard L, Sandoval-Denis M, Lamprecht SC, et al. (2019). Epitypification of
Fusarium oxysporum –clearing the taxonomic chaos. Persoonia 43:1–47.
Lombard L, van der Merwe NA, Groenewald JZ, et al. (2014). Lineages in
Nectriaceae: re-evaluating the generic status of Ilyonectria and allied
genera. Phytopathologia Mediterranea 53: 515–532.
Lombard L, van der Merwe NA, Groenewald JZ, et al. (2015). Generic concepts
in Nectriaceae.Studies in Mycology 80: 189–245.
Lombard L, van Doorn R, Crous PW (2019). Neotypification of Fusarium
chlamydosporum –a reappraisal of a clinically important species complex.
Fungal Systematics and Evolution 4: 183–200.
Luo J, Zhuang WY (2008). Two new species of Cosmospora (Nectriaceae,
Hypocreales)from China. Fungal Diversity 31:83–93.
Lynn KMT, Wingfield MJ, Duran A, et al. (2020). Euwallacea perbrevis (Cole-
optera: Curculionidae: Scolytinae), a confirmed pest on Acacia crassicarpa
in Riau, Indonesia, and a new fungal symbiont; Fusarium rekanum sp. nov.
Antonie van Leeuwenhoek 113: 803–823.
Madelin MF (1966). Trichothecium acridiorum (Trabut) comb. nov. on red lo-
custs. Transactions of the British Mycological Society 49: 275–288.
FUSARIUM REDELIMITED
www.studiesinmycology.org 179

Marasas WFO, Nelson PE, Toussoun TA (1985). Fusarium dlaminii, a new
species from Southern Africa. Mycologia 77: 971–975.
Marasas WFO, Nelson PE, Toussoun TA, et al. (1986). Fusarium poly-
phialidicum, a new species from South Africa. Mycologia 78: 678–682.
Marasas WFO, Rabie CJ, Lübben A, et al. (1987). Fusarium napiforme, a new
species from millet and sorghum in Southern Africa. Mycologia 79: 910–914.
Marasas WFO, Rheeder JP, Lamprecht SC, et al. (2001). Fusarium andiyazi sp.
nov., a new species from sorghum. Mycologia 93: 1203–1210.
Marasas WFO, Rheeder JP, Logrieco A, et al. (1998). Fusarium nelsonii and
F. musarum: two new species in section Arthrosporiella related to
F. camptoceras.Mycologia 90: 505–513.
Marcano V, Benitez P, Palacios-Prü E (2001). Ecophysiological responses of a
new Fusarium grown in non-aromatic hydrocarbon media ƞ-C
12
.Revista
de Ecología Latinoamericana 8:1–19.
Marinach-Patrice C, Lethuillier A, Marly A, et al. (2009). Use of mass spec-
trometry to identify clinical Fusarium isolates. Clinical Microbiology and
Infection 15: 634–642.
Maryani N, Lombard L, Poerba YS, et al. (2019). Phylogeny and genetic di-
versity of the banana Fusarium wilt pathogen Fusarium oxysporum f. sp.
cubense in the Indonesian centre of origin. Studies in Mycology 92:
155–194.
Maryani N, Sandoval-Denis M, Lombard L, et al. (2019). New endemic Fusarium
species hitch-hiking with pathogenic Fusarium strains causing Panama
disease in small-holder banana plots in Indonesia. Persoonia 43:48–69.
Matsushima T (1971). Microfungi of the Solomon Islands and Papua-New
Guinea. Published by the author, Kobe, Japan.
Matuo T, Kobayashi T (1960). A new Fusarium, the conidial stage of Hypocrea
splendens Phil. et Plowr. Transactions of the Mycological Society of Japan
2(4): 13–15.
McAlpine D (1904). Two new fungi parasitic on scale insects. Journal of the
Department of Agriculture of Victoria 2: 646–648.
Minh BQ, Nguyen MAT, von Haeseler A (2013). Ultrafast approximation for
phylogenetic bootstrap. Molecular Biology and Evolution 30: 1188–1195.
Minh Q, Hahn MW, Lanfear R (2020). New methods to calculate concordance
factors for phylogenomic datasets. Molecular Biology and Evolution 37:
2727–2733.
Minh Q, Schmidt HA, Chernomor O, et al. (2020). IQ-TREE2: new models and
efficient methods for phylogenetic inference in the genomic era. Molecular
Biology and Evolution 37: 1530–1534.
Moussa TAA, Al-Zharani HS, Kadasa NMS, et al. (2017). Two new species of
the Fusarium fujikuroi species complex isolated from the natural environ-
ment. Antonie van Leeuwenhoek 110: 819–832.
Munkvold GP (2017). Fusarium species and their associated mycotoxins. In:
Mycotoxigenic fungi: methods and protocols (Moretti A, Susca A, eds),
Methods in Molecular Biology,1542. Springer, Amsterdam: 51–106.
Na F, Carrillo JD, Mayorquin JS, et al. (2018). Two novel fungal symbionts
Fusarium kuroshium sp. nov. and Graphium kuroshium sp. nov. of Kuroshio
shot hole borer (Euwallaceae sp. nr. fornicatus) cause fusarium dieback on
woody host species in California. Plant Disease 102: 1154–1164.
Nakajima H, Hamasaki T, Tanaka K, et al. (1989). Production of cyclosporin by
fungi belonging to the genus Neocosmospora.Agricultural and Biological
Chemistry 53: 2291–2292.
Nakajima H, Shimomura K, Furumoto T, et al. (1995). Neovasipyridones A, B
and C: Metabolites related to neovasinin, a phytotoxin of the fungus, Neo-
cosmospora vasinfecta.Phytochemistry 40: 1643–1647.
Nalim FA, Samuels GJ, Wijesundera RL, et al. (2011). New species from the
Fusarium solani species complex derived from perithecia and soil in the Old-
World tropics. Mycologia 103: 1302–1330.
Nash S, Snyder WC (1962). Quantitative estimations by plate counts of prop-
agules of the bean root rot Fusarium in field soils. Phytopathology 52:
567–572.
Nelson PE, Dignani MC, Anaissie EJ (1994). Taxonomy, biology, and clinical
aspects of Fusarium species. Clinical Microbiology Reviews 7:479–504.
Nelson PE, Toussoun TA, Burgess LW (1987). Characterization of Fusarium
beomiforme sp. nov.Mycologia 79: 884–889.
Nelson PE, Toussoun TA, Marasas WFO (1983). Fusarium species: An illus-
trated manual for identification. Pennsylvania State University Press, USA.
Nelson PE, Toussoun TA, Marasas WFO (1995). Neotypification and emended
description of Fusarium anguioides.Mycologia 87: 543–546.
Nenkep V, Yun K, Son BW (2016). Oxysporizoline, an antibacterial polycyclic
quinazoline alkaloid from the marine-mudflat-derived fungus Fusarium
oxysporum.Journal of Antibiotics 69: 709–711.
Nguyen LT, Schmidt HA, von Haeseler A, et al. (2015). IQ-TREE: a fast and
effective stochastic algorithm for estimating maximum-likelihood phylog-
enies. Molecular Biology and Evolution 32: 268–274.
Nilsson RH, Tedersoo L, Abarenkov K, et al. (2012). Five simple guidelines for
establishing basic authenticity and reliability of newly generated fungal ITS
sequences. Mycokeys 4:37–63.
Nirenberg HI (1976). Untersuchungen über die morphologische und biologische
Differenzierung in der Fusarium-Sektion Liseola.Mitteilungen aus der Bio-
logischen Bundesanstalt für Land- und Forstwirtschaft Berlin-Dahlem 169:
1–117.
Nirenberg HI (1981). A simplified method for identifying Fusarium spp. occurring
on wheat. Canadian Journal of Botany 59: 1599–1609.
Nirenberg HI (1990). Recent advances in the taxonomy of Fusarium.Studies in
Mycology 32:91–101.
Nirenberg HI (1995). Morphological differentiation of Fusarium sambucinum
Fuckel sensu stricto, F. torulosum (Berk. & Curt.) Nirenberg comb. nov. and
F. venenatum Nirenberg comb. nov.Mycopathologia 129: 131–141.
Nirenberg HI, Aoki T (1997). Fusarium nisikadoi, a new species from Japan.
Mycoscience 38: 329–333.
Nirenberg HI, Brielmaiers-Liebetanz U (1996). Nectria ipomoeae Halst., ana-
morph: Fusarium striatum Sherb. on Passiflora edulis Sims. Nachrichtenblatt
des Deutschen Pflanzenschutzdienstes 48: 270–275.
Nirenberg HI, Hagedorn G (2008). Fusarium nematophilum spec. nov.–ein
neuer Nematoden-assoziierter Pilz. Nachrichtenblatt des Deutschen Pflan-
zenschutzdienstes 60: 213–216.
Nirenberg HI, O'Donnell K (1998). New Fusarium species and combinations
within the Gibberella fujikuroi species complex. Mycologia 90: 434–458.
Nirenberg HI, Samuels GJ (2000). Nectria and Fusarium. II. Cosmospora
zealandica comb. nov. and its anamorph, Fusarium zealandicum sp. nov.
Canadian Journal of Botany 78: 1482–1487.
Nirenberg HI, O'Donnell K, Kroschel J, et al. (1998). Two new species of
Fusarium: Fusarium brevicatenulatum from the noxious weed Striga asiatica
and Fusarium pseudoanthophilum from Zea mays in Zimbabwe. Mycologia
90: 459–463.
Nylander JAA (2004). MrModeltest v. 2. Evolutionary Biology Centre. Uppsala
University. Programme distributed by the author.
O'Donnell K (1993). Fusarium and its near relatives. In: The fungal holomorph:
mitotic, meiotic and pleomorphic speciation in fungal systematics
(Reynolds DR, Taylor JW, eds). CAB International, UK: 225–233.
O'Donnell K (2000). Molecular phylogeny of the Nectria haematococca–
Fusarium solani species complex. Mycologia 92: 919–938.
O'Donnell K, Al-Hatmi AMS, Aoki T, et al. (2020). No to Neocosmospora: Phy-
logenomic and practical reasons for continued inclusion of the Fusarium
solani species complex in the genus Fusarium.mSphere 5: e00810–e00820.
O'Donnell K, Cigelnik E (1997). Two divergent intragenomic rDNA ITS2 types
within a monophyletic lineage of the fungus Fusarium are nonorthologous.
Molecular Phylogenetics and Evolution 7: 103–116.
O'Donnell K, Cigelnik E, Nirenberg HI (1998). Molecular systematics and phy-
logeography of the Gibberella fujikuroi species complex. Mycologia 90:
465–493.
O'Donnell K, Kistler HC, Cigelnik E, et al. (1998). Multiple evolutionary origins of
the fungus causing Panama disease of banana: Concordant evidence from
nuclear and mitochondrial gene genealogies. Proceedings of the National
Academy of Sciences of the USA 95: 2044–2049.
O'Donnell K, Kistler HC, Tacke BK, et al. (2000). Gene genealogies reveal global
phylogeographic structure and reproductive isolation among lineages of
Fusarium graminearum, the fungus causing wheat scab. Proceedings of the
National Academy of Sciences of the USA 97: 7905–7910.
O'Donnell K, McCormick SP, Busman M, et al. (2018). Marasas et al. 1984
“Toxigenic Fusarium species: Identity and mycotoxicology”revisited.
Mycologia 110: 1058 –1080.
O'Donnell K, Nirenberg HI, Aoki T, et al. (2000). A multigene phylogeny of the
Gibberella fujikuroi species complex: detection of additional phylogenetically
distinct species. Mycoscience 41:61–78.
O'Donnell K, Rooney AP, Proctor RH, et al. (2013). Phylogenetic analyses of
RPB1 and RPB2 support a middle Cretaceous origin for a clade comprising
all agriculturally and medically important fusaria. Fungal Genetics and
Biology 52:20–31.
O'Donnell K, Sarver BAJ, Brandt M, et al. (2007). Phylogenetic diversity
and microsphere array-based genotyping of human pathogenic
fusaria, including isolates from the multistate contact lens-associated U.S.
keratitis outbreak of 2005 and 2006. Journal of Clinical Microbiology 45:
2235–2248.
CROUS ET AL.
180

O'Donnell K, Sutton DA, Fothergill A, et al. (2008). Molecular phylogenetic di-
versity, multilocus haplotype nomenclature, and in vitro antifungal resistance
within the Fusarium solani species complex. Journal of Clinical Microbiology
46: 2477–2490.
O'Donnell K, Sutton DA, Rinaldi MG, et al. (2009). Novel multilocus sequence
typing scheme reveals high genetic diversity of human pathogenic members
of the Fusarium incarnatum-F. equiseti and F. chlamydosporum species
complexes within the United States. Journal of Clinical Microbiology 47:
3851–3861.
O'Donnell K, Sutton DA, Rinaldi MG, et al. (2010). Internet-accessible DNA
sequence database for identifying fusaria from human and animal infections.
Journal of Clinical Microbiology 48: 3708–3718.
O'Donnell K, Sutton DA, Wiederhold N, et al. (2016). Veterinary fusarioses within
the United States. Journal of Clinical Microbiology 54: 2813–2819.
O'Donnell K, Ward TJ, Aberra D, et al. (2008). Multilocus genotyping and
molecular phylogenetics resolve a novel head blight pathogen within the
Fusarium graminearum species complex from Ethiopia. Fungal Genetics
and Biology 45: 1514–1522.
O'Donnell K, Ward TJ, Geiser DM, et al. (2004). Genealogical concordance
between the mating type locus and seven other nuclear genes supports
formal recognition of nine phylogenetically distinct species within the
Fusarium graminearum clade. Fungal Genetics and Biology 41: 600–623.
Ohshima S, Yanagisawa M, Katoh A, et al. (1994). Fusarium merismoides
CORDA NR 6356, the source of the protein kinase C inhibitor, azepinostatin.
Taxonomy, yield improvement, fermentation and biological activity. Journal of
Antibiotics 47: 639–647.
Otero-Colina G, Rodríquez-Alvarado G, Fern
andez-Pavía S, et al. (2010).
Identification and characterization of a novel etiological agent of mango
malformation disease in Mexico, Fusarium mexicanum sp. nov.Phytopa-
thology 100: 1176–1184.
Padwick GW (1945). Notes on Indian fungi III. Mycological Papers 12:1–12.
Palm ME, Gams W, Nirenberg HI (1995). Plectosporium, a new genus for
Fusarium tabacinum, the anamorph of Plectosphaerella cucumerina.
Mycologia 87: 397–406.
Parish CA, Smith SK, Calati K, et al. (2008). Isolation and structure elucidation
of parnafungins, antifungal natural products that inhibit mRNA poly-
adenylation. Journal of the American Chemical Society 130: 7060–7066.
Pascoe IG (1990). Fusarium morphology I: Identification and characterization of
a third conidial type, the mesoconidium. Mycotaxon 37: 121–160.
Pasinetti L, Buzzati-Traverso A (1935). Su alcune forme di cancrena delle
cactacee dovute a nuovi micromiceti e ad un batterio. Giornale Botanico
Italiano 42:89–123.
Paziani MH, Carvalho LT, Melhem MSC, et al. (2020). First comprehensive report
of clinical Fusarium strains isolated in the state of Sao Paulo (Brazil) and
identified by MALDI-TOF MS and molecular biology. Microorganisms 8:66.
Penzig AGO (1882). Funghi agrumicoli: contribuzione allo studio dei funghi
parassiti degli agrumi. Padova, Italy.
Pereira CB, Ward TJ, Tessmann DJ, et al. (2018). Fusarium subtropicale, sp.
nov., a novel nivalenol mycotoxin–producing species isolated from barley
(Hordeum vulgare) in Brazil and sister to F. praegraminearum.Mycologia
110:860 –871.
Perera RH, Hyde KD, Maharachchikumbura SSN, et al. (2020). Fungi on wild
seeds and fruits. Mycosphere 11: 2108 –2480.
Petch T (1920). Studies in entomogenous fungi. The Nectriae parasitic on scale
insects. Transactions of the British Mycological Society 7: 133–166.
Pfenning L (1995). A new species of Neocosmospora from Brazil. Sydowia 47:
65–69.
Pfenning LH, de Melo MP, Costa MM, et al. (2019). Fusarium udum revisited: a
common, but poorly understood member of the Fusarium fujikuroi species
complex. Mycological Progress 18: 107–117.
Phan HT, Burgess LW, Summerell BA, et al. (2004). Gibberella gaditjirrii
(Fusarium gaditjirrii) sp. nov., a new species from tropical grasses in
Australia. Studies in Mycology 50: 261–272.
Pilat A (1938). Liste der von A. C. J. Corda beschriebenen Pilzarten, mit Angabe
der Originalexemplare, die im Herbarium des Nationalmuseums in Prag
aufbewahrt sind. Acta Musei Nationalis Pragae, Botanica no. 3, 1B no. 10.
Plattner PA, Nager U, Boller A (1948). Welkstoffe und Antibiotika. 7. Mitteilung.
Über die Isolierung neuartiger Antibiotika aus Fusarien. Helvetica Chimica
Acta 31: 594–602.
Price MN, Dehal PS, Arkin AP (2010). FastTree 2 –approximately maximum-
likelihood trees for large alignments. PLoS ONE 5: e9490.
Quaedvlieg W, Kema GHJ, Groenewald JZ, et al. (2011). Zymoseptoria gen.
nov.: a new genus to accommodate Septoria-like species occurring on
graminicolous hosts. Persoonia 26:57–69.
Raillo AI (1950). Griby roda Fusarium. Gosudarstv. Izd. Sel’skochoz. Lit.,
Moskva.
Rambaut A, Drummond AJ, Xie D, et al. (2018). Posterior summarization in
Bayesian phylogenetics using Tracer 1.7. Systematic Biology 67: 901–904.
Rayner RW (1970). A mycological colour chart. CMI and British Mycological
Society, Kew, Surrey, UK.
Reeb V, Lutzoni F, Roux C (2004). Contribution of RPB2 to multilocus
phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with
special emphasis on the lichen-forming Acarosporaceae and evolution of
polyspory. Molecular Phylogenetics and Evolution 32: 1036–1060.
Reddy GL, Reddy SM (1992). Production of IAA by some species of Fusarium.
National Academy Science Letters, India 15: 247–249.
Renner MK, Jensen PR, Fenical W (2000). Mangicols: structures and biosyn-
thesis of a new class of sesterterpene polyols from a marine fungus of the
genus Fusarium.Journal of Organic Chemistry 65: 4843–4852.
Rheeder JP, Marasas WF, Nelson PE (1996). Fusarium globosum, a new
species from corn in southern Africa. Mycologia 88: 509–513.
Ronquist F, Huelsenbeck JP (2003). MrBayes 3: Bayesian phylogenetic infer-
ence under mixed models. Bioinformatics 19: 1572–1574.
Roos A (1977). Physiology and pathogenicity of Neocosmospora vasinfecta EF
Smith. PhD thesis. ETH Zurich, Switzerland.
Rossman AY (1979). A preliminary account of the taxa described in Calonectria.
Mycotaxon 8: 485–558.
Rossman AY (1983). The phragmosporous species of Nectria and related
genera. Mycological Papers 150:1–164.
Rossman AY, Allen WC, Braun U, et al. (2016). Overlooked competing asexual
and sexually typified generic names of Ascomycota with recommendations
for their use or protection. IMA Fungus 7:289–308.
Rossman AY, Samuels GJ, Rogerson CT, et al. (1999). Genera of Bio-
nectriaceae, Hypocreaceae and Nectriaceae (Hypocreales, Ascomycetes).
Studies in Mycology 42:1–248.
Rossman AY, Seifert KA (2011). Phylogenetic revision of taxonomic concepts in
the Hypocreales and other Ascomycota. A tribute to Gary J. Samuels.
Studies in Mycology volume 68, CBS-KNAW Fungal Biodiversity Centre,
Utrecht, The Netherlands.
Rossman AY, Seifert KA, Samuels GJ, et al. (2013). Genera of Bionectriaceae,
Hypocreaceae and Nectriaceae (Hypocreales) proposed for acceptance and
rejection. IMA Fungus 4:41–51.
Rostrup E (1894). Sygdomme hos Landbrugsplanter foraarsagede af Snyltes-
vampe. Botanisches Zentralblatt 15: 284–285.
Saccardo PA (1892). Supplementum Universale, Pars II. Discomyceteae-
Hyphomyceteae. Sylloge Fungorum 10:1–964.
Saccardo PA (1899). Sylloge fungorum 14: 725–1316.
Saccardo PA (1906). Notae mycologicae. Series VII. Annales Mycologici 4:
273–278.
Salgado-Salazar C, Rossman AY, Chaverri P (2016). The genus Thelonectria
(Nectriaceae, Hypocreales, Ascomycota) and closely related species with
cylindrocarpon-like asexual states. Fungal Diversity 80:411–455.
Salichos L, Stamatakis A, Rokas A (2014). Novel information theory-based
measures for quantifying incongruence among phylogenetic trees. Molecular
Biology and Evolution 31: 1261–1271.
Samson RA (1974). Paecilomyces and some allied hyphomycetes. Studies in
Mycology 6:1–119.
Samson RA, Visagie CM, Houbraken J, et al. (2014). Phylogeny, identification
and nomenclature of the genus Aspergillus.Studies in Mycology 78:
141–173.
Samuels GJ (1976). A revision of the fungi formerly classified in Nectria subg.
Hyphonectria. Memoirs of the New York Botanical Garden 26:1–126.
Samuels GJ (1976). Perfect states of Acremonium the genera Nectria, Acti-
niopsis, Ijuhya, Neohenningsia, Ophiodictyon, and Peristomialis.New Zea-
land Journal of Botany 14: 231–260.
Samuels GJ (1978). Some species of Nectria having Cylindrocarpon imperfect
states. New Zealand Journal of Botany 16:73–82.
Samuels GJ (1988). Fungicolous, Lichenicolous, and Myxomyceticolous Species
of Hypocreopsis, Nectriopsis, Nectria, Peristomialis, and Trichonectria.New
York Botanical Garden 48:1–78.
Samuels GJ, Brayford D (1994). Species of Nectria (sensu lato) with red
perithecia and striate ascospores. Sydowia 46:75–161.
FUSARIUM REDELIMITED
www.studiesinmycology.org 181

Samuels GJ, Rogerson CT (1984). Nectria atrofusca and its anamorph, Fusa-
rium staphyleae, a parasite of Staphylea trifolia in eastern North America.
Brittonia 36:81–85.
Samuels GJ, Doi Y, Rogerson CT (1990). Hypocreales. In: Contributions toward
a mycobiota of Indonesia: Hypocreales, synnematous Hyphomycetes,
Aphyllophorales, Phragmobasidiomycetes, and Myxomycetes (Samuels GJ,
ed). New York Botanical Garden, New York: 6–108.
Samuels GJ, Hallett IC (1983). Microdochium stoveri and Monographella stoveri
new combinations for Fusarium stoveri and Micronectriella stoveri.Trans-
actions of the British Mycological Society 81: 473–483.
Samuels GJ, Lu B, Chaverri P, et al. (2009). Cyanonectria, a new genus for
Nectria cyanostoma and its Fusarium anamorph. Mycologial Progress 8:
49–58.
Samuels GJ, Nirenberg H (1989). Nectria and Fusarium.I.Nectria setofusariae
and its anamorph Fusarium setosum.Canadian Journal of Botany 67:
3372–3377.
Samuels GJ, Rossman AY, Lowen R, Rogerson CT (1991). A synopsis of
Nectria subgen. Dialonectria. Mycological Papers 164:1–48.
Sandoval-Denis M, Crous PW (2018). Removing chaos from confusion:
assigning names to common human and animal pathogens in Neo-
cosmospora.Persoonia 41: 109–129.
Sandoval-Denis M, Guarnaccia V, Polizzi G, et al. (2018). Symptomatic Citrus
trees reveal a new pathogenic lineage in Fusarium and two new Neo-
cosmospora species. Persoonia 40:1–25.
Sandoval-Denis M, Lombard L, Crous PW (2019). Back to the roots: a reap-
praisal of Neocosmospora.Persoonia 43:90–185.
Sandoval-Denis M, Swart WJ, Crous PW (2018). New Fusarium species from
the Kruger National Park, South Africa. MycoKeys 34:63–92.
Sangalang AE, Summerell BA, Burgess LW, et al. (1995). Taxonomy of
Fusarium: characterization of Fusarium avenaceum subsp. aywerte
and Fusarium avenaceum subsp. nurragi.Mycological Research 99:
287–290.
Santos ACS, Trindade JVC, Lima CS, et al. (2019). Morphology, phylogeny, and
sexual stage of Fusarium caatingaense and Fusarium pernambucanum,
new species of the Fusarium incarnatum-equiseti species complex associ-
ated with insects in Brazil. Mycologia 111: 244–259.
Sarver BAJ, Ward TJ, Gale LR, et al. (2011). Novel Fusarium head blight
pathogens from Nepal and Louisiana revealed by multilocus genealogical
concordance. Fungal Genetics and Biology 48: 1096–1107.
Sawai K, Okuno T, Terada Y, et al. (1981). Isolation and properties of two
antifungal substances from Fusarium solani.Agricultural and Biological
Chemistry 45: 1223–1228.
Scauflaire J, Gourgue M, Munaut F (2011). Fusarium temperatum sp. nov. from
maize, an emergent species closely related to Fusarium subglutinans.
Mycologia 103: 586–597.
Schneider R, Dalchow J (1975). Fusarium inflexum spec. nov., als Erreger einer
Welkekrankheit an Vicia faba L. in Deutschland. Phytopathologische Zeit-
schrift 82:70–82.
Schoch CL, Seifert KA, Huhndorf S, et al. (2012). Nuclear ribosomal internal
transcribed spacer (ITS) region as a universal DNA barcode marker for
Fungi. Proceedings of the National Academy of Sciences of the United
States of America 109: 6241–6246.
Schroers H-J, Baayen RP, Meffert JP, et al. (2004). Fusarium foetens, a new
species pathogenic to begonia elatior hybrids (Begonia xhiemalis) and the
sister taxon of the Fusarium oxysporum species complex. Mycologia 96:
393–406.
Schroers H-J, Gr€
afenhan T, Nirenberg HI, et al. (2011). A revision of Cyano-
nectria and Geejayessis gen. nov., and related species with fusarium-like
anamorphs. Studies in Mycology 68:115–138.
Schroers H-J, O'Donnell K, Lamprecht SC, et al. (2009). Taxonomy and phylogeny
of the Fusarium dimerum species group. Mycologia 101:44–70.
Schroers HJ, Samuels GJ, Zhang N, et al. (2016). Epitypification of Fusisporium
(Fusarium) solani and its assignment to a common phylogenetic species in
the Fusarium solani species complex. Mycologia 108: 806–819.
Secor GA, Rivera-Varas V, Christ DS, et al. (2014). Characterization of Fusarium
secorum,a new species causing Fusarium yellowing decline of sugar beet
in north central USA. Fungal Biology 118: 764 –775.
Seifert KA (1985). A monograph of Stilbella and some allied Hyphomycetes.
Studies in Mycology 27:1–235.
Seifert KA (1996). FusKey: Fusarium interactive key. Agriculture & Agri-Food
Canada. Research Branch, Eastern Cereal & Oilseed Research Centre,
Canada.
Seifert KA (2013). Pionnotes, a synonym of Dacrymyces rather than Fusarium.
Mycotaxon 123: 205–211.
Seifert KA, Gr€
afenhan T (2012). Lectotypification and characterization
of the natural phenotype of Fusarium bactridioides.Mycotaxon 120:415–422.
Shang QJ, Phookamsak R, Camporesi E, et al. (2018). The holomorph of
Fusarium celtidicola sp. nov. from Celtis australis.Phytotaxa 361: 251–265.
Sherbakoff CD (1915). Fusaria of potatoes. Memoirs of the Cornell University
Agricultural Experimental Station 6:87–270.
Sibilia C (1925). Due specie di Fusarium parasite di piantine di Conifere:
Fusarium fuliginosporum n. sp. e F. echinosporum n. sp. Annals of the
Institute of Forestry (Firenze) II 1:77–97.

Si
si
c A, Al-Hatmi AMS, Ba
canovi
c-
Si
si
cJ,et al. (2018). Two new species of the
Fusarium solani species complex isolated from compost and hibiscus (Hi-
biscus sp.). Antonie van Leeuwenhoek 111: 1785 –1805.

Si
si
cA,Ba

canovi
c-
Si
si
c J, Al-Hatmi AMS, et al. (2018). The ‘forma specialis’
issue in Fusarium: A case study in Fusarium solani f. sp. pisi.Scientific
Reports 8: 1252.
Skovgaard K, Rosendahl S, O'Donnell K, et al. (2003). Fusarium commune is a
new species identified by morphological and molecular phylogenetic data.
Mycologia 95: 630–636.
Sleiman S, Halliday CL, Chapman B, et al. (2016). Performance of matrix-
assisted laser desorption ionization time of flight mass spectrometry for
identification of Aspergillus, Scedosporium, and Fusarium spp. in the
Australian clinical setting. Journal of Clinical Microbiology 54: 2182–2186.
Snyder WC, Hansen HN (1940). The species concept in Fusarium.American
Journal of Botany 27:64–67.
Snyder WC, Hansen HN (1941). The species concept in Fusarium with refer-
ence to section Martiella.American Journal of Botany 28: 738–742.
Sogonov MV, Castlebury LA, Rossman AY, et al. (2007). The type species of
Apiognomonia, A. veneta, with its Discula anamorph is distinct from
A. errabunda.Mycological Research 111: 693 –709.
Sorauer P (1923). Handbuch der Pflanzenkrankheiten. Verlagbuchhandlung
Paul Parey, Berlin, Germany.
Sørensen JL, Akk E, Thrane U, et al. (2013). Production of fusarielins by
Fusarium.International Journal of Food Microbiology 160: 206–211.
Stamatakis A (2014). RAxML version 8: a tool for phylogenetic analysis and
post-analysis of large phylogenies. Bioinformatics 30: 1312–1313.
Starkey DE, Ward TJ, Aoki T, et al. (2007). Global molecular surveillance re-
veals novel Fusarium head blight species and trichothecene toxin diversity.
Fungal Genetics and Biology 44: 1191–1204.
Steenkamp ET, Wingfield BD, Coutinho TA, et al. (2000). PCR-based identifi-
cation of MAT-1 and MAT-2 in the Gibberella fujikuroi species complex.
Applied and Environmental Microbiology 66: 4378–4382.
Steyaert RL (1948). Contribution a l’
etude des parasites des v
eg
etaux du Congo
Belge. Bulletin de la Soci
et
e Royale de Botanique de Belgique T80, Fasc 1/
2:11–58.
Strasser PP (1910). Fünfter Nachtrag zur Pilzflora des Sonntagberges (N.-€
O.),
1909. Verhandlungen der Zoologisch-Botanischen Gesellschaft Wien 60:
303–335.
Stukenbrock EH, Jørgensen FG, Zala M, et al. (2010). Whole-genome
and chromosome evolution associated with host adaptation and speciation
of the wheat pathogen Mycosphaerella graminicola.PLoS Genetics 6:
e1001189.
Subrahmanyam A (1983). Fusarium laceratum.Mykosen 26: 478–480.
Subramanian CV (1971). Hyphomycetes. An account of Indian species, except
Cercosporae. Indian Council of Agricultural Research, New Delhi, India.
Sugimoto Y, Ahmed NE, Yasuda N, et al. (2002). Trichothecene inhibitors of
Striga hermonthica germination produced by Fusarium solani.Weed Sci-
ence 50: 658–661.
Summerell BA, Rugg CA, Burgess LW (1995). Characterization of Fusarium
babinda sp. nov.Mycological Research 99: 1345–1348.
Summerell BA, Salleh B, Leslie JF (2003). A utilitarian approach to Fusarium
identification. Plant Disease 87:117–128.
Sutton BC (1986). Presidential address: Improvizations on conidial themes.
Transactions of the British Mycological Society 86:1–38.
Sydow H, Sydow P (1939). Fungi aequatorienses. Annales Mycologici 37:
275–438.
Tatsuno T, Saito M, Enomoto M, et al. (1968). Nivalenol, a toxic principle of
Fusarium nivale.Chemical and Pharmaceutical Bulletin 16: 2519–2520.
Taubenhaus JJ (1920). Wilts of the watermelon and related crops (Fusarium
wilts of cucurbits.). Bulletin of the Texas Agricultural Experiment Station 260:
3–49.
CROUS ET AL.
182

Taylor JW (2014). Appropriately sized genera and appropriately ranked higher
taxa. IMA Fungus 5:1–2.
Taylor JW, Jacobson DJ, Kroken S, et al. (2000). Phylogenetic species
recognition and species concepts in fungi. Fungal Genetics and Biology 31:
21–32.
Thines M (2019). An evolutionary framework for host shifts–jumping ships for
survival. New Phytologist 224: 605–617.
Tianpanich K, Prachy S, Wiyakrutta S, et al. (2011). Radical scavenging and
antioxidant activities of isocoumarins and a phthalide from the endophyte
fungus Colletotrichum sp. Journal of Natural Products 74:79–81.
Tio ML, Burgess W, Nelson PE, et al. (1977). Techniques for the isolation,
culture, and preservation of the Fusaria. Australasian Plant Pathology So-
ciety Newsletter 6:11–13.
Torbati M, Arzanlou M, Sandoval-Denis M, et al. (2019). Multigene phylogeny
reveals new fungicolous species in the Fusarium tricinctum species complex
and novel hosts in the genus Fusarium from Iran. Mycological Progress 18:
119 –133.
Torp M, Nirenberg HI (2004). Fusarium langsethiae sp. nov. on cereals in
Europe. International Journal of Food Microbiology 95: 247–256.
Triest D, De Cremer K, Pi
erard D, et al. (2016). Unique phylogenetic lineage
found in the Fusarium-like clade after re-examining BCCM/IHEM fungal
culture collection material. Mycobiology 44: 121–130.
Triest D, Stubbe D, de Cremer K, et al. (2015). Use of matrix-assisted laser
desorption ionization–time of flight mass spectrometry for identification of
molds of the Fusarium genus. Journal of Clinical Microbiology 53: 465–476.
Tulloch M (1972). The genus Myrothecium Tode ex Fr. Mycological Papers 130:
1–42.
Turland NJ, Wiersema JH, Barrie FR, et al. (eds) (2018). International Code of
Nomenclature for algae, fungi, and plants (Shenzhen Code). Regnum
Vegetabile 159. Koeltz Botanical Books, Glashütten, Germany.
Ueda S, Udagawa S (1983). A new Japanese species of Neocosmospora from
marine sludges. Mycotaxon 16: 387–395.
Ueno Y, Ishii K, Sakai K, et al. (1972). Toxicological approaches to the me-
tabolites of fusaria. IV. Microbial survey on "bean hulls poisoning of horses"
with the isolation of toxic trichothecenes, neosolaniol and T-2 toxin of
Fusarium solani M-1-1. Japanese Journal of Experimental Medicine 42:
187–203.
Urry WH, Wehrmeister HL, Hodge EB, et al. (1966). The structure of zear-
alenone. Tetrahedron Letters 7: 3109–3114.
van Hove F, Waalwijk C, Logrieco A, et al. (2011). Gibberella musae (Fusarium
musae) sp. nov., a recently discovered species from banana is sister to
F. verticillioides.Mycologia 103: 570–585.
van Wyk PS, Scholtz DJ, Los O (1986). A selective medium for the isolation of
Fusarium spp. from soil debris. Phytophylactica 18:67–69.
Vellinga EC, Kuyper TW, Ammirati J, et al. (2015). Six simple guidelines for
introducing new genera of fungi. IMA fungus 6:65–68.
Vesonder RF, Tjarks LW, Rohwedder WK, et al. (1979). Equisetin, an antibiotic
from Fusarium equiseti NRRL 5537, identified as a derivative of n-methyl-
2,4-pyrollidone. Journal of Antibiotics 32: 759–761.
Vilgalys R (2003). Taxonomic misidentification in public DNA databases. New
Phytologist 160:4–5.
Vilgalys R, Hester M (1990). Rapid genetic identification and mapping of
enzymatically amplified ribosomal DNA from several Cryptococcus species.
Journal of Bacteriology 172: 4238–4246.
Vilgalys R, Sun BL (1994). Ancient and recent patterns of geographic speciation
in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ri-
bosomal DNA sequences. Proceedings of the National Academy of Science
of the USA 91: 4599–4603.
Vincens F (1915). Deux champignons entomophytes sur L
epidopt
eres,
r
ecolt
es au nord du Br
esil. Bulletin de la Soci
et
e Mycologique de France 31:
25–28.
Visagie CM, Houbraken J, Frisvad JC, et al. (2014). Identification and nomen-
clature of the genus Penicillium.Studies in Mycology 78: 343–371.
Voglmayr H, Thines M (2007). Phylogenetic relationships and nomenclature of
Bremiella sphaerosperma (Chromista,Peronosporales). Mycotaxon 100:
11–20.
von Bargen KW, Niehaus EM, Bergander K, et al. (2013). Structure elucidation
and antimalarial activity of apicidin F: an apicidin-like compound produced
by Fusarium fujikuroi.Journal of Natural Products 76: 2136–2140.
von Höhnel F (1915). Fragmente zur Mykologie (XVII. Mitteilung, Nr. 876 bis
943). Sitzungsberichte der mathematisch-naturwissenschaftlichen Klasse
der Kaiserlichen Akademie der Wissenschaften, Wien 124:49–159.
Walker J (1962). Notes on plant parasitic fungi. I. Proceedings of the Linnean
Society of New South Wales 87: 162–176.
Walsh JL, Laurence MH, Liew ECY, et al. (2010). Fusarium: two endophytic
novel species from tropical grasses of northern Australia. Fungal Diversity
44: 149–159.
Wang MM, Chen Q, Diao YZ, et al. (2019). Fusarium incarnatum-equiseti
complex from China. Persoonia 43:70–89.
Ward TJ, Bielawski JP, Kistler HC, et al. (2002). Ancestral polymorphism and
adaptive evolution in the trichothecene mycotoxin gene cluster of phyto-
pathogenic Fusarium.Proceedings of the National Academy of Sciences of
the USA 99: 9278–9283.
Wergen B (2018). Handbook of Ascomycota. Vol. Ib. Pyrenomycetes s.l. mit
zweifach septierten bis mauerförmigen Sporen. Funghiparadise Productions,
Germany.
White TJ, Bruns T, Lee S, et al. (1990). Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. In: PCR protocols: a guide to
methods and applications (Innes MA, Gelfand DH, Sninsky JJ, et al., eds).
Academic Press, USA: 315–322.
Wigmann EF, Behr J, Vogel RF, et al. (2019). MALDI-TOF MS fingerprinting
for identification and differentiation of species within the Fusarium
fujikuroi species complex. Applied Microbiology and Biotechnology 103:
5323–5337.
Willkomm M (1866). Die mikroskopischen Feinde des Waldes: Natur-
wissenschaftliche Beitr€
age zur Kenntniss der Baum- und Holzkrankheiten,
für Forstm€
anner und Botaniker, bearbeitet und in zwanglosen Heften her-
ausgegeben. G. Schönfeld's Buchhandlung, Dresden, Germany.
Wingfield MJ, De Beer ZW, Slippers B, et al. (2012). One fungus, one name
promotes progressive plant pathology. Molecular Plant Pathology 13:
604–613.
Wollenweber HW (1914). Identification of species of Fusarium occurring on the
sweet potato, Ipomoea batatas.Journal of Agricultural Research 2:251–285.
Wollenweber HW (1916–1935). Fusaria autographice delineata. Selbstverlag,
Berlin, Germany.
Wollenweber HW (1924). Pyrenomyceten-Studien. I. Angewandte Botanik 6:
300–313.
Wollenweber HW (1926). Pyrenomyceten-Studien. II. Angewandte Botanik 8:
168–212.
Wollenweber HW (1934). Fusarium bactridioides sp. nov., associated with
Cronartium.Science New York 79: 572.
Wollenweber HW (1943). Fusarium-Monographie. II. Fungi parasitici et sapro-
phytici. Zentralblatt für Bakteriologie Abt. 2 106: 104–135.
Wollenweber HW, Reinking OA (1925). Aliquot Fusaria tropicalia nova vel
revisa. Phytopathology 15: 155–169.
Wollenweber HW, Reinking OA (1935). Die Fusarien. Verlagsbuchandlung Paul
Parey, Berlin, Germany.
Woudenberg JHC, Aveskamp MM, de Gruyter J, et al. (2009). Multiple Didy-
mella teleomorphs are linked to the Phoma clematidina morphotype. Per-
soonia 22:56–62.
Xia JW, Sandoval-Denis M, Crous PW, et al. (2019). Numbers to names –
reappraisal of the Fusarium incarnatum-equiseti species complex. Persoonia
43: 186–221.
Xu Y, Vinas M, Alsarraq A, et al. (2019). Bis-naphthopyrone pigments protect
filamentous ascomycetes from a wide range of predators. Nature Commu-
nications 10: 3579.
Yamamoto W, Maeda M, Oyasu N (1957). Some Nectriaceae and Elsinoe
species from Japan. Science Reports of the Hyogo University of Agriculture.
Series agricultural biology 3:15–18.
Yilmaz N, Sandoval-Denis M, Lombard L, et al. (2021). Redefining species
limits in the Fusarium fujikuroi species complex. Persoonia 46:
129–162.
Yli-Mattila T, Ward T, O'Donnell K, et al. (2011). Fusarium sibiricum sp. nov,a
novel type A trichothecene-producing Fusarium from northern Asia closely
related to F. sporotrichioides and F. langsethiae.International Journal of
Food Microbiology 147:58–68.
Yli-Mattila Y, Gagkaeva T, Ward TJ, et al. (2009). A novel Asian clade within
the Fusarium graminearum species complex includes a newly discovered
cereal head blight pathogen from the Far East of Russia. Mycologia 101:
841–852.
Yoshida K, Saitoh H, Fujisawa S, et al. (2009). Association genetics reveals
three novel avirulence genes from the rice blast fungal pathogen Magna-
porthe oryzae.The Plant Cell 21: 1573–1591.
FUSARIUM REDELIMITED
www.studiesinmycology.org 183

Yoshizawa T, Morooka N (1973). Deoxynivalenol and its monoacetate: new
mycotoxins from Fusarium roseum and moldy barley. Agricultural and Bio-
logical Chemistry 37: 2933–2934.
Zeller KA, Summerell BA, Bullock S, et al. (2003). Gibberella konza (Fusarium
konzum) sp. nov. from prairie grasses, a new species in the Gibberella
fujikuroi species complex. Mycologia 95: 943–954.
Zeng ZQ, Zhuang WY (2017). Eight new combinations of Bionectriaceae and
Nectriaceae.Mycosystema 36: 278–281.
Zeng ZQ, Zhuang WY (2017). Two new species of Neocosmospora from China.
Phytotaxa 319: 175–183.
Zeng ZQ, Zheng HD, Wang XC, et al. (2020). Ascomycetes from the Qilian
Mountains, China –Hypocreales.MycoKeys 71:119–137.
Zhang FA, Liu S-R, Zhou X-J, et al. (2020). Fusarium xiangyunensis (Nec-
triaceae), a remarkable new species of the Nematophagus fungi from
Yunnan, China. Phytotaxa 450: 273–284.
Zhang XM, Zhuang WY (2003). Re-examinations of Bionectriaceae and Nec-
triaceae (Hypocreales) from temperate China on deposit in HMAS. Nova
Hedwigia 76: 191–200.
Zhao ZH, Lu GZ (2008). Fusarium sinensis sp. nov., a new species from wheat
in China. Mycologia 100: 746–751.
Zhou G, Qiao L, Zhang X, et al. (2019). Fusaricates H-K and fusalanones A-B
from a mangrove endophytic fungus Fusarium solani HDN15-410. Phyto-
chemistry 158:13–19.
Zhou X, O'Donnell K, Aoki T, et al. (2016). Two novel Fusarium species
that cause canker disease of prickly ash (Zanthoxylum bungeanum)in
northern China form a novel clade with Fusarium torreyae.Mycologia 108:
668–681.
Zhuang WY, Nong Y, Luo J (2007). New species and new Chinese records of
Bionectriaceae and Nectriaceae (Hypocreales, Ascomycetes) from Hubei,
China. Fungal Diversity 24: 347–357.
Zoutman DE, Sigler L (1991). Mycetoma on the foot caused by Cylindrocarpon
destructans.Journal of Clinical Microbiology 29: 1839–1855.
Zwickl DJ, Hillis DM (2002). Increased taxon sampling greatly reduces phylo-
genetic error. Systematic Biology 51: 588–598.
CROUS ET AL.
184