New Records of lichenized fungi for Antarctica

Abstract

Three lichenized fungal species collected from James Ross Island (Eastern coast of
Antarctic Peninsula): Cladonia acuminata (Ach.) Norrl., Rhizocarpon pusillum Runemark
and Rhizoplaca parilis S.D. Leav., Fern.-Mend., Lumbsch, Sohrabi & St. Clair are reported from Antarctica for the first time. Detailed morphological and anatomical properties of these species along with photographes based on Antarctic specimens are provided here. In addition, the nrITS gene regions of the selected specimens are studied and the phylogenetic positions of the species are discussed. The nrITS data for Rhizocarpon pusillum is provided for the first time. According to our studies the lichen biodiversity of Antarctica is still poorly known and molecular studies are very important in order to present the correct lichen biodiversity of Antarctica.

Full text

New records of lichenized fungi for Antarctica
Mehmet Gökhan HALICI
1
*, Merve KAHRAMAN
1
, Osman OSMANOĞLU
1
and Milos BARTAK
2
1
Department of Biology, Faculty of Science, Erciyes University, 380 39 Kayseri, Turkey
2
Department of Experimental Biology, Section of Plant Physiology, Masaryk University,
Kamenice 5, 625 00 Brno, Czech Republic
*coresponding author mghalici@gmail.com
Abstract: Three lichenized fungal species collected from James Ross Island (eastern coast
of Antarctic Peninsula): Cladonia acuminata (Ach.) Norrl., Rhizocarpon pusillum
Runemark and Rhizoplaca parilis S.D. Leav., Fern.-Mend., Lumbsch, Sohrabi et St. Clair
are reported from Antarctica for the first time. Detailed morphological and anatomical
properties of these species along with photographes based on Antarctic specimens are
provided here. In addition, the nrITS gene regions of the selected specimens are studied and
the phylogenetic positions of the species are discussed. The nrITS data for Rhizocarpon
pusillum is provided for the first time. According to our studies the lichen biodiversity of
the Antarctic is still poorly known and molecular studies are very important in order to
present the correct lichen biodiversity of Antarctica.
Keywords: Antarctic, biodiversity, James Ross Island, lichens.
Introduction
Antarctica is a continent dominated by lower plant groups in deglaciated
areas. The flora of the Antarctic is composed predominantly of mosses and
lichens with a few liverwort species and two native species of vascular plants
(Øvstedal and Lewis Smith 2001).
In Antarctic lichens a diversity gradient exists along the Antarctic Peninsula
with a strong decline in species richness from 62°S to around 70
o
S (Peat et al.
2007). These authors report that the distribution pattern of Antarctic lichens
shows 3 clusters – (1) the South Orkney and South Shetland Islands and the
vol. 42 no. 3, pp. 203–219, 2021 10.24425/ppr.2021.137145
Copyright © 2021. Mehmet Gökhan Halici, Merve Kahraman Osman Osmanoğlu and Milos Bartak. This is an open-
access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License
(CC BY-NC-ND 3.0 https://creativecommons.org/licenses/by-nc-nd/3.0/), which permits use, distribution, and
reproduction in any medium, provided that the article is properly cited, t he use is non-commercial, and no
modifications or adaptations are made.

northern and western sections of the Antarctic Peninsula; (2) the eastern and
southern sections of the Antarctic Peninsula; and (3) Eastern Antarctica. James
Ross Island belongs to the region fitting group 2 which, according to Terauds and
Lee (2016), belongs to the the North-East Antarctic Peninsula region. The lichen
flora of the James Ross Island has been investigated by Øvstedal and Lewis Smith
(2001) and a comprehensive list of species known for the island is available in the
herbarium of the British Antarctic Survey (BAS) and from their database
(Antarctic Plant Database). Recently, over 100 lichen species are reported for
James Ross Island and the Trinity Peninsula in the above-mentioned database.
Within last decade, several ecological and ecophysiological studies have been
published covering different aspects of lichen abundance at the James Ross Island,
such as local microclimate effects on lichen abundance (Láska et al. 2011), and
sucessional gradient (Bohuslavová et al. 2018). A recent study (Sancho et al.
2019) gave an overview of the lichen flora in the Antarctic, especially in the
relation to lichen responses to environmental factors including global change. The
authors suggest that lichen growth and diversity (1) might be used for
biomonitoring of environmental changes, and (2) contribute to our understanding
of drivers of climate change responses in the Antarctic. At James Ross Island
some lichen species have been used for the study of lichen responses to long-term
manipulated warming effects using the approach of open top chambers (Barták
et al. 2019). Within the last decade, several new lichen species have been recorded
from James Ross Island as the materials collected during an expedition in 2017,
where we participated, are gradually analyzed and determined with molecular
taxonomic tools (e.g., Halici et al. 2017, 2018). In the present study, we bring
records and supplementary description of three lichen species newly found at
James Ross Island with DNA based identification methods.
Materials and methods
Samples of lichenized fungi were collected from James Ross Island which
belongs to the North-East Antarctic Peninsula region (Terauds and Lee 2016). The
specimens detailed below are deposited in Erciyes University Herbarium Kayseri,
Turkey (ERCH). They were numbered starting with ‘JR’ and added to the database
of the herbarium under those numbers. All the lichen specimens were examined by
standard microscopic techniques. Hand-cut sections were studied in water,
potassium hydroxide (KOH) and Lugol’s solution (I). Measurements were made
in water. Ascospores were measured from five different ascomata for each species.
The measurements are given as minimum–maximum, from N measurements. TLC
(Thin-Layer Chromotography) was carried out to determine some of the
compounds, using solvent system C (Orange et al. 2001) when the results of
spot tests were inconclusive. The descriptions summarized below for each species
are based on the specimens collected from James Ross Island by the authors.
204 Mehmet Gökhan Halici, Merve Kahraman Osman Osmanoğlu and Milos Bartak

DNA isolation, PCR and sequencing. — Samples of freshly collected
specimens were cleaned under a stereoscopic microscope and ground in 2 ml
Eppendorf tubes with sterile plastic pestles. Total DNA was extracted from
apothecia by using the DNeasy Plant Mini Kit (Qiagen) according to the
manufacturer’s instructions. PCR was carried out in 50 μL reaction volumes
using 25 μl of Trans Bio Novo 2x Easy Taq
©
PCR Super Mix (Catalog No.
AS111), 1 μl of each primer (ITS1F and ITS4), 4 μl of genomic DNA and 19 μl
nuclease free water on a thermal cycler equipped with a heated lid. ITS4
(TCCTCCGCTTATTGATATGC) (White et al. 1990) and ITS1-F (CTTG
GTCATTTAGAGGAAGTAA, Gardes and Bruns 1993) were used to amplify
the ITS sequences. Polymerase chain reaction (PCR) amplification was
performed under the following conditions: an initial denaturation for 5 min. at
95°C; 10 cycles at 30 sec. at 95°C, 30 sec. at 55°C, and 1 min. at 72°C; and 25
cycles with 30 sec. at 95°C, 30 sec. at 52°C, and 1 min. at 72°C. A final extension
step of 8 min. at 72°C was added, after which the samples were kept at 4°C. The
PCR products were visualized on 1.6% agarose gel as a band of approximately
500 or 700 bp.
Sequence alignment and phylogenetic analysis. — Sequence analyses of
the lichen samples obtained from the PCR products were performed by the BM
Labosis laboratory. Sequence results of the lichen samples were checked in
GenBank (NCBI) by blast similarity search. Our ITS sequences plus sequences
obtained from Genbank were aligned by the ClustalW plug-in in the BioEdit
program (Hall 1999) and manually adjusted. The selection of sequences from
Genbank was made by considering the morphological relationships as well as the
molecular results of the studied samples (Table 1). For the reconstruction of
phylogenetic trees, the MEGA 7 (Molecular Evolutionary Genetics Analysis)
program was used (Tamura et al. 2013). Maksimum Likelihood was chosen,
using the model Kimura 2-parameter. Pairwise deletion was applied to gaps in
data and, for a control, the reliability of the inferred tree was tested by 1,000
bootstrap replications. The out-groups used in the phylogenetic trees were chosen
to be phylogenetically related with the in-groups.
Table 1
List of species used in phylogenetic trees. The newly generated sequences are in bold.
GenBank Number Species Locality
MW938045 Cladonia acuminata (JR 0.029) James Ross Island, Antarctica
MW938044 Cladonia acuminata (JR 0.201) James Ross Island, Antarctica
MW938041 Rhizocarpon pusillum (JR 0.030) James Ross Island, Antarctica
MW938040 Rhizocarpon pusillum (JR 0.031) James Ross Island, Antarctica
MW938043 Rhizocarpon pusillum (JR 0.040) James Ross Island, Antarctica
MW938042 Rhizoplaca parilis (JR 0.179) James Ross Island, Antarctica
Lichenized fungi for Antarctica 205

GenBank Number Species Locality
JN621928 Cladonia acuminata Canada
JN621932 Cladonia acuminata USA
JN621933 Cladonia acuminata Canada
JN621911 Cladonia cariosa Spain
FR695863 Cladonia cariosa Spain
JN621906 Cladonia cariosa Portugal
JN621907 Cladonia cariosa Spain
JN621908 Cladonia cariosa Spain
JN621909 Cladonia cariosa Spain
JN621910 Cladonia cariosa Spain
JN621912 Cladonia cariosa USA
JN621913 Cladonia cariosa Norway
JN621915 Cladonia cariosa Finland
JN621916 Cladonia cariosa Finland
JN621917 Cladonia cariosa Russia
JN621937 Cladonia latiloba Brazil
JN621935 Cladonia subcariosa USA
JN621936 Cladonia subcariosa USA
JN621914 Cladonia symphycarpa Norway
JN621918 Cladonia symphycarpa Bosnia and Herzegovina
JN621919 Cladonia symphycarpa Spain
JN621921 Cladonia symphycarpa Spain
JN621923 Cladonia symphycarpa Sweden
JN621926 Cladonia symphycarpa Germany
JN621924 Cladonia symphycarpa USA
JN621930 Cladonia symphycarpa Ukraine
JN621931 Cladonia symphycarpa Bosnia and Herzegovina
MK625448 Rhizocarpon atroflavescens China
MK629879 Rhizocarpon atroflavescens China
MK629881 Rhizocarpon atroflavescens China
MH979409 Rhizocarpon effiguratum China
MH979410 Rhizocarpon effiguratum China
AF250805 Rhizocarpon geographicum –
AF483619 Rhizocarpon geographicum Norway
DQ534482 Rhizocarpon geographicum Antarctica
KX550103 Rhizocarpon geographicum Turkey
206 Mehmet Gökhan Halici, Merve Kahraman Osman Osmanoğlu and Milos Bartak

GenBank Number Species Locality
DQ534483 Rhizocarpon nidificum Antarctica
AF483618 Rhizocarpon norvegicum Norway
KY680775 Rhizocarpon norvegicum Russia
KY680776 Rhizocarpon norvegicum Russia
KY680779 Rhizocarpon smaragdulum Russia
NR152547 Rhizocarpon smaragdulum Russia
MH979404 Rhizocarpon superficiale China
MH979405 Rhizocarpon superficiale China
MH979406 Rhizocarpon superficiale China
KU934705 Rhizoplaca aff. porterii “nevadensis” –
HM577242 Rhizoplaca chrysoleuca USA
HM577243 Rhizoplaca chrysoleuca USA
KU934617 Rhizoplaca chrysoleuca Russia
KU934618 Rhizoplaca chrysoleuca Russia
KU934619 Rhizoplaca chrysoleuca Russia
HM577303 Rhizoplaca haydenii subsp. arbuscula USA
HM577304 Rhizoplaca haydenii subsp. arbuscula USA
AY530885 Rhizoplaca huashanensis China
HM577295 Rhizoplaca idahoensis USA
HM577296 Rhizoplaca idahoensis USA
HM577297 Rhizoplaca idahoensis USA
KU934640 Rhizoplaca macleanii Antarctica
KU934641 Rhizoplaca macleanii Antarctica
MK970668 Rhizoplaca macleanii Victoria Land, Antarctica
MK970669 Rhizoplaca macleanii Victoria Land, Antarctica
MK970670 Rhizoplaca macleanii Victoria Land, Antarctica
JX948273 Rhizoplaca melanophtalma Iran
JX948274 Rhizoplaca melanophtalma Iran
JX948292 Rhizoplaca melanophtalma Iran
KP314423 Rhizoplaca melanophtalma Svalbard
MK811669 Rhizoplaca melanophtalma Norway
MK812478 Rhizoplaca melanophtalma Norway
NR120221 Rhizoplaca melanophtalma Spain
KU934699 Rhizoplaca novomexicana USA
KU934700 Rhizoplaca novomexicana USA
KU934706 Rhizoplaca novomexicana USA
Lichenized fungi for Antarctica 207

GenBank Number Species Locality
HM577305 Rhizoplaca occulta USA
HM577306 Rhizoplaca occulta USA
HM577307 Rhizoplaca occulta USA
NR119880 Rhizoplaca occulta USA
JX948220 Rhizoplaca parilis Chile
JX948223 Rhizoplaca parilis Chile
JX948224 Rhizoplaca parilis Chile
JX948226 Rhizoplaca parilis Chile
JX948227 Rhizoplaca parilis Chile
HM577317 Rhizoplaca parilis USA
NR119881 Rhizoplaca parilis USA
JX948225 Rhizoplaca parilis Chile
HM577318 Rhizoplaca parilis USA
NR119882 Rhizoplaca polymorpha USA
KU934778 Rhizoplaca polymorpha USA
KU934779 Rhizoplaca polymorpha USA
HM577377 Rhizoplaca porterii USA
HM577379 Rhizoplaca porterii USA
JX948228 Rhizoplaca porterii USA
KU934833 Rhizoplaca porterii USA
KU934834 Rhizoplaca porterii USA
NR119883 Rhizoplaca porterii USA
HM577291 Rhizoplaca shushanii USA
HM577292 Rhizoplaca shushanii USA
HM577293 Rhizoplaca shushanii USA
KU934859 Rhizoplaca shushanii USA
KU934860 Rhizoplaca shushanii USA
NR119879 Rhizoplaca shushanii USA
AF163113 Rhizoplaca subdiscrepans –
KP226212 Rhizoplaca subdiscrepans –
KU934894 Rhizoplaca subdiscrepans Russia
KU934900 Rhizoplaca subdiscrepans Russia
HQ650649 Catolechia wahlenbergii –
KM250247 Pilophorus clavatus South Korea
MH481906 Protoparmelia badia Japan
208 Mehmet Gökhan Halici, Merve Kahraman Osman Osmanoğlu and Milos Bartak

Species list
Cladonia acuminata (Ach.) Norll.
Detailed descriptions of this species were provided by Osyczka et al. (2011)
and Pino-Bodas et al. (2013).
Primary thallus squamulose, persistent, light greenish to gray. Squamules
rather large and conspicuous; up to 0.5 mm wide, and up to 1 mm long, entire or
irregularly crenate-edged or wavy or sinuous edged, lobate, lobes ascending and
nearly concave. Podetia rarely developed, when present grayish white, blunt at
the tips, without scypi, up to 1.6 cm tall, 0.5 cm thick at base, mostly simple and
not branched. Podetial surface squamulose at base and granulose at upper parts.
Apothecia and pycnidia not seen (Fig. 1).
Chemistry. – Podetia and primary thallus K+ yellow to orange, KC-, Pd+
yellow. Atranorin and norstictic acid identified by TLC.
Remarks. – Cladonia acuminata belongs to the Cladonia cariosa group
which includes C. cariosa (Ach.) Spreng., C. symphycarpa (Ach.) Fr. and C. acu-
minata. These three species constitute a monophyletic group according to Stenroos
et al. (2002). Our specimen fell into that group, in a strongly supported clade with
Genbank accessions JN621920.1, JN621922.1, and JN621932.1 of C. acuminata
Fig. 1. Cladonia acuminata. Squamulose thallus and podetium with squamules at the base.
Lichenized fungi for Antarctica 209

(Fig. 2). From the other species of the group, C. symphycarpa differs in mostly
lacking podetia, and C. acuminata differs from the two other species by having
sorediate podetia which are mostly unbranched or rarely dichotomously branched
near the tips (Ahti 2000). While C. cariosa mostly have apothecia on the podetia,
C. acuminata rarely have; and our Antarctic specimens also lack apothecia. These
three species in the Cladonia cariosa group have atranorin in common and they all
grow on calcareous substratum (Stenroos et al. 2002).
Fig. 2. Maximum Likelihood (ML) analysis inferred from ITS region sequences of the
210 Mehmet Gökhan Halici, Merve Kahraman Osman Osmanoğlu and Milos Bartak

Cladonia cariosa group
Cladonia acuminata has a bipolar distribution and mostly grows on calcareous
soil which is rich in humus (Osyczka et al. 2011). In James Ross Island we found
this species from two different localities on sandy soils, close to the sea shore
growing with many terricolous lichens such as Physconia muscigena (Ach.)
Poelt, Peltigera antarctica C.W.Dodge, P. castanea Goward, Goffinet et Miądl.
and Solorina spongiosa (Ach.) Anzi. The geographically nearest record of this
species is from the Navarino Island of Chile (Burgaz and Raggio 2007) at 400 m
altitude. It is also known from the Arctic, e.g. Greenland (Hansen 2007; Alstrup
et al. 2009) and Svalbard (Konoreva et al. 2019).
Specimens examined. – Antarctica, Antarctic Peninsula, James Ross Island,
Solorina Valley (63° 52′ 39.0″ S, 57° 46′ 51.6″ W, alt. 2 m.), on soil. Leg. M.G.
Halici and M. Bartak (JR 0.029); Lachman Bay, (63° 47′ 22.5″ S, 57° 48′ 12″ W,
alt. 36 m.), on soil. Leg. M.G. Halici and M. Bartak (JR 0.201).
Rhizocarpon pusillum Runemark
Lichenicolous on Sporastatia testidunea in the early stages of development but
later sometimes independent (Fig. 3).
Thallus continuous, forming areolate pacthes in the host thallus up to 5 cm.
Areoles bright greenish yellow, angular, flat or weakly concave, up to 2 mm.
Fig. 3. Early stages of Rhizocarpon pusillum growing on Sporastatia testudinea. Dark brown color
of the stone (lower left corner) indicates a proximity to ground level where more moisture is
avaliable than on lichen-free tops of the stones (upper right corner).
Lichenized fungi for Antarctica 211

Apothecia black, mostly angular, rarely rounded, flat or convex, slightly white
pruniose, 0.15−0.8 mm, apothecial margin distinct, prominent, white-greyish,
thicker at young ones. Epihymenium brown, 40−70 µm, N+ red, K+ weakly
reddish. Hymenium brownish hyaline, N+ red, K+ red, 60-85 µm. Hypothecium
dark brown, 90 µm. Asci 8-spored. Ascospores brown, one septate, widely
elipsoid or almost subglobose, (12–)14,5–16–17,5(–19) × (6–)8,5–10–11,5(–13)
µm (n=31) and spore length/width ratio (1,23–)1,37–1,65–1,92(–2,5) µm (n=31).
Paraphyses simple, not branched, has oil droplets, strongly adglutinated, end cells
enlarged to 3.5-4 µm. Pycnidium not observed (Fig. 4).
Chemistry. – Thallus and medulla K-, C-, I-, KI- and Pd+ yellow.
Rhizocarpic acid and Psoromic acid identified by TLC.
Two other yellow Rhizocarpon species with 1-septate ascospores were
previously reported from the Antarctic: Rhizocarpon adarense (Darb.) I.M. Lamb
and R. superficiale (Schaer.) Malme. Rhizocarpon pusillum differs from these
species by its lichenicolous habit on Sporastatia testudinea (Ach.) A. Massal.
(Wang et al. 2015). Other morphological differences were summarized in Table
2. The other yellow Rhizocarpon species with one-septate ascospores which are
not known from the Antarctic are: R. alpicola (Wahlenb.) Rabenh.,
R. effiguratum (Anzi) Th. Fr., R. eupetraeoides (Nyl.) Blomb. et Forssell,
R. inarense (Vain.) Vain., R. norvegicum Räsänen and R. parvum Runemark.
Among these species, only R. effiguratum, R. norvegicum and R. parvum are
known to be lichenicolous, but on different hosts (on Pleopsidium flavum
(Trevis.) Körb., the Acrosporaceae, and Tremolecia atrata (Ach.) Hertel,
respectively) (Table 2).
There were no sequences of Rhizocarpon pusillum in GenBank. According to
our ITS phylogeny, R. pusillum is closely related to R. superficiale which also has
one-septate ascospores (Fig. 5).
In James Ross Island, this species is very common on basaltic rocks. It starts
its life cycle on Sporastatia testudinea, and usually damages the whole host thalli
and becomes independent. Occurences of R. pusillum on the stones form an
Fig. 4. Rhizocarpon pusillum A. Thallus, B. Ascospores.
212 Mehmet Gökhan Halici, Merve Kahraman Osman Osmanoğlu and Milos Bartak

Table 2
Comparision of yellow Rhizocarpon species with 1-septate ascospores.
R. adarense R. alpicola R.
effiguratum
R.
eupetraeoides
R.
norvegicum R. parvum R. pusillum R. inarense R.
superficiale
Lichenicolous No No Yes No No Yes Yes No No
Secondary
Chemistry
rhizocarpic
acid
rhizocarpic
acid, psoromic
acid,
gyrophoric
acid, and
atranorin.
rhizocarpic
acid, often
psoromic acid,
stictic acid
(sometimes)
rhizocarpic
acid, norstictic
or psoromic
acid or
norstictic or
bourgeanic
acid
rhizocarpic
acid with or
without
psoromic acid.
rhizocarpic
acid
rhizocarpic
acid, psoromic
acid
rhizocarpic
acid, norstictic
acid,
sometimes
with traces of
psoromic or
gyrophoric
acid
rhizocarpic
acid, stictic
acid complex
Spot Tests Thallus and
medulla
K-, C-, I-, KI-
Medulla K-, Pd
+ yellow
Medulla K-,
C-, KC-, P+
yellow, I+
violet
Medulla K+
red, P+ yellow
and I+ violet
Medulla K-, P-
, or P+ yellow,
1+ dark blue
Medulla K-, C-
, P-, I+ violet
Thallus and
medulla K-,
C-, I-,KI- and
Pd+ yellow
Medulla K+
yellow
Medulla K+
yellow or
orange, K/I-
Ascospore
sizes
11–18 × 5–10
µm
20–33 × 9–17
µm
9–14 x 4–8 µm 22–34 × 9–17
µm
9–15 x 6–7 µm 9–15 x 6–7 µm 12–19 × 6–13
µm
21–30 × 10–12
µm
11–12 × 8–9
µm
Literature McCarthy and
Elix (2014)
Smith et al.
(2009)
Nash et al.
(2004);
Hawksworth
et al. (2008)
Nash et al.
(2004);
Hawksworth
et al. (2008)
McCarthy and
Elix (2014)
Wang et al.
(2015)
This article Nimis (2016) Fryday and
Øvstedal
(2012)

irregular pattern on sedimentary rock plateau (Northern coast of James Ross
Island, neighbourhood of J.G. Mendel station) and is restricted to the leeward
side of a stone or boulder. This is due to the fact that snow depositions do not
form a layer of constant thickness but rather accumulations on the leeward side
while the winward side and the top of the stones remain snow-free. Because
southern to western wind prevail (Bohuslavová et al. 2018; Kavan et al. 2018) at
the localities, S. testudinea and R. pusillum are found on N to E sides of the
stones/boulders where, close to ground surface (see Fig. 4) more moisture is
available thanks to gradually melting snow accumulation. The locality of
collection with the patterend distribution of volcanic stones belongs to glacial-
sculpted erosional surface of sedimentary rock (Jennings et al. 2021).
Rhizocarpon superficiale was reported from James Ross Island by Øvstedal
and Lewis Smith (2001), but we could not collect this species although we made
field excursion almost in all deglaciated parts of the island for two months.
Probably the records of R. superficiale belongs to R. pusillum. Another
explanation could be that the collection site of R. superficiale reported by
Øvstedal and Lewis Smith (2001)- top of hill located South of the Santa Marta
Cove, has not yet been sampled systematically since the 1990-ies and, therefore,
the occurence of the species can not be proven.
Rhizocarpon pusillum is a cosmopolite species with bipolar distribution and
has been reported from Asia, Europe, North America, New Zealand (Thomson
Fig. 5. Maximum Likelihood (ML) analysis inferred from ITS sequences of Rhizocarpon pusillum
and related species.
214 Mehmet Gökhan Halici, Merve Kahraman Osman Osmanoğlu and Milos Bartak

1997; Feuerer and Timdal 2004; Matwiejuk 2008; Hafellner 2015; Wang et al.
2015), China (Wang et al. 2015), Turkey (Halici et al. 2005), and Greenland
(Hansen 1982, 2002, 2012).
Specimens examined. – Antarctica, Antarctic Peninsula, James Ross Island,
Dirty Valley, (63° 48′ 38.1″ S, 57° 51′ 36″ W, alt. 92 m.), the locality is a shallow
small-area valley located 750 m NW from the Panorama Pass, on rock.
Leg. M.G. Halici and M. Bartak (JR 0.030); neighbourhood of V-Shape Valley
(63° 48′ 52.2″ S, 57° 54′ 52.8″ W, alt. 102 m.), on rock. Leg. M.G. Halici and
M. Bartak (JR 0.031 and JR 0.040).
Rhizoplaca parilis S. Leavitt, F. Fernández-Mendoza, Lumbsch, Sohrabi
et L. St. Clair
Thallus crustose, yellow-green, attached to the substratum in one point, almost
vagrant, lobate, edges of the lobes blue-blackish. Apothecia abundant,
aggregated, lecanorine, immersed then sessile, convex or not, especially mature
ones strongly convex. Apothecia disc black, white pruinose, especially mature
ones heavily white pruinose, (0.4–)–0.45–0.5–0,55– (–0.6) mm (Fig. 6).
Epihymenium black-green, 35–100 µm. Hymenium hyaline, 50–90 µm.
Hypotechium hyaline, 120 µm. Asci 8-spored, 40 × 8 µm. Ascospores simple,
hyaline, subglobose or eliptic, 9–10 × 4–5 µm. Paraphyses simple, not branched,
tips somewhat enlarged, 3 µm.
Chemistry. – Thallus and medulla K- and C-.
Fig. 6. Rhizoplaca parilis. Habitus.
Lichenized fungi for Antarctica 215

Fıg. 7. Phylogenetic reconstruction based on the maximum likelihood (ML) criterion, inferred from
ITS sequences of Rhizoplaca parilis and the other species of the genus.
216 Mehmet Gökhan Halici, Merve Kahraman Osman Osmanoğlu and Milos Bartak

Rhizoplaca parilis is a cryptic species recently described in the Rhizoplaca
melanophthalma complex. Except for the genetics, the only differences between
these two species are the occurence and amounts of orsellinic, lecanoric, and
gyrophoric acids (Leavitt et al. 2013). Phylogenetically R. parilis and R. mela-
nophthalma (DC.) Leuckert occurs at different clades within the genus. Our
sequence was recovered within the R. parilis clade (Fig. 7). These two species
also have similar ecological characteristics, both occur on calcium-poor rocks
such as basalt, granite, schist (Leavitt et al. 2013). As far as we know, no samples
reported as Rhizoplaca melanophthalma from Antarctica were DNA barcoded
and the previous reports of this species may belong to R. parilis. Since the
lichens of genus Rhizoplaca are found on only few small-area spots on James
Ross Island, typically close to bird nesting sites enriched by nutrients from
ornithoguano, future field ecophysiological studies should address the occurence
of R. melanophthalma and R. parilis in particular spots.
Specimen examined. — Antarctica, Antarctic Peninsula, James Ross Island,
Berry Hill Mesa, (63° 48′ 42.0″, 57° 50′ 5.4″ W, alt. 345 m.), on rock. Leg. M. G.
Halici et M. Bartak (JR 0.179).
Acknowledgements. — The first author thanks for Erciyes University for their
financial support to make the field works in James Ross Island, Antarctica and
infrastructure and facilities of J. G. Mendel Station provided during the Czech Antarctic
expedition, Jan-Feb 2017. This study was financially supported by TÜBİTAK 118Z587
coded project. Steve Leavit and Raquel Pina-Bodas are thanked for confirming our
species identifications of Rhizoplaca parilis and Cladonia acuminata.
Lichenized fungi for Antarctica 217

References
AHTI T. 2000. Cladoniaceae. Flora Neotropica Monograph 78: 1–362.
ALSTRUP V., KOCOURKOVÁ J., KUKWA M., MOTIEJūNAITė J., VON BRACKEL W. and SUIJA A.
(2009). The lichens and lichenicolous fungi of South Greenland. Folia Cryptogamica
Estonica 46: 1–24.
ANTARCTIC PLANT DATABASE (database of the BAS Herbarium). GB/NERC/BAS/AEDC/00023
https://data.bas.ac.uk//metadata.php?id=GB/NERC/BAS/AEDC/00023
BARTÁK M., LÁSKA K., HÁJEK J. and VÁCZI P. 2019. Microclimate variability of Antarctic
terrestrial ecosystems manipulated by open top chambers: Comparison of selected austral
summer seasons within a decade. Czech Polar Reports 9: 88–106.
BOHUSLAVOVÁ O., MACEK P., REDČENKO O., LÁSKA K., NEDBALOVÁ L. and ELSTER J. 2018.
Dispersal of lichens along a successional gradient after deglaciation of volcanic mesas on
northern James Ross Island, Antarctic Peninsula. Polar Biology 41: 2221–2232.
BURGAZ A.R. and RAGGIO J. 2007. Cladoniaceae of Navarino Island (Prov. Antartica Chilena,
Chile). Mycotaxon 99: 103–116
FEUERER T. and TIMDAL E. 2004. Rhizocarpon. In: T.H. Nash III (ed.) Lichen flora of the greater
Sonoran desert region, vol. 2. Tempe AZ, Lichens Unlimited, Arizona State University,
Tempe: 456–466.
FRYDAY A.M. and ØVSTEDAL D.O. 2012. New species, combinations and records of lichenized
fungi from the Falkland Islands (Islas Malvinas). The Lichenologist 44: 483–500.
GARDES M. and BRUNS T.D. 1993. ITS primers with enhanced specificity for basidiomycetes‐
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 1113–18.
HAFELLNER J. 2015. Lichenicolous Biota (Nos 201–230). Fritschiana 80: 24–41.
HALICI M.G., BARTAK M. and GÜLLÜ M. 2018. Identification of some lichenised fungi from James
Ross Island (Antarctic Peninsula) using nrITS markers. New Zealand Journal of Botany 56:
276–290
HALICI M.G., GÜLLÜ M. and BARTÁK M. 2017. First record of a common endolithic lichenized
fungus species Catenarina desolata Søchting, Søgaard & Elvebakk from James Ross Island
(Antarctic Peninsula). Czech Polar Reports 7: 11–17.
HALICI M.G., JOHN V. and AKSOY A. (2005). Lichens of Erciyes mountain (Kayseri, Turkey).
Flora Mediterranea 15: 567–580.
HALL T.A. 1999. BioEdit: a user–friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic acids symposium series 41: 95–98.
HANSEN E.S. 1
982. Lichens from Central East Greenland. Meddelelser om Grenland, Bioscience 9: 1–33.
HANSEN E.S. 2002. Lichens from Inglefield Land, NW Greenland. Willdenowia 32: 105–126.
HANSEN E.S. 2007. Inventoring lichen diversity. Alpine Research 20: 292–298.
HANSEN E.S. 2012. A contribution to the lichen flora of North East Greenland. Botanica Lithuanica
18: 109–116.
HAWKSWORTH D.L., TAMARIT V.A. and COPPINS B.J. 2008. Artifical Keys to the Lichenicolous
Fungi of Great Britain, Ireland, the Channel Islands, Iberian Peninsula and Canary Islands.
Milford House, UK.
JENNINGS S.J.A., DAVIES B.J., NÝVLT D., GLASSER N.F., ENGEL Z., HRBÁČEK F., CARRIVICK J.L.,
MLČOCH B. and HAMBREY M.J. 2021. Geomorphology of Ulu Peninsula, James Ross Island,
Antarctica. Journal of Maps: 17: 125–139.
KAVAN J., DAGSSON-WALDHAUSEROVA P., RENARDS J.B., LÁSKA K. and AMBROŽOVÁ K. 2018.
Aerosol Concentrations in Relationship to Local Atmospheric Conditions on James Ross
Island, Antarctica. Frontiers in Earth Science 6: 1–17.
KONOREVA L., KOZHIN M., CHESNOKOV S. and HONG S.G. (2019). Lichens and vascular plants in
Duvefjorden area on Nordaustlandet, Svalbard. Czech Polar Reports 9: 182–199.
218 Mehmet Gökhan Halici, Merve Kahraman Osman Osmanoğlu and Milos Bartak

LÁSKA K., BARTÁK M., HÁJEK J., PROŠEK P. and BOHUSLAVOVÁ O. 2011 Climatic and ecological
characteristics of deglaciated area of James Ross Island, Antarctica, with a special respect to
vegetation cover. Czech Polar Reports 1: 49–62.
LEAVITT S., FERNÁNDEZ-MENDOZA F., PÉREZ-ORTEGA S., SOHRABI M., DIVAKAR P., LUMBSCH T.
and CLAIR L.S. 2013. DNA barcode identification of lichen–forming fungal species in the
Rhizoplaca melanophthalma species–complex (Lecanorales, Lecanoraceae), including five
new species. MycoKeys 7: 1–22.
MATWIEJUK A. 2008. Noteworthy species of the genus Rhizocarpon Ramond ex DC.
(Rhizocarpaceae, lichenized Ascomycota) in the LBL herbarium. Annales UMCS, Biologia
63: 79–92.
MCCARTHY P. and ELIX J. 2014. The lichen genus Rhizocarpon in mainland Australia. Telopea 16:
195–211.
NASH T.H., RYAN B.D., GRIES C. and BUNGARTZ F. 2004. Lichen Flora of the Greater Sonoran
Desert Region. Vol 2. Lichens Unlimited. Arizona State University Lichen Herbarium.
Tempe.
NIMIS P.L. 2016. ITALIC — The Information System on Italian Lichens. Version 5.0. University of
Trieste, Deptartment of Biology, (http://dryades.units.it/italic), for all data contained in the
taxon pages, including notes, descriptions, and ecological indicator values.
ORANGE A., JAMES P.W. and WHITE F.J. 2001. Usnic acid chemical Methods for the Identification
of Lichens. British Lichen Society, London.
OSYCZKA P., YAZICI K. and ASLAN A. 2011. Note on Cladonia species (lichenized Ascomycota)
from Ardahan province (Turkey). Acta Societatis Botanicorum Poloniae 80: 59–62.
ØVSTEDAL D.O. and LEWIS-SMITH R.I. 2001. Lichens of Antarctica and South Georgia-a guide to
their identifcation and ecology. Cambridge University Press, Cambridge.
PEAT H. J., CLARK, A. and CONVEY, P. 2007. Diversity and biogeography of Antarctic flora.
Journal of Biogeography 34: 132–146.
PINO‐BODAS R., MARTIN M.P., BURGAZ A.R. and LUMBSCH H.T. 2013. Species delimitation in
Cladonia (Ascomycota): a challenge to the DNA barcoding philosophy. Molecular Ecology
Resources 13: 1058–1068.
SANCHO L.G., PINTADO, A. and GREEN A.T. 2019. Antarctic studies show lichens to be excellent
Biomonitors of climate change. Diversity 11: 42.
SMITH C.W., APPROOT A., COPPINS B.J., FLETCHER A., GILBERT O.L., JAMES P.W. and WOLSELEY
P. A. 2009. The Lichens of Great Britain and Ireland (Enlarged revision). The British Lichen
Society, London.
STENROOS S., HYVONEN J., MYLLYS L., THELL A. and AHTI T. 2002. Phylogeny of the genus
Cladonia s. lat. (Cladoniaceae, Ascomycetes) inferred from molecular, morphological, and
chemical data. Cladistics 18: 237–278.
TAMURA K., STECHER G., PETERSON D., FILIPSKI A. and KUMAR S. 2013. MEGA6: molecular
evolutionary genetics analysis version 6.0. Molecular biology and evolution 30: 2725–2729.
TERAUDS A. and LEE J.R. 2016. Antarctic biogeography revisited: updating the Antarctic
Conservation Biogeographic Regions. Diversity and Distributions 22: 836–840.
THOMSON J.W. 1997. American Arctic Lichens 2: The Microlichens. University of Wisconsin Press,
Madison.
WANG W.C., ZHAO Z.T. and ZHANG L.L. 2015. Four new records of Rhizocarpon from China.
Mycotaxon 130: 739–747.
WHITE T.M., BRUNS T., LEE S. and TAYLOR J. 1990. Amplification and direct sequencing of fungal
ribosomal RNA for phylogenetics. In: M.A. Innis, D.H. Gelfand, J.J. Sninsky (eds) PCR
protocols: a guide to methods and applications. Academic Press, San Diego, CA: 315–321.
Received 17 March 2021
Accepted 2 July 2021
Lichenized fungi for Antarctica 219