A new infrageneric classification of the pantropical genus Chamaecrista (Fabaceae: Caesalpinioideae) based on a comprehensive molecular phylogenetic analysis and morphology

Abstract

Chamaecrista with > 330 species, six sections, three subsections and 39 series has had a long and complex taxonomic history. The genus is monophyletic, but most of its traditional infrageneric categories are not. To test the monophyly of sections, subsections and series of Chamaecrista, we used two molecular phylogenetic approaches. The first (Broad) based on two DNA regions (ITS and trnL-F) includes a comprehensive sampling of Chamaecrista spp. and infrageneric taxa. The second (Multilocus) is based on four molecular regions (ITS, ETS, trnL-F and trnE-T) for a smaller but representative sampling. We performed ancestral character reconstructions to identify morphological characters that could serve as synapomorphies for major clades. Both molecular approaches support Chamaecrista and sections Apoucouita, Grimaldia and Xerocalyx as monophyletic, but sections Chamaecrista, Caliciopsis and Absus and most of the series are not monophyletic. The four main clades recovered are all characterized by a combination of morphological characters: a clade of tree species with cauliflorous inflorescences (including species of section Apoucouita); a mostly Brazilian campo rupestre clade (including all species of subsections Adenophyllum, Baseophyllum and Otophyllum); a clade of mostly herbaceous/shrubby species with solitary flowers or fascicles (including sections Chamaecrista, Caliciopsis and Xerocalyx and extra-American species) and a clade (with three main subclades) of species with viscous indumentum (including section Grimaldia and section Absus subsection Absus). We propose a new infrageneric classification for Chamaecrista supported by molecular phylogenetic analyses and morphology, recognizing the four main clades as sections Apoucouita, Baseophyllum, Chamaecrista and Absus, the last with three subsections (Absus, Viscosa and Zygophyllum), but we do not recognize any previously circumscribed series. Our taxonomic treatment includes descriptions of and a key to the newly defined infrageneric taxa and an updated species list for the genus under the new classification.

Full text

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46 1
Botanical Journal of the Linnean Society, 2021, XX, 1–46. With 12 figures.
*Corresponding author. E-mail: alessandro341@hotmail.com
A new infrageneric classification of the pantropical
genus Chamaecrista (Fabaceae: Caesalpinioideae) based
on a comprehensive molecular phylogenetic analysis and
morphology
ALESSANDRO OLIVEIRA DE SOUZA1,*, GWILYM P. LEWIS2, and
MARCOS JOSÉ DA SILVA3,
1Postgraduate Program in Botany, Instituto de Ciências Biológicas, Universidade de Brasília, Asa Norte,
70.919-970, Brasília, DF, Brazil
2Comparative Plant and Fungal Biology Department, Royal Botanic Gardens, Kew, Richmond, Surrey,
TW9 3AB, UK
3Universidade Federal de Goiás, Laboratório de Filogenia Molecular de Plantas, Departamento de
Botânica, Instituto de Ciências Biológicas, Campus Samambaia II, CP. 131. 74001-970, Goiânia, GO,
Brazil
Received 28 October 2020; revised 3 February 2021; accepted for publication 21 March 2021
Chamaecrista with > 330 species, six sections, three subsections and 39 series has had a long and complex taxonomic
history. The genus is monophyletic, but most of its traditional infrageneric categories are not. To test the monophyly
of sections, subsections and series of Chamaecrista, we used two molecular phylogenetic approaches. The first
(Broad) based on two DNA regions (ITS and trnL-F) includes a comprehensive sampling of Chamaecrista spp. and
infrageneric taxa. The second (Multilocus) is based on four molecular regions (ITS, ETS, trnL-F and trnE-T) for a
smaller but representative sampling. We performed ancestral character reconstructions to identify morphological
characters that could serve as synapomorphies for major clades. Both molecular approaches support Chamaecrista
and sections Apoucouita, Grimaldia and Xerocalyx as monophyletic, but sections Chamaecrista, Caliciopsis and
Absus and most of the series are not monophyletic. The four main clades recovered are all characterized by a
combination of morphological characters: a clade of tree species with cauliflorous inflorescences (including species
of section Apoucouita); a mostly Brazilian campo rupestre clade (including all species of subsections Adenophyllum,
Baseophyllum and Otophyllum); a clade of mostly herbaceous/shrubby species with solitary flowers or fascicles
(including sections Chamaecrista, Caliciopsis and Xerocalyx and extra-American species) and a clade (with three main
subclades) of species with viscous indumentum (including section Grimaldia and section Absus subsection Absus).
We propose a new infrageneric classification for Chamaecrista supported by molecular phylogenetic analyses and
morphology, recognizing the four main clades as sections Apoucouita, Baseophyllum, Chamaecrista and Absus, the
last with three subsections (Absus, Viscosa and Zygophyllum), but we do not recognize any previously circumscribed
series. Our taxonomic treatment includes descriptions of and a key to the newly defined infrageneric taxa and an
updated species list for the genus under the new classification.
ADDITIONAL KEYWORDS: Cassia – large-scale phylogeny – Leguminosae – molecular systematics – morphology.
INTRODUCTION
Chamaecrista (L.) Moench with > 330 species is one
of the largest genera of caesalpinioid Fabaceae (Lewis
et al., 2005; LPWG, 2017). The genus has a pantropical
distribution, 85% of the species occurs in the Americas
and 15% occurs in the Africa, Madagascar, Middle East,
Southern Asia and Oceania, but it is far more diverse
in the Brazil where 272 species occur (Flora do Brazil,
2020). Chamaecrista includes small annual herbs,
perennial shrubs and subshrubs with several growth
aspects and habits; rarely, they are trees. Species
applyparastyle “g//caption/p[1]” parastyle “FigCapt”
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

2 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
have paripinnate leaves, bi-bracteolate pedicels,
asymmetrical enantiostylic flowers pollinated by bees,
actinomorphic androecium, anthers pubescent along
the sutures, elastically dehiscent fruits and a diversity
of trichome types and extrafloral nectaries (Irwin &
Barneby, 1982). The genus is ecologically important
because it is one of the genera of Caesalpinioideae
able to fix atmospheric nitrogen through bacteria-
inhabited root nodules (Irwin & Barneby, 1982; Lewis
et al., 2005).
Chamaecrista with Cassia L. and Senna Mill.
make up subtribe Cassiinae of tribe Cassieae (Irwin
& Barneby, 1982). The genus has a long taxonomic
history with inclusion in, or separation from, Cassia
over > 200 years. Chamaecrista was established by
Moench (1794) based on a few Cassia spp., but much
later considered by Bentham (1870) and Irwin &
Barneby (1978) as a subgenus of Cassia (= Cassia
subgenus Lasiorhegma Benth.). One hundred and
twelve years after Bentham (1870), Chamaecrista was
re-established as an independent genus and revised
for the Americas by Irwin & Barneby (1982), who
assigned to it 275 species, distributed in six sections,
four subsections and 39 series, on the basis of a set of
morphological characters including leaflet number per
leaf, consistency and orientation of the leaflets, leaflet
venation pattern, presence/absence and location of
extrafloral nectaries and glandular trichomes, types
and location of the inflorescences and floral characters.
The classification of Irwin & Barneby (1982) is the
current standard work for the genus, especially in the
Americas.
With the advancement of phylogenetic studies in
the late 20th century, classifications started to be based
more on the recognition of monophyletic groups, and
this required changes in circumscription at various
taxonomic ranks (LPWG, 2017). A number of pioneering
studies with Chamaecrista and its infrageneric taxa
were developed to ascertain their monophyly and the
relationship of Chamaecrista with its assumed closely
related Cassia and Senna. Conceição et al. (2009)
conducted the first phylogenetic study focused on
Chamaecrista. It used the molecular markers trnL-F
(plastid DNA) and ITS (nuclear ribosomal DNA) and
sampled 47 species, representing six sections, two
subsections and 11 series of Chamaecrista. Their study
(Conceição et al., 2009) demonstrated the monophyly
of Chamaecrista and sections Apoucouita (H.S.Irwin &
Barneby) H.S.Irwin & Barneby and Xerocalyx (Benth.)
H.S.Irwin & Barneby, but highlighted the para- or
polyphyletic status of other sections and most of the
series in the genus.
Torres et al. (2011) performed a phylogenetic
analysis of Chamaecrista section Xerocalyx based on
ITS and plastid trnE-T markers. Their study supported
the monophyly of section Xerocalyx and suggested
that it would better be considered a subcategory of
section Chamaecrista. More recently, Rando et al.
(2016), Souza et al. (2019a) and Mendes, Souza & Silva
(2020) recovered the phylogenetic history of series
Coriaceae (Benth.) H.S.Irwin & Barneby, Rigidulae
(Benth.) H.S.Irwin & Barneby and Paniculatae
(Benth.) H.S.Irwin & Barneby, respectively, and found
that the series are all polyphyletic and proposed their
recircumscription based on monophyletic groups.
These three studies demonstrated new species-level
relationships and indicated that the classification of
Chamaecrista proposed by Irwin & Barneby (1982)
at section and series level did not reflect our current
phylogenetic knowledge of the genus.
No new infrageneric classification at section level
has been proposed for Chamaecrista since Irwin &
Barneby (1982). This is largely because the previous
phylogenetic studies: (1) sampled < 25% of the species
of the genus; (2) subsections Adenophyllum (H.S.Irwin
& Barneby) H.S.Irwin & Barneby and Otophyllum
(H.S.Irwin & Barneby) H.S.Irwin & Barneby and 16
series [including Bracteolatae (Collad.) H.S.Irwin &
Barneby, Ericifoliae (H.S.Irwin & Barneby) H.S.Irwin
& Barneby and Strictifoliae (H.S.Irwin & Barneby)
H.S.Irwin & Barneby] were not sampled; (3) the most
species-rich sections, sections Chamaecrista and Absus
(Collad.) H.S.Irwin & Barneby were represented by <
33% of their species and (4) other species-rich series
were poorly sampled [e.g. Microphyllae (Benth.)
H.S.Irwin & Barneby and Ochnaceae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby]. Therefore, more
densely sampled phylogenetic studies are needed to
fill taxonomic gaps not previously sampled with the
aim to clarify intrageneric relationships and more
accurately circumscribe infrageneric taxa.
In view of these factors, this study aims to
reconstruct the phylogenetic history of Chamaecrista
with a comprehensive species sampling to: (1) test the
monophyly of its infrageneric taxa (sections, subsections
and series) and understand the relationships between
them; (2) perform ancestral character reconstructions
to identify morphological characters that could serve
as synapomorphies for the main clades and (3) propose
a new infrageneric classification for Chamaecrista
supported by phylogenetic and morphological evidence.
MATERIAL AND METHODS
Taxon sampling
Two sampling strategies were developed to achieve
the proposed aims. In the Broad approach, the dataset
comprises the largest sampling ever carried out for
Chamaecrista and aims to retest the monophyly of
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 3
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
the genus and its sections based on broad taxonomic
sampling of its species and infrageneric taxa above
species level. Our sampling covers > 67% of all
Chamaecrista spp., all sections and subsections
and 34 out of 39 of the traditionally recognized
series (sensu Irwin & Barneby, 1982), covering the
pantropical distribution of the genus, sampling 95%
American species and 5% extra-American species. In
this broad approach, we used the two most commonly
used markers in previously published phylogenetic
analyses of Chamaecrista, namely ITS (nrDNA) and
trnL-F (plastid DNA) (Conceição et al., 2009; Rando
et al., 2016; Souza et al., 2019a; Mendes et al., 2020).
We sampled 232 species (286 accessions), 217 species
belong to Chamaecrista (270 accessions) and the
other 15 species (16 accessions) belong to selected
outgroup taxa including Cassia (three species), Senna
(seven species), Melanoxylon Schott in K.Sprengel
(one species), Recordoxylon Ducke (one species),
Vouacapoua Aubl. (two species) and Pterogyne Tul.
(one species). Pterogyne was used to root the trees.
It was not possible to sample all markers for all
species, the missing data between the matrices in this
approach was c. 4%.
In the Multilocus approach, the dataset was
designed to recover better internal taxon resolution
in Chamaecrista and to seek support for major clades
in the genus, especially for the species-rich sections
Chamaecrista and Absus. The overall aim was to be
able to propose a new infrageneric classification for
the genus based on well-supported clades. We used
four molecular markers (ITS, ETS, trnL-F and trnE-T)
and a smaller sample of 150 species (193 accessions), of
which 144 species (187 accessions) are of Chamaecrista
and representative of all taxonomic infrageneric taxa
(sections, subsections and series). We used six species
as the outgroup. The missing data between the markers
matrices in this approach was c. 10%. The complete list
of accessions, sequences generated in this study and
those obtained from GenBank from previous studies
of the genus (e.g. Conceição et al., 2009; Torres et al.,
2011; Rando et al., 2016; Souza et al., 2019a; Mendes
et al., 2020), and vouchers are presented in Table 1.
Dna exTracTion, amplificaTion anD sequencing
Total genomic DNA was extracted from fresh
fragments of leaves stored in silica or from herbarium
material, using the Doyle & Doyle (1987) extraction
protocol with 2% CTAB (cetyltrimethylammonium
bromide). ITS (including the ITS1 and ITS2 spacer
regions and the 5.8S ribosomal subunit) was amplified
and sequenced using primers ITS1 and ITS4 (White
et al., 1990) or for some samples the primer pair 17SE
and 26SE (Sun et al., 1994). The primers 18S-IGS and
26-IGS (Baldwin & Markos 1998) were used to amplify
and sequence the marker ETS. The trnL-F locus was
amplified and sequenced in two steps and assembled
later using the pairs of primers (c and d, e and f;
Taberlet et al., 1991). For trnE-T, the primers trnE-T-
Forward and trnE-T-Reverse (Kato et al., 2000) were
used for amplification and sequencing.
All PCR amplifications were performed in a reaction
with a final volume of 25 µL, containing 2 µL of 1×
buffer, 1.5 µL of MgCl2 (1.5 mM), 1 µL of dNTPs (1 mM),
2 µL of each primer (5 µM), 1 µL of BSA, 0.2 µL of Taq
DNA polymerase and H2O ultrapure (q.s.p. 25 µL). For
the amplification of ITS and ETS, we added 1 µL of
DMSO (dimethyl sulphoxide) and 1 µL of betaine. The
sequences of the primers used and the thermocycling
cycles for each marker are listed in Tables 2 and 3,
respectively. The products of all amplifications were
purified and sequenced through a commercial external
service (Macrogen, South Korea).
alignmenT anD phylogeneTic analysis
The sequences were visualized and base calling
accuracy confirmed using the software Chromas
Lite v.2.1.1 and edited in the BioEdit v.7.2.5 (Hall,
1999). The individual matrices were edited in the
software MEGA 6 (Tamura et al., 2013) and aligned
using the software MAFFT 7 available online (Katoh,
Rozewicki & Yamada, 2017) and corrected manually.
The indels of the molecular markers were encoded by
the simple coding method (Simmons & Ochoterena,
2000) using the software FastGap v.1.2 (Borchsenius,
2009) and analysed individually to verify their level
of information, then incorporated into the matrices as
informative characters.
Potential incongruences between nuclear and plastid
datasets were evaluated using the incongruence
length difference (ILD) test (Farris et al., 1994, 1995)
implemented in PAUP* v.4.0 (Swofford, 2003) as the
partition-homogeneity test, with 1,000 replicates, a
heuristic search, with simple addition of taxa, tree
bisection-reconnection and the ‘multrees’ option in
effect and saving up to ten trees per replicate. The
indels were not considered in this analysis.
For the two sampling approaches, analyses of
maximum likelihood (ML) and Bayesian inference
(BI) were performed for the individual and combined
datasets (ITS+ETS, ITS+ trnL-F+, trnL-F+trnE-T
and four markers combined) considering and not
considering the indels to investigate possible topology
conflicts. The ML analysis was performed in the
RAxML-HPC2 v.8.1.11 (Stamatakis, 2006) under
the substitution model GTR+I+G and bootstrap
(BT) support was estimated using 1,000 pseudo-
replicates. The BI analysis was performed in MrBayes
v.3.2 (Ronquist et al., 2012). The models of evolution
were selected for each marker in JModelTest v.2.1.5
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

4 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Table 1. List of taxa and GenBank accessions used in the phylogenetic analysis. Vouchers (first collector, collection number and acronym of the herbarium where
the specimen is housed) followed by locality (country and first political division, when given on the field label) and GenBank accession numbers. Asterisks indi-
cate sequences generated in this study. Underlined taxa were used in the reconstruction of ancestral character analysis. Infrageneric taxa of Chamaecrista follow
Irwin & Barneby (1982) with updates by Rando et al. (2016), Souza et al. (2019a) and Mendes et al. (2020). Sections are numbered 1 to 6. Numbers in square
brackets indicate the number of species sampled in this study/total of species in the taxon
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Outgroup
Cassia fistula W.M. Bezerra 5 (EAC) Brazil, Ceará GU175310 — EU361781 GU175321
Cassia grandis L.P. Queiroz 2878 (HUEFS) Brazil, Bahia FJ009820 — FJ009875 —
Cassia javanica L.P. Queiroz 11039 (HUEFS) Brazil, Bahia FJ009821 — FJ009876 —
Melanoxylon brauna M. Nuscheler 10 (CEPEC) Brazil, Bahia — — AY899700 —
Pterogyne nitens P.S. Herendeen 13/XII/97/1
(US)
Tanzania KX372782 — AF365074 —
Recordoxylon speciosum H.C. Lima 3333 (INPA) Brazil, Amazonas — — AY899699 —
Senna alata A. Bruneau 1076 (MT) Cameroon KX372780 MW681928* AF365091 GU175334
Senna cana A.O. Souza 423 (UFG) Brazil, Goiás MH835400 — MH835400 —
Senna corifolia var. caesia A.O. Souza 289 (UFG) Brazil, Goiás MH835401 — MH835401 —
Senna corifolia var. corifolia A.O. Souza 1037 (UFG) Brazil, Goiás MH835402 — MH835402 —
Senna gardneri L.P. Queiroz 7860 (HUEFS) Brazil, Bahia FJ009822 — FJ009877 —
Senna occidentalis A. Bruneau 1257 (MT) — MH050236 MW681929* AF365030 GU175337
Senna pendula A.O. Souza 190 (UFG) Brazil, Goiás MH835403 MW681930* MH835403 —
Senna rugosa A.O. Souza 201 (UFG) Brazil, Goiás MH835404 — MH835404 —
Vouacapoua americana D. Cardoso 3444 Brazil, Amazonas KR134125 KP999911 AY899701 —
Vouacapoua macropetala Breteler 13793 (WAG) Guyana — — AF365110 —
Chamaecrista (L.) Moench
[217/363]
1. Chamaecrista section
Chamaecrista [39/58]
Chamaecrista section
Chamaecrista series
Chamaecrista [6/18]
Chamaecrista fasciculata USDA DLEG920271 United States EF590760 — — —
Chamaecrista glandulosa var.
brasiliensis
A.O. Souza 859 (UFG) Brazil, Goiás MW683419* MW681882* MW681984* MW682103*
Chamaecrista lineata J.G. Rando 958 (SPF) Bahamas — KP967085 KP966912 KP966967
Chamaecrista nictitans subsp.
brachypoda
L.P. Queiroz 10335 (HUEFS) Brazil, Goiás FJ009855 KP999907 FJ009909 —
Chamaecrista nictitans subsp.
disadena
A.S. Conceição 790 (HUEFS) Brazil, Minas Gerais FJ009852 — FJ009906 KU720163
Chamaecrista nictitans subsp.
nictitans var. jaliscensis
Klitgaard 654 (K) Costa Rica KU720159 — AF365093 KU720161
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 5
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista nictitans subsp.
patellaria var. ramosa
L.P. Queiroz 10406 (HUEFS) Brazil, Mato Grosso FJ009853 MW681897* FJ009907 MW682121*
Chamaecrista pascuorum L.P. Queiroz 9169 (HUEFS) Brazil, Bahia FJ009851 KP999909 FJ009905 KP966979
Chamaecrista repens A.M. Giulietti 2325 (HUEFS) Brazil, Minas Gerais KP967098 KP967036 KP966925 KP966982
Chamaecrista section
Chamaecrista series
Bauhinianae [2/2]
Chamaecrista basifolia A.O. Souza 1018 (UFG) Brazil, Goiás MW683379* MW681840* MW681942* MW682057*
Chamaecrista rotundifolia var.
grandiflora
C.B.N. Costa 128 (HUEFS) Brazil, Bahia FJ009857 MW681910* FJ009911 GU175331
Chamaecrista section
Chamaecrista series
Coriaceae [18/19]
Chamaecrista anceps M.M.T. Cota 410 (DIAM) Brazil, Minas Gerais — — KP966898 KP966953
Chamaecrista aristata J.G. Rando 976 (SPF) Brazil, Minas Gerais KP967072 KP967070 KP966899 KP966954
Chamaecrista burchellii J.G. Rando 1092 (SPF) Brazil, Goiás KP967073 KP967068 KP966900 KP966956
Chamaecrista cardiostegia J.G. Rando 1125 (SPF) Brazil, Minas Gerais KP967074 KP967067 KP966901 KP966957
Chamaecrista choriophylla J.G. Rando 1034 (HUEFS) Brazil, Minas Gerais KP967076 KP967063 KP966904 KP966959
Chamaecrista cinerascens J.G. Rando 661 (SPF) Brazil, Minas Gerais KP967077 KP967062 KP966905 KP966960
Chamaecrista distichoclada J.G. Rando 1230 (SPF) Brazil, Minas Gerais KP967078 KP967060 KP966906 KP966961
Chamaecrista lagotois J.G. Rando 1029 (HUEFS) Brazil, Minas Gerais KP967079 KP967058 KP966907 KP966963
Chamaecrista latifolia J.G. Rando 1024 (HUEFS) Brazil, Minas Gerais KP967081 KP967056 KP966909 KP966964
Chamaecrista mucronata J.G. Rando 879 (SPF) Brazil, Minas Gerais KP967086 KP967050 KP966913 KP966968
Chamaecrista olesiphylla J.G. Rando 632 (SPF) Brazil, Minas Gerais KP967088 KP967046 KP966915 KP966971
Chamaecrista papillata J.G. Rando 1011 (HUEFS) Brazil, Minas Gerais KP967093 KP967043 KP966920 KP966976
Chamaecrista potentilla J.G. Rando 1139 (SPF) Brazil, Minas Gerais KP967096 KP967038 KP966923 KP966980
Chamaecrista rossicorum J.G. Rando 1045 (HUEFS) Brazil, Minas Gerais KP967101 KP967029 KP966931 KP966988
Chamaecrista rotundata var.
grandistipula
J.G. Rando 1240 (SPF) Brazil, Minas Gerais KP967106 KP967025 KP966937 KP966994
Chamaecrista rotundata var.
interstes
J.G. Rando 1145 (SPF) Brazil, Minas Gerais KP967107 KP967024 KP966938 KP966995
Chamaecrista rotundata var.
rotundata
J.G. Rando 1144 (SPF) Brazil, Minas Gerais KP967103 KP967022 KP966933 KP966990
Chamaecrista simplifacta J.G. Rando 802 (SPF) Brazil, Minas Gerais KP967109 KP967019 KP966942 KP966999
Chamaecrista tragacanthoides var.
rasa
J.G. Rando 969 (SPF) Brazil, Minas Gerais KP967113 KP967015 KP966946 KP967003
Chamaecrista tragacanthoides var.
tragacanthoides
J.R. Pirani 6334 (SPF) Brazil, Minas Gerais KP967114 KP967013 KP966948 KP967004
Chamaecrista ulmea M.F. Santos 650 (SPF) Brazil, Minas Gerais KP967115 KP967012 KP966949 KP967005
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

6 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Excluded from series
Coriaceae [3/3]
Chamaecrista caribaea J.G. Rando 963 (SPF) Bahamas, Ragged Is-
land
KP967075 KP967066 KP966902 KP966958
Chamaecrista roraimae 1 J.G. Rando 1154 (SPF) Brazil, Roraima KP967099 KP967033 KP966927 KP966983
Chamaecrista roraimae 2 R.M. Harley 55036 (HUEFS) Brazil, Bahia — KP967034 KP966928 KP966984
Chamaecrista venulosa J.G. Rando 1015 (HUEFS) Brazil, Minas Gerais KP967116 KP967011 KP966950 KP967006
Chamaecrista section
Chamaecrista series
Flexuosae [5/6]
Chamaecrista flexuosa var.
flexuosa
A.M. Giulietti 2344 (HUEFS) Brazil, Minas Gerais FJ009858 KP967059 FJ009912 GU175327
Chamaecrista gonoclada G.G. Hatschbach 58737 (NY) Brazil, Mato Grosso
do Sul
MW683420* MW681883* MW681985* MW682104*
Chamaecrista oligandra M.J. Silva 8131 (UFG) Brazil, Goiás MK228886 MW681899* MK224843 MW682123*
Chamaecrista parvistipula A.O. Souza 183 (UFG) Brazil, Goiás MK228887 MW681904* MK224844 MW682128*
Chamaecrista swainsonii L.P. Queiroz 12314 (HUEFS) Brazil, Bahia KP967111 KP967016 KP966944 KP967001
Chamaecrista section
Chamaecrista series
Prostratae [5/9]
Chamaecrista kunthiana 1 A.O. Souza 2268 (UFG) Brazil, Goiás — MW681888* MW681995* MW682110*
Chamaecrista kunthiana 2 A.O. Souza 238 (UFG) Brazil, Goiás — MW681889* MW681996* MW682111*
Chamaecrista pilosa L.P. Queiroz 10221 (HUEFS) Brazil, Bahia FJ009856 KP999910 FJ009910 —
Chamaecrista supplex 1 L.P. Queiroz 10217 (HUEFS) Brazil, Bahia FJ009869 — FJ009923 —
Chamaecrista supplex 2 A.O. Souza 2099 (UFG) Brazil, Goiás MW683468* MW681916* MW682035* MW682143*
Chamaecrista tenuisepala A.O. Souza 2221 (UB) Brazil, Bahia MW683469* MW681917* MW682036* MW682144*
Chamaecrista trichopoda M. Aparecida 636 (EAC) Brazil, Bahia GU175318 MW681919* MW682038* GU175333
2. Chamaecrista section Absus
[158/206]
Chamaecrista section Absus
subsection Absus [148/196]
Chamaecrista section Absus
subsection Absus series
Absoideae [26/26]
Chamaecrista acosmifolia var.
acosmifolia
A.O. Souza 2089 (UB) Brazil, Bahia MK056255 MW681829* MK390616 MW682046*
Chamaecrista acosmifolia var.
euryloba
H.S. Irwin 28000 (K) Brazil, Minas Gerais MW683370* MW681830* MW681932* MW682047*
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 7
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista acosmifolia var.
oropedii
J.E.Q. Faria 3953 (UB) Brazil, Goiás MW683371* MW681831* MW681931* MW682048*
Chamaecrista amiciella A.O. Souza 2226 (UB) Brazil, Bahia MW683373* MW681834* MW681935* MW682050*
Chamaecrista andersonii A.O. Souza 2240 (UB) Brazil, Goiás MW683374* — MW681936* MW682051*
Chamaecrista arboae A.O. Souza 2197 (UB) Brazil, Bahia MW683376* MW681836* MW681938* MW682053*
Chamaecrista barbata A.O. Souza 2072 (UB) Brazil, Bahia MK056256 MW681839* MK390617 MW682056*
Chamaecrista belemii var. belemii A.O. Souza 2231 (UB) Brazil, Bahia MW683380* — MW681943* MW682058*
Chamaecrista belemii var.
paludicola
L.P. Queiroz 3841 (NY) Brazil, Bahia MW683381* — MW681944* MW682059*
Chamaecrista brevicalyx var.
brevicalyx
A.O. Souza 1245 (UFG) Brazil, Bahia MH835360 MW681847* MH828383 MW682066*
Chamaecrista brevicalyx var.
elliptica
A.O. Souza 2078 (UB) Brazil, Bahia MW683386* MW681848* MW681949* MW682067*
Chamaecrista campestris A.O. Souza 1596 (UFG) Brazil, Mato Grosso MH835361 — MH828384 MW682071*
Chamaecrista carobinha A.O. Souza 2190 (UB) Brazil, Bahia MK056257 MW681852* MK390618 MW682072*
Chamaecrista chapadae A.O. Souza 1541 (UB) Brazil, Bahia MW683394* MW681854* MW681958* MW682074*
Chamaecrista egleri W.R. Anderson 11071 (NY) Brazil, Pará MW683409* — MW681974* MW682094*
Chamaecrista fagonioides var.
fagonioides
S. Zamudio 11764 (XAL) Mexico, Michoacán MW683414* MW681876* MW681979* MW682097*
Chamaecrista fagonioides var.
macrocalyx
A.O. Souza 910 (UFG) Brazil, Goiás MH835373 MW681877* MH828396 MW682098*
Chamaecrista hispidula A.O. Souza 1570 (UFG) Brazil, Sergipe MH835379 MW681884* MH828402 MW682105*
Chamaecrista jacobinea M.J.G. Andrade 610 (HUEFS) Brazil, Bahia FJ009827 — FJ009882 —
Chamaecrista juruenensis A.O. Souza 2045 (UB) Brazil, Bahia MW683428* MW681887* MW681993* MW682108*
Chamaecrista longicuspis A.O. Souza 1832 (UB) Brazil, Goiás MW683435* — MW682002* MW682113*
Chamaecrista longistyla D. Sasaki 1605 (UFG) Brazil, Mato Grosso MK056259 MW681891* MK390620 MW682114*
Chamaecrista multiseta A.O. Souza 1300 (UFG) Brazil, Goiás MH835384 — MH828407 MW682118*
Chamaecrista paraunana A.O. Souza 2115 (UB) Brazil, Bahia MK056261 MW681903* MK390622 MW682127*
Chamaecrista punctulata S. Zamudio 11764 (XAL) Mexico, Michoacán MW683455* MW681908* MW682022* MW682132*
Chamaecrista aff. roncadorensis L.P. Queiroz 10279 (HUEFS) Brazil, Goiás FJ009831 — — —
Chamaecrista roncadorensis A.O. Souza 2223 (UB) Brazil, Goiás MW683456* MW681909* MW682023* MW682133*
Chamaecrista rugosula A.O. Souza 1225 (UB) Brazil, Bahia MW683457* — MW682024* MW682134*
Chamaecrista salvatoris W. Santana 12181 (BHCB) Brazil, Bahia MW683458* — MW682025* MW682136*
Chamaecrista souzana A.O Souza 2105 (UB) Brazil, Minas Gerais MW683463* MW681913* MW682030* MW682140*
Chamaecrista viscosa var. major A.O. Souza 2092 (UB) Brazil, Bahia MW683474* MW681922* MW682042* MW682148*
Chamaecrista viscosa var.
paraguayensis
A.O. Souza 1641 (UFG) Brazil, Mato Grosso MH835399 MW681923* MH828422 MW682149*
Chamaecrista viscosa var. viscosa E. Martinez 5753 (XAL) Mexico, Guerrero MW683475* MW681924* MW682043* MW682150*
Chamaecrista zygophylloides var.
colligans
A.O. Souza & al. 2050 Brazil, Bahia MK056262 MW681925* MK390623 MW682151*
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

8 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista zygophylloides var.
deamii
A.O. Souza 2237 (UB) Brazil, Bahia MW683476* MW681926* MW682044* MW682152*
Chamaecrista zygophylloides var.
zygophylloides
A.O. Souza 2236 (UB) Brazil, Bahia MW683477* MW681927* MW682045* MW682153*
Chamaecrista section Absus
subsection Absus series
Adenophyllae [3/5]
Chamaecrista adenophylla A.O. Souza 2122 (UB) Brazil, Minas Gerais MW683372* MW681832* MW681933* —
Chamaecrista axilliflora N. Roque 4359 (US) Brazil, Bahia MW683378* — MW681941* —
Chamaecrista chrysosepala A.O. Souza 582 (UFG) Brazil, Goiás MW683395* MW681855* MW681959* MW682075*
Chamaecrista section Absus
subsection Absus series
Bracteolatae [2/3]
Chamaecrista bracteolata A.O. Souza 2124 (UB) Brazil, Minas Gerais MW683385* MW681846* MW681948* MW682065*
Chamaecrista phyllostachya A.O. Souza 2110 (UB) Brazil, Minas Gerais MW683450* — MW682017* —
Chamaecrista section Absus
subsection Absus series
Catharticae [1/3]
Chamaecrista cathartica A.S. Conceição 789 (HUEFS) Brazil, Minas Gerais FJ009841 — FJ009895 —
Chamaecrista section Absus
subsection Absus series
Confertae [4/4]
Chamaecrista anamariae A.S. Conceição 787 (HUEFS) Brazil, Bahia FJ009826 — FJ009881 —
Chamaecrista caespitosa A.O. Souza 2126 (UB) Brazil, Minas Gerais MW683388* MW681850* MW681951* MW682069*
Chamaecrista conferta var.
conferta
A.O. Souza 2121 (UB) Brazil, Minas Gerais MW683396* MW681860* MW681960* MW682080*
Chamaecrista conferta var.
gurgueiana
A.O. Souza 2173 (UB) Brazil, Piauí MW683397* MW681861* MW681961* MW682081*
Chamaecrista conferta var.
machrisiana
A.O. Souza 1815 (UFG) Brazil, Goiás MW683398* MW681862* MW681962* MW682082*
Chamaecrista conferta var.
simulans
A.O. Souza 1062 (UFG) Brazil, Goiás MW683399* MW681863* MW681963* MW682083*
Chamaecrista conferta var. virgata A.O. Souza 168 (UFG) Brazil, Goiás MW683400* MW681864* MW681964* MW682084*
Chamaecrista crommyotricha A.O. Souza 1183 (UFG) Brazil, Distrito Federal MW683402* MW681867* MW681966* MW682087*
Chamaecrista section Absus
subsection Absus series
Ericifoliae [1/1]
Chamaecrista ericifolia M.F. Simon 1814 (CEN) Brazil, Minas Gerais MW683412* — MW681977* —
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 9
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista section Absus
subsection Absus series
Geminatae [2/2]
Chamaecrista didyma J. H. Kirkbride Jr. 2906 (NY) Brazil, Pará MW683405* MW681871* MW681970* MW682091*
Chamaecrista geminata G.P. Silva 1648 (CEN) Brazil, Goiás MW683418* MW681881* MW681983* MW682102*
Chamaecrista section Absus
subsection Absus series
Glutinosae [6/14]
Chamaecrista dentata R.G. Chacon 569 (UEC) Brazil, Minas Gerais MW683403* — MW681968* —
Chamaecrista echinocarpa E.T. Neto 4079 (BHCB) Brazil, Minas Gerais MW683408* — MW681973* —
Chamaecrista gumminans G.P. Silva 2879 (CEN) Brazil, Minas Gerais MW683421* — MW681986* —
Chamaecrista myrophenges M.B. Vasconcellos 21730 (UEC) Brazil, Minas Gerais MW683438* — MW682005* —
Chamaecrista stillifera A.O. Souza 2103 (UB) Brazil, Minas Gerais MW683465* MW681914* MW682032* MW682141*
Chamaecrista verruculosa A.O. Souza 2165 (UB) Brazil, Piauí MW683473* MW681921* MW682041* MW682147*
Chamaecrista section Absus
subsection Absus series
Gracilimae [1/1]
Chamaecrista benthamii A.O. Souza 1056 (UFG) Brazil, Goiás MW683382* — MW681945* —
Chamaecrista section Absus
subsection Absus series
Hedysaroides [2/2]
Chamaecrista fulgida A.O. Souza 1283 (UFG) Brazil, Goiás MW683417* — MW681982* —
Chamaecrista hedysaroides A.O. Souza 2127 (UB) Brazil, Minas Gerais MW683423* — MW681988* —
Chamaecrista section Absus
subsection Absus series
Incurvatae [3/5]
Chamaecrista incurvata E.P. Heringer 7536 (NY) Brazil, Minas Gerais MW683426* — MW681991* —
Chamaecrista lavradioides A.O. Souza 590 (UFG) Brazil, Goiás MW683432* — MW681999* —
Chamaecrista planifolia E.M. Teixeira s/n (BHCB) Brazil, Minas Gerais MW683451* — MW682018* —
Chamaecrista section Absus
subsection Absus series
Lomatopodae [1/1]
Chamaecrista lomatopoda H.S. Irwin 25557 (NY) Brazil, Minas Gerais MW683434* — MW682001* —
Chamaecrista section Absus
subsection Absus series
Lucidae [2/5]
Chamaecrista caiapo R.C. Sodré 2374 (UFG) Brazil, Goiás MW683389* MW681851* MW681952* MW682070*
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

10 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista lamprosperma M.M. Cota 671 (NY) Brazil, Minas Gerais MW683430* — MW681997* —
Chamaecrista section Absus
subsection Absus series
Microphyllae [17/20]
Chamaecrista barnebyana M.J. Silva 6059 (UFG) Brazil, Goiás MH835363 — MH828386 —
Chamaecrista belladonna M.J. Silva 5993 (UFG) Brazil, Goiás MH835356 — MH828379 —
Chamaecrista cristalinae A.O. Souza 1459 (UFG) Brazil, Goiás MW683401* MW681866* MW681965* MW682086*
Chamaecrista dalbergiifolia L.P. Queiroz 10318 (HUEFS), Brazil, Goiás FJ009837 — FJ009891 —
Chamaecrista dumalis A.O. Souza 1650 (UFG) Brazil, Rondônia MW683407* MW681873* MW681972* MW682093*
Chamaecrista elachistophylla A.O. Souza 1382 (UFG) Brazil, Distrito Federal MW683410* — MW681975* —
Chamaecrista foederalis R.G. Matos 173 (UFG) Brazil, Distrito Federal MW683415* MW681880* MW681980* MW682101*
Chamaecrista frondosa A.O. Souza 1849 (UFG) Brazil, Goiás MW683416* — MW681981* —
Chamaecrista harmsiana R.G. Matos 430 (UFG) Brazil, Goiás MW683422* — MW681987* —
Chamaecrista huntii var.
correntina
R.G. Matos 75 (UFG) Brazil, Bahia MW683424* — MW681989* —
Chamaecrista imbricans R.G. Matos 63 (UFG) Brazil, Goiás MW683425* MW681885* MW681990* MW682106*
Chamaecrista isidorea M.J. Silva 6059 (UFG) Brazil, Goiás MW683427* — MW681992* —
Chamaecrista neesiana var.
goyazensis
R.G. Matos 117 (UFG) Brazil, Goiás MW683439* — MW682006* —
Chamaecrista neesiana var.
laxiracemosa 1
M.J. Silva 5183 (UFG) Brazil, Goiás MH835386 MW681896* MH828409 MW682120*
Chamaecrista neesiana var.
laxiracemosa 2
A.O. Souza 1393 (UFG) Brazil, Minas Gerais MW683440* — MW682007* —
Chamaecrista neesiana var.
neesiana
R.G. Matos 124 (UFG) Brazil, Minas Gerais MW683441* — MW682008* —
Chamaecrista neesiana var.
subnitida
R.G. Matos 65 (UFG) Brazil, Bahia MW683442* — MW682009* —
Chamaecrista pohliana R.G. Matos 208 (UFG) Brazil, Distrito Federal MW683452* — MW682019* —
Chamaecrista polymorpha R.G. Matos 1 (UFG) Brazil, Goiás MW683453* MW681907* MW682020* MW682131*
Chamaecrista psoraleopsis R.G. Matos 9 (UFG) Brazil, Goiás MW683454* — MW682021* —
Chamaecrista subdecrescens R.G. Matos 135 (UFG) Brazil, Minas Gerais MW683467* — MW682034* —
Chamaecrista section Absus
subsection Absus series
Nigricantes [5/12]
Chamaecrista machaeriifolia A.O. Souza 1177 (UFG) Brazil, Distrito Federal MW683436* — MW682003* —
Chamaecrista philippi A.M. Giulietti 2245 (HUEFS) Brazil, Bahia FJ009838 — FJ009892 —
Chamaecrista speciosa A.S. Conceição 546 (HUESF) Brazil, Bahia FJ009839 — FJ009893 —
Chamaecrista tephrosiifolia A.O. Souza 2104 (UB) Brazil, Minas Gerais MW683470* — MW682037* —
Chamaecrista urophyllidia R.M. Harley 54656 (HUEFS) Brazil, Bahia FJ009840 — FJ009894 —
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 11
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista section Absus
subsection Absus series
Ochnaceae [4/8]
Chamaecrista bifoliola A.O. Souza 928 (UFG) Brazil, Goiás MW683383* — MW681946* —
Chamaecrista cotinifolia var.
cotinifolia
T.P. Mendes 261 (UFG) Brazil, Minas Gerais MK839193 — MK836327 —
Chamaecrista cotinifolia var.
glaberrima
T.P. Mendes 338 (UFG) Brazil, Goiás MK839194 — MK836328 —
Chamaecrista cotinifolia var.
leptodictya
T.P. Mendes 270 (UFG) Brazil, Minas Gerais MK839195 — MK836329 —
Chamaecrista lavradiiflora A.O. Souza 927 (UFG) Brazil, Goiás MW683431* MW681890* MW681998* MW682112*
Chamaecrista ochnacea var.
purpurascens
P.O. Rosa 1322 (HUFU) Brazil, Minas Gerais MW683444* — MW682011* —
Chamaecrista ochnacea var.
speluncae
J.N. Nakajima 751 (HUFU) Brazil, Minas Gerais MW683445* — MW682012* —
Chamaecrista section Absus
subsection Absus series
Oligospermae [1/1]
Chamaecrista oligosperma A.O. Souza 1212 (UFG) Brazil, Goiás MW683447* — MW682014* —
Chamaecrista aff. oligosperma L.P. Queiroz 10265 (HUEFS) Brazil, Bahia FJ009830 — FJ009884 —
Chamaecrista section Absus
subsection Absus series
Paniculatae [13/13]
Chamaecrista celiae T.P. Mendes 284 (UFG) Brazil, Minas Gerais MK839190 — MK836324 —
Chamaecrista cercidifolia T.P. Mendes 279 (UFG) Brazil, Minas Gerais MK839201 MW681853* MK836335 MW682073*
Chamaecrista claussenii A.O. Souza 979 (UFG) Brazil, Goiás MH835367 MW681859* MH828390 MW682079*
Chamaecrista crenulata T.P. Mendes 42 (UFG) Brazil, Goiás MK839196 — MK836330 —
Chamaecrista cyclophylla T.P. Mendes 90 (UFG) Brazil, Goiás MK839191 MW681868* MK836325 MW682088*
Chamaecrista megacycla T.P. Mendes 333 (UFG) Brazil, Goiás MK839192 MW681892* MK836326 MW682115*
Chamaecrista orbiculata T.P. Mendes 193 (UFG) Brazil, Goiás MK839198 MW681901* MK836332 MW682125*
Chamaecrista pachyclada A.O. Souza 557 (UFG) Brazil, Goiás MH835389 — MH828412 —
Chamaecrista rigidifolia T.P. Mendes 155 (UFG) Brazil, Mato Grosso MK839202 — MK836336 —
Chamaecrista tocantinensis T.P. Mendes 312 (UFG) Brazil, Tocantins MK839204 MW681918* MK836338 MW682145*
Chamaecrista trichorthyrsus T.P. Mendes 169 (UFG) Brazil, Goiás MK839199 — MK836333 —
Chamaecrista ustulata T.P. Mendes 290 (UFG) Brazil, Minas Gerais MK839200 — MK836334 —
Chamaecrista veadeirana T.P. Mendes 215 (UFG) Brazil, Goiás MK839203 — MK836337 —
Excluded from series
Paniculatae [1/1]
Chamaecrista lundii T.P. Mendes 168 (UFG) Brazil, Goiás MK839197 — MK836331 —
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

12 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista section Absus
subsection Absus series
Pinifoliae [1/1]
Chamaecrista paniculata A.O. Souza 654 (UFG) Brazil, Goiás MW683448* MW681902* MW682015* MW682126*
Chamaecrista section Absus
subsection Absus series
Rigidulae [32/32]
Chamaecrista altoana M.J. Silva 6465 (UFG) Brazil, Goiás MH806439 — MH828377 —
Chamaecrista azulana A.O. Souza 1116 (UFG) Brazil, Mato Grosso MH835355 MW681838* MH828378 MW682055*
Chamaecrista benthamiana A.O. Souza 1576 (UFG) Brazil, Goiás MH835357 MW681841* MH828380 MW682060*
Chamaecrista botryoides A.O. Souza 2230 (UFG) Brazil, Bahia MW683384* MW681843* MW681947* MW682062*
Chamaecrista brachyrachis A.O. Souza 1179 (UFG) Brazil, Distrito Federal MH835359 — MH828382 —
Chamaecrista chaetostegia H.S. Irwin 29729 (NY) Brazil, Distrito Federal MW683393* — MW681957* —
Chamaecrista cipoana A.O. Souza 1414 (UFG) Brazil, Minas Gerais MH835366 MW681858* MH828389 MW682078*
Chamaecrista dawsonii M.J. Silva 4474 (UFG) Brazil, Goiás MH835369 — MH828392 —
Chamaecrista decumbens A.O. Souza 802 (UFG) Brazil, Goiás MH835370 — MH828393 —
Chamaecrista densifolia A.O. Souza 1159 (UFG) Brazil, Goiás MH835371 — MH828394 —
Chamaecrista elata M.J. Silva 6187 (UFG) Brazil, Goiás MH835372 MW681874* MH828395 MW682095*
Chamaecrista feliciana A.O. Souza 1500 (UFG) Brazil, Goiás MH835374 MW681878* MH828397 MW682099*
Chamaecrista filicifolia A.O. Souza 781 (UFG) Brazil, Goiás MH835375 MW681879* MH828398 MW682100*
Chamaecrista floribunda A.O. Souza 1288 (UFG) Brazil, Goiás MH835376 — MH828399 —
Chamaecrista glaucofilix A.O. Souza 1550 (UFG) Brazil, Bahia MH835377 — MH828400 —
Chamaecrista gymnothyrsa R.C. Sodré 1330 (UFG) Brazil, Goiás MH835378 — MH828401 —
Chamaecrista irwiniana A.O. Souza 605 (UFG) Brazil, Goiás MH835380 MW681886* MH828403 MW682107*
Chamaecrista macedoi M.J. Silva 6073 (UFG) Brazil, Goiás MH835381 — MH828404 —
Chamaecrista mollicaulis M.J. Silva 5693 (UFG) Brazil, Distrito Federal MH835382 MW681893* MH828405 MW682116*
Chamaecrista multipennis A.O. Souza 1411 (UFG) Brazil, Minas Gerais MH835383 MW681894* MH828406 MW682117*
Chamaecrista nanodes A.O. Souza 1763 (UFG) Brazil, Goiás MH835385 MW681895* MH828408 MW682119*
Chamaecrista nummulariifolia A.O. Souza 790 (UFG) Brazil, Goiás MH835387 — MH828410 —
Chamaecrista obolaria A.O. Souza 864 (UFG) Brazil, Goiás MH835388 MW681898* MH828411 MW682122*
Chamaecrista oppositifolia A.O. Souza 1246 (UFG) Brazil, Bahia MK056260 MW681900* MK390621 MW682124*
Chamaecrista pauciflora A.O. Souza 2153 (UB) Brazil, Tocantins MW683449* MW681905* MW682016* MW682129*
Chamaecrista planaltoana A.O. Souza 1355 (UFG) Brazil, Distrito Federal MH835390 — MH828413 —
Chamaecrista polita A.O. Souza 352 (UFG) Brazil, Goiás MH835391 MW681906* MH828414 MW682130*
Chamaecrista rupestrium A.O. Souza 1234 (UFG) Brazil, Bahia MH835392 MW681911* MH828415 MW682135*
Chamaecrista sincorana R.G. Matos 73 (UFG) Brazil, Bahia MH835395 MW681912* MH828418 MW682139*
Chamaecrista sparsifolia A.O. Souza 1050 (UFG) Brazil, Goiás MH835396 — MH828419 —
Chamaecrista strictula A.O. Souza 1324 (UFG) Brazil, Goiás MH835397 MW681915* MH828420 MW682142*
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 13
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista tenuicaulis A.O. Souza 1256 (UFG) Brazil, Goiás MH835398 — MH828421 —
Excluded from series
Rigidulae [2/2]
Chamaecrista brachyblepharis M.J. Silva 4472 (UFG) Brazil, Goiás MH835358 MW681844* MH828381 MW682063*
Chamaecrista ciliolata var.
ciliolata
J.G. Rando 1115 (HUEFS) Brazil, Minas Gerais MH835364 MW681856* MH828387 MW682076*
Chamaecrista ciliolata var.
pulchella
A.O. Souza 1423 (UFG) Brazil, Minas Gerais MH835365 MW681857* MH828388 MW682077*
Chamaecrista section Absus
subsection Absus series
Secundae [1/1]
Chamaecrista secunda A.O. Souza 1449 (UFG) Brazil, Minas Gerais MW683459* — MW682026* —
Chamaecrista section Absus
subsection Absus series
Setosae [7/9]
Chamaecrista auris-zerdae J.A. Oliveira 120 (UFG) Brazil, Minas Gerais MW683377* — MW681940* —
Chamaecrista campicola A.O. Souza 893 (UFG), Brazil, Distrito Federal MH835362 — MH828385 —
Chamaecrista coradinii L.L.C. Antunes 1579 (UFG) Brazil, Tocantins MH835368 — MH828391 —
Chamaecrista obtecta J.A. Oliveira 60 (UFG) Brazil, Goiás MW683443* — MW682010* —
Chamaecrista ochrosperma M.N. Rissi 659 (CEN) Brazil, Goiás MW683446* — MW682013* —
Chamaecrista scabra A.O. Souza 1456 (UFG) Brazil, Goiás MH835393 — MH828416 MW682137*
Chamaecrista setosa var. dentosa A.O. Souza 405 (UFG) Brazil, Goiás MH835394 — MH828417 MW682138*
Chamaecrista setosa var.
paucivenia
J.A. Oliveira 110 (UFG) Brazil, Minas Gerais MW683460* — MW682027* —
Chamaecrista setosa var. setosa J.A. Oliveira 166 (UFG) Brazil, Mato Grosso MW683461* — MW682028* —
Chamaecrista setosa var. subsetosa J.A. Oliveira 50 (UFG) Brazil, Goiás MW683462* — MW682029* —
Chamaecrista section Absus
subsection Absus series
Spinulosae [1/1]
Chamaecrista spinulosa A.O. Souza 2258 (UFG) Brazil, Goiás MW683464* — MW682031* —
Chamaecrista section Absus
subsection Absus series
Strictifoliae [1/1]
Chamaecrista strictifolia E.T. Neto 4080 (BHCB) Brazil, Minas Gerais MW683466* — MW682033* —
Chamaecrista section Absus
subsection Absus series
Trachycarpae [2/3]
Chamaecrista cavalcantina A.O. Souza 862 (UFG) Brazil, Goiás MW683390* — MW681954* —
Chamaecrista venatoria A.O. Souza 1258 (UFG) Brazil, Goiás MW683472* — MW682040* —
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

14 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista section Absus
subsection Absus series
Unijugae [1/4]
Chamaecrista monticola A.O. Souza 2128 (UB) Brazil, Minas Gerais MW683437* — MW682004* —
Chamaecrista section Absus
subsection Absus series
Ursinae [5/11]
Chamaecrista exsudans A.O. Souza 2107 (UB) Brazil, Minas Gerais MW683413* — MW681978* —
Chamaecrista fuscescens A.O. Souza 2117 (UB) Brazil, Minas Gerais MW683391* — MW681955* —
Chamaecrista leucopilis A.O. Souza 1822 (UFG) Brazil, Goiás MW683433* — MW682000* —
Chamaecrista ursina A.O. Souza 2131 (UB) Brazil, Minas Gerais MW683471* — MW682039* —
Chamaecrista xanthadena G.G. Hatschbach 41481 (NY) Brazil, Minas Gerais MW683392* — MW681956* —
Chamaecrista section Absus
subsection Adenophyllum
[1/1]
Chamaecrista bucherae Marie-Victorium 21759 (MT) Cuba MW683387* MW681849* MW681950* MW682068*
Chamaecrista section Absus
subsection Baseophyllum
[8/8]
Chamaecrista blanchetii M.J.G. Andrade 607 (HUEFS) Brazil, Bahia FJ009846 MW681842* FJ009890 MW682061*
Chamaecrista brachystachya A.S. Conceição 713 (HUEFS) Brazil, Minas Gerais FJ009847 MW681845* FJ009901 MW682064*
Chamaecrista confertiformis C.B.N. Costa 132 (HUEFS) Brazil, Bahia FJ009848 MW681865* FJ009902 MW682085*
Chamaecrista coriacea A.S. Conceição 869 (HUEFS) Brazil, Minas Gerais FJ009843 — FJ009897 —
Chamaecrista cytisoides A.S. Conceição 870 (HUEFS) Brazil, Minas Gerais FJ009844 — FJ009898 —
Chamaecrista decora A.S. Conceição 810 (HUEFS) Brazil, Minas Gerais FJ009849 — FJ009903 —
Chamaecrista depauperata A.S. Conceição 863 (HUEFS) Brazil, Bahia FJ009850 — FJ009904 —
Chamaecrista unijuga A.S. Conceição 694 (HUEFS) Brazil, Bahia FJ009845 MW681920* FJ009899 MW682146*
Chamaecrista section Absus
subsection Otophyllum [1/1]
Chamaecrista debilis A.O. Souza 1869 (UB) Brazil, Minas Gerais — MW681869* MW681967* MW682089*
3. Chamaecrista section
Apoucouita [7/22]
Chamaecrista section
Apoucouita series
Apoucouita [5/20]
Chamaecrista amorimii A.S. Conceição 795 (HUEFS) Brazil, Bahia FJ009823 KP967071 FJ009878 KP966952
Chamaecrista apoucouita L.A.G. Souza 66/09 (INPA) Brazil, Amazonas MW683375* MW681835* MW681937* MW682052*
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 15
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista eitenorum 1 D. Cardoso 3484 Brazil, Rio Grande do
Norte
KR134121 KP999905 — —
Chamaecrista eitenorum 2 D. Cardoso 3483 Brazil, Rio Grande do
Norte
KR134120 KP999904 — —
Chamaecrista ensiformis C.A. Sousa IFN-4802171.5 (UB) Brazil, Maranhão MW683411* MW681875* MW681976* MW682096*
Chamaecrista onusta A.S. Conceição 800 (HUEFS) Brazil, Bahia FJ009824 — FJ009879 —
Chamaecrista section
Apoucouita series
Pteridophyllae [2/2]
Chamaecrista adiantifolia L.A.G. Souza 62 (INPA) Brazil, Amazonas — MW681833* MW681934* MW682049*
Chamaecrista aspleniifolia R.R. Vervloet 1660 (UFG) Brazil, Espírito Santo — MW681837* MW681939* MW682054*
4. Chamaecrista section
Caliciopsis [2/2]
Chamaecrista calycioides 1 L.P. Queiroz 11 (HUEFS) Brazil, Rio Grande do
Norte
FJ009863 — FJ009917 —
Chamaecrista calycioides 2 EAC 26229 Brazil, Ceará GU175311 — MW681953* GU175322
Chamaecrista duckeana A. Fernandes s/n (NY) Brazil, Ceará MW683406* MW681872* MW681971* MW682092*
5. Chamaecrista section
Grimaldia [1/1]
Chamaecrista absus var. absus 1 A.S. Conceição 1056 (HUEFS) Brazil, Rio Grande do
Norte
FJ009832 — FJ009886 —
Chamaecrista absus var. absus 2 V. Sundaresan s/n India KT279729 — — —
Chamaecrista absus var. absus 3 — — KC817015 — — —
6. Chamaecrista section
Xerocalyx [4/4]
Chamaecrista cultrifolia N.F.O. Mota 2161 (HUEFS) Brazil, Mato Grosso KR134033 KP999796 — —
Chamaecrista desvauxii var.
brevipes
A.R. Barbosa 794 (HUEFS) Brazil, Bahia KR134094 KP999848 — —
Chamaecrista desvauxii var.
desvauxii
L.P. Queiroz 10453 (HUEFS) Brazil, Bahia FJ009864 — FJ009918 —
Chamaecrista desvauxii var.
glauca
A.O. Souza 2147 (UB) Brazil, Tocantins MW683404* MW681870* MW681969* MW682090*
Chamaecrista desvauxii var.
graminea
A.R. Barbosa 782 (HUEFS) Brazil, Bahia KR134102 KP999854 — —
Chamaecrista desvauxii var.
langsdorffii
A.S. Conceição 674 (HUEFS) Brazil, Bahia FJ009866 KP999886 FJ009920 —
Chamaecrista desvauxii var.
latifolia
A.R. Barbosa 1068 (HUEFS) Brazil, Minas Gerais KR134092 KP999846 — —
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

16 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Taxon Voucher Locality ITS ETS trnL-F trnE-T
Chamaecrista desvauxii var.
latistipula
A.S. Conceição 912 (HUEFS) Brazil, Espírito Santo FJ009867 KP967061 FJ009921 KP967008
Chamaecrista desvauxii var.
mollissima
A.K.A. Santos 356 (HUEFS) Brazil, Bahia FJ009865 — FJ009919 GU175325
Chamaecrista desvauxii var.
piptostegia
A.R. Barbosa 867 (HUEFS) Brazil, Minas Gerais KR134101 KP999853 — —
Chamaecrista desvauxii var.
pirebebuiensis
A.R. Barbosa 957 (HUEFS) Brazil, Goiás KR134110 KP999860 — —
Chamaecrista diphylla L.P. Queiroz 10269 (HUEFS) Brazil, Bahia FJ009868 KP999896 FJ009922 GU175326
Chamaecrista ramosa var.
curvifolia
A.R. Barbosa 1075 (HUEFS) Brazil, Maranhão KR134046 KR133795 — —
Chamaecrista ramosa var.
erythrocalyx
A.R. Barbosa 882 (HUEFS) Brazil, Minas Gerais KR134113 KP999863 — —
Chamaecrista ramosa var. lucida EAC 28606 Brazil, Goiás GU175316 — — GU175330
Chamaecrista ramosa var.
mollissima
EAC 24258 Brazil, Piauí GU175317 — — GU175329
Chamaecrista ramosa var.
parvifoliola
A.R. Barbosa 812 (HUEFS) Brazil, Minas Gerais KR134099 KP999851 — —
Chamaecrista ramosa var. ramosa A.R. Barbosa 815 (HUEFS) Brazil, Minas Gerais KR134105 KP999855 — —
Extra-American species
without classification [6/62]
Chamaecrista grantii Hohbein B10-K1267 Kenya, Rift Valley KR734123 — KR738334 —
Chamaecrista kirkii Carvalho 2403 (NY) Equatorial Guinea MW683429* — MW681994* MW682109*
Chamaecrista kleinii RRCBI-MUS132A (MUS) India KJ605907 — — —
Chamaecrista mimosoides LUH:5201 Nigeria KX057847 — KX268162 —
Chamaecrista nigricans LUH:5131 Nigeria KX057848 — KX268163 —
Chamaecrista pumila LSC125 India MH768080 — KU551117 —
Table 1. Continued
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 17
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
(Darriba et al., 2012) using the Akaike information
criterion test; each fittest model is available in Table
4. The BI analysis consisted of two simultaneous
independent runs of four Markov chain Monte Carlo
with 107 generations, sampling trees and parameters
each thousand generations. After excluding 25%
as burn-in the remaining samples were used to
calculate the tree of maximum clade credibility
using TreeAnnotator in the BEAST package v.1.8.0
(Drummond et al., 2012), with clade support indicated
as posterior probabilities (PP). All analyses were
performed on the platform CIPRES Science Gateway
Table 4. Statistical information of each matrix and sample set analysed
ITS ETS trnL-F trnE-T Four markers
combined
Broad Multilocus Multilocus Broad Multilocus Multilocus Broad Multilocus
Number of
accessions
275 185 150 267 174 153 286 193
Alignment length
(bp)
1296 1258 742 1112 1186 937 2519 4123
Variable sites 1041 981 562 341 328 223 1493 2123
Potentially
informative sites
823 749 453 187 195 138 1074 1535
Average number of
indels (bp)
140 132 134 105 94 71 — —
Evolution model TIM1+G TIM1+G TIM3+G GTR+G GTR+G TVM+G Partitioned Partitioned
Table 2. Sequences and references of primers used in this study
Region Primer Primer sequence (5′‒3′)Reference
ITS 17SE ACGAATTCATGGTCCGGTGAAGTGTTCG Sun et al., 1994
26SE TAGAATTCCCCGGTTCGCTCGCCGTTAC
ITS1 GCTACGTTCTTCATCGAT White et al., 1990
ITS4 TCCTCCGCTTATTGATATGC
ETS 18IGS GCCTGCTGCCTTCCTTGGATGTGG Baldwin & Markos, 1998
26IGS GGGAACGTGAGCTGGGTTTAGACCGTC
trnL-F d GGGGATAGAGGGACTTGAAC Taberlet et al., 1991
c CGAAATCGGTAGACGCTACG
f ATTTGAACTGGTGACACGAG
e GGTTCAAGTCCCTCTATCCC
trnE-T trnE-T forward ATCGGATTTGAACCGATGAC Kato et al., 2000
trnE-T reverse CCCAGGGGAAGTCGAATC
Table 3. PCR cycles used for each region studied
Steps ITS ETS trnL-F trnE-T
Initial denaturation 94 °C for 4 min 94 °C for 4 min 94 °C for 2 min 94 °C for 3 min
Denaturation 94 °C for 1 min 94 °C for 1 min 94 °C for 1 min 94 °C for 1 min
Annealing 61.5 °C for 1 min 55 °C for 1 min 61.5 °C for 45 s 61 °C for 45 s
Extension 72 °C for 1 min 72 °C for 2 min 72 °C for 1.2 min 72 °C for 1.3 min
Final extension 72 °C for 4 min 72 °C for 4 min 72 °C for 4 min 72 °C for 9 min
Number of cycles 33 35 32 35
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

18 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
3.3 (Miller, Pfeiffer & Schwartz, 2010, https://www.
phylo.org/), and the resulting trees were viewed and
edited in the program FigTree v.1.4.3 (Rambaut, 2016).
ancesTral characTer reconsTrucTion
To ascertain potential morphological synapomorphies,
another majority-rule consensus tree from the
BI analysis of the combined molecular data set
with 80 selected taxa was elaborated and used to
trace the evolution of 20 morphological characters
previously used in the diagnoses and differentiation of
infrageneric taxa of Chamaecrista by Irwin & Barneby
(1982). The characters were evaluated in Mesquite
v.3.51 (Maddison & Maddison, 2018) using the ‘trace
character history’ option in the ‘stochastic character
mapping’ method using the ‘current probability models’
(Maddison & Maddison, 2006). All morphological
characters were considered unordered and unweighted.
The 80 selected taxa were chosen to represent all the
morphological diversity of the main clades, and the
lack of some species is not predicted to alter the results
since the missing species have similar characteristics
analysed to the selected taxa from respective clades
(Irwin & Barneby, 1982). Characters were coded
from information in the relevant literature (Irwin &
Barneby, 1977, 1978, 1982) or by direct examination
of specimens from the herbaria ALCB, BHCB, CEN,
CEPEC, CGMS, EAC, ESA, F, G, HRB, HTO, HUEFS,
HUTO, IAN, IBGE, INPA, K, M, MBM, MO, NY, P, R,
RBSP, SPF, UB, UEC, UFG, UFMT, US, VIES and W
(acronyms according to Thiers, 2020). Morphological
terminologies follow Radford et al. (1974) and Irwin &
Barneby (1978, 1982). The list of selected characters
and coding is presented in Supporting Information,
Appendix S1, and the data matrix with the character
states for each species is presented in Supporting
Information, Appendix S2.
Taxonomic TreaTmenT
Taxonomic decisions were based on the phylogenetic
relationships obtained and morphological evidence.
The proposed combinations and new taxonomic
categories follow the standards and recommendations
of the International Code of Nomenclature for Algae,
Fungi and Plants (Turland et al., 2018). Descriptions
of the infrageneric taxa (sections and subsections)
recognized in Chamaecrista consider the distinguishing
morphological characters of the species which comprise
the supraspecific taxa. To confirm the accepted species
names in Chamaecrista, we consulted in the literature
around the world (e.g. Irwin & Barneby, 1977, 1978,
1982; Lock, 1988; Randell, 1988; Souza, Lewis & Silva,
2019b; Cota, Rando & Mello-Silva, 2020; Souza &
Silva, 2020) to create a list of updated binomials of
Chamaecrista. The types of vegetation cited follow
Ribeiro & Walter (2008) and IBGE (2012) for Brazilian
vegetation.
RESULTS
DaTa maTrices anD phylogeneTic analyses
We produced 434 new sequences (108 ITS, 102 ETS, 115
trnL-F and 109 trnE-T) for 167 accessions corresponding
to 140 species (137 Chamaecrista spp. and three Senna
spp.). We sampled all six sections, all four subsections
and 34 out of the 39 series of Chamaecrista, making
it the largest molecular sampling of the genus so far
and covering the pantropical distribution of the genus
with 204 out of the 280 American species and six out
of the 62 extra-American species. We were unable
to sample the monospecific series Andromedeae
(H.S.Irwin & Barneby) H.S.Irwin & Barneby,
Atroglandulosae (H.S.Irwin & Barneby) H.S.Irwin
& Barneby, Hassleranae (H.S.Irwin & Barneby)
H.S.Irwin & Barneby and Incanae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby from Chamaecrista
section Absus subsection Absus and series Greggianae
H.S.Irwin & Barneby from Chamaecrista section
Chamaecrista due to the difficulty of extracting and
sequencing DNA from herbarium specimens.
The ILD test showed negative incongruity (ρ = 0.9)
between the four markers used. Therefore, as the
trees were congruent the markers could be combined.
Complete information on the composition of each
matrix in each sampling approach is given in Table 4.
Results from the BI and ML analyses, either
individually or combined in the Broad and Multilocus
approaches strongly supported Chamaecrista as
a monophyletic genus (PP = 1.0 and BT = 100%)
(Figs 1–6, Supporting Information, Appendices S3–
S10). All the analyses recovered the same main
clades in Chamaecrista, and therefore we chose to
present and discuss the BI trees from the combined
analyses considering the indels in both the Broad and
Multilocus approaches (ITS + trnL-F + indels from
the Broad approach and four markers + indels from
the Multilocus approach) because they provided more
resolution at infrageneric level. The bootstrap values
obtained from the ML analyses were plotted on the BI
trees. The trees resulting from the ML analyses are
presented for comparison (Supporting Information,
Appendices S3–S10). The nuclear markers (ETS and
ITS) had the largest number of indels and potentially
informative sites (Table 4) and recovered the four main
clades in Chamaecrista (Supporting Information,
Appendix S3), whereas the plastid markers (trnL-F
and trnE-T) recovered the same clades, although with
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 19
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
lower internal resolution (Supporting Information,
Appendices S2, S6). Individual trees from the trnE-T
and ETS analyses were the only ones to recover
subclades D1, D2 and D3 of clade D (Supporting
Information, Appendices S5, S6). The trees resulted
from only the coded indels of the nuclear and plastid
markers showed a good level of resolution, especially
in the Multilocus analysis (Supporting Information,
Appendices S7–S10).
BroaD analysis
The Broad analysis strategy comprised the larger
number of taxa and provided an overview at section
level in Chamaecrista and support for the relationships
among the sampled genera, but relationships within
and between series and species are poorly supported
(Fig. 1). For this reason, we used the results of the
Broad analysis to discuss only the sectional level.
In analyses of individual and combined data sets
(ITS + trnL-F + indels) Vouacapoua americana
Aubl. emerged as sister to Chamaecrista with
maximum support (1.0 PP and 100% BT) (Fig. 1), and
Chamaecrista+V. americana) emerged in a polytomy
with Cassia, Melanoxylon and Recordoxylon, the last
two as sister genera, and Vouacapoua macropetala
Sandwith (Fig. 1).
In Chamaecrista, sections Apoucouita, Grimaldia
and Xerocalyx were recovered as monophyletic,
whereas section Caliciopsis H.S.Irwin & Barneby is
paraphyletic and sections Chamaecrista and Absus
are polyphyletic (Fig. 1). Section Apoucouita in all
analyses had maximum support (1.0 PP and 100% BT)
and is always placed as the earliest-diverging lineage
(Fig. 1, clade A), whereas taxa of sections Chamaecrista
and Caliciopsis emerged mixed in a clade (Fig. 1 clade
C, 1.0 PP, 100% BT) with the monophyletic section
Xerocalyx and Extra-American species. Chamaecrista
section Absus appears in two distinct and well-
supported clades; the first (Fig. 1 clade B, 1.0 PP, 100%
BT) includes all taxa of subsections Adenophyllum,
Baseophyllum (Collad.) H.S.Irwin & Barneby and
Otophyllum and emerged as the sister of clade C; and
the second (Fig. 1 clade D, 1.0 PP, 100% BT) includes
all species of subsection Absus and the monophyletic
section Grimaldia (Schrank) H.S.Irwin & Barneby.
Clade D had the longest branch and maximum support
in all analyses, although it is the clade with the lowest
internal resolution in the Broad approach analyses
(Fig. 1).
mulTilocus analysis
The Multilocus analysis included fewer taxa than the
Broad analysis but achieved better internal resolution
in Chamaecrista (Fig. 2). As for the Broad approach
analysis, the Multilocus analysis recovered four main
well-supported clades, A, B, C and D (Fig. 2) with the
individual and combined datasets, although more
resolution was observed in clades C and D. Based on
this, the Multilocus results are used to discuss the
taxonomic relationships at section, subsection and
series levels, and they are used later as the basis
for a proposed new infrageneric classification of
Chamaecrista.
Chamaecrista section Apoucouita emerged as
monophyletic (1.0 PP and 100% BT) (Figs 2, 3, clade
A), although series Apoucouita and Pteridophyllae
(H.S.Irwin & Barneby) H.S.Irwin & Barneby in this
section appeared in a polytomy of three subclades,
one of which (Fig. 3, subclade A2) corresponds to the
monophyletic series Pteridophyllae (0.99 PP, 100% BT)
and the others (Fig. 3, subclades A1 and A3) include
taxa of series Apoucouita.
Chamaecrista section Xerocalyx is supported
as monophyletic, with an increase in its internal
resolution (Figs 2 and 4 subclade C6) and is nested in
a clade that includes taxa from sections Chamaecrista
and Caliciopsis (Fig. 2 clade C). Section Chamaecrista
maintains the same phylogenetic structure as revealed
by the Broad approach analysis, although with
better resolution (Fig. 2). Of the six series belonging
to Chamaecrista section Chamaecrista, only series
Bauhinianae (Collad.) H.S.Irwin & Barneby (sensu
Irwin & Barneby, 1982) and Coriaceae (sensu Rando
et al., 2019) are recovered as monophyletic; the others
are para- or polyphyletic (Fig. 4).
Chamaecrista section Absus is polyphyletic and
divided into two main isolated clades (Fig. 2, clades
B and D) as also revealed in the Broad strategy
analysis. Clade B includes species from subsections
Baseophyllum, Adenophyllum and Otophyllum and
recovered C. bucherae (Moldenke) H.S.Irwin & Barneby
(subsection Adenophyllum) as sister to C. debilis (Vogel)
H.S.Irwin & Barneby (subsection Otophyllum), the two
together in a clade sister to the monophyletic subsection
Baseophyllum (1.0 PP and 98% BT; Fig 3). Clade D groups
species of subsection Absus and section Grimaldia with
better resolution than the Broad analysis, and recovers
three well-supported subclades (subclade D1: 0.96 PP and
89% BT; subclade D2: 0.98 PP and 85% BT; subclade D3:
0.99 PP and 90% BT; Figs 2, 5). Subclade D1 comprises
some species belonging to series Absoideae (Benth.)
H.S.Irwin & Barneby, Confertae (H.S.Irwin & Barneby)
H.S.Irwin & Barneby and Oligospermae (H.S.Irwin
& Barneby) H.S.Irwin & Barneby of C. section Absus
subsection Absus with C. absus (L.) H.S.Irwin & Barneby
from Chamaecrista section Grimaldia (sensu Irwin &
Barneby, 1982). Subclade D2 comprises only species
from series Absoideae, and subclade D3 groups species
from the remaining 33 series of Chamaecrista section
Absus subsection Absus, although this subclade has poor
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

20 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 1. Majority consensus tree of the Bayesian analysis resulting from Broad sampling (ITS + trnL-F + indels). 1,
Cladogram with the sections recognized in the classification of Irwin & Barneby (1982). 2, Representative scheme showing
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 21
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
internal resolution (Fig. 5). The analysis demonstrated
that most of the traditionally recognized series sampled
of subsection Absus are polyphyletic (e.g. Absoideae,
Microphyllae and Ochnaceae), and require further
analysis before species can be accurately assigned to
named subclades (Fig. 5).
ancesTral characTer reconsTrucTion
Our analysis of the evolution of morphological
characters demonstrated that ten of the 20 studied
characters are homoplastic. Nevertheless, the
isomorphic androecium (character 14), pubescence
of the anther suture (character 15), fruits elastically
dehiscent (character 18) and pedicels bi-bracteolate
(character 20) emerged as potential synapormorphies
for Chamaecrista. The character states: cauliflorous
inflorescence (character 10) and nectaries on the
inflorescence axis (character 7) emerged as potential
synapomorphies for clade A. Alternate-distichous
leaves (character 8), leaflets with palmate venation
(character 9) and flowers solitary or grouped in
fascicles (character 10) are synapomorphic characters
for clade C, and the presence of glandular trichomes
(character 5) and loss of nectaries (character 6) are
synapomorphies for clade D. Appendices S11–S20 in the
Supporting Information present the reconstructions of
the individual characters studied.
a new infrageneric classificaTion of
ChamaeCrista
A new classification of Chamaecrista is proposed
supported by a molecular phylogenetic analysis and the
results of a morphological character evolution study. The
genus is divided into four sections: (1) section Apoucouita
maintains the same composition as that established by
Irwin & Barneby (1982), although we do not recognize
any series within it; (2) section Baseophyllum raises the
rank of subsection Baseophyllum of Irwin & Barneby and
now includes in synonymy subsections Adenophyllum
and Otophyllum; (3) section Chamaecrista now
includes the former sections Caliciopsis and Xerocalyx
and (4) section Absus now includes the former section
Grimaldia. Section Absus is divided into three
subsections: (1) subsection Absus; (2) subsection Viscosa
and (3) subsection Zygophyllum.
A taxonomic treatment is presented based on the
new infrageneric classification. A bibliographic survey
resulted in a list of 363 Chamaecrista spp. in the
world, of which 64 are exclusively extra-American and
have never been formally placed in any infrageneric
category. These extra-American species are allocated
here to section Chamaecrista based on our molecular
phylogenetic analysis and morphological evidence.
A complete list of all currently accepted binomials is
available in Supporting Information, Appendix S21.
DISCUSSION
Our results confirm the monophyly of Chamaecrista
based on a comprehensive sampling of its species (210
species) and infrageneric categories (six sections, four
subsections and 34 series). All previous phylogenetic
studies that included Chamaecrista also supported
its monophyly, although all included fewer species
(≤ 85 species, e.g. Conceição et al., 2009; Torres et al.,
2011; Rando et al., 2016; Souza et al., 2019a; Mendes
et al., 2020). Our work made use of several strategies
such as coding indels, which presented a good level of
resolution, demonstrating their information potential,
although they are largely ignored in phylogenetic
analyses and removed from the alignment of
sequences being considered as missing data (Sanyal
et al., 2015). In addition, the strategy of multiple
nuclear and plastid markers has been widely used
in phylogenetic studies at lower levels to provide an
increase in resolution in order to reach consistent
classifications (Trovó et al., 2013; Ribeiro et al., 2014;
Inglis & Cavalcanti, 2018; Cândido et al., 2020). The
use of all these strategies has allowed us to have
a good understanding of general relationships in
Chamaecrista as discussed next.
relaTionships wiThin ChamaeCrista
The results from all our analyses revealed the non-
monophyly of the traditionally recognized major
taxonomic ranks of Chamaecrista, suggesting that
the current infrageneric classification of Irwin
& Barneby (1982) should be redefined. The same
conclusion was reached by Conceição et al. (2009),
Torres et al. (2011), Rando et al. (2016), Souza et al.
(2019a) and Mendes et al. (2020), whose studies
revealed the incongruence between the traditional
hierarchical classification and the phylogenetic
relationships in Chamaecrista.
the outgroup and the four main clades recovered in Chamaecrista. 3, Phylogram of the tree shown in 1, with branch lengths
proportional to the number of substitutions. Clades marked with letters are discussed in the text. Red asterisks indicate
type species for each section. Taxa with three names are varieties and those with four names are subspecies and varieties.
Support of the branches is represented by the thickness of the line, PP = posterior probability and BT = bootstrap value.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

22 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 2. Majority consensus tree of the Bayesian analysis resulting from a Multilocus sampling (ITS + ETS + trnL-F + trnE-T
+ Indels). 1, Cladogram with the sections of Chamaecrista recognized by Irwin & Barneby (1982). 2, Phylogram of the tree shown
in 1 with branch lengths proportional to the number of substitutions. Clades marked with letters are discussed in the text. Red
asterisks indicate type species for each section. Taxa with three names are varieties and those with four names are subspecies and
varieties. Support for the branches is represented by the thickness of the line, PP = posterior probability and BT = bootstrap value.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 23
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Despite the contributions of previous studies, no
major changes to the classification of Chamaecrista
were made, mainly because < 33% of the diversity of
the genus was sampled in these studies. Compared
to the studies of Conceição et al. (2009), Rando et al.
(2016) and Souza et al. (2019a) who sampled 45, 55
Figure 3. Part of the tree resulting from the Bayesian analysis of a Multilocus sampling showing clades A and B and
outgroup. Clades and species marked in colours correspond to the taxa recognized in the classification of Irwin & Barneby
(1982). Clades marked with letters are discussed in the text. Red asterisks indicate type species for a section. Numbers in
the squares indicate the synapomorphies with the annotation characterstate and some of these are illustrated on the right.
Support of the branches is represented by the thickness of the line, PP = posterior probability and BT = bootstrap value.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

24 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 4. Part of the tree resulting from the Bayesian analysis of a Multilocus sampling showing clade C. Clades and
species marked in colours correspond to the taxa recognized in the classification of Irwin & Barneby (1982). Clades marked
with letters are discussed in the text. Red asterisks indicate type species for a section. Taxa with three names are varieties
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 25
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
and 85 Chamaecrista spp., respectively, our study
comprises 210 species, which together covers 90% of
the categories recognized by Irwin & Barneby (1982)
and the pantropical distribution. Our overview of the
infrageneric relations in Chamaecrista recovered four
main clades (A, B, C and D), which we discuss next.
Clade A: the tree group with cauliflorous
inflorescences
Clade A comprises exclusively species from
Chamaecrista section Apoucouita, which is a
phylogenetically and morphologically well-supported
group (Figs 1–3). In our analyses section Apoucouita
was represented by seven out of its 22 species and
emerged as monophyletic and sister to all other
species of the genus; a similar relationship was
observed by Conceição et al. (2009) and Souza et al.
(2019a) in which the section was represented by only
two species. The species of Chamaecrista section
Apoucouita are easily recognized and distinguished
by a unique combination of characters that include
the arboreal or shrubby habit, leaves with extrafloral
nectaries on the petiole, rachis and/or inflorescence,
cauliflorous racemes, anthers pubescent across almost
their whole surface, and legumes pendulous and
relatively large (7–15 cm long). Furthermore, morpho-
anatomical evidence suggests that section Apoucouita
is the only group of Chamaecrista with hypostomatic
leaflets (Coutinho et al., 2016). Unlike most species of
the genus, species of section Apoucouita occur in rain
forests (the Atlantic Forest of north-eastern and south-
eastern Brazil and in Amazonia region of Brazil and
surrounding countries).
Irwin & Barneby (1982) divided the section into two
series: series Pteridophyllae and series Apoucouita.
Series Pteridophyllae comprised two species with
multifoliolate leaves (ten to 20 leaflet pairs per leaf)
and series Apoucouita contained 19 species with
paucifoliolate leaves (with up to five leaflet pairs
per leaf). In our analysis, the series Pteridophyllae is
monophyletic, whereas series Apoucouita (represented
by five species) is paraphyletic, with the species
clustered in two distinct lineages (Fig. 3).
Clade B: the Baseophyllum group
Clade B includes all species of the subsections
Adenophyllum (one species), Otophyllum (one species)
and Baseophyllum (eight species) from section Absus
sensu Irwin & Barneby (1982) (Fig. 2, 3). The clade
is sister to a clade that groups species of sections
Chamaecrista, Caliciopsis and Xerocalyx (Fig. 2, 4;
Clade C). In our Multilocus analysis, we recovered two
subclades (B1 and B2), one with species of subsections
Adenophyllum and Otophyllum (B1, Fig. 3) sister to
another subclade that comprises the monophyletic
subsection Baseophyllum (B2, Fig. 3).
Conceição et al. (2009) observed a similar position for
subsection Baseophyllum, demonstrated its monophyly
and its relationship with sections Chamaecrista,
Caliciopsis and Xerocalyx, and subsection Absus
and section Grimaldia were also shown to be closely
related. Our results strongly suggest two distinct
origins of the subsections of section Absus pointing to
its non-monophyly. In addition to corroborating these
relationships, our study reveals, for the first time,
the relationship of subsection Baseophyllum with
subsections Adenophyllum and Otophyllum.
The close relationship of subsections Baseophyllum,
Otophyllum and Adenophyllum with members of
sections Chamaecrista, Caliciopsis and Xerocalyx is
witnessed by the common presence of nectaries on
the leaves of all these taxa, whereas the absence of
nectaries and presence of glandular trichomes are
typical of the related subsection Absus and section
Grimaldia.
Species of clade B occur mainly in campo rupestre
(‘rocky fields’) vegetation in north-eastern and south-
eastern Brazil, with the exception of the peculiar, little-
known and infrequently collected C. bucherae which
is endemic to Cuba. In addition to the leaf nectaries,
the species of clade B share glabrous branches,
inflorescences, flowers and fruits; leaves with one to
three pairs of leathery leaflets (except for C. debilis with
eight to 15 pairs of membranous leaflets), flowers with
an internal petal partially enveloping the stamens,
and a pod with a thickened margin, a combination
of characteristics not found in any other group of the
genus. Furthermore, in the Baseophyllum group the
leaves are epistomatic, whereas in section Apoucouita
they are hypostomatic, and in most other species,
apart from these groups, the leaves are commonly
amphistomatic (Coutinho, Francino & Meira, 2013;
Coutinho et al., 2016).
Clade C: herbaceous/shrubby group with solitary
flowers or fascicles
Clade C includes 45 species of sections Chamaecrista
(39 species), Caliciopsis (two species) and Xerocalyx
(four species) (Fig. 4), corresponding to 67, 100
and those with four names are subspecies and varieties. Numbers in the squares indicate the synapomorphies with the
annotation characterstate and some of these are illustrated on the right. Support of the branches is represented by the
thickness of the line, PP = posterior probability and BT = bootstrap value.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

26 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 5. Part of the tree resulting from the Bayesian analysis of a Multilocus sampling showing clade D. Names in blue text on
the right of the species correspond to the series of Chamaecrista section Absus subsection Absus, sensu Irwin & Barneby (1982)
together with updates by Souza et al. (2019) and Mendes et al. (2020). Clades marked with letters are discussed in the text.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 27
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
and 100% of their diversity, respectively (Table 1).
Conceição et al. (2009) and Torres et al. (2011) found
clades with a similar sectional composition based on a
total sampling of 15 and 18 species, respectively. Our
study agrees with previous results in highlighting the
non-monophyly of these sections and suggesting that
they should be included in a single section.
Section Caliciopsis sensu Irwin & Barneby (1982)
comprises two species [C. calycioides (Collad.) Greene
and C. duckeana (P.Bezerra & Afr. Fern.) H.S.Irwin
& Barneby], and our results reveal this section to be
paraphyletic. In our analyses, C. calycioides emerged
as related to C. roraimae (Benth.) Gleason from section
Chamaecrista (Fig. 4, clade C5), whereas C. duckeana
is in a separate clade with other species of section
Chamaecrista (Fig. 4, clade C10). In previous studies
(Conceição et al., 2009; Torres et al., 2011), only
C. calycioides was sampled from section Caliciopsis
and it was found to be related to members of section
Chamaecrista. According to Irwin & Barneby (1982),
the members of section Caliciopsis have vegetative
and floral morphologies similar to members of section
Chamaecrista, but the section was considered to be
distinct due to the peculiar calyx with prominent
parallel venation that resembles more the members of
section Xerocalyx.
Chamaecrista section Xerocalyx comprising four
species and 24 infraspecific taxa (sensu Irwin & Barneby
1982; Barbosa et al., 2016) is always resolved as a
well-supported monophyletic group in all phylogenetic
analyses of Chamaecrista (Conceição et al., 2009;
Torres et al., 2011; Barbosa et al., 2016). However,
the specific and intraspecific internal relationships in
section Xerocalyx remain unclear (Fig. 4). For example,
C. desvauxii (Collad.) Killip and C. ramosa (Vogel)
H.S.Irwin & Barneby are not monophyletic (Fig. 4,
clade C6), and both are considered by some authors
to be unresolved complexes (Torres et al., 2011;
Barbosa et al., 2016). Members of section Xerocalyx
superficially resemble the paucifoliolate species of
section Chamaecrista [e.g. C. rotundifolia (Pers.)
Greene], but are distinguished by their resupinate
flowers, multi-striate calyces with prominent parallel
veins, two sepals shorter than others and claviform
seeds (Irwin & Barneby, 1982).
Section Chamaecrista was divided into six series by
Irwin & Barneby (1982): Bauhinianae, Chamaecrista,
Coriaceae, Greggianae, Flexuosae H.S.Irwin &
Barneby and Prostratae (Benth.) H.S.Irwin &
Barneby, differentiated mainly by characters of their
branches, leaves and flower morphology. Based on
our results, the section is polyphyletic and only the
series Bauhinianae (sensu Irwin & Barneby 1982)
and the recently re-circumscribed Coriaceae (sensu
Rando et al., 2019) are monophyletic, whereas the
others are para- or polyphyletic (Fig. 4). Even so, some
morphologically supported clades can be observed, e.g.
subclade C1 (Fig. 4), which includes sub-shrubby and
shrubby species with a woody underground system and
typically rigid, chartaceous or coriaceous leaflets. This
subclade includes members of the series Flexuosae
and Coriaceae, the former is paraphyletic because
one of its species [C. swainsonii (Benth.) H.S.Irwin
& Barneby] is sister to series Coriaceae, whereas the
remaining species form a well-supported clade (Fig.
4, subclade C2) characterized mainly by flexuous
branches. Chamaecrista swainsonii was variously
placed in previous studies, sometimes related to
members of series Coriaceae (Conceição et al., 2009)
and sometimes to members of series Flexuosae (Rando
et al., 2016; Silva, Souza & Alonso, 2019). In those
studies, Flexuosae was represented by a maximum of
four species, whereas we have sampled five out of the
six species considered to belong to the series.
Series Coriaceae was recently redefined (Rando et al.,
2016, 2019) as a monophyletic group by the exclusion
of C. caribaea (Northr.) Britton, C. roraimae and
C. venulosa (Benth.) H.S.Irwin & Barneby, which had
been included in the series by Irwin & Barneby (1982).
These three species emerged more related to series
Prostratae and section Caliciopsis in the phylogenetic
analysis of Rando et al. (2016) and in our study (Fig.
4). Our subclade C3 (Fig. 4) recovered the same species
composition for ‘Coriaceae’ as presented by Rando
et al. (2016); however, the subclades ‘Bifoliolate’ and
‘Multifoliolate’ proposed by Rando et al. (2016) in
Coriaceae were not recovered in our analysis (Fig. 4).
Subclade C4 includes three series of section
Chamaecrista (series Prostratae, Bauhinianae and
Chamaecrista sensu Irwin & Barneby); two species
excluded from series Coriaceae (sensu Rando et al.,
2016) and 18 taxa of section Xerocalyx and one of
Caliciopsis (Fig. 4). Series Prostratae is polyphyletic
with C. kunthiana (Schltdl. & Cham.) H.S.Irwin &
Barneby and C. supplex (Benth.) Britton & Killip in
an early-diverging position in the subclade, whereas
C. tenuisepala (Benth.) H.S.Irwin & Barneby is sister to
C. venulosa (series Coriaceae), and C. pilosa (L.) Greene
and C. trichopoda (Benth.) Britton & Killip are more
closely related to species of series Bauhinianae (Fig. 4,
subclade C7). Series Bauhinianae is monophyletic with
two species [C. basifolia (Vogel) H.S.Irwin & Barneby
Red asterisks indicate type species for a section. Taxa with three names are varieties and those with four names are subspecies
and varieties. Numbers in the squares indicate the synapomorphies with the annotation characterstate and are illustrated on the
right. Support of the branches is represented by the thickness of the line, PP = posterior probability and BT = bootstrap value.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

28 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
and C. rotundifolia] and is differentiated from other
species of clade C by the bifoliolate leaves which lack
nectaries.
Subclade C9 grouped species of the polyphyletic
Chamaecrista series Chamaecrista, one species of
section Caliciopsis, one species excluded from series
Coriaceae (sensu Rando et al., 2016) and a monophyletic
group of six extra-American species without systematic
position (Fig. 4, subclade C8). Taxa of subclade C9 have
a wide distribution range and share inflorescences
in fascicles in a supra-axillary position, whereas
other species of clade C have axillary fascicles. All
extra-American Chamaecrista spp. (including those
not sampled and excluding C. absus from section
Grimaldia) are similar to members of Chamaecrista
section Chamaecrista. Irwin & Barneby (1982),
however, did not treat them in their classification, nor
in local floras of Africa, Asia and Oceania; these species
have never been formally placed in any supraspecific
categories, but it is clear from our phylogenetic and
morphological results that they should be placed in a
redefined section Chamaecrista.
Despite all this diversity, clade C groups most species
known to have root nodulating capacity, leafy stipules,
alternate-distichous leaves and flowers solitary or in
axillary or supra-axillary fascicles. Most of the species
are American, with fewer species in Africa, Asia and
Oceania. The woody species occur in savannas, campo
rupestre or desert habitats, but most other species
occur in disturbed habitats where an herbaceous
habit and rapid life cycle from germination to seed
dispersal are more common. Based on this, the option
of considering Chamaecrista a single section that
includes sections Xerocalyx and Caliciopsis agrees
with our phylogenetic and morphological results and
corroborates the conclusions of Conceição et al. (2009)
and Torres et al. (2011) in previous studies based on
lower sampling.
Clade D: the viscous indumentum group
Clade D (Fig. 5) includes the monospecific section
Grimaldia and the diverse subsection Absus sensu
Irwin & Barneby (1982). These two taxa have always
considered to be phylogenetically and morphologically
related (Irwin & Barneby, 1982; Conceição et al., 2009;
Torres et al., 2011; Souza et al., 2019a) and share
glandular trichomes on vegetative and/or reproductive
structures, racemose inflorescences and the absence
of leaf nectaries; this combination of traits easily
separates them from all other sections.
Section Grimaldia contains a single pantropically
distributed species (C. absus) with two varieties that
can be differentiated by a unique set of characters
including alternate-distichous leaves, glandular
trichomes throughout the plant, a leafy appendix on the
leaf rachis, racemose inflorescences, flowers without a
petal enveloping the stamens and orange or red petals
an the androecium with three to seven fertile stamens.
Some of these characters commonly occur in members
of section Chamaecrista and others are typical of
subsection Absus and, due to this, Irwin & Barneby
(1982) suggested that C. absus could represent an
intermediary species between sections Absus and
Chamaecrista, which is why they preferred to consider
it as a separate monospecific section. However, our
results indicate that C. absus is more related to
subsection Absus and as sister to C. hispidula (Vahl)
H.S.Irwin & Barneby of series Absoideae (Fig. 5).
Section Absus, as previously mentioned, is not
monophyletic because subsections Adenophyllum,
Baseophyllum and Otophyllum appear in a distinct
clade (clade B, Fig. 4), whereas subsection Absus is
positioned in clade D, related to section Grimaldia.
The subsection Absus comprises c. 180 species and has
been divided into 31 series (Irwin & Barneby 1982),
of which 141 species and 27 series were sampled in
this study. In our analysis, most series were recovered
as para- or polyphyletic, including the species-rich
series Absoideae, Microphyllae and Ochnaceae (Fig.
5), but we highlight that series recently redefined as
Rigidulae and Paniculatae (Souza et al., 2019a, and
Mendes et al., 2020, respectively) were recovered as
monophyletic based on their new circumscriptions.
Nevertheless, the resolution in clade D is generally
low and it is not possible to constructively comment on
relationships among all the series of subsection Absus.
This group is mainly from the Brazilian cerrado and
campo rupestre vegetation and appears to have had
a recent and rapid diversification in these vegetation
types, as hypothesized in studies of time divergence
for series Rigidulae and Paniculatae (Souza et al.,
2019a, and Mendes et al., 2020, respectively). This is
a common pattern in other genera of Fabaceae diverse
in these two vegetation types (Simon et al., 2009;
Souza et al., 2013; Queiroz et al., 2015; Alcantara,
Ree & Mello-Silva, 2018; Inglis & Cavalcanti, 2018;
Vaconcelos et al., 2020).
Despite the low resolution at species level, our
Multilocus analysis results recovered three well-
supported subclades in clade D (subclade D1: 0.96
PP and 89% BT; subclade D2: 0.98 PP and 85% BT;
subclade D3: 0.99 PP and 90% BT, Fig. 5). Subclade D1
includes C. absus (section Grimaldia) and members
of series Absoideae, Confertae and Oligospermae
(subsection Absus). These taxa share leaves
predominantly with two pairs of papyraceous leaflets,
non-striate branches and bark sometimes exfoliating,
and they are distributed mainly in the Americas with
six species endemic to Brazil.
Subclade D2 (Fig. 5) consists of 11 taxa from
series Absoideae (sensu Irwin & Barneby 1982) all
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 29
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
endemic to Brazil and growing in cerrado, campo
rupestre, caatinga or restinga vegetation in north-
eastern Brazil. The species of this subclade have
leaves consistently tetra-foliolate with papyraceous or
chartaceous leaflets and their branches are commonly
striate.
Subclade D3 (Fig. 5) includes taxa of 26 series
of subsection Absus and encompasses the greatest
diversity in the genus with species differing in habit,
foliage (leaves with one to 70 pairs of leaflets) and
organization of their inflorescences and flowers.
Nevertheless, the taxa of subclade D3 share the
characters of an androecium with ten fertile,
isomorphic stamens and oblong fruits covered by
glandular trichomes. In contrast to the tetra-foliolate
species in subclades D1 and D2 the leaflets of tetra-
foliolate species in subclade D3 are conspicuously
dorsoventrally differentiated in colour and/or texture,
coriaceous or papyraceous, oblanceolate to obovate and
glabrous or not; when papyraceous, the leaflet apex is
acuminate or cuspidate. Species of this subclade are
closely associated with the Brazilian cerrado and
campo rupestre, where c. 130 species are endemic.
characTer evoluTion in ChamaeCrista
Inflorescence type, leaflet venation pattern, leaflet
number per leaf, trichome type, presence, location
and type of extrafloral nectaries and androecium
arrangement have long been used in the classification
of Chamaecrista (Irwin & Barneby, 1982). Our
study shows that most of these characters are
homoplastic, having evolved independently several
times (Supporting Information, Appendices S11–
S20). However, some characters, including isomorphic
androecium (character 14), pubescence of the anther
suture (character 15), elastic fruit dehiscence (character
18) and bi-bracteolate pedicels (character 20), emerged
as potential synapomorphies of Chamaecrista
(Supporting Information, Appendices S17–S20) and
were the main characters used to reinstate the genus
and differentiate it from Cassia and Senna (Irwin &
Barneby, 1982).
Cauliflorous inflorescence (character 10) and
nectaries on the inflorescence axis (character
7) emerged as synapomorphies for clade A (Supporting
Information, Appendices S14, S15). The species of
section Apoucouita are trees mostly from forest
margins, and the cauliflorous inflorescences could be an
adaptation to partition pollinators, since cauliflorous
inflorescences can allow trees to be pollinated by
animals that cannot climb or bees that cannot fly high
(Diniz, Domingos-Melo & Machado, 2019). Nectaries
on the inflorescence axes may have evolved together
with cauliflory, since their mutualistic interactions
with ants provides a secondary defence against
herbivory (Del-Claro, Rico-Gray & Torezan-Silingardi,
2016). Moreover, although pendulous fruits (character
17) are a plesiomorphic condition in Chamaecrista
it is a character exclusive to section Apoucouita
(Supporting Information, Appendix S19) shared with
rain forest species of Cassia and some Senna spp.
Clade B does not have any morphological
synapomorphies, although its species share a shrubby
habit (character 1), racemose inflorescences (character
10) and a decamerous androecium concealed by a
strongly heteromorphic corolla, with an ovate or
falcate, convolute petal interposed between the
stamens (character 13). Irwin & Barneby (1982)
classified subsections Baseophyllum, Adenophyllum
and Otophyllum as part of section Absus based on
these characters. However, our analyses do not support
this taxonomy, instead suggesting an independent
evolution and convergence of floral morphology
between clades B and D. Flowers of clade B species
are more ‘closed’ with the internal petal more open,
whereas those of clade D, in general, are more ‘open’
with the internal petal strongly interposed between
the stamens. These slight floral differences in clade D
may be related to a more effective pollination system
in this group (Costa et al., 2012) which led to a greater
diversification than observed in clade B.
Alternate-distichous leaves (character 8), leaflets
with a palmate venation (character 9) and flowers
solitary or grouped in fascicles (character 10) are
synapomorphies of clade C, which includes taxa of
sections Chamaecrista, Xerocalyx and Caliciopsis. In
section Xerocalyx, leaflet venation evolved further
into a parallel pattern (character 9) (Supporting
Information, Appendix S15). Species of this clade also
commonly have short life cycles and abundant seed-
production, as observed in many species of section
Chamaecrista [e.g. C. fasciculata (Michx.) Greene
and C. nictitans (L.) Moench], allowing them to
survive the winter in temperate regions as seeds. This
might explain their colonization of various disturbed
environments in North America and throughout the
Tropics (Irwin & Barneby, 1982; Naisbitt, James &
Sprent, 1992).
Clade D, including sections Grimaldia and Absus
(subsection Absus), shares two synapomorphies, the
presence of glandular trichomes (character 5) and
loss of extrafloral nectaries (character 6) (Supporting
Information, Appendix S13), supporting the combining
of these taxa into one section. The emergence of
glandular trichomes has probably played an important
role in the rapid diversification of this group in open
areas of the Brazilian cerrado, where > 100 of the
species are endemic (Irwin & Barneby, 1982). According
to Wagner (1991), glandular trichomes, when present
on vegetative structures, provide protection to the
plant by secreting compounds that prevent herbivory
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

30 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
by insects. This important evolutionary step seems to
have been accompanied by several changes in DNA,
as observed in the long length of the branches of clade
D in all analyses (Figs 1, 2, Supporting Information,
Appendices S3–S10). In our alignments, we also
observed that the sequences of species in clade D are
quite different, especially in their nuclear regions (ITS
and ETS), which on average are 200–300 bp larger
than other species analysed in our study. These DNA
changes may represent molecular synapormophies of
clade D.
proposeD new infrageneric classificaTion of
ChamaeCrista
Our molecular and morphological results and those
of previous studies (e.g. Conceição et al., 2009;
Torres et al., 2011; Rando et al., 2016; Souza et al.,
2019a; Mendes et al., 2020) lead us to conclude
that Chamaecrista should have its infrageneric
classification modified based on the monophyletic
groups revealed in our molecular analyses. The four
main clades (A–D) recovered in all of our analyses are
proposed here as the newly circumscribed sections
of Chamaecrista, namely Chamaecrista section
Apoucouita (Clade A: a tree group with cauliflorous
inflorescences), Chamaecrista section Baseophyllum
(Clade B: Baseophyllum group), Chamaecrista section
Chamaecrista (Clade C: herbaceous/shrubby group
with solitary flowers or fascicles) and Chamaecrista
section Absus (Clade D: a viscous indumentum
group). In addition, we recognize the subclades of
clade D (D1–D3) as subsections of section Absus. (D1:
Chamaecrista section Absus subsection Absus; D2:
Chamaecrista section Absus subsection Zygophyllum
and D3: Chamaecrista section Absus subsection
Viscosa) (Fig. 6). The proposed new classification is
presented in Figure 6 and the adjustments to previous
classifications (essentially that of Irwin & Barneby
1982, with some more recent minor adjustments) are
explained next.
Our concept of section Apoucouita is the same as that
proposed by Irwin & Barneby (1982). However, at least
for now, we decided not to retain series Apoucouita and
Pteridophyllae proposed by Irwin & Barneby (1982)
due to the low sampling of these taxa and their unclear
relationship.
Section Baseophyllum is up-ranked from subsection
Baseophyllum and subsections Adenophyllum and
Otophyllum are placed in synonymy. No internal
division is proposed for this group that only comprises
ten species.
Section Chamaecrista now includes sections
Xerocalyx and Caliciopsis, and all extra-American
Chamaecrista spp. (except C. absus), and we no longer
recognize any series within the section. Although
Xerocalyx is a genetically and morphologically well-
defined subgroup of section Chamaecrista, to recognize
it as a distinct section would necessitate the creation
of at least six other sections, each of which would lack
diagnostic characters and thus be difficult to recognize.
Based on the same reasoning, we do not recognize any
taxa at the rank of series in our redefined section
Chamaecrista. The monospecific series Greggianae,
the only series of section Chamaecrista not sampled
in our study, is included in the section because
morphologically it shares some key characters of
section Chamaecrista, such as alternate-distichous
leaves: leaflets with a palmate venation and flowers
solitary or grouped in fascicles.
Chamaecrista section Absus in our proposed
classification includes as a synonym Chamaecrista
section Grimaldia (sensu Irwin & Barneby, 1982),
since Absus has nomenclatural priority because it was
first described at section level by Colladon (1816) in
Cassia (= Cassia section Absus). In our comprehensive
sampling of the series of section Absus, most emerged
as non-monophyletic and appear, in many cases, in a
large polytomy. Based on these findings we decided
not to recognize any of the series of subsection Absus
proposed by Irwin & Barneby (1982). Nevertheless, we
did recover three phylogenetically and morphologically
well-supported subclades (D1–D3), and we propose
these as three subsections: (1) Chamaecrista section
Absus subsection Absus, including the type species of
the section (C. hispidula), and with series Absoideae
and Oligospermae (sensu Irwin & Barneby, 1982)
included in synonymy; (2) Chamaecrista section Absus
subsection Zygophyllum, a new subsection proposed
here [its name is based on the selected type species
of the taxon (C. zygophylloides (Taub.) H.S.Irwin &
Barneby], comprising eight species from the former
series Absoideae (sensu Irwin & Barneby, 1982) and
(3) Chamaecrista section Absus subsection Viscosa
is created to place the remaining taxa from the 29
series of Chamaecrista section Absus subsection Absus
(sensu Irwin & Barneby, 1982). All series previously
recognized are considered, at least preliminarily,
as synonyms of these subsections due to a lack of
resolution at species level. The four monospecific
series of subsection Absus not sampled in our study
(Andromedeae, Atroglandulosae, Hassleranae and
Incanae) are also being temporarily allocated to
section Absus subsection Viscosa because they share
similar morphologies with this subsection.
TAXONOMIC TREATMENT
Given the changes proposed here to the higher level
infrageneric classification of Chamaecrista, we
now provide a key to the four sections recognized
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 31
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 6. New infrageneric classification for Chamaecrista. 1, Cladogram showing the taxa recognized in the new
classification. 2, Compressed version of 1 giving number of species in each section with geographical distribution of clades
A, B, C and D. Red asterisks indicate type species of a section.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

32 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
in our treatment (Apoucouita, Baseophyllum,
Chamaecrista and Absus) and descriptions in which
we highlight the diagnostic characters in bold type.
We provide comments on their species composition,
their geographical distribution and photographs to
show their morphological diversity (Figs 7–12). In
addition, an up-to-date list of all accepted binomials
in the genus, and the sections to which each species
belongs is provided in Supporting Information,
Appendix S21.
1. Chamaecrista section Apoucouita (Benth.)
H.S.Irwin & Barneby, Brittonia 31(1): 155. 1979. ≡
Cassia section Apoucouita Benth. In Martius, Fl.
Bras. 15(2): 129. 1870. – Type species: Chamaecrista
apoucouita (Aubl.) H.S.Irwin & Barneby.
= Chamaecrista series Pteridophyllae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York Bot.
Gard. 35: 641. 1982. ≡ Cassia series Pteridophyllae
H.S.Irwin & Barneby, Brittonia 29(3): 279. 1977.
Syn. nov. Type species: Chamaecrista adiantifolia
(Benth.) H.S.Irwin & Barneby.
Trees or perennial shrubs, 2–15 m tall, glabrous or
pubescent without glandular trichomes. Stipules
usually caducous or inconspicuous. Extrafloral
nectaries patelliform or discoid on the leaf petiole,
leaf rachis and/or on the inflorescence rachis
or pedicels. Leaves petiolate, alternate, spirally
arranged or rarely distichous, (one–) two–35 pairs
of leaflets per leaf, venation brochidodromous.
Racemes cauliflorous or, less frequently, axillary.
Buds globose with rounded or obtuse apex. Flowers
with sepals similar in size and shape, with venation
reticulate and inconspicuous, glabrous or with an
external indumentum; petals yellowish, the three
adaxial petals similar in size and length, and one
of the two abaxial petals slightly asymmetrical, but
not falcate nor interposed between the stamens;
androecium with ten fertile isomorphic stamens,
anthers pubescent throughout their surface
or, less frequently, only on the sutures; ovary
glabrescent or glabrous, style slightly curved at the
apex. Legumes 8–20 cm long, pendulous with
coriaceous valves. Seeds 7–10 mm long.
Chamaecrista section Apoucouita is a South American
taxon with 22 species distributed mainly in the
phytogeographic domains of Mata Atlântica and
Amazonia in Brazil and neighbouring countries
(Fig. 6), usually growing along humid forest
margins. The morphological diversity of the section
is illustrated in Figure 7.
2. Chamaecrista section Baseophyllum (Collad.)
A.O.Souza, G.P.Lewis & M.J.Silva, comb. nov.
≡ Cassia section Baseophyllum Collad., Hist.
Nat. Méd. Casses. 115. 1816. ≡ Cassia subsection
Baseophyllum (Collad.) H.S.Irwin & Barneby, Mem.
New York Bot. Gard. 30: 9. 1978. ≡ Chamaecrista
subsection Baseophyllum (Collad.) H.S.Irwin
& Barneby, Mem. New York Bot. Gard. 35: 646.
1982. Type species: Chamaecrista cytisoides (DC.)
H.S.Irwin & Barneby.
Key To The secTions of ChamaeCrista
1. Plants predominantly viscous due to the presence of glandular trichomes, glutinous dots or other secretory
structures on the vegetative and/or reproductive organs; extrafloral nectaries absent, androecium
decamerous (tri- to heptamerous only in C. absus) ...................................... 4. Chamaecrista section Absus
1’. Plants non-viscous; glabrous or with an indumentum composed of non-glandular trichomes; extrafloral
nectaries present on the petiole, leaf rachis and/or axis of the inflorescence, if nectaries are lacking (only
two species) then the androecium is pentamerous .........................................................................................2
2. Trees or shrubs; racemes cauliflorous, commonly with nectaries on the inflorescence axis; anthers
commonly pubescent throughout their surface; fruits pendulous and relatively large (8–20 cm long) .........
.............................................................................................................. 1. Chamaecrista section Apoucouita
2’. Shrubs, subshrubs or perennial herbs; racemes terminal or axillary, or in fascicles, or flowers solitary;
nectaries on the inflorescece absent; anthers pubescent only in the sutures; fruits not pendulous and
smaller (1.5–6 cm long) ....................................................................................................................................3
3. Leaves alternate and spirally arranged; stipules caducous or inconspicuous or lanceolate when persistent;
inflorescences racemose; flowers with one strongly heteromorphic petal interposed between the stamens
.......................................................................................................... 2. Chamaecrista section Baseophyllum
3’. Leaves alternate-distichous; stipules persistent, conspicuous and commonly foliaceous; inflorescences
axillary or supra-axillary fascicles or flowers solitary, corolla with an asymmetrical abaxial petal, not
interposed among the stamens ...................................................... 3. Chamaecrista section Chamaecrista
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 33
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 7. Morphological diversity of section Apoucouita. Tree habit: A, B, Chamaecrista ensiformis. Fertile branches: C–E,
C. ensiformis and F, C. xinguensis. Extrafloral nectary between leaflets. G, C. apoucouita. Cauliflorous inflorescences: H–J,
C. ensiformis. Flowers: K, C. xinguensis and L, C. ensiformis. Fruits: M, N, C. ensiformis. Photographs provided by Rubens
Teixeira de Queiroz.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

34 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 8. Morphological diversity of section Baseophyllum. Shrub habit: A, Chamaecrista brachystachya. B, C. decora.
C, C. confertiformis. D, E, C. debilis. Leaves: F, C. brachystachya and G, C. blanchetii. Fertile branches: H, C. unijuga, I,
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 35
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
= Chamaecrista subsection Adenophyllum (H.S.Irwin
& Barneby) H.S.Irwin & Barneby, Mem. New
York Bot. Gard. 35: 647. 1982. ≡ Cassia subsection
Adenophyllum H.S.Irwin & Barneby, Mem.
New York Bot. Gard. 30: 16. 1978. Type species:
Chamaecrista bucherae (Moldenke) H.S.Irwin &
Barneby. Syn. nov.
= Chamaecrista subsection Otophyllum (H.S.Irwin
& Barneby) H.S.Irwin & Barneby, Mem. New
York Bot. Gard. 35: 647. 1982. ≡ Cassia subsection
Otophyllum H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 30: 17. 1978. Type species: Chamaecrista
debilis (Vogel) H.S.Irwin & Barneby. Syn. nov.
Perennial shrubs and treelets, 1–5 m tall, erect, without
a xylopodium, or less frequently a decumbent
subshrub with a xylopodium, and 10–20 cm tall,
glabrous. Stipules lanceolate or inconspicuous,
persistent or caducous. Extrafloral nectaries
discoid, positioned on the petiole or the leaf rachis
between the leaflets, or in inter-foliolar regions of
the rachis and on the peduncles. Leaves petiolate
or sessile, alternate, spirally arranged, with one
to 20(–25) pairs of leaflets, these chartaceous or
coriaceous (membranaceous only in C. debilis),
leaflet venation palmate or brochidodromous.
Racemes terminal. Buds globose or ovoid with
a rounded or obtuse apex. Flowers with the sepals
equal in shape and size, with venation reticulate
and inconspicuous, glabrous; petals yellowish, the
three adaxial petals similar in size and one of the
two abaxial petals strongly heteromorphic and
interposed between the stamens; androecium
with ten fertile isomorphic stamens, anthers
pubescent along their sutures; ovary glabrous or
with an indumentum, style curved at the apex.
Legume 2–7 cm long, ascendant, valves coriaceous.
Seeds 4–7 mm long.
Chamaecrista section Baseophyllum is an American
taxon comprising ten species, nine of which are
narrowly endemic to the states of Bahia and Minas
Gerais, occurring in campo rupestre vegetation of the
Espinhaço range in eastern Brazil, and one species
is endemic to Cuba (C. bucherae) (Fig. 6 ). The section,
as circumscribed here, includes Chamaecrista
section Absus subsection Adenophyllum and
section Absus subsection Otophyllum sensu Irwin
& Barneby (1982) as synonyms. We recognize no
infrasectional taxa above the rank of species. The
morphological diversity of the section is illustrated
in Figure 8.
3. Chamaecrista (L.) Moench section Chamaecrista,
Methodus, 272. 1794. emend. A.O. Souza, G.P.
Lewis & M.J. Silva. Type species: Chamaecrista
nictitans (L.) Moench.
= Chamaecrista section Caliciopsis H.S.Irwin &
Barneby, Mem. New York Bot. Gard. 30: 9. 1978.
Type species: Chamaecrista calycioides (Collad.)
Greene. Syn. nov.
= Chamaecrista section Xerocalyx (Benth.) H.S.Irwin
& Barneby, Mem. New York Bot. Gard. 35: 862.
1982. ≡ Cassia section Chamaecrista subsection
Xerocalyx Benth. In Martius, Fl. Bras. 15(2): 155.
1870. Type species: Chamaecrista diphylla (L.)
Greene. Syn. nov.
= Chamaecrista series Bauhinianae (Collad.)
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
35: 727. 1982. ≡ Cassia series Bauhinianae Collad.
Hist. Nat. Méd. Casses. 119. 1816. Type species:
Chamaecrista rotundifolia (Pers.) Greene. Syn.
nov.
= Chamaecrista series Coriaceae (Benth.) H.S.Irwin &
Barneby, Mem. New York Bot. Gard. 35: 667. 1982.
≡ Cassia series Coriaceae Benth. Trans. Linn. Soc.
London 27: 537. 1871. Type species: Chamaecrista
Key To The suBsecTions of secTion absus
1. Leaves with one to 70 pairs of leaflets of varying shape, consistency and apex; when in exactly two pairs
they are coriaceous and differentiated dorsoventrally in colour and texture, or they are oblanceolate or
with an acuminate, acute or cuspidate apex; flowers with yellow petals ............... 4.2. subsection Viscosa
1’. Leaves with exactly two pairs of membranaceous, papyraceous or chartaceous, elliptical, obovate or ovate
leaflets, their apices rounded, emarginate or obtuse; flowers with yellow, orange or red petals (seven to 18
pairs of leaflets only in C. oligosperma, which has orange or red petals) ......................................................2
2. Branches commonly striate with whitish streaks and without exfoliating bark; petiole 1.0–1.5 times longer
than the leaf rachis; flowers with yellow petals ............................................. 4.3. subsection Zygophyllum
2’. Branches lack streaks and sometimes have exfoliating bark; petioles two to four times longer than the leaf
rachis (except in C. oligosperma); flowers with yellow, orange or red petals ............. 4.1. subsection Absus
C. blanchetii. Petiolar extrafloral nectary: J, C. decora. Corymbiform raceme: K, C. brachystachya. Racemes: L, C. debilis.
Flowers: M, C. debilis, N, C. blanchetii and O, C. brachystachya. Fruits: P, C. unijuga. Photographs provided by Rubens
Teixeira de Queiroz and A. O. Souza.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

36 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 9. Morphological diversity of section Chamaecrista. Prostrate herb: A, Chamaecrista serpens. Shrub habit: B,
C. ramosa, C, C. roraimae and D, C. rotundata. Branches and stipules: E, C. rotundata, F, C. swainsonii and G, C. nictitans.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 37
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
choriophylla (Vogel) H.S.Irwin & Barneby. Syn.
nov.
= Chamaecrista series Flexuosae H.S.Irwin & Barneby,
Mem. New York Bot. Gard. 35: 695. 1982. Type
species: Chamaecrista flexuosa (L.) Greene. Syn.
nov.
= Chamaecrista series Greggianae H.S.Irwin &
Barneby, Mem. New York Bot. Gard. 35: 735. 1982.
Type species: Chamaecrista greggii (A. Gray)
Pollard. Syn. nov.
= Chamaecrista series Prostratae (Benth.) H.S.Irwin &
Barneby, Mem. New York Bot. Gard. 35: 667. 1982.
≡ Cassia series Prostratae Benth., Fl. Bras. 15(2):
162. 1870. Type species: Chamaecrista serpens (L.)
Greene. Syn. nov.
Monocarpic herbs with a short life cycle or
perennial subshrubs or shrubs with or without
a xylopodium, 0.1–1.5 m tall, glabrous or with
an indumentum of non-glandular trichomes.
Stipules foliaceous, ovate or deltoid, persistent.
Extrafloral nectaries, patelliform or discoid, on
petioles, and less commonly on the distal inter-
foliolar segments, rarely absent. Leaves petiolate,
alternate, distichous, leaflets in one to 65 pairs
per leaf, venation palmate or parallel, rarely
brochidodromus. Flowers solitary or in axillary
or supra-axillary fascicles. Buds ovoid, with an
acute or acuminate apex, less frequently obtuse.
Flowers with sepals equal in shape and size or
with two sepals reduced, venation reticulate and
inconspicuous or parallel and prominent, glabrous
or with an indumentum; petals yellowish, the
three adaxial petals similar in size and of the two
abaxial petals one asymmetrical and curved but
not covering the stamens; androecium with
three to ten fertile stamens, these isomorphic or
slightly differing in size, anthers pubescent along
the sutures; ovary glabrous or hairy, style curved
at the apex. Legume 3–6 cm long, ascending, valves
chartaceous. Seeds 2–5 mm long.
Chamaecrista section Chamaecrista, as defined here,
comprises 134 species and includes Chamaecrista
sections Xerocalyx and Caliciopsis (sensu Irwin
& Barneby 1982) and 64 extra-American species,
previously unclassified to infrageneric category.
The section thus has a pantropical distribution
but with its main centre of diversity in the
Americas (c. 72 species) and the other species
distributed in Africa, Asia and Oceania (Fig. 6).
The species inhabit diverse environments and
are often found at the edges of natural vegetation
or in anthropogenically altered habitats.
The morphological diversity of the section is
illustrated in Figures 9 and 10.
4. Chamaecrista section Absus (Collad.) H.S.Irwin &
Barneby, Mem. New York Bot. Gard., 35: 644. 1982.
emend. A.O.Souza, G.P.Lewis & M.J.Silva ≡ Cassia
section Absus Collad., Hist. Nat. Méd. Casses, 116.
1816. Type species: Chamaecrista hispidula (Vahl)
Irwin & Barneby.
= Chamaecrista section Grimaldia (Schrank)
H.S.Irwin & Barneby, Mem. New York Bot.
Gard., 35: 664. 1982. ≡ Cassia section Grimaldia
(Schrank) H.S.Irwin & Barneby, Mem. New York
Bot. Gard., 30: 277. 1978. ≡ Grimaldia Schrank,
Bot. Zeitung (Regensburg), 4: 184. 1805. Type
species: Chamaecrista absus (L.) H.S.Irwin &
Barneby.
Perennial shrubs or subshrubs, commonly with a
xylopodium, or rarely trees or herbs, 0.1–10.0
m tall, with an indumentum of glandular and
non-glandular trichomes, glutinous dots or other
secretory structures, at least on the inflorescence,
branches and/or leaflets, rarely glabrous. Stipules
linear or lanceolate, rarely foliaceous, persistent
or caducous. Extrafloral nectaries absent. Leaves
petiolate, alternate and spirally arranged, distichous
only in C. absus, with (one–) two to 45 pairs of
leaflets, venation brochidodromus. Inflorescences
racemose, mostly terminal, or axillary. Flowers
with sepals equal in shape and size with venation
reticulate and inconspicuous, with an indumentum
or (rarely) glabrous; petals yellowish, rarely orange
or reddish, the three adaxial petals similar in size
or the adaxial-lateral petal shorter, of the two
abaxial petals one strongly heteromorphic and
interposed between the stamens; androecium with
ten fertile isomorphic stamens (three to seven only
in C. absus), anthers pubescent along the sutures;
ovary hairy or (rarely) glabrous, style curved at the
apex (straight only in C. absus). Legumes 1–6 cm
long, ascending, valves chartaceous or coriaceous.
Seeds 3–5 mm long.
Chamaecrista section Absus here includes
Chamaecrista section Grimaldia (sensu Irwin &
Barneby 1982) in synonymy. In our classification,
the section comprises 197 species, 196 of which are
exclusively American and C. absus is pantropical.
Brazil is the main centre of diversity with 165
endemic species, mainly in cerrado and caatinga
(Fig. 6). The morphological diversity of the section
is illustrated in Figures 11 and 12. We recognize
three subsections within section Absus, identified
in the following key:
Leaves: H, C. capensis, I, C. supplex and J, C. fasciculata. Petiolar extrafloral nectary: K, C. nictitans. Leaflets: L, C. choriophylla
and M, C. kunthiana. Photographs provided by Rubens Teixeira de Queiroz and A. O. Souza.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

38 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 10. Morphological diversity of section Chamaecrista. Fascicles: A, C. fasciculata. Solitary flowers: B, C. pilosa, C,
C. rotundifolia, D, C. diphylla, E, C. tragacanthoides and F, C. basifolia. Stipules: G, C. glandulosa and H, C. potentilla. Buds:
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 39
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
4.1. Chamaecrista section Absus subsection Absus
= Chamaecrista series Absoideae (Benth.) H.S.Irwin &
Barneby, Mem. New York Bot. Gard. 35: 660. 1982.
≡ Cassia series Absoideae Benth., Fl. Bras. 15(2):
131. 1870. Type species: Chamaecrista hispidula
(Vahl) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Oligospermae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York Bot.
Gard. 35: 648. 1982. ≡ Cassia series Oligospermae
H.S.Irwin & Barneby, Mem. New York Bot. Gard. 30:
38. 1978. Type species: Chamaecrista oligosperma
(Benth.) H.S.Irwin & Barneby. Syn. nov.
Shrubs or subshrubs with a xylopodium (this lacking
only in C. absus, which is a herb). Leaves alternate
and spirally arranged (distichous only in C. absus);
leaflets in two pairs per leaf with distal pairs
slightly larger than the proximal pair (seven to 18
pairs only in C. oligosperma). Racemes terminal
or axillary. Flowers with hairy sepals; petals
yellowish, orange or reddish; androecium with
ten stamens [(two–) three to seven in C. absus];
ovary hairy, style curved at the apex (straight in
C. absus). Root nodules known only in C. absus.
Chamaecrista section Absus subsection Absus comprises
20 species (27 taxa) and now includes the former
Chamaecrista section Absus series Absoideae and
Oligospermae (sensu Irwin & Barneby 1982). This
subsection is a predominantly American group with
17 species endemic in Brazil; C. absus is pantropical.
The species grow from lowland to montane areas
in open, dry vegetation, including in cerrado and
caatinga in Brazil, and in forest margins, coastal
vegetation and disturbed environments.
4.2. Chamaecrista section Absus subsection Viscosa
(Benth.) A.O. Souza, G.P. Lewis & M.J. Silva, comb
& stat nov. ≡ Chamaecrista series Paniculatae
(Benth.) H.S.Irwin & Barneby, Mem. New York Bot.
Gard. 35: 655. 1982. ≡ Cassia series Paniculatae
Benth. Fl. Bras. 15(2): 140. 1870. Type species:
Chamaecrista orbiculata (Benth.) H.S.Irwin &
Barneby.
= Chamaecrista series Andromedeae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York Bot.
Gard. 35: 651. 1982. ≡ Cassia series Andromedeae
H.S.Irwin & Barneby, Mem. New York Bot. Gard. 30:
83. 1978. Type species: Chamaecrista andromeda
(Benth.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Atroglandulosae (H.S.Irwin
& Barneby) H.S.Irwin & Barneby, Mem. New
York Bot. Gard. 35: 648. 1982. ≡ Cassia series
Atroglandulosae H.S.Irwin & Barneby, Mem.
New York Bot. Gard. 30: 39. 1978. Type species:
Chamaecrista atroglandulosa (Harms) H.S.Irwin &
Barneby. Syn. nov.
= Chamaecrista series Bracteolatae (H.S.Irwin
& Barneby) H.S.Irwin & Barneby, Mem. New
York Bot. Gard. 35: 650. 1982. ≡ Cassia series
Bracteolatae H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 30: 51. 1978. Type species: Chamaecrista
bracteolata (Vogel) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Catharticae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 647. 1982. ≡ Cassia series Catharticae
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
30: 27. 1978. Type species: Chamaecrista cathatica
(Mart.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Confertae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 658. 1982. ≡ Cassia series Confertae
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
30: 193. 1978. Type species: Chamaecrista conferta
(Benth.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Ericifoliae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 660. 1982. ≡ Cassia series Ericifoliae
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
30: 229. 1978. Type species: Chamaecrista ericifolia
(Benth.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Glutinosae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 658. 1982. ≡ Cassia series Glutinosae
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
30: 201. 1978. Type species: Chamaecrista dentata
(Vogel) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Gracillimae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 660. 1982. ≡ Cassia series Gracillimae
H.S.Irwin & Barneby, Mem. New York Bot. Gard. 30:
229. 1978. Type species: Chamaecrista benthamii
(Ghesq.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Hassleranae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 656. 1982. ≡ Cassia series Hassleranae
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
30: 172. 1978. Type species: Chamaecrista hassleri
(H.S.Irwin & Barneby) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Hedysaroides (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York Bot.
Gard. 35: 656. 1982. ≡ Cassia series Hedysaroides
H.S.Irwin & Barneby, Mem. New York Bot. Gard. 30:
174. 1978. Type species: Chamaecrista hedysaroides
(Vogel) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Incanae (H.S.Irwin & Barneby)
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
I, C. olesiphylla. Flowers: J, C. duckeana, K, C. papillata, L, C. ramosa, M, C. roraimae, N, C. pascuorum, O, C. olesiphylla and
P, C. nictitans. Sepals: Q, C. fasciculata. Photographs provided by Rubens Teixeira de Queiroz and A. O. Souza.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

40 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 11. Morphological diversity of section Absus subsection Absus (A–G) and subsection Zygophyllum (H–N). Fertile
branches: A, C. absus, B, C. barbata, C, C. viscosa. Flowers: D, C. absus, E, C. fagonioides, F, C. carobinha and G, C. hispidula.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 41
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
35: 648. 1982. ≡ Cassia series Incanae H.S.Irwin
& Barneby, Mem. New York Bot. Gard. 30: 40.
1978. Type species: Chamaecrista incana (Vogel)
H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Incurvatae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Brittonia 31(4):
467. 1979. ≡ Cassia series Incurvatae H.S.Irwin &
Barneby, Mem. New York Bot. Gard. 30: 214. 1978.
Type species: Chamaecrista incurvata (Benth.)
H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Lomatopodae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York Bot.
Gard. 35: 651. 1982. ≡ Cassia series Lomatopodae
H.S.Irwin & Barneby, Mem. New York Bot. Gard. 30:
85. 1978. Type species: Chamaecrista lomatopoda
(Benth.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Lucidae (H.S.Irwin & Barneby)
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
35: 656. 1982. ≡ Cassia series Lucidae Beth., Fl.
Bras. 15(2): 146. 1870. Type species: Chamaecrista
lamprosperma (Benth.) H.S.Irwin & Barneby. Syn.
nov.
= Chamaecrista series Microphyllae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York Bot.
Gard. 35: 651. 1982. ≡ Cassia series Microphyllae
Benth., Fl. Bras. 15(2): 146. 1870. Type species:
Chamaecrista pohliana (Benth.) H.S.Irwin &
Barneby. Syn. nov.
= Chamaecrista series Ochnaceae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 656. 1982. ≡ Cassia series Ochnaceae
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
30: 176. 1978. Type species: Chamaecrista ochnacea
(Vogel) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Pinifoliae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 650. 1982. ≡ Cassia series Pinifoliae
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
30: 66. 1978. Type species: Chamaecrista paniculata
(Benth.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Rigidulae (Benth.) H.S.Irwin &
Barneby, Mem. New York Bot. Gard. 35: 654. 1982.
≡ Cassia series Rigidulae Benth., Fl. Bras. 15(2):
142. 1870. Type species: Chamaecrista decumbens
(Benth.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Secundae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 651. 1982. ≡ Cassia series Secundae
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
30: 86. 1978. Type species: Chamaecrista secunda
(Benth.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Setosae (H.S.Irwin & Barneby)
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
35: 650. 1982. ≡ Cassia series Setosae H.S.Irwin
& Barneby, Mem. New York Bot. Gard. 30: 86.
1978. Type species: Chamaecrista setosa (Vogel)
H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Spinulosae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 659. 1982. ≡ Cassia series Spinulosae
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
30: 221. 1978. Type species: Chamaecrista setosa
(H.S.Irwin & Barneby) H.S.Irwin & Barneby. Syn.
nov.
= Chamaecrista series Strictifoliae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York
Bot. Gard. 35: 659. 1982. ≡ Cassia series Strictifoliae
H.S.Irwin & Barneby, Mem. New York Bot. Gard. 30:
227. 1978. Type species: Chamaecrista strictifolia
(Benth.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Trachycarpae (H.S.Irwin &
Barneby) H.S.Irwin & Barneby, Mem. New York Bot.
Gard. 35: 648. 1982. ≡ Cassia series Trachycarpae
H.S.Irwin & Barneby, Mem. New York Bot. Gard. 30:
33. 1978. Type species: Chamaecrista trachycarpa
(Vogel) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Unijugae (Benth.) H.S.Irwin &
Barneby, Mem. New York Bot. Gard. 35: 659. 1982.
≡ Cassia series Unijugae Benth., Fl. Bras. 15(2):
134. 1870. Type species: Chamaecrista monticola
(Benth.) H.S.Irwin & Barneby. Syn. nov.
= Chamaecrista series Ursinae (H.S.Irwin & Barneby)
H.S.Irwin & Barneby, Mem. New York Bot. Gard.
35: 650. 1982. ≡ Cassia series Ursinae H.S.Irwin
& Barneby, Mem. New York Bot. Gard. 30: 54.
1978. Type species: Chamaecrista ursina (Benth.)
H.S.Irwin & Barneby. Syn. nov.
Shrubs or subshrubs with a xylopodium or this lacking,
rarely trees. Leaves with one to 70 pairs of leaflets,
with different shapes, consistency and apices, but
when with exactly two pairs of leaflets they are
coriaceous and differentiated dorsoventrally in
colour and texture, or they are oblanceolate, or with
an acuminate, acute or cuspidate apex. Racemes
terminal or axillary. Flowers with hairy sepals;
petals yellowish; androecium with ten fertile
stamens; ovary hairy, style curved at the apex.
Chamaecrista section Absus subsection Viscosa
contains 169 species and includes the taxa of the
29 series of Chamaecrista section Absus subsection
Absus (sensu Irwin & Barneby, 1982). The subsection
is South American with its main centre of diversity
Shrubby habit: H, C. belemii. Fertile branches: I, C. zygophylloides, J, C. arboae and K, C. andersonii. Striate branch: L,
C. zygophylloides. Flowers: M, C. arboae and N, C. zygophylloides.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

42 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Figure 12. Morphological diversity of section Absus subsection Viscosa. Tree habit: A, C. fulgida. Sub-shrubby habit:
B, C. ericifolia and C, C. strictula. Shrubby habit: D, C. orbiculata and E, C. stillifera. Fertile branches: F, C. obolaria and
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 43
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
in Brazil with c. 160 species, many endemic to the
cerrado.
4.3. Chamaecrista section Absus subsection
Zygophyllum A.O.Souza, G.P.Lewis & M.J.Silva
subsection nov. Type species: Chamaecrista
zygophylloides (Taub.) H.S.Irwin & Barneby.
Shrubs or subshrubs with xylopodium or this lacking.
Branches with whitish streaks and without
exfoliating bark. Leaves alternate and spiral,
two pairs of leaflets; petiole 1.0–1.5 times
longer than the rachis. Raceme terminal.
Flowers with sepals indumented externally, or
glabrous; petals yellow; androecium with ten
stamens; ovary indumented or glabrous, style
curved at the apex.
Chamaecrista section Absus subsection Zygophyllum
has eight species and includes some taxa from
former Chamaecrista section Absus subsection
Absus series Absoideae (sensu Irwin & Barneby,
1982). This subsection is American with five species
endemic to Brazil and occurring in caatinga in
north-eastern Brazil and one (C. zygophylloides)
occurring from north-eastern Brazil to Mexico.
CONCLUSIONS AND FUTURE DIRECTIONS
This work, based on a multiple markers associated with
indels strategy, presents the most comprehensively
sampled phylogenetic reconstruction of Chamaecrista
so far and sheds greater light on the status of its
infrageneric categories (sections, subsections and
series). Newly discovered evolutionary relationships
in the genus have led us to propose a modified
infrageneric classification. In our analysis, most of
the previously recognized infrageneric taxa are found
not to be monophyletic. In our new classification,
the genus comprises four sections, Apoucouita,
Baseophyllum, Chamaecrista and Absus (the last with
three subsections: Absus, Viscosa and Zygophyllum),
all phylogenetically and morphologically well-
supported. No series in Chamaecrista proposed by
Irwin & Barneby (1982) are retained because of their
low phylogenetic support and/or non-monophyletic
status. Nevertheless, we highlight that the recently
redefined series Coriaceae, Rigidulae and Paniculatae
were supported in our analyses, although we have
temporarily placed the first in section Chamaecrista
and the other two in subsection Viscosa, pending
further study. Notwithstanding the findings of our
study, we consider the published revisions of Irwin &
Barneby (1977, 1978, 1982) still to be the most useful
publications for the identification of Chamaecrista
spp. in the Americas.
The lack of some extra-American species of section
Chamaecrista should not alter the results found here.
However, the inclusion of more extra-American species
could provide better estimations of the number of
lineages outside the Americas from section Chamaecrista.
Additionally, new studies with new markers will be needed
to clarify some of the deeper relationships in subsection
Viscosa and to resolve the relationships between species
further leading to the understanding of the evolution
of the genus in low levels; also, population-level studies
would promote an understanding of the relationships of
some of the species with disjunct distributions.
ACKNOWLEDGEMENTS
We are grateful to CAPES for a scholarship granted to
the first author (process number 88882.387126/2019-
01); to CNPq for the productivity grant to Marcos
J. Silva (process number 307747/2019-0) and to the
of New York Botanical Garden for a Rupert Barneby
award granted to the first author allowing him to
review the large collection of Chamaecrista in the NY
herbarium. We also thank the entire staff of the NY
herbarium for their assistance in accessing specimens
and for logistical support and to Rubens Teixa de
Queiroz for providing some species photographs.
REFERENCES
Alcantara S, Ree RH, Mello-Silva R. 2018. Accelerated
diversification and functional trait evolution in
Velloziaceae reveal new insights into the origins of the
campos rupestres exceptional floristic richness. Annals of
Botany 122: 165–180.
Baldwin BG, Markos S. 1998. Phylogenetic utility of the
external transcribed spacer (ETS) of 18S–26S rDNA:
congruence of ETS and ITS trees of Calycadenia (Compositae).
Molecular Phylogenetics and Evolution 10: 449–463.
Barbosa AR, Machado MC, Lewis GP, Forest F, Queiroz LP.
2016. Re-establishment of Chamaecrista cultrifolia
(Leguminosae, Caesalpinioideae) based on morphological and
molecular analyses. Phytotaxa 265: 183–203.
Bentham G. 1870. Cassia. In: Martius CFP, Eichler AW, eds.
Flora Brasiliensis. Vienna: Fried, Fleischer, 82–176.
Borchsenius F. 2009. FastGap, version 1.2. http://www.aubot.
dk/FastGap_home.htm.
G, C. benthamii. Branch indumentum: H, C. multiseta and I, C. leucopilis. Racemes: J, C. urophyllidia, K, C. spinulosa,
L, C. phyllostachya and M, C. catharticae. Flowers: N, C. urophyllidia, O, C. adenophylla, P, C. imbricans and Q,
C. orbiculata. Photographs provided by Rubens Teixeira de Queiroz and A. O. Souza.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

44 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Cândido ES, Vatanparast M, Vargas W, Bezerra LMPA,
Lewis GP, Mansano VF, Simões AO, Silva MJ,
Stirton C, Tozzi AMGA, Fortuna-Perez AP. 2020.
Molecular phylogenetic insights into the evolution of
Eriosema (Fabaceae): a recent tropical savanna-adapted
genus. Botanical Journal of the Linnean Society 194:
439–459.
Colladon LTF. 1816. Histoire naturelle et médicale des casses,
et particulièrement de la casse et des sénés employés en
médecine. Montpellier: Jean Martel.
Conceição AS, Queiroz LP, Lewis GP, Andrade MJG,
Almeida PRM, Schnadelbach AS, Van de Berg C.
2009. Phylogeny of Chamaecrista Moench (Leguminosae-
Caesalpinioideae) based on nuclear and chloroplast DNA
regions. Taxon 58: 1168–1180.
Costa CBN, Costa JAS, Queiroz LP, Borba EL. 2012.
Selfcompatible sympatric Chamaecrista (Leguminosae-
Caesalpinioideae) species present different interspecific
isolation mechanisms depending on their phylogenetic
proximity. Plant Systematics and Evolution 299: 699–711.
Cota MMT, Rando JG, Mello-Silva R. 2020. Chamaecrista
(Leguminosae) of the Diamantina Plateau, Minas Gerais,
Brazil, with six new species and taxonomic novelties.
Phytotaxa 469: 001–082.
Coutinho IAC, Francino DMT, Meira RMSA. 2013. Leaf
anatomical studies of Chamaecrista subsect. Baseophyllum
(Leguminosae, Caesalpinioideae): new evidence for the
up-ranking of the varieties to the species level. Plant
Systematics and Evolution 299: 1709–1720.
Coutinho IAC, Rando JG, Conceição AS, Meira RMSA.
2016. A study of the morphoanatomical characters of
the leaves of Chamaecrista (L.) Moench sect. Apoucouita
(Leguminosae-Caesalpinioideae). Acta Botanica Brasilica
30: 205–221.
Darriba D, Taboada GL, Doallo R, Posada D. 2012.
jModelTest 2.1.5: more models, new heuristics and parallel
computing. Nature Methods 9: 772.
Del-Claro K, Rico-Gray V, Torezan-Silingardi HM.
2016. Loss and gains in ant-plant interactions mediated by
extrafloral nectar: fidelity, cheats, and lies. Insectes Sociaux
63: 207–221.
Diniz UM, Domingos-Melo A, Machado IC. 2019. Flowers
up! The effect of floral height along the shoot axis on the
fitness of bat-pollinated species. Annals of Botany 124:
809–818.
Doyle JJ, Doyle JL. 1987. A rapid DNA isolation method
for small quantities of fresh tissue. Phytochemical Bulletin,
Botanical Society of America 19: 11–15.
Drummond AJ, Suchard MA, Xie D, Rambaut A. 2012.
Bayesian phylogenetics with BEAUti and the BEAST 1.7.
Molecular Biology and Evolution 29: 1969–1973.
Farris JD, Kallersjӧ M, Kluge AG, Bult C. 1994. Testing
significance of incongruence. Cladistics 10: 315–319.
Farris JD, Kallersjӧ M, Kluge AG, Bult C. 1995. Constructing
a significance test for incongruence. Systematic Biology 44:
570–572.
Flora do Brasil, under construction. 2020. Flora do Brasil
2020. http://floradobrasil.jbrj.gov.br/.
Hall TA. 1999. BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/
NT. Nucleic Acids Symposium Series 41: 95–98.
IBGE (Instituto Brasileiro de Geografia e Estatística).
2012. Manual técnico da vegetação brasileira: sistema
fitogeográfico, inventário das formações florestais e
campestres, técnicas e manejo de coleções botânicas,
procedimentos para mapeamentos. Rio de Janeiro: IBGE-
Diretoria de Geociências.
Inglis PW, Cavalcanti TB. 2018. A molecular phylogeny of
the genus Diplusodon (Lythraceae), endemic to the campos
rupestres and cerrados of South America. Taxon 67: 66–82.
Irwin HS, Barneby RC. 1977. Monographic studies in Cassia
(Leguminosae-Caesalpinioideae). IV. Supplementary notes
on section Apoucouita Bentham. Brittonia 29: 277–290.
Irwin HS, Barneby RC. 1978. Monographic studies in Cassia
(Leguminosae-Caesalpinioideae) III. Sections Absus and
Grimaldia. Memoirs of the New York Botanical Garden 30:
1–277.
Irwin HS, Barneby RC. 1982. The American Cassiinae: a
synoptical revision of Leguminosae tribe Cassieae subtribe
Cassiinae in the New World. Memoirs of the New York
Botanical Garden 35: 455–918.
Kato T, Kaneko T, Sato S, Nakamura Y, Tabata S. 2000.
Complete structure of the chloroplast genome of a legume,
Lotus japonicus. DNA Research 7: 323–330.
Katoh K, Rozewicki J, Yamada KD. 2017. MAFFT online
service: multiple sequence alignment, interactive sequence
choice and visualization. http://mafft.cbrc.jp/alignment/
server.
Lewis G, Schrire B, Mackinder B, Lock M. 2005. Legumes
of the World. Kew: Royal Botanic Gardens.
Lock JM. 1988. Cassia sens. lat. (Leguminosae:
Caesalpinioideae) in Africa. Kew Bulletin 43: 333–342.
LPWG (The Legume Phylogeny Working Group). 2017.
A new subfamily classification of the Leguminosae based
on a taxonomically comprehensive phylogeny. Taxon 66:
44–77.
Maddison WP, Maddison DR. 2006. StochChar: a package
of Mesquite modules for stochastic models of character
evolution. http://www.mesquiteproject.org.
Maddison WP, Maddison DR. 2018. Mesquite: a modular
system for evolutionary analysis. http://www.mesquiteproject.
org.
Mendes TP, Souza AO, Silva MJ. 2020. Molecular phylogeny
and diversification timing of the Chamaecrista sect. Absus
subsect. Absus ser. Paniculatae, a newly circumscribed
and predominantly endemic of the Cerrado Biome group.
Phytotaxa 446: 159–182.
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the
CIPRES science gateway for inference of large phylogenetic
trees. https://www.phylo.org.
Moench C. 1794. Methodus plantas horti botanici et agri
marburgensis, a staminum situ describendi. Marburg:
Officina Nova Libraria Academiae.
Naisbitt T, James EK, Sprent JI. 1992. The evolutionary
significance of the legume genus Chamaecrista, as determined
by nodule structure. New Phytologist 122: 487–492.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

CLASSIFICATION OF CHAMAECRISTA 45
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
Queiroz LP, Pastore JFB, Cardoso D, Snak C, Lima ALC,
Gagnon E, Vatanparast M, Holland AE, Egan AN. 2015.
A multilocus phylogenetic analysis reveals the monophyly
of a recircumscribed papilionoid legume tribe Diocleae
with well-supported generic relationships. Molecular
Phylogenetics and Evolution 90: 1–19.
Rambaut A. 2016. Figtree, a graphical viewer of phylogenetic
trees. http://tree.bio.ed.ac.uk/software/gtree.
Randell BR. 1988. Revision of the Cassiinae in Australia.
Journal of the Adelaide Botanic Gardens 11: 19–49.
Rando JG, Pirani JR, Cota MMT, Lewis GP. 2019. New
circumscription, morphology and synopsis of Chamaecrista
sect. Chamaecrista ser. Coriaceae (Leguminosae). Brittonia
71: 268–298.
Radford AE, Dickinson WC, Massey JR, Bell CR. 1974.
Vascular plant systematics. New York: Harper & Row.
Rando JG, Zuntini AR, Conceição AS, van den Berg C,
Pirani JR. Queiroz LP. 2016. Phylogeny of Chamaecrista
ser. Coriaceae (Leguminosae) unveils a lineage recently
diversified in Brazilian campo rupestre vegetation.
International Journal of Plant Sciences 177: 3–17.
Ribeiro JF, Walter BMT. 2008. As principais fitofisionomias
do Bioma Cerrado. In: Sano SM, Almeida SP, Ribeiro JF,
eds. Cerrado: ecologia e flora, Vol. 1. Planaltina: Embrapa
Cerrados, 151–212.
Ribeiro PL, Rapini A, Damascena LS, Van den Berg C.
2014. Plant diversification in the Espinhaço Range: insights
from the biogeography of Minaria (Apocynaceae). Taxon 63:
1253–1264.
Ronquist F, Teslenko M, van der Mark P, Ayres DL,
Darling A, Hohna S, Huelsenbeck JP. 2012. MrBayes
3.2: efficient Bayesian phylogenetic inference and model
choice across a large model space. Systematic Biology 61:
539–542.
Sanyal G, Mahadani AK, Mahadani P, Bhattacharjee P.
2015. Insertion-deletion as informative characters in
DNA barcoding. International Journal of Multimedia and
Ubiquitous Engineering 10: 67–74.
Silva MJ, Souza AO, Alonso AA. 2019. A new species for the
legume genus Chamaecrista (Fabaceae, Caesalpinioideae)
supported by molecular, morphological, and anatomical data.
Plant Systematics and Evolution 305: 325–340.
Simmons MP, Ochoterena H. 2000. Gaps as characters in
sequence-based phylogenetic analyses. Systematic Biology
49: 369–381.
Simon MF, Grether R, Queiroz LP, Skema C,
Pennington RT, Hughes CE. 2009. Recent assembly of
the cerrado, a Neotropical plant diversity hotspot, by in situ
evolution of adaptations to fire. Proceedings of the National
Academy of Sciences of the United States of America 106:
20359–20364.
Souza AO, Lewis GP, Telles MPC, Silva MJ. 2019a. Phylogeny
and divergence time estimation of Chamaecrista ser. Rigidulae
(Leguminosae, Caesalpinioideae). Taxon 68: 20–33.
Souza AO, Lewis GP, Silva MJ. 2019b. Taxonomic synopsis
of the genus Chamaecrista (Leguminosae, Caesalpinioideae)
in the Chapada dos Veadeiros region, Goiás, Brazil. Phytotaxa
427: 131–185.
Souza AO, Silva MJ. 2020. Updated taxonomic circumscription
of Chamaecrista sect. Absus subsect. Absus series Rigidulae
(Leguminosae, Caesalpinioideae). Phytotaxa 462: 001–087.
Souza ER, Lewis GP, Forest F, Schnadelbach AS,
van den Berg C, Queiroz LP. 2013. Phylogeny of
Calliandra (Leguminosae: Mimosoideae) based on nuclear
and plastid molecular markers. Taxon 62: 1200–1219.
Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-
based phylogenetic analyses with thousands of taxa and
mixed models. Bioinformatics 22: 2688–2689.
Sun Y, Skinner DZ, Liang GH, Hulbert SH. 1994.
Phylogenetic analysis of Sorghum and related taxa using
internal transcribed spacers of nuclear ribosomal DNA.
Theoretical and Applied Genetics 89: 26–32.
Swofford DL. 2003. PAUP*: phylogenetic analysis using
parsimony (*and other methods), version 4.0. https://paup.
phylosolutions.com.
Taberlet P, Gielly L, Pautou G, Bouvet J. 1991.
Universal primers for amplification of three non-coding
regions of chloroplast DNA. Plant Molecular Biology 15:
1105–1109.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S.
2013. MEGA6: molecular evolutionary genetics analysis
version 6.0. Molecular Biology and Evolution 30: 2725–9.
Thiers B. 2020. Index herbariorum: a global directory of public
herbaria and associated staff. New York Botanical Garden’s
Virtual Herbarium. http://sweetgum.nybg.org/ih/.
Torres DC, Matos JP, Lima S, Fernandes AG, Nunes EP,
Grangeiro TB. 2011. Phylogenetic relationships
within Chamaecrista sect. Xerocalyx (Leguminosae,
Caesalpinioideae) inferred from the cpDNA trnE-trnT
intergenic spacer and nrDNA ITS sequences. Genetics and
Molecular Biology 34: 244–251.
Trovó M, Andrade MJG, Sano PT, Ribeiro PL, Berg C.
2013. Molecular phylogenetics and biogeography of
Neotropical Paepalanthoideae with emphasis on Brazilian
Paepalanthus (Eriocaulaceae). Botanical Journal of the
Linnean Society 171: 225–243.
Turland NJ, Wiersema JH, Barrie FR, Greuter W,
Hawksworth DL, Herendeen PS, Knapp S, Kusber W-
H, Li D-Z, Marhold K, Maio TW, McNeill J, Monro AM,
Prado J, Price MJ, Smith GF. 2018. International Code
of Nomenclature for algae, fungi, and plants (Shenzhen
Code). Glashütten: Regnum Vegetabile 159 Koeltz
Botanical Books.
Vaconcelos TNC, Alcantara S, Andrino CO, Forest F,
Reginato M, Simon MF, Pirani JR. 2020. Fast
diversification through a mosaic of evolutionary histories
characterizes the endemic flora of ancient Neotropical
mountains. Proceedings of the Royal Society B: Biological
Sciences 287: e20192933.
Wagner GJ. 1991. Secreting glandular trichomes: more than
just hairs. Plant Physiology 96: 675–679.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification
and direct sequencing of fungal ribosomal RNA genes
for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ,
White TJ, eds. PCR protocols: a guide to methods and
applications. New York: Academic Press, 315–322.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021

46 A. O. DE SOUZA ET AL.
© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, XX, 1–46
SUPPORTING INFORMATION
Additional Supportisng Information may be found in the online version of this article at the publisher's web-site:
Appendix S1. List of morphological characters and their encoded states used for the reconstruction of the
ancestral states.
Appendix S2. Morphological matrix with character states of each taxon (? = missing).
Appendix S3. Maximum likelihood tree from analysis of ITS in the Broad approach. Colours represent the
sections recognized in the new classification proposed in this study. Branch support is in bootstrap values.
Appendix S4. Maximum likelihood tree from analysis of trnL-F in the Broad approach. Colours represent the
sections recognized in the new classification proposed in this study. Branch support is in bootstrap values.
Appendix S5. Maximum likelihood tree from analysis of ETS in the Multilocus approach. Colours represent the
sections recognized in the new classification proposed in this study. Branch support is in bootstrap values.
Appendix S6. Maximum likelihood tree from analysis of trnE-T in the Multilocus approach. Colours represent
the sections recognized in the new classification proposed in this study. Branch support is in bootstrap values.
Appendix S7. Maximum likelihood tree from analysis of the indels of ITS in the Multilocus approach.
Colours represent the sections recognized in the new classification proposed in this study. Branch support is in
bootstrap values.
Appendix S8. Maximum likelihood tree from analysis of the indels of trnL-F in the Multilocus approach.
Colours represent the sections recognized in the new classification proposed in this study. Branch support is in
bootstrap values.
Appendix S9. Maximum likelihood tree from analysis of the indels of ETS in the Multilocus approach.
Colours represent the sections recognized in the new classification proposed in this study. Branch support is in
bootstrap values.
Appendix S10. Maximum likelihood tree from analysis of the indels of trnE-T in the Multilocus approach.
Colours represent the sections recognized in the new classification proposed in this study. Branch support is in
bootstrap values.
Appendix S11. Ancestral character reconstruction for selected morphological characters (1) and (2).
Appendix S12. Ancestral character reconstruction for selected morphological characters (3) and (4).
Appendix S13. Ancestral character reconstruction for selected morphological characters (5) and (6).
Appendix S14. Ancestral character reconstruction for selected morphological characters (7) and (8).
Appendix S15. Ancestral character reconstruction for selected morphological characters (9) and (10).
Appendix S16. Ancestral character reconstruction for selected morphological characters (11) and (12).
Appendix S17. Ancestral character reconstruction for selected morphological characters (13) and (14).
Appendix S18. Ancestral character reconstruction for selected morphological characters (15) and (16).
Appendix S19. Ancestral character reconstruction for selected morphological characters (17) and (18).
Appendix S20. Ancestral character reconstruction for selected morphological characters (19) and (20).
Appendix S21. Updated list of accepted binomials and infrageneric categories (sections and subsections) of
Chamaecrista proposed in the new classification presented in this study and their area of occurrence. The number
in square brackets indicates the updated number of species for each infrageneric taxon. Asterisks indicate extra-
American species that were placed in the section Chamaecrista for the first time.
Downloaded from https://academic.oup.com/botlinnean/advance-article/doi/10.1093/botlinnean/boab029/6287730 by alessandro341@hotmail.com on 29 May 2021