Content uploaded by Frederick Adams Ekuban
Author content
All content in this area was uploaded by Frederick Adams Ekuban on Jun 01, 2021
Content may be subject to copyright.
International Journal of
Molecular Sciences
Article
Nrf2 Activation Attenuates Acrylamide-Induced Neuropathy
in Mice †
Chand Basha Davuljigari 1, ‡, Frederick Adams Ekuban 1 ,‡ , Cai Zong 1, Alzahraa A. M. Fergany 1,2,
Kota Morikawa 1and Gaku Ichihara 1, *
Citation: Davuljigari, C.B.; Ekuban,
F.A.; Zong, C.; Fergany, A.A.M.;
Morikawa, K.; Ichihara, G. Nrf2
Activation Attenuates
Acrylamide-Induced Neuropathy in
Mice. Int. J. Mol. Sci. 2021,22, 5995.
https://doi.org/10.3390/ijms22115995
Academic Editor: G. Jean Harry
Received: 19 May 2021
Accepted: 30 May 2021
Published: 1 June 2021
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
1
Department of Occupational and Environmental Health, Tokyo University of Science, Noda 278-8510, Japan;
drchandbasha2012@gmail.com (C.B.D.); 3B18701@alumni.tus.ac.jp (F.A.E.); zongcai@rs.tus.ac.jp (C.Z.);
Zhraa.fergany@alexu.edu.eg (A.A.M.F.); mkouta9331@gmail.com (K.M.)
2Genetics and Genetic Engineering in Department of Animal Husbandry and Animal Wealth Development,
Faculty of Veterinary Medicine, Alexandria University, Alexandria 21500, Egypt
*Correspondence: gak@rs.tus.ac.jp
†
Part of the data of the present study was presented at the 60th Annual Meeting and ToxExpo of the Society of
Toxicology, March 2021 (Virtual Meeting) and the 47th Annual Meeting of the Japanese Society of Toxicology,
Sendai, Japan, 29 June–1 July 2020, but the study is not published in full or under review for
publication elsewhere.
‡ These authors contributed equally to this work.
Abstract:
Acrylamide is a well characterized neurotoxicant known to cause neuropathy and en-
cephalopathy in humans and experimental animals. To investigate the role of nuclear factor erythroid
2-related factor 2 (Nrf2) in acrylamide-induced neuropathy, male C57Bl/6JJcl adult mice were ex-
posed to acrylamide at 0, 200 or 300 ppm in drinking water and co-administered with subcutaneous
injections of sulforaphane, a known activator of the Nrf2 signaling pathway at 0 or 25 mg/kg body
weight daily for 4 weeks. Assessments for neurotoxicity, hepatotoxicity, oxidative stress as well
as messenger RNA-expression analysis for Nrf2-antioxidant and pro-inflammatory cytokine genes
were conducted. Relative to mice exposed only to acrylamide, co-administration of sulforaphane
protected against acrylamide-induced neurotoxic effects such as increase in landing foot spread or
decrease in density of noradrenergic axons as well as hepatic necrosis and hemorrhage. Moreover,
co-administration of sulforaphane enhanced acrylamide-induced mRNA upregulation of Nrf2 and
its downstream antioxidant proteins and suppressed acrylamide-induced mRNA upregulation of
tumor necrosis factor alpha (TNF-
α
) and inducible nitric oxide synthase (iNOS) in the cerebral
cortex. The results demonstrate that activation of the Nrf2 signaling pathway by co-treatment of
sulforaphane provides protection against acrylamide-induced neurotoxicity through suppression of
oxidative stress and inflammation. Nrf2 remains an important target for the strategic prevention of
acrylamide-induced neurotoxicity.
Keywords: sulforaphane; Nrf2; acrylamide; neurotoxicity; noradrenergic axons; oxidative stress
1. Introduction
Acrylamide is a neurotoxicant widely used in many industrial applications [
1
]. As an
electrophile, acrylamide is known to form reactive Michael-type adducts with nucleophilic
residues in living organisms [
2
] and has been confirmed to exhibit neurotoxicity in both
humans and experimental animals [
3
–
7
], as well as genotoxicity, reproductive toxicity and
carcinogenicity in experimental animals [
8
–
12
]. Exposure to acrylamide is known to cause
ascending central or peripheral axonopathies in humans and animals, thereby leading to
sensory, motor, and autonomic dysfunctions [13].
The acrylamide-induced toxicities have been linked to the monomer form, which
is mostly used for the synthesis of polyacrylamides, used in several applications, such
as water purification, preparation of anti-grouting agents, among others [
13
]. Human
Int. J. Mol. Sci. 2021,22, 5995. https://doi.org/10.3390/ijms22115995 https://www.mdpi.com/journal/ijms
Int. J. Mol. Sci. 2021,22, 5995 2 of 24
exposure to acrylamide occurs through several anthropogenic means, such as tobacco
smoke [
14
,
15
], occupational exposure and water pollution. In April 2002, researchers at
the Swedish National Food Administration and the University of Stockholm, Sweden,
reported the discovery of significant levels of acrylamide in various foods, such as coffee
and potato crisps that have been thermally processed through a process known as the
Maillard reaction [
16
,
17
]. Acrylamide is unintentionally generated when foods containing
amino acids, such as asparagines, and carbohydrates containing reducing sugars, such
as glucose, are processed under extremely hot conditions [
17
]. The levels of acrylamide
generated are thus dependent on the cooking temperature, cooking time, water and mois-
ture contents and the amounts of amino acid (asparagine) and reducing sugar (glucose)
present in raw food [
18
–
20
]. Based on the wide range of food items that may contain acry-
lamide, avoidance of such foods or undercooking food for fear of generating acrylamide,
could constitute health problems related to an unbalanced diet or possible microbiological
infestation, respectively [
21
]. Thus, it seems that exposure of humans to acrylamide is
inevitable, which could pose a great threat to human health and safety. Therefore, it is
crucial to explore possible strategies that can offer protection against acrylamide-induced
neurotoxic effects.
A large number of existing studies in the broader literature have established Nrf2 as
the master regulator of cellular redox homeostasis [
22
–
24
]. Under conditions of oxidative
or electrophilic stress, Nrf2 is detached from the stress sensor protein Kelch-like ECH-
associated protein 1 (Keap1), and translocated to the nucleus, where it is heterodimerized
with the small musculoaponeurotic fibrosarcoma (sMaf) protein [
25
–
29
]. The Nrf2-sMAF
heterodimer then binds to the antioxidant or electrophile response element (ARE/EpRE),
leading to the induction and transcription of several antioxidant and cytoprotective genes,
including glutathione and thioredoxin systems [
24
,
30
], as well as several phases I, II and
III drug-metabolizing enzymes involved in the regulation of oxidative stress [22,31–33].
Sulforaphane is a dietary phytochemical and an isothiocyanate abundantly present
in cruciferous vegetables (e.g., broccoli, cabbage and Brussels sprouts), [
34
] that has been
identified as a potent inducer of various cytoprotective metabolizing genes and enzymes
through activation of the Nrf2 signaling pathway. Sulforaphane has been shown to offer pro-
tection against electrophiles, carcinogens, oxidative stress as well as inflammation
[35–37].
A body of literature has reported that deletion of the Nrf2 gene results in increased sen-
sitivity to environmental electrophiles such as 1-bromopropane, cadmium, methyl mercury
and 1,2-naphtaquenone among others [
38
–
42
]. Moreover, results from our recent publi-
cation have showed that deletion of the Nrf2 gene increased the susceptibility of mice to
acrylamide-induced neurotoxicity [
43
]. Notwithstanding these studies, it remains unknown
whether activation of the Nrf2 signaling pathway offers protection against acrylamide-
induced neurotoxicity
in vivo
. The aim of the present study was to determine whether
the activation of the Nrf2 signaling pathway by sulforaphane offers protection against
acrylamide-induced neurotoxicity and the related mechanisms of protection in mice.
2. Results
2.1. Changes in Body Weight
Analysis of variance (ANOVA) followed by Dunnett’s multiple comparison showed
that acrylamide dose-dependently and significantly decreased body weight at 300 ppm
in mice groups untreated with sulforaphane but had no effect in the sulforaphane-treated
mice groups (Figure S2; Table 1). Linear regression analysis showed a significant positive
trend with acrylamide exposure level for body weight among the sulforaphane-untreated
mice, in contrast to the sulforaphane co-treated mice, which did not show any significant
change (Table 1). Multiple regression analysis showed no interaction for body weight
indicating that sulforaphane does not change the effect of acrylamide dose level. Moreover,
one model of multiple regression analysis free of interactions showed a significant effect
for acrylamide exposure level and sulforaphane (Table 1).
Int. J. Mol. Sci. 2021,22, 5995 3 of 24
Table 1.
Changes in body weight and landing foot spread according to the dose of acrylamide and sulforaphane treatment.
Test
Parameters Treatment
Concentration of Acrylamide (ppm) Simple
Regression Multiple Regression (pValue)
0 200 300
Regression
Coefficient of
ACR (pValue)
Interaction
of ACR and
SFN
Regression
Coefficient
of ACR
Regression
Coefficient
of SFN
Body Weight
(g)
SFN (−) 25.4 ±1.2 24.8 ±1.1 23.3 ±1.5 * −0.007 (0.002)
g/ppm 0.004 (0.17) −0.007
(0.0005)
g/ppm
0.25
(0.42)/mg
SFN (+) 25.1 ±1.3 24.9 ±0.8 24.1 ±1.1 −0.003 (0.07)
g/ppm
Landing foot
spread (cm)
SFN (−) 2.7 ±0.4 3.7 ±0.5 * 4.5 ±0.7 * 0.006 (<0.0001)
cm/ppm −0.002 (0.12) 0.006
(<0.0001)
cm/ppm
−0.37
(0.02)/mg
SFN (+) 2.5±0.5 3.6±0.3 * 3.7±1.0 * 0.004 (0.0003)
cm/ppm
Abbreviation: ACR, acrylamide; SFN, sulforaphane. Data are mean
±
standard deviation (SD). * p< 0.05, compared with the corresponding
treatment control (by ANOVA followed by Dunnett’s multiple comparison) for body weight and landing foot spread test (n= 10). Mice
were exposed daily to acrylamide in drinking water and co-administered with sulforaphane in saline for 28 days. Simple regression analysis
in each treatment (n= 30 per each treatment for body weight and landing foot) and tests for interaction in multiple regression model (n= 60
for landing foot spread and body weight) with dummy variables (0: acrylamide only and 1: sulforaphane treatment) for treatment were
conducted for body weight and landing foot spread. Since interaction was not significant for body weight and landing foot spread, multiple
regression analysis in a model without interaction (n= 60) was conducted to estimate the effect of acrylamide or sulforaphane co-treatment.
2.2. Changes in Function
Landing Foot Spread and Hindlimb Clasping Effect Observation
ANOVA followed by Dunnett’s multiple comparison showed that acrylamide signifi-
cantly increased the hindlimb splay at 200 and 300 ppm in both the sulforaphane-untreated
and -treated mice. However, the extent of increase in the hindlimb splay in the sulforaphane-
untreated mice was markedly higher relative to the sulforaphane-treated mice (
Figure S3
;
Table 1). Multiple regression analysis did not show a significant interaction between
acrylamide dose level and sulforaphane. Moreover, multiple regression analysis without
interaction showed a significant effect for acrylamide exposure level but no significance for
the effect for sulforaphane (Table 1).
A qualitative-based observational assessment for motor dysfunction showed that
acrylamide in sulforaphane-untreated mice induced an increased hindlimb clasping effect
upon tail suspension relative to sulforaphane-treated mice, which showed reduced clasping
effect and improved extension of the hindlimbs (Figure 1).
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 3 of 25
change (Table 1). Multiple regression analysis showed no interaction for body weight in-
dicating that sulforaphane does not change the effect of acrylamide dose level. Moreover,
one model of multiple regression analysis free of interactions showed a significant effect
for acrylamide exposure level and sulforaphane (Table 1).
Table 1. Changes in body weight and landing foot spread according to the dose of acrylamide and sulforaphane treatment.
Test Parameters
Treat-
ment
Concentration of Acrylamide
(ppm)
Simple Regression
Multiple Regression (p Value)
0
200
300
Regression Coeffi-
cient of ACR (p
Value)
Interaction of
ACR and SFN
Regression Coeffi-
cient of ACR
Regression Coef-
ficient of SFN
Body Weight (g)
SFN (−)
25.4 ± 1.2
24.8 ± 1.1
23.3 ± 1.5 *
−0.007 (0.002)
g/ppm
0.004 (0.17)
−0.007 (0.0005)
g/ppm
0.25 (0.42)/mg
SFN (+)
25.1 ± 1.3
24.9 ± 0.8
24.1 ± 1.1
−0.003 (0.07) g/ppm
Landing foot
spread (cm)
SFN (−)
2.7 ± 0.4
3.7 ± 0.5 *
4.5 ± 0.7 *
0.006 (<0.0001)
cm/ppm
−0.002 (0.12)
0.006 (<0.0001)
cm/ppm
−0.37 (0.02)/mg
SFN (+)
2.5±0.5
3.6±0.3 *
3.7±1.0 *
0.004 (0.0003)
cm/ppm
Abbreviation: ACR, acrylamide; SFN, sulforaphane. Data are mean ± standard deviation (SD). * p < 0.05, compared with
the corresponding treatment control (by ANOVA followed by Dunnett’s multiple comparison) for body weight and land-
ing foot spread test (n = 10). Mice were exposed daily to acrylamide in drinking water and co-administered with sul-
foraphane in saline for 28 days. Simple regression analysis in each treatment (n = 30 per each treatment for body weight
and landing foot) and tests for interaction in multiple regression model (n = 60 for landing foot spread and body weight)
with dummy variables (0: acrylamide only and 1: sulforaphane treatment) for treatment were conducted for body weight
and landing foot spread. Since interaction was not significant for body weight and landing foot spread, multiple regression
analysis in a model without interaction (n = 60) was conducted to estimate the effect of acrylamide or sulforaphane co-
treatment.
2.2. Changes in Function
Landing Foot Spread and Hindlimb Clasping Effect Observation
ANOVA followed by Dunnett’s multiple comparison showed that acrylamide signif-
icantly increased the hindlimb splay at 200 and 300 ppm in both the sulforaphane-un-
treated and -treated mice. However, the extent of increase in the hindlimb splay in the
sulforaphane-untreated mice was markedly higher relative to the sulforaphane-treated
mice (Figure S3; Table 1). Multiple regression analysis did not show a significant interac-
tion between acrylamide dose level and sulforaphane. Moreover, multiple regression
analysis without interaction showed a significant effect for acrylamide exposure level but
no significance for the effect for sulforaphane (Table 1).
A qualitative-based observational assessment for motor dysfunction showed that
acrylamide in sulforaphane-untreated mice induced an increased hindlimb clasping effect
upon tail suspension relative to sulforaphane-treated mice, which showed reduced clasp-
ing effect and improved extension of the hindlimbs (Figure 1).
Figure 1.
Representative images of mice showing various degrees of hindlimb clasping effect following exposure to
acrylamide and sulforaphane for 4 weeks.
2.3. Changes in Monoaminergic Axons
Noradrenaline Transporter (NAT)-Immunoreactive (Noradrenergic) Axons
The density of noradrenergic-immunoreactive axons was quantified in the primary
(S1HL, S1BF, S1FL) and secondary (S2) regions of the somatosensory cortex (Figures 2–5).
ANOVA followed by Dunnett’s multiple comparison showed that exposure to acrylamide
Int. J. Mol. Sci. 2021,22, 5995 4 of 24
significantly and dose-dependently decreased the density of noradrenergic axons in the
S1HL and S1FL regions at 200 ppm as well as in the S1BF and S2 regions at 200 and 300 ppm
in the sulforaphane-untreated mice. However, the same analysis showed that 200 and 300
ppm acrylamide significantly decreased the density of noradrenergic axons in the S1BF
and S1FL regions of sulforaphane-treated mice, respectively. It is noteworthy that the
decrease in density of noradrenergic axons was greater in the sulforaphane-untreated mice
compared with the sulforaphane-treated mice (Figures 2–5; Table S1). Moreover, it was
noteworthy that the S2 region of the somatosensory cortex showed much higher sensitivity
to acrylamide-induced degeneration of noradrenergic axons (Figure 5).
Simple regression analysis showed a significant positive trend with acrylamide ex-
posure level in the S1HL, S1BF, S1FL and S2 regions of the somatosensory cortex in the
sulforaphane-untreated mice as well as in the S1HL and S1FL regions of the sulforaphane-
treated mice (Table 2). Multiple regression analysis showed a significant interaction be-
tween acrylamide exposure level and sulforaphane treatment for noradrenergic axons in
the S1BF and S2 somatosensory cortex regions, indicating that the effect of acrylamide
depends on the respective treatment of sulforaphane. A model of multiple regression
analysis free of interaction showed a significant effect for acrylamide exposure level with
no significant effect for sulforaphane in the S1HL and S1FL regions (Table 2).
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 4 of 25
Figure 1. Representative images of mice showing various degrees of hindlimb clasping effect following exposure to acryla-
mide and sulforaphane for 4 weeks.
2.3. Changes in Monoaminergic Axons
Noradrenaline Transporter (NAT)-Immunoreactive (Noradrenergic) Axons
The density of noradrenergic-immunoreactive axons was quantified in the primary
(S1HL, S1BF, S1FL) and secondary (S2) regions of the somatosensory cortex (Figures 2, 3,
4 and 5). ANOVA followed by Dunnett’s multiple comparison showed that exposure to
acrylamide significantly and dose-dependently decreased the density of noradrenergic
axons in the S1HL and S1FL regions at 200 ppm as well as in the S1BF and S2 regions at
200 and 300 ppm in the sulforaphane-untreated mice. However, the same analysis showed
that 200 and 300 ppm acrylamide significantly decreased the density of noradrenergic ax-
ons in the S1BF and S1FL regions of sulforaphane-treated mice, respectively. It is note-
worthy that the decrease in density of noradrenergic axons was greater in the sul-
foraphane-untreated mice compared with the sulforaphane-treated mice (Figures 2, 3, 4,
and 5; Table S1). Moreover, it was noteworthy that the S2 region of the somatosensory
cortex showed much higher sensitivity to acrylamide-induced degeneration of noradren-
ergic axons (Figure 5).
Simple regression analysis showed a significant positive trend with acrylamide ex-
posure level in the S1HL, S1BF, S1FL and S2 regions of the somatosensory cortex in the
sulforaphane-untreated mice as well as in the S1HL and S1FL regions of the sulforaphane-
treated mice (Table 2). Multiple regression analysis showed a significant interaction be-
tween acrylamide exposure level and sulforaphane treatment for noradrenergic axons in
the S1BF and S2 somatosensory cortex regions, indicating that the effect of acrylamide
depends on the respective treatment of sulforaphane. A model of multiple regression
analysis free of interaction showed a significant effect for acrylamide exposure level with
no significant effect for sulforaphane in the S1HL and S1FL regions (Table 2).
Figure 2. Representative photomicrographs (A) and density (B) of noradrenaline transporter (NAT)-immunoreactive ax-
ons in the Barrel field primary somatosensory cortex (S1BF) of mice following exposure to acrylamide and treatment with
sulforaphane. Data are mean ± SD. * p < 0.05, ** p < 0.01, compared to the corresponding control (by ANOVA followed by
Dunnett’s multiple comparison). Scale bars = 40 µm; n = 4.
Figure 2.
Representative photomicrographs (
A
) and density (
B
) of noradrenaline transporter (NAT)-immunoreactive axons
in the Barrel field primary somatosensory cortex (S1BF) of mice following exposure to acrylamide and treatment with
sulforaphane. Data are mean
±
SD. * p< 0.05, ** p< 0.01, compared to the corresponding control (by ANOVA followed by
Dunnett’s multiple comparison). Scale bars = 40 µm; n= 4.
Int. J. Mol. Sci. 2021,22, 5995 5 of 24
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 5 of 25
Figure 3. Representative photomicrographs (A) and density (B) of noradrenaline transporter (NAT)-immunoreactive ax-
ons in the hindlimb primary somatosensory cortex (S1HL) of mice following exposure to acrylamide and treatment with
sulforaphane. Data are mean ± SD. * p < 0.05, compared to the corresponding control (by ANOVA followed by Dunnett’s
multiple comparison) Scale bars = 40 µm; n = 4.
Figure 4. Representative photomicrographs (A) and density (B) of noradrenaline transporter (NAT)-immunoreactive ax-
ons in the forelimb primary somatosensory cortex (S1FL) of mice following exposure to acrylamide and treatment with
sulforaphane. Data are mean ± SD. * p < 0.05, compared to the corresponding control (by ANOVA followed by Dunnett’s
multiple comparison). Scale bars = 40 µm; n = 4.
Figure 3.
Representative photomicrographs (
A
) and density (
B
) of noradrenaline transporter (NAT)-immunoreactive axons
in the hindlimb primary somatosensory cortex (S1HL) of mice following exposure to acrylamide and treatment with
sulforaphane. Data are mean
±
SD. * p< 0.05, compared to the corresponding control (by ANOVA followed by Dunnett’s
multiple comparison) Scale bars = 40 µm; n= 4.
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 5 of 25
Figure 3. Representative photomicrographs (A) and density (B) of noradrenaline transporter (NAT)-immunoreactive ax-
ons in the hindlimb primary somatosensory cortex (S1HL) of mice following exposure to acrylamide and treatment with
sulforaphane. Data are mean ± SD. * p < 0.05, compared to the corresponding control (by ANOVA followed by Dunnett’s
multiple comparison) Scale bars = 40 µm; n = 4.
Figure 4. Representative photomicrographs (A) and density (B) of noradrenaline transporter (NAT)-immunoreactive ax-
ons in the forelimb primary somatosensory cortex (S1FL) of mice following exposure to acrylamide and treatment with
sulforaphane. Data are mean ± SD. * p < 0.05, compared to the corresponding control (by ANOVA followed by Dunnett’s
multiple comparison). Scale bars = 40 µm; n = 4.
Figure 4.
Representative photomicrographs (
A
) and density (
B
) of noradrenaline transporter (NAT)-immunoreactive
axons in the forelimb primary somatosensory cortex (S1FL) of mice following exposure to acrylamide and treatment with
sulforaphane. Data are mean
±
SD. * p< 0.05, compared to the corresponding control (by ANOVA followed by Dunnett’s
multiple comparison). Scale bars = 40 µm; n= 4.
Int. J. Mol. Sci. 2021,22, 5995 6 of 24
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 6 of 25
Figure 5. Representative photomicrographs (A) and density (B) of noradrenaline transporter (NAT)-immunoreactive ax-
ons in the secondary somatosensory cortex (S2) of mice following exposure to acrylamide and treatment with sul-
foraphane. Data are mean ± SD. ** p < 0.01, *** p < 0.001, compared to the corresponding control (by ANOVA followed by
Dunnett’s multiple comparison). Scale bars = 40 µm; n = 4.
Table 2. Results of regression analysis of the effects of acrylamide and sulforaphane co-treatment on the density of nora-
drenergic axons in primary and secondary somatosensory cortex.
Test Parameter
Region
Treat-
ment
Simple Regression
Multiple Regression (p Value)
Regression Coeffi-
cient of ACR (p Value)
Interaction of ACR
and SFN
Regression Coeffi-
cient of ACR
Regression Coeffi-
cient of SFN
Density of noradrenergic
axons (%)
S1HL
SFN (−)
−0.03 (0.02) %/ppm
0.02 (0.07)
−0.03 (0.001) %/ppm
1.4 (0.3)/mg
SFN (+)
−0.008 (0.03) %/ppm
S1BF
SFN (−)
−0.04 (0.001) %/ppm
−0.03 (0.009)
-
-
SFN (+)
−0.007 (0.24) %/ppm
S1FL
SFN (−)
−0.02 (0.01) %/ppm
0.01 (0.23)
−0.02 (0.001) %/ppm
0.41 (0.70)/mg
SFN (+)
−0.01 (0.02) %/ppm
S2
SFN (−)
−0.04 (<0.0001) %/ppm
0.03 (0.002)
-
-
SFN (+)
−0.007 (0.29) %/ppm
Abbreviation: ACR, acrylamide; SFN, sulforaphane. Primary somatosensory cortices (S1BF: barrel field; S1FL: forelimb;
S1HL: hindlimb) and secondary somatosensory cortex (S2). Simple regression analysis for each treatment (n = 12 per treat-
ment) and test for interaction in multiple regression model (n = 24 per treatment group) with dummy variables (0: wild
type and 1: sulforaphane treated mice) for treatment were conducted for noradrenergic axons. When interaction was not
significant for density of noradrenergic axons in S1HL and S1FL, multiple regression analysis in a model without interac-
tion (n = 24) was conducted to estimate the effect of acrylamide or sulforaphane treatment. Since significant interaction
was found in density of noradrenergic axons in S1BF and S2, the effect of acrylamide or sulforaphane treatment was not
tested in multiple regression analysis.
2.4. Changes in mRNA Expression
2.4.1. Nrf2-Antioxidant Genes
ANOVA followed by Dunnett’s multiple comparison showed that acrylamide at 300
ppm significantly induced the mRNA expression of Superoxide dismutase 1 (SOD-1),
Figure 5.
Representative photomicrographs (
A
) and density (
B
) of noradrenaline transporter (NAT)-immunoreactive axons
in the secondary somatosensory cortex (S2) of mice following exposure to acrylamide and treatment with sulforaphane.
Data are mean
±
SD. ** p< 0.01, *** p< 0.001, compared to the corresponding control (by ANOVA followed by Dunnett’s
multiple comparison). Scale bars = 40 µm; n= 4.
Table 2.
Results of regression analysis of the effects of acrylamide and sulforaphane co-treatment on the density of
noradrenergic axons in primary and secondary somatosensory cortex.
Test Parameter Region Treatment
Simple Regression Multiple Regression (pValue)
Regression Coefficient
of ACR (pValue)
Interaction of
ACR and SFN
Regression
Coefficient of
ACR
Regression
Coefficient of
SFN
Density of
noradrenergic
axons (%)
S1HL SFN (−)−0.03 (0.02) %/ppm 0.02 (0.07) −0.03 (0.001)
%/ppm 1.4 (0.3)/mg
SFN (+) −0.008 (0.03) %/ppm
S1BF SFN (−)−0.04 (0.001) %/ppm −0.03 (0.009) - -
SFN (+) −0.007 (0.24) %/ppm
S1FL SFN (−)−0.02 (0.01) %/ppm 0.01 (0.23) −0.02 (0.001)
%/ppm 0.41 (0.70)/mg
SFN (+) −0.01 (0.02) %/ppm
S2 SFN (−)−0.04 (<0.0001) %/ppm 0.03 (0.002) - -
SFN (+) −0.007 (0.29) %/ppm
Abbreviation: ACR, acrylamide; SFN, sulforaphane. Primary somatosensory cortices (S1BF: barrel field; S1FL: forelimb; S1HL: hindlimb)
and secondary somatosensory cortex (S2). Simple regression analysis for each treatment (n= 12 per treatment) and test for interaction in
multiple regression model (n= 24 per treatment group) with dummy variables (0: wild type and 1: sulforaphane treated mice) for treatment
were conducted for noradrenergic axons. When interaction was not significant for density of noradrenergic axons in S1HL and S1FL,
multiple regression analysis in a model without interaction (n= 24) was conducted to estimate the effect of acrylamide or sulforaphane
treatment. Since significant interaction was found in density of noradrenergic axons in S1BF and S2, the effect of acrylamide or sulforaphane
treatment was not tested in multiple regression analysis.
2.4. Changes in mRNA Expression
2.4.1. Nrf2-Antioxidant Genes
ANOVA followed by Dunnett’s multiple comparison showed that acrylamide at
300 ppm significantly induced the mRNA expression of Superoxide dismutase 1 (SOD-1),
Heme oxygenase 1 (HO-1), Glutathione S transferase mu (GST-M), Nrf2 and metalloth-
ionein 1 (MT-1) in the sulforaphane-untreated mice. In contrast, sulforaphane induced
a dose-dependent increase in the mRNA expression of SOD-1, NAD(P)H: quinone oxi-
Int. J. Mol. Sci. 2021,22, 5995 7 of 24
doreductase 1(NQO1), Glutathione S transferase mu5 (GST-M5), GST-M and Nrf2 with
marked and significant changes at 300 ppm (Figure 6A–C,E,F; Table S2). Furthermore,
sulforaphane was associated with upregulation of Thioredoxin Reductase 1 (TXNRD1)
and MT-1 in a dose-dependent manner, with marked and significant changes at 200 and
300 ppm acrylamide (Figure 6G,H; Table S2). Interestingly, acrylamide at 200 ppm did not
induce significant upregulation of Nrf2-antioxidant gene expression both in sulforaphane-
untreated and -treated mice. Furthermore, sulforaphane downregulated HO-1 mRNA
expression (Figure 6D; Table S2).
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 7 of 25
Heme oxygenase 1 (HO-1), Glutathione S transferase mu (GST-M), Nrf2 and metallothi-
onein 1 (MT-1) in the sulforaphane-untreated mice. In contrast, sulforaphane induced a
dose-dependent increase in the mRNA expression of SOD-1, NAD(P)H: quinone oxidore-
ductase 1(NQO1), Glutathione S transferase mu5 (GST-M5), GST-M and Nrf2 with
marked and significant changes at 300 ppm (Figure 6A–C,E,F; Table S2). Furthermore,
sulforaphane was associated with upregulation of Thioredoxin Reductase 1 (TXNRD1)
and MT-1 in a dose-dependent manner, with marked and significant changes at 200 and
300 ppm acrylamide (Figure 6G,H; Table S2). Interestingly, acrylamide at 200 ppm did not
induce significant upregulation of Nrf2-antioxidant gene expression both in sul-
foraphane-untreated and -treated mice. Furthermore, sulforaphane downregulated HO-1
mRNA expression (Figure 6D; Table S2).
Simple regression analysis showed a positive trend with the dose of acrylamide for
SOD-1, NQO1, GST-M, Nrf2, and MT-1 in both treatment groups, and a significant in-
crease in HO-1 in sulforaphane-untreated mice and in GST-M5 and TXNRD1 in sul-
foraphane-treated mice (Table 3). Multiple regression analysis showed significant interac-
tion of acrylamide dose level with sulforaphane for TXNRD1 and MT-1. Other non-inter-
action models of multiple regression analysis showed that acrylamide exposure level cor-
related with increased mRNA expression of NQO1, HO-1, GST-M, and that sulforaphane
significantly increased SOD-1, HO-1, GST-M5 and GST-M mRNA expression levels (Table
3).
Figure 6. Effects of the combination of acrylamide and sulforaphane on relative mRNA expression of Nrf2 antioxidant
genes in the cerebral cortex, Nrf2 (A), NQO1 (B), SOD-1 (C), HO-1 (D) GST-M (E), GST-M5 (F), TXNRD1 (G) and MT-1
(H) after exposure to acrylamide for 4 weeks. Data are mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001,
compared to the corresponding control (by ANOVA followed by Dunnett’s multiple comparison). [n = 6].
Figure 6.
Effects of the combination of acrylamide and sulforaphane on relative mRNA expression of Nrf2 antioxidant
genes in the cerebral cortex, Nrf2 (
A
), NQO1 (
B
), SOD-1 (
C
), HO-1 (
D
) GST-M (
E
), GST-M5 (
F
), TXNRD1 (
G
) and MT-1 (
H
)
after exposure to acrylamide for 4 weeks. Data are mean
±
SD. * p< 0.05, ** p< 0.01, *** p< 0.001, **** p< 0.0001, compared
to the corresponding control (by ANOVA followed by Dunnett’s multiple comparison). [n= 6].
Simple regression analysis showed a positive trend with the dose of acrylamide for
SOD-1, NQO1, GST-M, Nrf2, and MT-1 in both treatment groups, and a significant increase
in HO-1 in sulforaphane-untreated mice and in GST-M5 and TXNRD1 in sulforaphane-
treated mice (Table 3). Multiple regression analysis showed significant interaction of
acrylamide dose level with sulforaphane for TXNRD1 and MT-1. Other non-interaction
models of multiple regression analysis showed that acrylamide exposure level correlated
with increased mRNA expression of NQO1, HO-1, GST-M, and that sulforaphane signifi-
cantly increased SOD-1, HO-1, GST-M5 and GST-M mRNA expression levels (Table 3).
Int. J. Mol. Sci. 2021,22, 5995 8 of 24
Table 3.
Results of regression analysis of the effects of acrylamide and sulforaphane on mRNA expression of Nrf2-
antioxidants in the cerebral cortex.
Test Parameters Treatment
Simple Regression Multiple Regression (pvalue)
Regression Coefficient
of ACR (pValue)
Interaction of ACR
and SFN
Regression
Coefficient of ACR
Regression
Coefficient of SFN
SOD-1 SFN (−) 0.0005 (0.02)/ppm 0.0007 (0.09) 0.0005 (0.10)/ppm 0.26 (<0.0001)/mg
SFN (+) 0.001 (0.005)/ppm
NQO1 SFN (−) 0.002 (0.04)/ppm 0.00008 (0.95) 0.002 (0.02)/ppm 0.33 (0.05)/mg
SFN (+) 0.002 (0.02)/ppm
HO-1 SFN (−) 0.002 (0.006)/ppm −0.002 (0.06) 0.002 (0.002)/ppm -0.26 (0.02)/mg
SFN (+) 0.0004 (0.45)/ppm
GST-M5 SFN (−) 0.0006 (0.08)/ppm 0.0003 (0.45) 0.0006 (0.07)/ppm 0.23 (0.0001)/mg
SFN (+) 0.0009 (0.01)/ppm
GST-M SFN (−) 0.001 (0.004)/ppm 0.0003 (0.67) 0.001 (0.003)/ppm 0.26 (0.002)/mg
SFN (+) 0.002 (0.002)/ppm
NRF2 SFN (−) 0.0005 (0.02)/ppm 0.0003 (0.33) 0.0005 (0.05)/ppm 0.07 (0.11)/mg
SFN (+) 0.0008 (0.01)/ppm
TXNRD1 SFN (−)−0.0001 (0.81)/ppm 0.002 (0.004) - -
SFN (+) 0.002 (<0.0001)/ppm
MT-1 SFN (−) 0.003 (0.0008)/ppm 0.002 (0.03) - -
SFN (+) 0.005 (<0.0001)/ppm
Abbreviation: ACR, acrylamide; SFN, sulforaphane. Simple regression analysis for each genotype (n= 18 per each treatment) and test
for interaction in multiple regression model (n= 36 per treatment group) with dummy variable (0: acrylamide only and 1: sulforaphane
co-treated mice) for treatment were conducted for SOD-1, NQO1, HO-1, GST-M5, GST-M, Nrf2, Txnrd1 and MT-1. Since interaction was
not significant for SOD-1, NQO1, HO-1, GST-M5, GST-M and Nrf2, multiple regression analysis in a model without interaction (n= 36) was
conducted to estimate the effect of acrylamide and sulforaphane. As significant interaction was found for Txnrd1 and MT-1, the effect of
acrylamide and sulforaphane was not tested in multiple regression.
2.4.2. Pro-Inflammatory Cytokines
ANOVA followed by Dunnett’s multiple comparison showed that exposure to acry-
lamide at 300 ppm significantly increased the mRNA expression levels of TNF-
α
and iNOS
in the sulforaphane-untreated mice while sulforaphane abrogated such effects
(Figure 7A,B
;
Table S3).
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 8 of 25
Table 3. Results of regression analysis of the effects of acrylamide and sulforaphane on mRNA expression of Nrf2-antiox-
idants in the cerebral cortex.
Test Param-
eters
Treat-
ment
Simple Regression
Multiple Regression (p value)
Regression Coefficient of
ACR (p Value)
Interaction of ACR and
SFN
Regression Coefficient of
ACR
Regression Coefficient of
SFN
SOD-1
SFN (−)
0.0005 (0.02)/ppm
0.0007 (0.09)
0.0005 (0.10)/ppm
0.26 (<0.0001)/mg
SFN (+)
0.001 (0.005)/ppm
NQO1
SFN (−)
0.002 (0.04)/ppm
0.00008 (0.95)
0.002 (0.02)/ppm
0.33 (0.05)/mg
SFN (+)
0.002 (0.02)/ppm
HO-1
SFN (−)
0.002 (0.006)/ppm
−0.002 (0.06)
0.002 (0.002)/ppm
-0.26 (0.02)/mg
SFN (+)
0.0004 (0.45)/ppm
GST-M5
SFN (−)
0.0006 (0.08)/ppm
0.0003 (0.45)
0.0006 (0.07)/ppm
0.23 (0.0001)/mg
SFN (+)
0.0009 (0.01)/ppm
GST-M
SFN (−)
0.001 (0.004)/ppm
0.0003 (0.67)
0.001 (0.003)/ppm
0.26 (0.002)/mg
SFN (+)
0.002 (0.002)/ppm
NRF2
SFN (−)
0.0005 (0.02)/ppm
0.0003 (0.33)
0.0005 (0.05)/ppm
0.07 (0.11)/mg
SFN (+)
0.0008 (0.01)/ppm
TXNRD1
SFN (−)
−0.0001 (0.81)/ppm
0.002 (0.004)
-
-
SFN (+)
0.002 (<0.0001)/ppm
MT-1
SFN (−)
0.003 (0.0008)/ppm
0.002 (0.03)
-
-
SFN (+)
0.005 (<0.0001)/ppm
Abbreviation: ACR, acrylamide; SFN, sulforaphane. Simple regression analysis for each genotype (n = 18 per each treat-
ment) and test for interaction in multiple regression model (n = 36 per treatment group) with dummy variable (0: acryla-
mide only and 1: sulforaphane co-treated mice) for treatment were conducted for SOD-1, NQO1, HO-1, GST-M5, GST-M,
Nrf2, Txnrd1 and MT-1. Since interaction was not significant for SOD-1, NQO1, HO-1, GST-M5, GST-M and Nrf2, multiple
regression analysis in a model without interaction (n = 36) was conducted to estimate the effect of acrylamide and sul-
foraphane. As significant interaction was found for Txnrd1 and MT-1, the effect of acrylamide and sulforaphane was not
tested in multiple regression.
2.4.2. Pro-Inflammatory Cytokines
ANOVA followed by Dunnett’s multiple comparison showed that exposure to
acrylamide at 300 ppm significantly increased the mRNA expression levels of TNF-α and
iNOS in the sulforaphane-untreated mice while sulforaphane abrogated such effects (Fig-
ure 7A,B; Table S3).
Figure 7.
Effects of exposure to acrylamide and treatment with sulforaphane on relative mRNA expression of pro-
inflammatory cytokines in the cerebral cortex; TNF-
α
(
A
), iNOS (
B
), IL-1
β
(
C
), IL-6 (
D
) and COX-2 (
E
) after exposure to
acrylamide for 4 weeks. Data are mean
±
SD. * p< 0.05, compared to the corresponding treatment control (by analysis of
variance (ANOVA) followed by Dunnett’s multiple comparison), (n= 6).
Int. J. Mol. Sci. 2021,22, 5995 9 of 24
Simple regression analysis showed significant positive trend with the dose of acry-
lamide for TNF-
α
and iNOS in the sulforaphane-untreated mice but not in the sulforaphane-
treated mice (Table 4). Multiple regression analysis showed no significant interaction of
acrylamide exposure level and sulforaphane treatment for all the genes examined (TNF-
α
,
iNOS, IL-1
β
, interleukin 1 beta; IL-6, interleukin 6 and COX-2, cyclooxygenase-2). More-
over, the same analysis model limited to the data of no-interaction showed significant
positive effect for acrylamide exposure level on the mRNA expression TNF-
α
and iNOS as
well as significant positive effect for sulforaphane on IL-6 (Table 4).
Table 4.
Results of regression analysis for the effects of acrylamide and sulforaphane on mRNA expression of pro-
inflammatory cytokines in the cerebral cortex.
Test Parameters Treatment
Simple Regression Multiple Regression (pValue)
Regression Coefficient
of ACR (pValue)
Interaction of
ACR and SFN
Regression
Coefficient of
ACR
Regression
Coefficient of SFN
TNF-αSFN (−) 0.003 (0.01)/ppm −0.002 (0.09) 0.003 (0.002)/ppm −0.03 (0.80)/mg
SFN (+) 0.0007 (0.22)/ppm
iNOS SFN (−) 0.002 (0.008)/ppm −0.001 (0.21) 0.002 (0.001)/ppm −0.21 (0.07)/mg
SFN (+) 0.001 (0.05)/ppm
IL-IβSFN (−) 0.0002 (0.45)/ppm −0.00009 (0.86) 0.0002 (0.56)/ppm −0.13 (0.05)/mg
SFN (+) 0.0001 (0.78)/ppm
IL-6 SFN (−) 0.0004 (0.36)/ppm −0.0002 (0.70) 0.0004 (0.27)/ppm −0.22 (0.003)/mg
SFN (+) 0.0002 (0.47)/ppm
COX-2 SFN (−)−0.00001 (0.99)/ppm −0.0003 (0.74) −0.00001
(0.98)/ppm 0.11 (0.27)/mg
SFN (+) −0.0003 (0.60)/ppm
Abbreviation: ACR, acrylamide; SFN, sulforaphane. Simple regression analysis for each genotype (n= 18 per each treatment) and test for
interaction in multiple regression model (n= 36 per treatment group) with dummy variables (0: acrylamide only and 1: sulforaphane
co-treated mice) for treatment were conducted for TNF-
α
, iNOS, IL-1
β
, IL-6 and COX-2. Since interaction was not significant for TNF-
α
,
iNOS, IL-1
β
, IL-6 and COX-2, multiple regression analysis in a model without interaction (n= 36) was conducted to estimate the effects of
acrylamide and sulforaphane.
2.5. Changes in Glutathione and Malondialdehyde (MDA) Levels
ANOVA followed by Dunnett’s multiple comparison showed that sulforaphane sig-
nificantly reduced malondialdehyde (MDA) levels when administered with 300 ppm
acrylamide (Table 5; Figure S4).
Table 5.
Effects of different doses of acrylamide and sulforaphane co-treatment on the expression levels of oxidative stress
markers in cerebral cortex.
Test Parameters Treatment
Acrylamide Concentration (ppm) Simple Regression Multiple Regression (pValue)
0 200 300
ACR Regression
Coefficient
(pValue)
Interaction of
ACR and SFN
ACR
Regression
Coefficient
SFN
Regression
Coefficient
Total Glutathione
(GSH + GSSG, µM)
SFN (−) 92.1 ±12.3 94.4 ±18.0 103.3 ±21.3 0.034 (0.32)/ppm −0.05 (0.29) 0.03
(0.28)/ppm
16.69
(0.004)/mg
SFN (+) 115.7 ±16.1 111.8 ±6.7 112.2 ±20.3 −0.013 (0.66)/ppm
Glutathione Disulfide
(GSSG, µM)
SFN (−) 2.7 ±2.8 2.8 ±2.2 3.7 ±1.5 0.003 (0.46)/ppm −0.004 (0.51) 0.003
(0.45)/ppm
−0.36
(0.62)/mg
SFN (+) 2.5 ±1.4 3.6 ±2.3 2.0 ±2.4 −0.001 (0.86)/ppm
GSSG/GSH ratio
(×10−2)
SFN (−) 3.3 ±3.7 3.2 ±2.9 4.0 ±2.4 0.002 (0.73)/ppm −0.002 (0.73) 0.002
(0.67)/ppm
−1.11
(0.19)/mg
SFN (+) 2.1 ±1.1 3.2 ±2.0 1.8 ±1.9 −0.0003
(0.92)/ppm
MDA (µM) SFN (−) 6.5 ±2.2 6.6 ±2.2 8.7 ±1.1 0.006 (0.10)/ppm −0.015 (0.003) - -
SFN (+) 8.5 ±1.6 7.0 ±1.3 5.9 ±1.6 * −0.008
(0.008)/ppm
Abbreviation: ACR, acrylamide; GSH, glutathione; GSSG/GSH ratio, glutathione redox ratio; MDA, malondialdehyde; SFN, sulforaphane.
Data are mean
±
SD. * p< 0.05, compared to the corresponding treatment control (by ANOVA followed by Dunnett’s multiple comparison).
(n= 6). Simple regression analysis for each genotype (n= 18 per each treatment) and test for interaction in multiple regression model
(
n= 36
per treatment group) with dummy variables (0: ACR only and 1: sulforaphane co-treated mice) for treatment were conducted for
total glutathione, glutathione disulfide, GSSG/GSH ratio and MDA. Since interaction was insignificant for total glutathione, glutathione
disulfide and GSSG/GSH ratio, multiple regression analysis was conducted in a model without interaction (n= 36) to estimate the effect of
acrylamide or sulforaphane co-treatment. Since significant interaction was found for MDA, the effect of acrylamide or sulforaphane was
not tested in multiple regression model.
Int. J. Mol. Sci. 2021,22, 5995 10 of 24
Single regression analysis showed significant positive trend with the dose of acry-
lamide for MDA among the sulforaphane groups. There was no significant effect for
acrylamide exposure level or sulforaphane treatment on total glutathione, glutathione
disulfide and glutathione-redox ratio (GSSG/GSH ratio) (Table 5). Multiple regression
analysis showed significant interaction between acrylamide and sulforaphane for MDA,
indicating different magnitude of effects by acrylamide depending on the treatment of
sulforaphane. Moreover, multiple regression analysis without interaction showed no sig-
nificant effect for acrylamide exposure level on total glutathione, GSSG and GSSG/GSH
ratio but a significant effect for sulforaphane treatment on total glutathione levels (Table 5).
2.6. Effects of Acrylamide on Liver Histopathology
Histopathological examination of hematoxylin and eosin (H&E)-stained liver tis-
sue samples showed normal liver morphology in the control (acrylamide 0 ppm) and
sulforaphane-alone (25 mg/kg bw) mice (Figure S5). On the other hand, treatment with
acrylamide up to 300 ppm produced extensive necrosis and severe hemorrhage
(Figure S5)
.
However, these pathological lesions were greatly attenuated in mice treated with sul-
foraphane. Mice of the latter group showed moderate to minimal hemorrhage with clear-
ance of necrotic lesions (Figure S5).
3. Discussion
The present study investigated the role of Nrf2 in the process of acrylamide-induced
neuropathy in mice upon activation by systemic administration of sulforaphane. The
study used specific markers of neurotoxicity, including sensorimotor dysfunction and
degeneration of monoaminergic-immunoreactive axons which were confirmed by landing
foot spread test and immunohistochemistry respectively, and showed that activation of
the Nrf2-signaling pathway by co-administration of sulforaphane offers protection against
acrylamide-induced neurotoxicity in mice. Recent work by our laboratory using a gene
deletion model of Nrf2-knockout mice have demonstrated the pivotal role of the Nrf2-
dependent transcription offering protection against acrylamide-induced neurotoxicity
such as sensorimotor dysfunction, degeneration of monoaminergic axons associated with
activation of microglia [
43
]. Moreover, deletion of Nrf2 was shown to enhance acrylamide-
induced pro-inflammatory cytokine genes and suppression of Nrf2-antioxidant genes,
thereby establishing the importance of the Nrf2 gene [43].
Sulforaphane is a well-recognized inducer of the Nrf2-ARE signaling pathway which
ultimately results in the induction of several phase II and III cytoprotective genes and
enzymes that provide protection against various degrees of electrophilic attack caused
by xenobiotics [
36
,
44
]. As such, sulforaphane has been shown to have neuroprotective
potential in various neurological disorders [45–48].
A key mechanism on how sulforaphane activates the Nrf2 signaling pathway has been
associated with covalent modification of Keap1. As an electrophile, sulforaphane activates
the Nrf2-ARE signaling pathway by reacting with sulfhydryl or thiol functional groups of
cysteine residues found in Keap1, particularly Cys-151, which results in the termination
of the Culin-3 ubiquitin ligase-mediated proteosomal degradation and dissociation and
subsequent build-up of Nrf2 expression [49–51].
The neuroprotective role of sulforaphane has already been reported in several exper-
imental models. For example, pre-treatment with sulforaphane effectively ameliorated
6
-hydroxydopamine (6-OHDA) and hydrogen peroxide (H
2
O
2
)-induced oxidative stress
and cytotoxicity in dopaminergic neuroblastoma SH-SY5Y cell line [
47
]. Moreover, sul-
foraphane provided protection against cell damage induced by rotenone in PC12 cells [
52
]
as well as inhibition of rotenone-induced deficiency of locomotor activity and loss of
dopaminergic neurons [
53
]. Furthermore, sulforaphane was described as neuroprotective
in the Parkinson’s disease mouse model of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine
(MPTP) and 6-OHDA as it crosses the blood brain barrier [
54
,
55
]. Consistent with the afore-
mentioned studies, the present study demonstrated the protective effect of sulforaphane
Int. J. Mol. Sci. 2021,22, 5995 11 of 24
against acrylamide-induced sensorimotor dysfunction and degeneration of noradrenergic
axons in the murine somatosensory cortex.
First, exposure to acrylamide induced impairments in sensorimotor function as evi-
denced by the dose-dependent increase in hindlimb splay length (Figure S3 and Table 1).
Moreover, exposure to acrylamide induced paralysis and weakness in hindlimbs as well as
heightened effect of clasping when mice were suspended by the tail (Figure 1). However,
these effects were abrogated by sulforaphane, including sensorimotor dysfunction (Table 1
and Figure S3). The hindlimb clasping effect has been described as a marker of neurological
disorders or dysfunction, which are probably triggered by changes in neurotransmission
of monoaminergic axons, including noradrenaline and serotonin within the neocortex,
cerebellum and basal ganglia of mice [
56
]. The hindlimb clasping effect has also been
considered a manifestation of motor dysfunction [57,58].
The effects of acrylamide on sensory, motor and autonomic functions have been
extensively studied in laboratory animals, such as cats [
59
–
61
], rats [
62
–
65
], mice [
66
,
67
],
monkeys [
60
], baboons [
68
,
69
], chickens/hens [
65
], and Japanese quail [
70
]. The results
of these studies confirmed the intoxication effects of acrylamide monomer on excessive
tiredness and ataxia observed in industrial workers in the 1960s [71,72].
Secondly, acrylamide-induced degeneration of monoaminergic axons in the primary
somatosensory cortex (S1) of forelimb (S1FL), hindlimb (S1HL) and barrel field (S1BF) and
secondary somatosensory cortex (S2; Figure S1), characterized by a dose-dependent and
significant decrease in the density of noradrenergic axons. Notably, the extent of nora-
drenergic axon degeneration varied widely across the regions of the somatosensory cortex
examined, with the S1BF and S2 somatosensory cortex showing the highest sensitivity
(Figures 2and 5). Conversely, sulforaphane attenuated acrylamide-induced degeneration
of noradrenergic axons within the primary and secondary regions of the somatosensory
cortex in mice (Figures 2–5).
The mammalian cortex is demarcated into different regions responsible for the regula-
tion of specific functions such as motor, sensory and cognition [
73
]. The somatosensory
cortex forms connections with several cortical and subcortical regions of the brain [
74
],
which allows for full representations of different parts of the body, such as face, fingers,
hands, arms, feet and toes. The somatosensory cortex has, therefore, been implicated in the
performance of many functions, including full representation of the body, sensory, motor,
processing of painful stimuli, empathy and emotion in humans [75–77] and primates [78].
A converging body of evidence in the literature indicates that impairments or abnormal
functioning of the somatosensory cortex contributes to deficits observed in various neu-
rological disorders, such as aberrant sensory and motor dysfunction in humans [
79
–
82
]
and monkeys [
83
]. At this stage, it is unclear whether the results of acrylamide-induced
changes in landing foot spread as shown in the present study are directly related to severe
impairments, such as degeneration of noradrenergic axons within the somatosensory cortex.
Further studies are needed to investigate the exact morphological and molecular mech-
anisms underlying the link between somatosensory cortex and functional impairments
affecting the lower limbs.
In agreement with previous studies on the pharmacological induction of the Nrf2-ARE
pathway by chemical activators, the present study demonstrated that sulforaphane was
associated with pronounced induction of Nrf2-antioxidant genes, evidenced by the results
of mRNA expression using real-time quantitative polymerase chain reaction (RT-qPCR)
in the cortex. Sulforaphane increased the nuclear translocation and expression of Nrf2
(Figure 6A) and its dependent antioxidant genes, NQO1, SOD-1, GST-M and GST-M5
additively, as well as TXNRD1 and MT-1 synergistically (Figure 6B,C,E–H). These results
are consistent with those of previous studies where treatment with sulforaphane increased
the expression of many Nrf2-ARE dependent antioxidants, such as NQO1, TXNRD1, HO-1
and GSTs [
84
–
86
]. Moreover, long-term treatment with sulforaphane in a mouse model
of Parkinson’s disease inhibited rotenone-induced deficiency of locomotor activity and
Int. J. Mol. Sci. 2021,22, 5995 12 of 24
dopaminergic neuronal loss, together with attenuation of reactive oxygen species (ROS),
MDA production as well as increased GSH levels [53].
Metallothioneins (MTs) constitute a group of cysteine-rich heavy metal binding pro-
teins known for cellular protective functions, such as heavy metal detoxification, and
protection against free radicals or oxidants among others [
87
–
90
]. MTs are considered in
numerous studies to protect cells against toxicity induced by oxidants and electrophiles
that can readily form reactions with sulfhydryl functional groups [
91
–
93
]. Electrophiles
such as acrolein, acetaldehyde nitrogen mustards as well as N-ethylmaleimide readily form
reactions with MTs [
94
]. Furthermore, Ghorbel and colleagues (2017) reported increased
levels of total MT, together with increased mRNA levels of MT-I and MT-II as a major
mechanism against acrylamide-induced oxidative stress in rats [
95
]. Several recent studies
have indicated that the induction of MTs by sulforaphane is dependent on the Nrf2-ARE
signaling pathway [96–98].
In the present study, the sulforaphane-induced upregulation of Nrf2-antioxidant genes
known to be associated with oxidative stress was corroborated by suppression of oxidative
stress, as evidenced by reduced levels of oxidative stress markers, glutathione redox ratio
and MDA levels in sulforaphane-treated mice.
Induction of the Nrf2-ARE antioxidant system by chemical activators is considered to
protect against oxidative damage induced by dopamine, hydrogen peroxide and glutamine
in neuronal cell lines [
99
–
101
]. Sulforaphane was effective in protecting against oxida-
tive stress induced by anti-psychotic drugs in human neuroblastoma SK-N-SH cells [
102
].
Moreover, sulforaphane suppressed oxidative stress induced by hydrogen peroxide and
paraquat, through the activation of the Nrf2-ARE pathway, thereby providing neuroprotec-
tion of rat striatal cultures [103].
However, it is noteworthy that the mRNA expression levels of HO-1 were down-
regulated in sulforaphane-treated mice relative to the sulforaphane-untreated groups.
Notwithstanding the fact that the induction of HO-1as a downstream gene from the
Nrf2-ARE pathway has been reported in various tissues and cells to offer protection, it
is becoming increasingly clear that its overexpression may induce various pathological
processes, such as neurodegeneration and carcinogenesis [
104
]. For example, activation
of HO-1 is reported to increase survival and suppression of the apoptotic pathways,
and thus potentially protecting against uncontrolled proliferation, progression of cancer,
metastasis and other neuronal disorders [
105
–
108
]. Moreover, it is reported that in several
neurodegenerative diseases such as Alzheimer disease, Parkinson’s and multiple sclerosis,
HO-1 protein is upregulated in the brain. The unexpected findings of HO-1 downregulation
in sulforaphane-treated mice in the present study, therefore, signals the need for further
studies to understand the related mechanisms and the net resultant impact on acrylamide-
induced neurotoxicity.
Exposure of mice to acrylamide induced mRNA expression of proinflammatory cy-
tokines, such as TNF-
α
and iNOS in the cortex (Figure 7A,B; Table 4; Table S3). However,
sulforaphane co-treatment suppressed the acrylamide-induced upregulation of mRNA
expression of proinflammatory cytokines, and thus protected against inflammation. The
observed upregulation of proinflammatory cytokines suggests the potential involvement of
inflammation as a major mechanism of acrylamide-induced neurotoxicity and suppression
of neuroinflammation could be a mechanism mediating the neuroprotective effects of
sulforaphane. There exists a considerable body of evidence in the literature indicating that
sulforaphane suppressed LPS-induced cytokine secretion of TNF-
α
, IL-1
β
, IL-6, iNOS and
COX-2, among others, through the activation of Nrf2, possibly by inhibition of nuclear
factor kappa b (NF-kB) transcriptional activity [
109
–
113
]. Sulforaphane also attenuated
microglia-induced inflammation in the hippocampus of LPS-exposed mice as evidenced by
reduced production of pro-inflammatory cytokines, such as iNOS, IL-6 and TNF-α[36].
Exposure to acrylamide upregulated not only Nrf2-dependent transcription but also
expression of Nrf2 gene itself. The mechanism for acrylamide-induced upregulation of Nrf2
gene is unknown. A previous study showed that treatment with DNA methyltransferases
Int. J. Mol. Sci. 2021,22, 5995 13 of 24
(Dnmts) inhibitor 5-aza-2
0
-deoxycytidine increased Nrf2 at both mRNA and protein levels
in N2a cells through downregulation of Dnmts and DNA demethylation [
114
], and a
recent study showed that glutathione depletion induced epigenetic alteration of vitamin
D metabolism genes in the livers of high-fat diet-fed obese mice [
115
]. Further studies
are needed to clarify how exposure to acrylamide alter the expression of Nrf2 including
epigenetic mechanism of regulation on gene expression. As the major organ responsible
for the metabolism of xenobiotics, the liver, is prone to chemical exposure and particularly
susceptible to several toxic insults [
116
,
117
]. The present study investigated the effect
of acrylamide on the liver and whether sulforaphane (which is also metabolized in the
liver) protects against any acrylamide-related hepatotoxic effect. The results showed that
sulforaphane provided protection against acrylamide-induced hemorrhagic necrosis of the
liver (Figure S5c,d), as evidenced by clearance of necrotic lesions (Figure S5g,h).
4. Methods
4.1. Chemicals and Preparation
Acrylamide (lot #A9099, purity > 99%) and sulforaphane (lot #3200372) were pur-
chased from Sigma Aldrich (St. Louis, MO, USA) and LKT Laboratories Inc. (St. Paul, MN),
respectively. Acrylamide was freshly prepared at the beginning of each week by dissolving
in a G-10 ion exchange cartridge (Organo Co., Tokyo, Japan) filtered drinking water, stored
at 4 degrees Celsius and administered every day in autoclaved bottles [
43
]. Sulforaphane
was prepared by dissolving the stock solution in normal saline just before treatment.
4.2. Animal Husbandry and Experimental Design
Ten-week-old male mice were used in the present study. Sixty male specific-pathogen
free C57BL/6JJcl mice were purchased from CLEA Japan, Inc. (Tokyo, Japan) at 9 weeks of
age and allowed to acclimatize for one week before the start of study. Mice were initially
housed in separate cages of six each and had access to filtered drinking water and normal
chow diet (Charles River Formula-1; CRF-1) ad libitum. They were housed in a controlled
environment of temperature (23–25
◦
C), humidity (57–60%) and light (lights on at 0800 h
and off at 2000 h).
After the one week of acclimatization, each mouse was weighed and then assigned
at random to one of six groups, each consisting of 10 mice, which were allocated into
acrylamide only (0, 200 or 300 ppm) or acrylamide plus sulforaphane co-exposure groups.
Groups 1 to 3 were exposed to acrylamide only at 0, 200 or 300 ppm, respectively, while
groups 4, 5 and 6 were co-treated with acrylamide at 0, 200 or 300, respectively, combined
with sulforaphane at 0 or 25 mg/kg body weight. Acrylamide was added to the drinking
water whereas sulforaphane was administered through sub-cutaneous injections. Mice of
groups 1 to 3 also received subcutaneous injections of saline (vehicle for the sulforaphane)
as a measure to control any form of bias. Mice of each group (n= 10) for the purpose
of assessment were randomly divided into groups of four and six for morphological
and biochemical study respectively and treated with the compounds (acrylamide and
sulforaphane) every day of the week for four weeks (Figure 8).
The protocol and experimental design of the present study were approved by the
animal experiment committee of the Tokyo University of Science (Experiment approval
number: Y19029 and Y20016) and strictly followed the guidelines of Tokyo University
of Science on animal experiments in accordance with the Japanese act on welfare and
management of animals.
Int. J. Mol. Sci. 2021,22, 5995 14 of 24
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 14 of 25
with sulforaphane at 0 or 25 mg/kg body weight. Acrylamide was added to the drinking
water whereas sulforaphane was administered through sub-cutaneous injections. Mice of
groups 1 to 3 also received subcutaneous injections of saline (vehicle for the sulforaphane)
as a measure to control any form of bias. Mice of each group (n = 10) for the purpose of
assessment were randomly divided into groups of four and six for morphological and
biochemical study respectively and treated with the compounds (acrylamide and sul-
foraphane) every day of the week for four weeks (Figure 8).
The protocol and experimental design of the present study were approved by the
animal experiment committee of the Tokyo University of Science (Experiment approval
number: Y19029 and Y20016) and strictly followed the guidelines of Tokyo University of
Science on animal experiments in accordance with the Japanese act on welfare and man-
agement of animals.
Figure 8. Schematic illustration of the study design. Drinking water containing acrylamide was provided daily to wild-
type mice for four weeks. Each mouse also received injection of sulforaphane or saline daily for four weeks. The mice
underwent functional tests (landing foot spread test) after 21 days of exposure, morphological analysis (immunostaining
of neurotransmitter-specific-reactive axons; hematoxylin and eosin staining of liver), RNA-expression analysis and
oxidative stress analysis after the 4-week exposure.
4.3. Concentration of Acrylamide
In the present study, 300 ppm was used as the highest exposure level for acrylamide
based on the findings of previous studies [67] and the fact that it matches the levels of
human exposure to acrylamide at 400 ppm from a polluted drinking well water [118,119].
Moreover, in a series of preliminary studies, 300 ppm of acrylamide induced signs of neu-
rotoxicity in experimental mice, without causing mortality. The experimental design of
the present study uses oral as the route of exposure to model human exposure to acryla-
mide in food or water. The concentration of acrylamide (200 and 300 ppm) used in the
present study are, therefore, considered relevant to human exposure as have been re-
ported in previous studies [15,118–120].
Figure 8.
Schematic illustration of the study design. Drinking water containing acrylamide was provided daily to wild-
type mice for four weeks. Each mouse also received injection of sulforaphane or saline daily for four weeks. The mice
underwent functional tests (landing foot spread test) after 21 days of exposure, morphological analysis (immunostaining of
neurotransmitter-specific-reactive axons; hematoxylin and eosin staining of liver), RNA-expression analysis and oxidative
stress analysis after the 4-week exposure.
4.3. Concentration of Acrylamide
In the present study, 300 ppm was used as the highest exposure level for acrylamide
based on the findings of previous studies [
67
] and the fact that it matches the levels of
human exposure to acrylamide at 400 ppm from a polluted drinking well water [
118
,
119
].
Moreover, in a series of preliminary studies, 300 ppm of acrylamide induced signs of
neurotoxicity in experimental mice, without causing mortality. The experimental design of
the present study uses oral as the route of exposure to model human exposure to acrylamide
in food or water. The concentration of acrylamide (200 and 300 ppm) used in the present
study are, therefore, considered relevant to human exposure as have been reported in
previous studies [15,118–120].
4.4. Amount of Acrylamide Uptake in Mice
The volume of drinking water consumed together with body weight of all mice
across the treatment groups were measured and recorded every day between 10:00 and
11:00 a.m. The volume of water consumption and the body weight of mice were then
used to calculate the actual amount per body weight of acrylamide for each given day
of exposure. Furthermore, the daily amount per body weight of acrylamide over the
28-day period of exposure was then averaged in order to obtain the mean daily amount
of acrylamide per body weight. The calculated mean daily amount of acrylamide per
body weight over the 28-day exposure period was 26.3
±
1.3, and 40.4
±
1.5 (mg/kg body
weight,
±
standard deviation (SD)) for the 200 and 300 ppm exposure groups respectively.
4.5. Hindlimb Clasping Effect
The hindlimb clasping effect was tested as described in detail previously [
121
,
122
].
Briefly, mice were suspended by their tail for 30 s and observed carefully for the extent
Int. J. Mol. Sci. 2021,22, 5995 15 of 24
of hindlimb clasping effect. In this test, once suspended, mice with normal neurological
function extend their hindlimbs away from the abdomen with torsions of the body in an
attempt to grab their tail. In contrast, mice with neurological defects retract the hindlimbs
towards the abdomen, to the extent of touching both hindlimbs.
4.6. Landing Foot Spread Test
The landing foot spread test was performed following the protocol of the functional
observatory battery testing for the effects of drugs and other chemicals on the nervous
system recommended by the United States Environmental Protection Agency (USEPA)
and as described previously [
43
]. Briefly, mice were dropped from a height of 15 cm after
applying a food dye ink to the soles of the hindlimb. The distance of hindlimb spread upon
landing is recorded as the hindlimb splay length. The test was carried out three times and
the mean landing foot spread value was reported.
4.7. Tissue Harvest, Processing and Morphological Assessment
At 24 h after the last exposure of acrylamide, mice were randomly selected and
euthanized for morphological and biochemical examinations.
For morphological examination, mice were selected at random (n= 4/group) then
deeply anesthetized with intraperitoneal injection of sodium pentobarbitone (50 mg/kg).
Upon confirmation of loss of sensation, the animals were transcardially perfused through
the ascending aorta with 4% paraformaldehyde (4% PFA) in phosphate buffer. The perfused
mice were wrapped in aluminum foil and kept on ice for a period of 1 h to increase the
penetrative effect of paraformaldehyde particularly through the brain tissues. The brain
was dissected out of the skull carefully and fixed for additional 24 h at 4
◦
C. After this,
the brain was divided into three parts by cutting coronally at the anterior margin of the
cerebellum and the optic chiasm and then placed in a series of 10, 20 and 30% sucrose
solutions over changing intervals of 24 h each. Brain tissues were then embedded in
optimal cutting temperature (OCT) medium with the use of plastic Tissue Tek cryomolds
(SFJ 4566, Sakura, Japan) and then stored at –80
◦
C. Furthermore, liver samples were also
dissected from mice and stored in 4% PFA at 4 ◦C until analysis.
Immunohistochemical Examination
The frozen OCT-embedded tissues were cryosectioned at 40
µ
m thickness using a
cryostat (Leica CM3050S, Leica Microsystems, Wetzlar, Germany) at bregma –0.34 [
123
],
which represents the full extent of the somatosensory cortex of mice. The frozen sections
were mounted on a Matsunami MAS superfrost glass slides (Matsunami Glass Ind., Osaka,
Japan) and allowed to dry at room temperature for about 1 h. Immunohistochemistry stain-
ing for noradrenaline-immunoreactive axons was performed as previously described [
43
].
Briefly, the air-dried sections were rinsed in Tris buffered saline (TBS; 50 mM Tris, 0.15 mM
NaCl, pH 7.5–7.8) and transferred into an antigen retrieval solution containing 10 mM
sodium citrate buffer (pH 8.5) that had been pre-heated to and maintained in a water bath
at 80
◦
C for 30 min. After the incubation, the sections were cooled to room temperature
together with the buffer solution and washed in Tris-buffered saline with 0.01% Tween-20
(TBST). Endogenous peroxidase activity was blocked for 20 min by incubating the sections
with Bloxal, a peroxidase blocking reagent (Vector Laboratories, Burlingame, CA, USA).
After triple washing in TBST, non-specific protein binding was blocked at 4
◦
C overnight
using protein blocking reagent [1% bovine serum albumin (BSA; Sigma Aldrich), 2.5% nor-
mal horse serum (NHS; Vector Laboratories, Burlingame, CA, USA), 0.3 M glycine (Wako)
and 0.1% Tween-20 (Wako)]. This was followed by brief incubation at 37
◦
C for 30 min
followed by rinsing thrice in TBST. Endogenous interferences of avidin-biotin were blocked
by incubating the sections in avidin/biotin blocking reagent (Sp-2001; Vector Laboratories),
as described by the manufacturer. The sections were then incubated for 2 h at 37
◦
C with
mouse anti-noradrenaline transporter antibody (NAT; 1:1000, #ab211463, Abcam, Japan).
Following incubation with the primary antibody, the sections were washed three times and
Int. J. Mol. Sci. 2021,22, 5995 16 of 24
then incubated for 1 h with horse anti-mouse biotinylated secondary antibody (BA-2000;
Vector Laboratories) and further washed three times in TBST. Finally, the sections were
stained with the avidin-biotin peroxidase complex (Elite ABC reagent, Vector Laboratories)
and visualized by reacting with diaminobenzidine peroxidase substrate as the chromogen
(ImmPACT DAB (Brown) peroxidase substrate SK-4105, Vector Laboratories). After three
washings in TBS Buffer, the sections were wiped off any liquid, allowed to air-dry and
mounted with an aqueous mounting medium (VectaMount Mounting Medium, H-5501,
Vector Laboratories).
4.8. Morphometric Analysis of Noradrenergic Axons
Quantification of noradrenergic axon density was conducted as described previ-
ously [
43
]. Uncompressed photomicrographs of the stained somatosensory cortex regions
were taken with a Leica FlexCam C1 digital camera-assisted microscope (BX 50, Olympus,
Tokyo). The density of noradrenergic axons was quantified in the primary somatosensory
cortex (S1) of forelimb (S1FL), hindlimb (S1HL) and barrel field (S1BF) and secondary
somatosensory cortex (S2) sub-regions of the somatosensory cortex (Figure S1) at Bregma
–0.34 [
123
], using a 200
µ
m
×
200
µ
m square sampling frame with the vessel analysis plugin
in the ImageJ software [
124
]. We also determined the vascular density, which represented
the ratio of the vessel area relative to the total area multiplied by 100%. These studies were
conducted in 4 mice and 2 sections from each were used for analysis.
4.9. Tissue Processing and Histopathology
After removal, about 5 mm strips of liver tissues containing the portal section, the
left lateral and medial lobes were cut and routinely processed for histopathological ex-
amination. Briefly, the trimmed liver tissue samples were dehydrated in graded ethanol
concentrations (70%, 80%, 95% and 100%), cleared in two changes of xylene, impregnated
and embedded in paraffin wax. Next, 5
µ
m thickness sections were cut using a sliding
microtome (Leica) and stained with H&E. The latter were examined under a light micro-
scope (BX100, Olympus, Tokyo) equipped with a digital camera (Leica FlexCam C1) and
evaluated for hepatocellular toxicity.
4.10. Tissue Harvest and Biochemical Assessment
For biochemical analysis, 6 mice were randomly selected, euthanized by decapitation,
and the cerebral cortex were harvested and immediately snap frozen on dry ice and stored
at –80
◦
C until analysis. The frozen samples were crushed in an aluminum foil into a
powdered form using two heavy metal rods over liquid nitrogen. The powdered tissue
was carefully collected in precooled nuclease-free plastic sample tubes using a spatula. All
items and utensils as mentioned were precooled in liquid nitrogen before crushing.
4.11. Assessment of Oxidative Stress
4.11.1. Glutathione Assay (Quantification of Total and Oxidized Glutathione)
Approximately 25 mg of frozen powdered cerebral cortex tissue sample was homog-
enized in 250
µ
L of 50 mM 2-(N-morpholino) ethanesulphonic acid (MES) buffer con-
taining 2 mM Ethylenediaminetetraacetic acid (EDTA). The homogenate was centrifuged
at
10,000×g
for 15 min at 4
◦
C. The supernatant was then deproteinated with an equal
volume of 0.1% metaphosphoric acid (239275; Sigma Aldrich) and mixed by vortexing. The
resultant mixture was allowed to stand at room temperature for 5 min and centrifuged
at
2000×g
for 2 min. The supernatant was aliquoted and stored at –20
◦
C until used for
analysis of total and oxidized glutathione. Ninety
µ
L of the supernatant was treated with
4.5
µ
L of 4 M solution of triethanolamine (TEAM; Sigma Aldrich) and immediately vor-
texed. For determination of total reduced glutathione (GSH), 30
µ
L TEAM-treated sample
was diluted 10-fold using the MES buffer. Subsequently, 50
µ
L of the diluted sample was
added to 150
µ
L freshly prepared assay cocktail (MES buffer, reconstituted cofactor mixture,
reconstituted enzyme mixture, distilled water and reconstituted DNTB) and incubated
Int. J. Mol. Sci. 2021,22, 5995 17 of 24
for 25 min, following which the mixture was assayed at 405 nm with a microplate reader
(Gen5™ Secure, BioTek®Instruments, Inc.)
For determination of oxidized glutathione (GSSG), 30
µ
L of the TEAM-treated sample
was diluted 5-fold with MES buffer and 200
µ
L of this diluted solution was derivatized
with 2
µ
L of 2-vinylpyridine (Sigma Aldrich). The mixture was vortexed and incubated for
1 h at room temperature. Fifty
µ
L of the derivatized sample was then mixed with 150
µ
L of
freshly prepared assay cocktail as explained earlier, incubated for 25 min in the dark and
then assayed at 405 nm on a microplate reader. The concentrations of GSH and GSSG were
calculated using absorbance in an equation of the line obtained from the GSSG standard
curve provided in the GSH assay kit (#703002, Cayman Chemical Company, Ann Arbor,
MI) and expressed as micro-moles of GHS or GSSG per mg protein.
4.11.2. Thiobarbituric Acid Reactive Substances (TBARS) Assay
MDA was measured using TBARS assay (#10009055, Cayman Chemical Company)
following the instructions provided by the manufacturer. Briefly 25 mg of powdered
cerebral cortex tissue was homogenized in 250
µ
L of radioimmunoprecipitation assay buffer
(RIPA) containing protease inhibitors on ice and then centrifuged for 10 min at
1600×g
and
4
◦
C. The supernatant was then aliquoted and kept on ice. A mixture containing 100
µ
L of
the sample supernatant together with 100
µ
L of sodium dodecyl sulfate (SDS) solution and
4 mL of color reagent was prepared in 5-mL vial and boiled vigorously for one hour. This
was to enable the reaction between the sample and thiobarbituric acid (TBA). Next, the
vial was removed from boiling water and placed in ice bath for 10 min to stop the reaction.
The vial was then centrifuged for 10 min at 1600
×
gand 4
◦
C. Subsequently, 150
µ
L was
loaded in duplicates into microplate and read at 532 nm with a microplate reader (Gen5
™
Secure, BioTek
®
Instruments, Inc.). MDA concentration was calculated using the MDA
colorimetric standard curve and expressed as micromoles of MDA per mg protein.
4.12. Total mRNA Isolation, cDNA Synthesis and Real-Time Quantitative Polymerase Chain
Reaction (PCR)
Total messenger RNA (mRNA) was isolated from the cerebral cortex using the RNeasy
Lipid Tissue Mini Kit (Qiagen Benelux B.V., Venlo, Netherlands) and according to the
instructions provided by the manufacturer. The concentration of the extracted mRNA
following elution with RNase-free water was measured using a NanoDrop 2000 spec-
trophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The quality of mRNA was
determined by confirming that the A260/A280 ratio was
≥
2.0 after measuring absorbance
at 260 nm and 280 nm. Complementary DNA (cDNA) was then synthesized by using 4
µ
g
of total extracted RNA with SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA,
USA) according to the instructions supplied by the manufacturer. Real-time quantitative
PCR was performed by using the THUNDERBIRD
®
SYBR
®
qPCR Mix (Toyobo Co., Osaka)
and the AriaMx Real-Time PCR System (Agilent Technologies, Inc., Santa Clara, CA). A
three-step real-time PCR amplification reaction comprising an initial denaturation step
at 95
◦
C for 1 min, followed by an amplification step of 45 denaturation cycles at 95
◦
C
for 15 s, primer annealing at 60
◦
C for 30 s, extension at 72
◦
C for 60 s and reading of
plate was utilized. A melting curve step from 55 to 95
◦
C with 0.5
◦
C increments for 5 s
followed by a plate read was also incorporated. A standard curve constructed using serial
concentrations of diluted cDNA samples from the control group was used to quantify the
relative expression level of each gene. The latter was calculated by standardization to
the endogenous mRNA levels of the housekeeping gene
β
-actin. The mRNA expression
levels of Nrf2-antioxidant genes: Nrf2, heme oxygenase 1 (HO-1), NAD(P)H:quinone
oxidoreductase 1 (NQO1), superoxide dismutase 1 (SOD 1), glutathione-s-transferase mu
(GST-M), glutathione-s-transferase mu-5 (GST-M5), thioredoxin reductase 1 (Txnrd1) and
metallothionein 1 (MT-1), as well as genes of several pro-inflammatory cytokines, including
tumor necrosis factor alpha (TNF-
α
), inducible nitric oxide synthase (iNOS), interleukin
1 beta (IL-1
β
), IL-6 and cyclooxygenase 2 (COX-2) were analyzed. Primer sequences for the
various genes are listed in Table 6.
Int. J. Mol. Sci. 2021,22, 5995 18 of 24
Table 6. Gene primers used for real-time quantitative polymerase chain reaction (qRT-PCR).
Gene PRIMER SEQUENCES REFERENCES
Nfe2l2 (Nrf2) F: CGAGATATACGCAGGAGAGGTAAGAR:
GCTCGACAATGTTCTCCAGCTT [125]
Keap-1 F: GATCGGCTGCACTGAACTGR:
GGCAGTGTGACAGGTTGAAG [126]
Gst-M (GSTµ)F: CTGAAGGTGGAATACTTGGAGCR:
GCCCAGGAACTGTGAGAAGA [127]
GST-M5 F: AGAAACGGTACATCTGTGGGGR:
GGATGGCGTTACTCTGGGTG [128]
HO-1 F: CACAGATGGCGTCACTTCCGTCR:
GTGAGGACCCACTGGGAGGAG [129]
NQO1 F: AGCGTTCGGTATTACGATCCR:
AGTACAATCAGGGCTCTTCTCG [130]
SOD-1 F: CAGGACCTCATTTTAATCCTCACR:
TGCCCAGGTCTCCAACAT
TXNDR1 F: GGGTCCTATGACTTCGACCTGR:
AGTCGGTGTGACAAAATCCAAG [131]
MT-1 F: ACCTCCTGCAAGAAGAGCTGR:
GCTGGGTTGGTCCGATACTA [132]
TNF-αF: CATCTTCTCAAAATTCGAGTGACAAR:
TGGGAGTAGACAAGGTACAACCC [36]
iNOS F: CCTCCTTTGCCTCTCACTCTTR:
AGTATTAGACGCGTGGCATGG [133]
IL-1βF: CTGGTGTGTGACGTTCCCATTAR:
CCGACAGCACGAGGCTTT
IL-6 F: CCTACCCCAATTTCCAATGCTR:
TATTTTCTGACCACAGTGAGGAAT
COX-2 F: TTCGGGAGCACAACAGAGTR:
TAACCGCTCAGGTGTTGCAC [36]
β-ACTIN F: TCCTTCCTGGGCATGGAGR:
AGGAGGAGCAATGATCTTGATCTT [133]
4.13. Statistical Analysis
Statistical analysis was performed using GraphPad Prism version 8.0 (GraphPad
Software, La Jolla, CA, USA) or JMP (version 14, SAS Institute, Cary, NC, USA). Data are
expressed as mean
±
standard deviation (SD) or
±
standard error of the mean (SEM), as
indicated. Differences among groups were analyzed by one-way ANOVA followed by
Dunnett’s multiple comparison test. Single regression analysis was carried out on the
dose of acrylamide in each mouse treatment groups (acrylamide only and acrylamide plus
sulforaphane group) to determine the effects of sulforaphane and trend with the dose of
acrylamide by the use of dummy variables for treatment. Multiple regression analysis with
dummy variable (0: without sulforaphane and 1: with sulforaphane) was carried out to
determine the interaction between the dose of acrylamide and sulforaphane treatment. A
model of multiple regression analysis without interaction was used to test the effects of
the dose of acrylamide and sulforaphane when their interaction was not significant. A
probability (p) of <0.05 denoted the presence of a statistically significant difference.
5. Conclusions
We have confirmed in the present study that in mice, acrylamide is neurotoxic, causing
hindlimb dysfunction, degeneration of monoaminergic axons, as well as hepatotoxic, and
that activation of the Nrf2 signaling pathway through co-administration of sulforaphane
abrogates the ill-effects of acrylamide. The sulforaphane-mediated induction of the Nrf2
signaling pathway resulted in upregulation of Nrf2 and its downstream genes, leading to
protection against acrylamide-induced neurotoxicity, through prevention of oxidative stress
together with suppression of pro-inflammatory cytokine gene upregulation. The present
study shows that activation of the Nrf2 signaling pathway through dietary phytochemicals
Int. J. Mol. Sci. 2021,22, 5995 19 of 24
such as sulforaphane attenuates acrylamide-induced neuro-hepatotoxicity and further
provides a scientific basis for nutrient recommendations in the preventive modulation of
electrophile-induced diseases.
Supplementary Materials:
They are available online at https://www.mdpi.com/article/10.3390/
ijms22115995/s1.
Author Contributions:
Conceptualization: C.B.D., F.A.E., C.Z. and G.I.; Methodology, C.B.D., F.A.E.
and G.I.; Investigation, C.B.D., F.A.E., K.M., C.Z., A.A.M.F.; Software, F.A.E.; Validation, C.B.D., F.A.E.
and G.I.; Data Curation, C.B.D. and F.A.E.; Visualization, C.B.D. and F.A.E.; Formal analysis, C.B.D.,
F.A.E. and G.I.; Writing—original draft, F.A.E.; Writing—review and editing, F.A.E. and G.I.; Funding
acquisition, Resources, Project administration and Supervision, G.I. All authors have read and agreed
to the published version of the manuscript.
Funding:
This work was supported by a Grant-in-Aid for Scientific Research from the Japan Society
for the Promotion of Science (17H06396, 19H04279).
Institutional Review Board Statement:
The protocol and experimental design of the present study
were approved by the animal experiment committee of the Tokyo University of Science (Experiment
approval number: Y19029 and Y20016) and strictly followed the guidelines of Tokyo University of
Science on animal experiments in accordance with the Japanese act on welfare and management
of animals.
Acknowledgments: We thank Arai for the excellent secretarial support throughout the study.
Conflicts of Interest: The authors declare no conflict of interest.
Abbreviations
ACR: Acrylamide; ANOVA, Analysis of Variance; ARE, Antioxidant response element; b.w., Body
weight; bZIP, Basic-region leucine zipper; CNC, Cap ‘n’ collar; COX-2, Cyclooxygenase 2; EpRE,
Electrophile response element; GSH, Glutathione; GSSG, Glutathione disulfide; Gst, Glutathione
S-transferase; GST-M, Glutathione S transferase mu; GST-M5, Glutathione S transferase mu5; HO-1,
Heme oxygenase; IL, Interleukin; IL-1
β
, Interleukin 1beta; IL-6, Interleukin 6; iNOS, Inducible
nitric oxide synthase; KEAP1, Kelch-like ECH-associated protein 1; MDA, Malondialdehyde; MES,
2-(N-morpholino)ethane sulfonic acid; MT-1, Metallothionein 1; Neh, Nrf2-ECH homology; NA,
Noradrenaline; NAT, Noradrenaline transporter; NQO1, NAD(P)H:quinone oxidoreductase 1; Nrf2,
Nuclear factor E2-related factor 2; RIPA buffer, Radioimmunoprecipitation assay buffer; ROS, Reac-
tive oxygen species; S1BF, primary somatosensory cortex, barrel field; S1HL, primary somatosensory
cortex hindlimb; S1FL, primary somatosensory cortex forelimb; S2, secondary somatosensory cortex;
sMaf, small musculoaponeurotic fibrosarcoma; SOD-1, Superoxide dismutase 1; SFN, Sulforaphane;
TBARS, Thiobarbituric acid reactive substances; TEAM, triethanolamine; TNF-
α
, Tumor necrosis
factor-alpha.
References
1.
Ruenz, M.; Bakuradze, T.; Eisenbrand, G.; Richling, E. Monitoring urinary mercapturic acids as biomarkers of human dietary
exposure to acrylamide in combination with acrylamide uptake assessment based on duplicate diets. Arch. Toxicol.
2016
,90,
873–881. [CrossRef]
2.
LoPachin, R.M.; Gavin, T. Molecular mechanism of acrylamide neurotoxicity: Lessons learned from organic chemistry. Environ.
Health Perspect. 2012,120, 1650–1657. [CrossRef] [PubMed]
3.
Erkeko˘glu, P.; Baydar, T. Toxicity of acrylamide and evaluation of its exposure in baby foods. Nutr. Res. Rev.
2010
,23, 323–333.
[CrossRef] [PubMed]
4.
Spencer, P.S.; Schaumburg, H.H. A review of acrylamide neurotoxicity. Part II. Experimental animal neurotoxicity and pathologic
mechanisms. Can. J. Neurol. Sci. 1974,1, 152–169. [CrossRef] [PubMed]
5. LoPachin, R.M. The changing view of acrylamide neurotoxicity. Neurotoxicology 2004,25, 617–630. [CrossRef] [PubMed]
6.
LoPachin, R.M.; Ross, J.F.; Lehning, E.J. Nerve Terminals as the Primary Site of Acrylamide Action: A Hypothesis. Neurotoxicology
2002,23, 43–59. [CrossRef]
7.
LoPachin, R.M.; Ross, J.F.; Reid, M.L.; Das, S.; Mansukhani, S.; Lehning, E.J. Neurological Evaluation of Toxic Axonopathies in
Rats: Acrylamide and 2,5-Hexanedione. Neurotoxicology 2002,23, 95–110. [CrossRef]
Int. J. Mol. Sci. 2021,22, 5995 20 of 24
8.
Dearfield, K.L.; Abernathy, C.O.; Ottley, M.S.; Brantner, J.H.; Hayes, P.F. Acrylamide: Its metabolism, developmental and
reproductive effects, genotoxicity, and carcinogenicity. Mutat. Res. 1988,195, 45–77. [CrossRef]
9.
Dearfield, K.L.; Douglas, G.R.; Ehling, U.H.; Moore, M.M.; Sega, G.A.; Brusick, D.J. Acrylamide: A review of its genotoxicity and
an assessment of heritable genetic risk. Mutat. Res. 1995,330, 71–99. [CrossRef]
10.
IARC. Monographs on the Evaluation of Carcinogenic Risks to Human: Some Industrial Chemicals; 60; International Agency for Research
on Cancer: Lyon, France, 1994; pp. 389–433.
11. Rice, J.M. The carcinogenicity of acrylamide. Mutat. Res. 2005,580, 3–20. [CrossRef]
12. Tyl, R.W.; Friedman, M.A. Effects of acrylamide on rodent reproductive performance. Reprod. Toxicol. 2003,17, 1–13. [CrossRef]
13.
Smith, E.A.; Oehme, F.W. Acrylamide and polyacrylamide: A review of production, use, environmental fate and neurotoxicity.
Rev. Environ. Health 1991,9, 215–228. [CrossRef] [PubMed]
14.
Bergmark, E. Hemoglobin adducts of acrylamide and acrylonitrile in laboratory workers, smokers and nonsmokers. Chem. Res.
Toxicol. 1997,10, 78–84. [CrossRef] [PubMed]
15.
Mojska, H.; Gieleci´nska, I.; Cendrowski, A. Acrylamide content in cigarette mainstream smoke and estimation of exposure to
acrylamide from tobacco smoke in Poland. Ann. Agric. Environ. Med. 2016,23, 456–461. [CrossRef]
16.
Tareke, E.; Rydberg, P.; Karlsson, P.; Eriksson, S.; Törnqvist, M. Acrylamide: A cooking carcinogen? Chem. Res. Toxicol.
2000
,13,
517–522. [CrossRef]
17.
Tareke, E.; Rydberg, P.; Karlsson, P.; Eriksson, S.; Törnqvist, M. Analysis of acrylamide, a carcinogen formed in heated foodstuffs.
J. Agric. Food Chem. 2002,50, 4998–5006. [CrossRef]
18.
Lukac, H.; Amrein, T.M.; Perren, R.; Conde-Petit, B.; Amadò, R.; Escher, F. Influence of roasting conditions on the acrylamide
content and the color of roasted almonds. J. Food Sci. 2007,72, C033–C038. [CrossRef]
19. Ishihara, K.; Matsunaga, A.; Miyoshi, T.; Nakamura, K.; Nakayama, T.; Ito, S.; Koga, H. Formation of acrylamide in a processed
food model system, and examination of inhibitory conditions. Shokuhin Eiseigaku Zasshi 2005,46, 33–39. [CrossRef]
20.
Elmore, J.S.; Koutsidis, G.; Dodson, A.T.; Mottram, D.S.; Wedzicha, B.L. The effect of cooking on acrylamide and its precursors in
potato, wheat and rye. Adv. Exp. Med. Biol. 2005,561, 255–269. [CrossRef]
21. Exon, J.H. A review of the toxicology of acrylamide. J. Toxicol. Environ. Health B Crit. Rev. 2006,9, 397–412. [CrossRef]
22.
Itoh, K.; Chiba, T.; Takahashi, S.; Ishii, T.; Igarashi, K.; Katoh, Y.; Oyake, T.; Hayashi, N.; Satoh, K.; Hatayama, I.; et al. An
Nrf2/Small maf heterodimer mediates the induction of phase ii detoxifying enzyme genes through antioxidant response elements.
Biochem. Biophys. Res. Commun. 1997,236, 313–322. [CrossRef]
23.
Vomund, S.; Schäfer, A.; Parnham, M.J.; Brüne, B.; von Knethen, A. Nrf2, the master regulator of anti-oxidative responses. Int. J.
Mol. Sci. 2017,18, 2772. [CrossRef] [PubMed]
24.
Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional Regulation by Nrf2. Antioxid. Redox Signal.
2018
,29, 1727–1745. [CrossRef]
[PubMed]
25.
Dinkova-Kostova, A.T.; Holtzclaw, W.D.; Cole, R.N.; Itoh, K.; Wakabayashi, N.; Katoh, Y.; Yamamoto, M.; Talalay, P. Direct
evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens
and oxidants. Proc. Natl. Acad. Sci. USA 2002,99, 11908–11913. [CrossRef] [PubMed]
26.
Zhang, D.D.; Hannink, M. Distinct cysteine residues in keap1 are required for keap1-dependent ubiquitination of Nrf2 and for
stabilization of Nrf2 by chemopreventive agents and oxidative stress. Mol. Cell. Biol. 2003,23, 8137–8151. [CrossRef]
27.
Itoh, K.; Wakabayashi, N.; Katoh, Y.; Ishii, T.; O’Connor, T.; Yamamoto, M. Keap1 regulates both cytoplasmic-nuclear shuttling
and degradation of Nrf2 in response to electrophiles. Genes Cells 2003,8, 379–391. [CrossRef] [PubMed]
28.
Levonen, A.-L.; Landar, A.; Ramachandran, A.; Ceaser, E.K.; Dickinson, D.A.; Zanoni, G.; Morrow, J.D.; Darley-Usmar, V.M.
Cellular mechanisms of redox cell signalling: Role of cysteine modification in controlling antioxidant defences in response to
electrophilic lipid oxidation products. Biochem. J. 2004,378, 373–382. [CrossRef]
29.
Motohashi, H.; Yamamoto, M. Nrf2–Keap1 defines a physiologically important stress response mechanism. Trends Mol. Med.
2004,10, 549–557. [CrossRef]
30.
Hayes, J.D.; Dinkova-Kostova, A.T. The Nrf2 regulatory network provides an interface between redox and intermediary
metabolism. Trends Biochem. Sci. 2014,39, 199–218. [CrossRef]
31.
Baird, L.; Dinkova-Kostova, A.T. The cytoprotective role of the Keap1-Nrf2 pathway. Arch. Toxicol.
2011
,85, 241–272. [CrossRef]
[PubMed]
32.
Hayashi, A.; Suzuki, H.; Itoh, K.; Yamamoto, M.; Sugiyama, Y. Transcription factor Nrf2 is required for the constitutive and
inducible expression of multidrug resistance-associated protein1 in mouse embryo fibroblasts. Biochem. Biophys. Res. Commun.
2003,310, 824–829. [CrossRef] [PubMed]
33.
Johnson, J.A.; Johnson, D.A.; Kraft, A.D.; Calkins, M.J.; Jakel, R.J.; Vargas, M.R.; Chen, P.C. The Nrf2-ARE pathway: An indicator
and modulator of oxidative stress in neurodegeneration. Ann. N. Y. Acad. Sci. 2008,1147, 61–69. [CrossRef] [PubMed]
34.
Zhang, Y.; Talalay, P.; Cho, C.G.; Posner, G.H. A major inducer of anticarcinogenic protective enzymes from broccoli: Isolation
and elucidation of structure. Proc. Natl. Acad. Sci. USA 1992,89, 2399–2403. [CrossRef] [PubMed]
35.
Cornblatt, B.S.; Ye, L.; Dinkova-Kostova, A.T.; Erb, M.; Fahey, J.W.; Singh, N.K.; Chen, M.S.; Stierer, T.; Garrett-Mayer, E.; Argani,
P.; et al. Preclinical and clinical evaluation of sulforaphane for chemoprevention in the breast. Carcinogenesis
2007
,28, 1485–1490.
[CrossRef]
Int. J. Mol. Sci. 2021,22, 5995 21 of 24
36.
Innamorato, N.G.; Rojo, A.I.; García-Yagüe, A.J.; Yamamoto, M.; de Ceballos, M.L.; Cuadrado, A. The transcription factor Nrf2 is
a therapeutic target against brain inflammation. J. Immunol. 2008,181, 680–689. [CrossRef]
37.
Ahn, Y.H.; Hwang, Y.; Liu, H.; Wang, X.J.; Zhang, Y.; Stephenson, K.K.; Boronina, T.N.; Cole, R.N.; Dinkova-Kostova, A.T.; Talalay,
P.; et al. Electrophilic tuning of the chemoprotective natural product sulforaphane. Proc. Natl. Acad. Sci. USA
2010
,107, 9590–9595.
[CrossRef]
38.
Liu, F.; Ichihara, S.; Valentine, W.M.; Itoh, K.; Yamamoto, M.; Sheik Mohideen, S.; Kitoh, J.; Ichihara, G. Increased susceptibility of
Nrf2-null mice to 1-bromopropane–induced hepatotoxicity. Toxicol. Sci. 2010,115, 596–606. [CrossRef] [PubMed]
39.
Miura, T.; Shinkai, Y.; Jiang, H.-Y.; Iwamoto, N.; Sumi, D.; Taguchi, K.; Yamamoto, M.; Jinno, H.; Tanaka-Kagawa, T.; Cho, A.K.;
et al. Initial response and cellular protection through the Keap1/Nrf2 system during the exposure of primary mouse hepatocytes
to 1,2-naphthoquinone. Chem. Res. Toxicol. 2011,24, 559–567. [CrossRef]
40.
Shinkai, Y.; Kimura, T.; Itagaki, A.; Yamamoto, C.; Taguchi, K.; Yamamoto, M.; Kumagai, Y.; Kaji, T. Partial contribution of the
Keap1-Nrf2 system to cadmium-mediated metallothionein expression in vascular endothelial cells. Toxicol. Appl. Pharmacol.
2016
,
295, 37–46. [CrossRef]
41.
Toyama, T.; Shinkai, Y.; Yasutake, A.; Uchida, K.; Yamamoto, M.; Kumagai, Y. Isothiocyanates reduce mercury accumulation
via an nrf2-dependent mechanism during exposure of mice to methylmercury. Environ. Health Perspect.
2011
,119, 1117–1122.
[CrossRef]
42.
Toyama, T.; Sumi, D.; Shinkai, Y.; Yasutake, A.; Taguchi, K.; Tong, K.I.; Yamamoto, M.; Kumagai, Y. Cytoprotective role of
nrf2/keap1 system in methylmercury toxicity. Biochem. Biophys. Res. Commun. 2007,363, 645–650. [CrossRef]
43.
Ekuban, F.A.; Zong, C.; Takikawa, M.; Morikawa, K.; Sakurai, T.; Ichihara, S.; Itoh, K.; Yamamoto, M.; Ohsako, S.; Ichihara, G.
Genetic ablation of Nrf2 exacerbates neurotoxic effects of acrylamide in mice. Toxicology
2021
,456, 152785. [CrossRef] [PubMed]
44.
Izumi, Y.; Kataoka, H.; Inose, Y.; Akaike, A.; Koyama, Y.; Kume, T. Neuroprotective effect of an Nrf2-ARE activator identified
from a chemical library on dopaminergic neurons. Eur. J. Pharmacol. 2018,818, 470–479. [CrossRef] [PubMed]
45.
Sun, Y.; Yang, T.; Mao, L.; Zhang, F. Sulforaphane protects against brain diseases: Roles of cytoprotective enzymes. Austin J.
Cerebrovasc. Dis. Stroke 2017,4. [CrossRef]
46.
Schepici, G.; Bramanti, P.; Mazzon, E. Efficacy of sulforaphane in neurodegenerative diseases. Int. J. Mol. Sci.
2020
,21, 8637.
[CrossRef]
47.
Tarozzi, A.; Morroni, F.; Merlicco, A.; Hrelia, S.; Angeloni, C.; Cantelli-Forti, G.; Hrelia, P. Sulforaphane as an inducer of
glutathione prevents oxidative stress-induced cell death in a dopaminergic-like neuroblastoma cell line. J. Neurochem.
2009
,111,
1161–1171. [CrossRef] [PubMed]
48.
Tarozzi, A.; Angeloni, C.; Malaguti, M.; Morroni, F.; Hrelia, S.; Hrelia, P. Sulforaphane as a potential protective phytochemical
against neurodegenerative diseases. Oxid. Med. Cell. Longev. 2013,2013, 415078. [CrossRef]
49.
McMahon, M.; Lamont, D.J.; Beattie, K.A.; Hayes, J.D. Keap1 perceives stress via three sensors for the endogenous signaling
molecules nitric oxide, zinc, and alkenals. Proc. Natl. Acad. Sci. USA 2010,107, 18838–18843. [CrossRef]
50.
Dayalan Naidu, S.; Dinkova-Kostova, A.T. KEAP1, a cysteine-based sensor and a drug target for the prevention and treatment of
chronic disease. Open Biol. 2020,10, 200105. [CrossRef]
51.
Suzuki, T.; Muramatsu, A.; Saito, R.; Iso, T.; Shibata, T.; Kuwata, K.; Kawaguchi, S.I.; Iwawaki, T.; Adachi, S.; Suda, H.; et al.
Molecular mechanism of cellular oxidative stress sensing by Keap1. Cell Rep. 2019,28, 746–758.e744. [CrossRef] [PubMed]
52.
Denzer, I.; Münch, G.; Pischetsrieder, M.; Friedland, K. S-allyl-L-cysteine and isoliquiritigenin improve mitochondrial function in
cellular models of oxidative and nitrosative stress. Food Chem. 2016,194, 843–848. [CrossRef]
53.
Zhou, Q.; Chen, B.; Wang, X.; Wu, L.; Yang, Y.; Cheng, X.; Hu, Z.; Cai, X.; Yang, J.; Sun, X.; et al. Sulforaphane protects against
rotenone-induced neurotoxicity
in vivo
: Involvement of the mTOR, Nrf2, and autophagy pathways. Sci. Rep.
2016
,6, 32206.
[CrossRef]
54.
Jazwa, A.; Rojo, A.I.; Innamorato, N.G.; Hesse, M.; Fernández-Ruiz, J.; Cuadrado, A. Pharmacological targeting of the transcription
factor Nrf2 at the basal ganglia provides disease modifying therapy for experimental parkinsonism. Antioxid. Redox Signal.
2011
,
14, 2347–2360. [CrossRef]
55.
Morroni, F.; Tarozzi, A.; Sita, G.; Bolondi, C.; Zolezzi Moraga, J.M.; Cantelli-Forti, G.; Hrelia, P. Neuroprotective effect of
sulforaphane in 6-hydroxydopamine-lesioned mouse model of Parkinson’s disease. Neurotoxicology 2013,36, 63–71. [CrossRef]
56.
Lalonde, R.; Strazielle, C. Brain regions and genes affecting limb-clasping responses. Brain Res. Rev.
2011
,67, 252–259. [CrossRef]
57.
Mangiarini, L.; Sathasivam, K.; Seller, M.; Cozens, B.; Harper, A.; Hetherington, C.; Lawton, M.; Trottier, Y.; Lehrach, H.; Davies,
S.W.; et al. Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in
transgenic mice. Cell 1996,87, 493–506. [CrossRef]
58.
Takahashi, E.; Niimi, K.; Itakura, C. Motor coordination impairment in aged heterozygous rolling Nagoya, Cav2.1 mutant mice.
Brain Res. 2009,1279, 50–57. [CrossRef]
59. Kuperman, A.S. Effects of acrylamide on the central nervous system of the cat. J. Pharmacol. Exp. Ther. 1958,123, 180–192.
60.
Leswing, R.J.; Ribelin, W.E. Physiologic and pathologic changes in acrylamide neuropathy. Arch. Environ. Health
1969
,18, 23–29.
[CrossRef]
61.
Lowndes, H.E.; Baker, T.; Cho, E.S.; Jortner, B.S. Position sensitivity of de-efferented muscle spindles in experimental acrylamide
neuropathy. J. Pharmacol. Exp. Ther. 1978,205, 40–48. [PubMed]
62. McCollister, D.D.; Oyen, F.; Rowe, V.K. Toxicology of Acrylamide. Toxicol. Appl. Pharmacol. 1964,6, 172–181. [CrossRef]
Int. J. Mol. Sci. 2021,22, 5995 22 of 24
63.
Fullerton, P.M.; Barnes, J.M. Peripheral neuropathy in rats produced by acrylamide. Br. J. Ind. Med.
1966
,23, 210–221. [CrossRef]
64.
Suzuki, K.; Pfaff, L.D. Acrylamide neuropathy in rats. An electron microscopic study of degeneration and regeneration. Acta
Neuropathol. 1973,24, 197–213. [CrossRef]
65.
Edwards, P.M. Neurotoxicity of acrylamide and its analogues and effects of these analogues and other agents on acrylamide
neuropathy. Br. J. Ind. Med. 1975,32, 31–38. [CrossRef]
66.
Bradley, W.G.; Asbury, A.K. Radioautographic studies of Schwann cell behavior. I. Acrylamide neuropathy in the mouse. J.
Neuropathol. Exp. Neurol. 1970,29, 500–506. [CrossRef]
67.
Gilbert, S.G.; Maurissen, J.P.J. Assessment of the effects of acrylamide, methylmercury, and 2,5-hexanedione on motor functions
in mice. J. Toxicol. Environ. Health 1982,10, 31–41. [CrossRef]
68.
Hopkins, A. The effect of acrylamide on the peripheral nervous system of the baboon. J. Neurol. Neurosurg. Psychiatry
1970
,33,
805–816. [CrossRef]
69.
Hopkins, A.P.; Gilliatt, R.W. Motor and sensory nerve conduction velocity in the baboon: Normal values and changes during
acrylamide neuropathy. J. Neurol. Neurosurg. Psychiatry 1971,34, 415–426. [CrossRef]
70.
Cabe, P.A.; Colwell, P.B. Toxic effects of acrylamide in Japanese quail (Coturnix coturnix Japonica). J. Toxicol. Environ. Health
1981
,
7, 935–940. [CrossRef]
71.
Auld, R.B.; Bedwell, S.F. Peripheral neuropathy with sympathetic overactivity from industrial contact with acrylamide. Can. Med.
Assoc. J. 1967,96, 652–654. [PubMed]
72. Garland, T.O.; Patterson, M.W. Six cases of acrylamide poisoning. Br. Med. J. 1967,4, 134–138. [CrossRef]
73.
Rho, H.J.; Kim, J.H.; Lee, S.H. Function of selective neuromodulatory projections in the mammalian cerebral cortex: Comparison
between cholinergic and noradrenergic systems. Front. Neural Circuits 2018,12, 47. [CrossRef]
74.
Kropf, E.; Syan, S.K.; Minuzzi, L.; Frey, B.N. From anatomy to function: The role of the somatosensory cortex in emotional
regulation. Braz J. Psychiatry 2019,41, 261–269. [CrossRef] [PubMed]
75.
Bufalari, I.; Aprile, T.; Avenanti, A.; Di Russo, F.; Aglioti, S.M. Empathy for pain and touch in the human somatosensory cortex.
Cereb. Cortex 2007,17, 2553–2561. [CrossRef]
76.
Eickhoff, S.B.; Jbabdi, S.; Caspers, S.; Laird, A.R.; Fox, P.T.; Zilles, K.; Behrens, T.E. Anatomical and functional connectivity of
cytoarchitectonic areas within the human parietal operculum. J. Neurosci. 2010,30, 6409–6421. [CrossRef]
77.
Timmermann, L.; Ploner, M.; Haucke, K.; Schmitz, F.; Baltissen, R.; Schnitzler, A. Differential coding of pain intensity in the
human primary and secondary somatosensory cortex. J. Neurophysiol. 2001,86, 1499–1503. [CrossRef]
78.
Kaas, J.H.; Nelson, R.J.; Sur, M.; Lin, C.S.; Merzenich, M.M. Multiple representations of the body within the primary somatosensory
cortex of primates. Science 1979,204, 521–523. [CrossRef] [PubMed]
79.
Elbert, T.; Candia, V.; Altenmüller, E.; Rau, H.; Sterr, A.; Rockstroh, B.; Pantev, C.; Taub, E. Alteration of digital representations in
somatosensory cortex in focal hand dystonia. Neuroreport 1998,9, 3571–3575. [CrossRef]
80.
Jacobs, M.; Premji, A.; Nelson, A.J. Plasticity-inducing TMS protocols to investigate somatosensory control of hand function.
Neural Plast. 2012,2012, 350574. [CrossRef]
81.
Konczak, J.; Abbruzzese, G. Focal dystonia in musicians: Linking motor symptoms to somatosensory dysfunction. Front. Hum.
Neurosci. 2013,7, 297. [CrossRef]
82.
Wolpert, D.; Pearson, K.; Ghez, C. The organization and planning of movement. In Principles of Neural Science, 5th ed.; Kandel, E.,
Schwartz, J., Jessell, T., Seigelbaum, S., Hudspeth, A., Eds.; McGraw-Hill Companies: New York, NY, USA, 2013; pp. 743–767.
83.
Hummelsheim, H.; Bianchetti, M.; Wiesendanger, M.; Wiesendanger, R. Sensory inputs to the agranular motor fields: A
comparison between precentral, supplementary-motor and premotor areas in the monkey. Exp. Brain Res.
1988
,69, 289–298.
[CrossRef]
84.
Juge, N.; Mithen, R.F.; Traka, M. Molecular basis for chemoprevention by sulforaphane: A comprehensive review. Cell. Mol. Life
Sci. 2007,64, 1105–1127. [CrossRef] [PubMed]
85.
Angeloni, C.; Leoncini, E.; Malaguti, M.; Angelini, S.; Hrelia, P.; Hrelia, S. Modulation of phase II enzymes by sulforaphane:
Implications for its cardioprotective potential. J. Agric. Food Chem. 2009,57, 5615–5622. [CrossRef]
86.
Dinkova-Kostova, A.T.; Talalay, P. Direct and indirect antioxidant properties of inducers of cytoprotective proteins. Mol. Nutr.
Food Res. 2008,52 (Suppl. 1), S128–S138. [CrossRef]
87. Vallee, B.L. Implications and inferences of metallothionein structure. Exp. Suppl. 1987,52, 5–16. [CrossRef]
88.
Maret, W. Cellular zinc and redox states converge in the metallothionein/thionein pair. J. Nutr.
2003
,133, 1460s–1462s. [CrossRef]
89. Maret, W. Redox biochemistry of mammalian metallothioneins. J. Biol. Inorg. Chem. 2011,16, 1079–1086. [CrossRef] [PubMed]
90.
Thirumoorthy, N.; Shyam Sunder, A.; Manisenthil Kumar, K.; Senthil Kumar, M.; Ganesh, G.; Chatterjee, M. A review of
metallothionein isoforms and their role in pathophysiology. World J. Surg. Oncol. 2011,9, 54. [CrossRef] [PubMed]
91.
Endresen, L.; Bakka, A.; Rugstad, H.E. Increased resistance to chlorambucil in cultured cells with a high concentration of
cytoplasmic metallothionein. Cancer Res. 1983,43, 2918–2926.
92.
Oh, S.H.; Deagen, J.T.; Whanger, P.D.; Weswig, P.H. Biological function of metallothionein. V. Its induction in rats by various
stresses. Am. J. Physiol. 1978,234, E282–E285. [CrossRef]
93.
Petering, D.H.; Krezoski, S.; Tabatabai, N.M. 12 Metallothionein toxicology: Metal ion trafficking and cellular protection
metallothioneins and related chelators. In Metallothioneins and Related Chelators; Sigel, H., Sigel, A., Sigel, R.K.O., Eds.; De Gruyter:
Berlin, Germany, 2009; Volume 48, pp. 353–398.
Int. J. Mol. Sci. 2021,22, 5995 23 of 24
94.
Hao, Q.; Maret, W. Aldehydes release zinc from proteins. A pathway from oxidative stress/lipid peroxidation to cellular functions
of zinc. FEBS J. 2006,273, 4300–4310. [CrossRef]
95.
Ghorbel, I.; Elwej, A.; Chaabene, M.; Boudawara, O.; Marrakchi, R.; Jamoussi, K.; Boudawara, T.S.; Zeghal, N. Effects of
acrylamide graded doses on metallothioneins I and II induction and DNA fragmentation: Bochemical and histomorphological
changes in the liver of adult rats. Toxicol. Ind. Health 2017,33, 611–622. [CrossRef] [PubMed]
96.
Gu, J.; Cheng, Y.; Wu, H.; Kong, L.; Wang, S.; Xu, Z.; Zhang, Z.; Tan, Y.; Keller, B.B.; Zhou, H.; et al. Metallothionein is downstream
of Nrf2 and partially mediates sulforaphane prevention of diabetic cardiomyopathy. Diabetes 2017,66, 529–542. [CrossRef]
97.
Lu, Y.; Zhang, Y.; Lou, Y.; Cui, W.; Miao, L. Sulforaphane suppresses obesity-related glomerulopathy-induced damage by
enhancing autophagy via Nrf2. Life Sci. 2020,258, 118153. [CrossRef]
98.
Wu, H.; Kong, L.; Cheng, Y.; Zhang, Z.; Wang, Y.; Luo, M.; Tan, Y.; Chen, X.; Miao, L.; Cai, L. Metallothionein plays a prominent
role in the prevention of diabetic nephropathy by sulforaphane via up-regulation of Nrf2. Free Radic. Biol. Med.
2015
,89, 431–442.
[CrossRef]
99.
Duffy, S.; So, A.; Murphy, T.H. Activation of endogenous antioxidant defenses in neuronal cells prevents free radical-mediated
damage. J. Neurochem. 1998,71, 69–77. [CrossRef]
100.
Li, J.; Lee, J.M.; Johnson, J.A. Microarray analysis reveals an antioxidant responsive element-driven gene set involved in conferring
protection from an oxidative stress-induced apoptosis in IMR-32 cells. J. Biol. Chem. 2002,277, 388–394. [CrossRef]
101.
Murphy, T.H.; De Long, M.J.; Coyle, J.T. Enhanced NAD(P)H:quinone reductase activity prevents glutamate toxicity produced by
oxidative stress. J. Neurochem. 1991,56, 990–995. [CrossRef] [PubMed]
102.
Mas, S.; Gassó, P.; Trias, G.; Bernardo, M.; Lafuente, A. Sulforaphane protects SK-N-SH cells against antipsychotic-induced
oxidative stress. Fundam. Clin. Pharmacol. 2012,26, 712–721. [CrossRef]
103.
Mizuno, K.; Kume, T.; Muto, C.; Takada-Takatori, Y.; Izumi, Y.; Sugimoto, H.; Akaike, A. Glutathione biosynthesis via activation
of the nuclear factor E2-related factor 2 (Nrf2)–antioxidant-response element (ARE) pathway is essential for neuroprotective
effects of sulforaphane and 6-(methylsulfinyl) hexyl isothiocyanate. J. Pharmacol. Sci. 2011,115, 320–328. [CrossRef]
104.
Waza, A.A.; Hamid, Z.; Ali, S.; Bhat, S.A.; Bhat, M.A. A review on heme oxygenase-1 induction: Is it a necessary evil. Inflamm.
Res. 2018,67, 579–588. [CrossRef] [PubMed]
105.
Abdalla, M.Y.; Ahmad, I.M.; Switzer, B.; Britigan, B.E. Induction of heme oxygenase-1 contributes to survival of Mycobacterium
abscessus in human macrophages-like THP-1 cells. Redox Biol. 2015,4, 328–339. [CrossRef] [PubMed]
106.
Prawan, A.; Kundu, J.K.; Surh, Y.J. Molecular basis of heme oxygenase-1 induction: Implications for chemoprevention and
chemoprotection. Antioxid. Redox Signal. 2005,7, 1688–1703. [CrossRef] [PubMed]
107.
Nitti, M.; Piras, S.; Marinari, U.M.; Moretta, L.; Pronzato, M.A.; Furfaro, A.L. HO-1 induction in cancer progression: A matter of
cell adaptation. Antioxidants 2017,6, 29. [CrossRef] [PubMed]
108. Chiang, S.K.; Chen, S.E.; Chang, L.C. A dual role of heme oxygenase-1 in cancer cells. Int. J. Mol. Sci. 2018,20, 39. [CrossRef]
109.
Heiss, E.; Herhaus, C.; Klimo, K.; Bartsch, H.; Gerhäuser, C. Nuclear factor kappa B is a molecular target for sulforaphane-mediated
anti-inflammatory mechanisms. J. Biol. Chem. 2001,276, 32008–32015. [CrossRef]
110.
Lin, W.; Wu, R.T.; Wu, T.; Khor, T.O.; Wang, H.; Kong, A.N. Sulforaphane suppressed LPS-induced inflammation in mouse
peritoneal macrophages through Nrf2 dependent pathway. Biochem. Pharmacol. 2008,76, 967–973. [CrossRef]
111.
Yehuda, H.; Soroka, Y.; Zlotkin-Fruši´c, M.; Gilhar, A.; Milner, Y.; Tamir, S. Isothiocyanates inhibit psoriasis-related proinflammatory
factors in human skin. Inflamm. Res. 2012,61, 735–742. [CrossRef]
112.
Brandenburg, L.O.; Kipp, M.; Lucius, R.; Pufe, T.; Wruck, C.J. Sulforaphane suppresses LPS-induced inflammation in primary rat
microglia. Inflamm. Res. 2010,59, 443–450. [CrossRef] [PubMed]
113.
Folkard, D.L.; Melchini, A.; Traka, M.H.; Al-Bakheit, A.; Saha, S.; Mulholland, F.; Watson, A.; Mithen, R.F. Suppression of
LPS-induced transcription and cytokine secretion by the dietary isothiocyanate sulforaphane. Mol. Nutr. Food Res.
2014
,58,
2286–2296. [CrossRef] [PubMed]
114.
Cao, H.; Wang, L.; Chen, B.; Zheng, P.; He, Y.; Ding, Y.; Deng, Y.; Lu, X.; Guo, X.; Zhang, Y.; et al. DNA demethylation upregulated
nrf2 expression in Alzheimer’s disease cellular model. Front. Aging Neurosci. 2015,7, 244. [CrossRef]
115.
Parsanathan, R.; Jain, S.K. Glutathione deficiency induces epigenetic alterations of vitamin D metabolism genes in the livers of
high-fat diet-fed obese mice. Sci. Rep. 2019,9, 14784. [CrossRef]
116. Gu, X.; Manautou, J.E. Molecular mechanisms underlying chemical liver injury. Expert Rev. Mol. Med. 2012,14, e4. [CrossRef]
117.
Gunawan, B.; Kaplowitz, N. Clinical perspectives on xenobiotic-induced hepatotoxicity. Drug Metab. Rev.
2004
,36, 301–312.
[CrossRef]
118.
Igisu, H.; Goto, I.; Kawamura, Y.; Kato, M.; Izumi, K. Acrylamide encephaloneuropathy due to well water pollution. J. Neurol.
Neurosurg. Psychiatry 1975,38, 581–584. [CrossRef]
119.
Morimoto, M. Occurence of human cases intoxicated with well water contaminated with acrylamide in Fukuoka prfecture. Water
Waste 1975,17, 51–62.
120. Kesson, C.M.; Baird, A.W.; Lawson, D.H. Acrylamide poisoning. Postgrad. Med. J. 1977,53, 16–17. [CrossRef]
121.
Brunetti, D.; Bottani, E.; Segala, A.; Marchet, S.; Rossi, F.; Orlando, F.; Malavolta, M.; Carruba, M.O.; Lamperti, C.; Provinciali, M.;
et al. Targeting multiple mitochondrial processes by a Metabolic Modulator prevents sarcopenia and cognitive decline in SAMP8
mice. Front. Pharmacol. 2020,11, 1171. [CrossRef] [PubMed]
Int. J. Mol. Sci. 2021,22, 5995 24 of 24
122.
Zhu, J.W.; Li, Y.F.; Wang, Z.T.; Jia, W.Q.; Xu, R.X. Toll-Like receptor 4 deficiency impairs motor coordination. Front. Neurosci.
2016
,
10, 33. [CrossRef]
123.
Paxinos, G.; Franklin, K.B.J. (Eds.) The Mouse Brain in Stereotaxic Coordinates, 2nd ed.; Elsevier Academic Press: Cambridge, MA,
USA, 2004.
124.
Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods
2012
,9, 671–675.
[CrossRef] [PubMed]
125.
Jiang, Y.M.; Wang, Y.; Tan, H.S.; Yu, T.; Fan, X.M.; Chen, P.; Zeng, H.; Huang, M.; Bi, H.C. Schisandrol B protects against
acetaminophen-induced acute hepatotoxicity in mice via activation of the NRF2/ARE signaling pathway. Acta Pharmacol. Sin.
2016,37, 382–389. [CrossRef] [PubMed]
126.
Tao, S.; Rojo de la Vega, M.; Quijada, H.; Wondrak, G.T.; Wang, T.; Garcia, J.G.N.; Zhang, D.D. Bixin protects mice against
ventilation-induced lung injury in an NRF2-dependent manner. Sci. Rep. 2016,6, 18760. [CrossRef] [PubMed]
127.
Shanmugam, G.; Narasimhan, M.; Tamowski, S.; Darley-Usmar, V.; Rajasekaran, N.S. Constitutive activation of Nrf2 induces a
stable reductive state in the mouse myocardium. Redox Biol. 2017,12, 937–945. [CrossRef] [PubMed]
128.
Chung, C.; Kim, T.; Kim, M.; Kim, M.; Song, H.; Kim, T.S.; Seo, E.; Lee, S.H.; Kim, H.; Kim, S.K.; et al. Hippo-Foxa2 signaling
pathway plays a role in peripheral lung maturation and surfactant homeostasis. Proc. Natl. Acad. Sci. USA
2013
,110, 7732–7737.
[CrossRef] [PubMed]
129.
Innamorato, N.G.; Jazwa, A.; Rojo, A.I.; García, C.; Fernández-Ruiz, J.; Grochot–Przeczek, A.; Stachurska, A.; Jozkowicz, A.;
Dulak, J.; Cuadrado, A. Different susceptibility to the parkinson’s toxin MPTP in mice lacking the redox master regulator Nrf2 or
its target gene heme oxygenase-1. PLoS ONE 2010,5, e11838. [CrossRef] [PubMed]
130.
Sehsah, R.; Wu, W.; Ichihara, S.; Hashimoto, N.; Hasegawa, Y.; Zong, C.; Itoh, K.; Yamamoto, M.; Elsayed, A.A.; El-Bestar, S.;
et al. Role of Nrf2 in inflammatory response in lung of mice exposed to zinc oxide nanoparticles. Part. Fibre Toxicol.
2019
,16.
[CrossRef] [PubMed]
131.
Checker, R.; Patwardhan, R.S.; Sharma, D.; Menon, J.; Thoh, M.; Bhilwade, H.N.; Konishi, T.; Sandur, S.K. Schisandrin B exhibits
anti-inflammatory activity through modulation of the redox-sensitive transcription factors Nrf2 and NF-
κ
B. Free Radic. Biol. Med.
2012,53, 1421–1430. [CrossRef]
132.
Kim, J.H.; Nam, Y.P.; Jeon, S.M.; Han, H.S.; Suk, K. Amyloid neurotoxicity is attenuated by metallothionein: Dual mechanisms at
work. J. Neurochem. 2012,121, 751–762. [CrossRef]
133.
Rojo, A.I.; Innamorato, N.G.; Martín-Moreno, A.M.; De Ceballos, M.L.; Yamamoto, M.; Cuadrado, A. Nrf2 regulates microglial
dynamics and neuroinflammation in experimental Parkinson’s disease. Glia 2009,58, 588–598. [CrossRef]
