Pseudopestalotiopsis gilvanii sp. nov. And Neopestalotiopsis formicarum leaves spot pathogens from guarana plant: a new threat to global tropical hosts

Abstract

Pestalotioid species (Pestalotiopsis, Pseudopestalotiopsis and Neopestalotiopsis) cause extremely damaging diseases in a wide range of hosts across the word. Recently, pestalotioid strains isolated from damaged guarana leaf tissue were subject to morphological and molecular characterization. Six monosporic isolates were obtained and analysed based on the following conidial characters: length, width, septation, absence or presence of basal appendage, number and length of apical appendages. For phylogenetic inference, sequences of the Internal Transcribed Spacer region (ITS), partial sequences of the genes encoding the translation elongation factor 1-α (tef1-α) and β-tubulin (tub2) were used. Three out of six strains analysed were identified as Neopestalotiopsis formicarum, while the three other isolates are described here as a new species of Pseudopestalotiopsis, named Ps. gilvanii sp. nov.. The pathogenicity of N. formicarum and Ps. gilvanii were confirmed following Koch's postulate. Besides guarana, the potential of N. formicaram and Ps. gilvanii to cause diseases in other economically important tropical plants were investigated. Ps. gilvanii was pathogenic to açaí palms (Euterpe oleracea, E. precatoria), and oil palm (Elaeis guineensis), but not to banana (Musa paradisiaca var. pacovan) and rubber trees (Hevea brasiliensis). N. formicarum was not pathogenic to rubber trees but was pathogenic to other species tested. To our knowledge this is the first report of N. formicarum as a plant pathogen in the guarana plant, and Ps. gilvanii as novel plant pathogen capable of causing disease in important plant crops from tropical regions.

Full text

Phytotaxa 489 (2): 121–139
https://www.mapress.com/j/pt/
Copyright © 2021 Magnolia Press Article PHYTOTAXA
ISSN 1179-3155 (print edition)
ISSN 1179-3163 (online edition)
Accepted by Ruvishika Jayawardena: 31 Dec. 2020; published: 4 Mar. 2021
https://doi.org/10.11646/phytotaxa.489.2.2
121
Pseudopestalotiopsis gilvanii sp. nov. and Neopestalotiopsis formicarum leaves spot
pathogens from guarana plant: a new threat to global tropical hosts
GILVANA F. GUALBERTOa,e, ARICLÉIA DE M. CATARINOa,f, THIAGO F. SOUSAb,c,g, JEFERSON C. CRUZc,h,
ROGÉRIO E. HANADAa,i, FERNANDA F. CANIATOd,j & GILVAN F. SILVAc,k*
a Programa de Pós-Graduação em Agricultura no Trópico Úmido, INPA, Manaus, 69.060-001 Brasil.
b Department of Microbiology, Federal University of Viçosa (UFV), Viçosa 36570-900, Brazil.
c Embrapa Amazônia Ocidental, Manaus 69010-970, Brazil.
d Department of Fundamental Sciences and Agricultural Development, Faculty of Agricultural Sciences, Federal University of Amazonas
(UFAM), Manaus 69080-900, Brazil.
e
�
gilvanafigueira43@gmail.com; https://orcid.org/0000-0001-7124-8335
f
�
amoraescatarino@gmail.com; https://orcid.org/0000-0002-5579-8625
g
�
thiago-fernandes2@hotmail.com; http://orcid.org/0000-0002-7451-9839
h
�
jeferson.cruz@embrapa.br; https://orcid.org/0000-0002-7718-2127
i
�
rhanada.inpa@gmail.com; https://orcid.org/0000-0002-4544-4882
j
�
fernanda.f.caniato@gmail.com; https://orcid.org/0000-0001-7597-0587
k
�
gilvan.silva@embrapa.br; https://orcid.org/0000-0003-2828-8299
*Corresponding author:
�
gilvan.silva@embrapa.br
Abstract
Pestalotioid species (Pestalotiopsis, Pseudopestalotiopsis and Neopestalotiopsis) cause extremely damaging diseases
in a wide range of hosts across the word. Recently, pestalotioid strains isolated from damaged guarana leaf tissue were
subject to morphological and molecular characterization. Six monosporic isolates were obtained and analysed based on
the following conidial characters: length, width, septation, absence or presence of basal appendage, number and length of
apical appendages. For phylogenetic inference, sequences of the Internal Transcribed Spacer region (ITS), partial sequences
of the genes encoding the translation elongation factor 1-α (tef1-α) and β-tubulin (tub2) were used. Three out of six strains
analysed were identified as Neopestalotiopsis formicarum, while the three other isolates are described here as a new species
of Pseudopestalotiopsis, named Ps. gilvanii sp. nov.. The pathogenicity of N. formicarum and Ps. gilvanii were confirmed
following Koch’s postulate. Besides guarana, the potential of N. formicaram and Ps. gilvanii to cause diseases in other
economically important tropical plants were investigated. Ps. gilvanii was pathogenic to açaí palms (Euterpe oleracea, E.
precatoria), and oil palm (Elaeis guineensis), but not to banana (Musa paradisiaca var. pacovan) and rubber trees (Hevea
brasiliensis). N. formicarum was not pathogenic to rubber trees but was pathogenic to other species tested. To our knowledge
this is the first report of N. formicarum as a plant pathogen in the guarana plant, and Ps. gilvanii as novel plant pathogen
capable of causing disease in important plant crops from tropical regions.
Keywords: Pestalotiopsis-like, açaí palm, oil palm, banana, plant pathogen, and leaf spot
Introduction
The guarana plant [Paullinia cupana var. sorbilis, (Mart.) Ducke] is a native species of the Brazilian Amazon, whose
seeds possess therapeutics, medicinal and pharmacological properties as cytoprotective modulators of antioxidant
enzyme activities, anxiolytic, panicolytic, antibacterial and antineoplastic effects (Bonadiman et al. 2017; Carvalho et
al. 2016; Rangel et al. 2013; Silveira et al. 2018). Moreover, the high concentration of caffeine in guarana seeds make
them attractive to the beverage industry (Beaufort 2018).
Brazil is the only country where guarana is cultivated on a commercial scale, however, phytosanitary issues have
limited the yield of the guarana crop and its expansion, especially in the State of Amazonas, where climatic features
such as high humidity combined with high temperature, favors the proliferation of fungal diseases. Two main diseases
affecting guarana yield can be highlighted: oversprouting caused by Fusarium decemcellulare and anthracnose caused

GUALBERTO ET AL.
122 • Phytotaxa 489 (2) © 2021 Magnolia Press
by Colletotrichum guaranicola (Queiroz et al. 2020). Until now, C. guaranicola was the only known pathogen causing
anthracnose-like leaf spots in the guarana plant. However, during a survey conducted to anthracnose-like leaf spots in a
guarana field near the municipality of Manaus, two pathogens of the genus Neopestalotiopsis and Pseudopestalotiopsis,
were identified instead C. guaranicola, and were reported in the current study.
Pestalotiopsis (Steyaert, 1949) is a member of the family Amphisphaeriaceae. This genus comprises about 374
species (Index Fungorum; http://www.indexfungorum.org/Names/Names.asp). The morphology of conidia among
Pestalotiopsis has been described as fusiform, ellipsoid, straight or slightly curved, with five cells, containing three
brown median cells and two hyaline cells (apical and basal), with two or more apical appendages (Jeewon et al. 2002;
Maharachchikumbura et al. 2014). Even in 2003, combining characteristics of median cells with ITS region analysis,
the first evidence came up that members of Pestalotiopsis should not be considered a single taxon (Jeewon et al. 2003).
It was only in 2014 that taxonomic reorganization of the Pestalotiopsis was proposed by the adoption of multilocus
phylogeny of ITS, tub2 and tef1-α regions in combination with characteristics related to the morphology of conidia,
such as the color of median cells and conidiogenous cells. At that time, Neopestalotiopsis and Pseudopestalotiopsis
were introduced (Maharachchikumbura et al. 2014). Currently, 23 species of Pseudopestalotiopsis and 47 species of
Neopestalotiopsis have been reported (Index Fungorum).
Representative species of Pestalotiopsis, Pseudopestalotiopsis and Neopestalotiopsis, have been reported as
endophytic (Alade et al. 2018; Yu et al. 2020; Zhou et al. 2018), saprophytes (Costa & Gusmão 2015; Jeewon et al.
2013; Maharachchikumbura et al. 2014), and causal agents of disease, in the fruits and leaves of important economic
plants, such as Fragaria ananassa, Vitis vinifera, Euterpe oleracea, Camellia sinensis L., Eucalyptus spp., Hevea
brasiliensis, Mangifera indica, Camellia chrysantha (Ayoubi & Soleimani 2016; Jayawardena et al. 2016; Morales-
Rodríguez et al. 2019; Pornsuriya et al. 2020; Shu et al. 2020; Zhao et al. 2020) and other plant species, such as fishtail
palm (Caryota mitis), white heather (Erica arborea), and Bulbophyllum thouars (Catarino et al. 2020; Hlaiem et al.
2018; Wang et al. 2017).
In Camellia sinensis, species from three genera (Pseudopestalotiopsis camelliae-sinensis, Neopestalotiopsis
clavispora and Pestalotiopsis camelliae) were associated with gray blight symptoms (Chen et al. 2018). The pestalotioid
group (Pestalotiopsis, Pseudopestalotiopsis and Neopestalotiopsis) cause diseases in a wide range of hosts around the
world. However, despite its capability to cause losses in economically important crops, it has not yet been properly
recognized (Ayoubi & Pari 2016).
Although agronomic losses have been associated with diseases caused by pestalotioid species, their biotechnological
potential has also been described. Before taxonomic reformulation, a set of 135 compounds were reported in a review
focused in Pestalotiopsis, summarizing the main activities related to secondary metabolites as antiviral, antibacterial,
antifungal and antitumor activities (Xu et al. 2010). Recently eight new polyketides derived from Pseudopestalotiopsis
theae have been identified, some of them displaying activity against drug-resistant bacteria (Yu et al. 2020), in addition
to, compounds with cytotoxic and antimicrobial effects (Alade et al. 2018; Riga et al. 2019; Yuan et al. 2017).
Several other substances of medical and industrial importance have been isolated from pestalotioid fungi, such as
taxol (Kathiravan et al. 2014), furanones (Liu et al. 2012, chitin deacetylase (Cord-Landwehr et al. 2016), chlorinated
chromone and diphenyl ether derivatives (Klaiklay et al. 2012). Besides that, important environmental applications
have also been observed in pestalotioid fungi (Marzall-Pereira et al. 2019). Russell et al. (2011) described two
Pestalotiopsis microspora endophytic isolates with the ability to use polyurethane as their only carbon source, showing
the potential of this endophytic for bioremediation.
Recently, 13 new pestalotioid species were described: five Pseudopestalotiopsis, six Neopestalotiopsis and two
Pestalotiopsis (Norphanphoun et al. 2019; Tsai et al. 2020). Here we introduce Pseudopestalotiopsis gilvanii sp. nov.,
a new phytopathogenic species isolated from guarana plants, and the first report of Neopestalotiopsis formicarum as
a pathogen in the guarana plant. The host range was further evaluated on five important commercial crops of tropical
regions.
Material and methods
Isolation and culture conditions
Leaves showing irregular dark brown spots were sampled in guarana fields near the municipality of Manaus (2°53’28.
6” S 59°58’35. 6” W) and brought to the laboratory. The tissues were fragmented and surface sterilized with alcohol

NEW THREAT TO GLOBAL TROPICAL HOSTS Phytotaxa 489 (2) © 2021 Magnolia Press • 123
70% (v/v) for one minute, sodium hypochlorite 0.2% (v/v) for three minutes, and washed with sterilized distilled
water for three minutes. The fragmented leaves were then incubated in PDA medium (200 g L-1 potato, 15 g L-1 agar,
20 g L-1 dextrose and 100 mg L-1 chloramphenicol) at 25 °C for three days. The monosporic isolates obtained were
used for morphological and molecular characterization, as well as, pathogenicity assays. The isolates accessions were
registered at Sistema Nacional de Gestão do Patrimônio Genético e do Conhecimento Tradicional Associado (SisGen,
Brazil, Registration Nº A6FB8EF). The holotype and ex-type living cultures of the new species from this study were
deposited in the Microbiological Collections of the National Institute of Amazon Research (INPA).
FIGURE 1. Phylogenetic relationship in Pseudopestalotiopsis inferred with concatenated sequences of ITS, tub2 and
tef1-α, showing the placement Pseudopestalotiopsis gilvanii. The tree topology was generated by the ML analysis and
bootstrap values for maximum parsimony (MP), maximum likelihood (ML), and posterior probability (PP) analyses
are presented at the branches (MP/ML/PP). Isolates from this study are highlighted in blue.

GUALBERTO ET AL.
124 • Phytotaxa 489 (2) © 2021 Magnolia Press
FIGURE 2. Phylogenetic relationship in Neopestalotiopsis inferred with concatenated sequences of ITS, tub2 and tef1-
α. The tree topology was generated by the ML analysis and bootstrap values for maximum parsimony (MP), maximum
likelihood (ML), and posterior probability (PP) analyses are presented at the branches (MP/ML/PP). Isolates from this
study are highlighted in yellow.

NEW THREAT TO GLOBAL TROPICAL HOSTS Phytotaxa 489 (2) © 2021 Magnolia Press • 125
FIGURE 3. Pseudopestalotiopsis gilvanii (strain INPA 2913), aspects of colonies in PDA (A), aspects of conidia
(B) and scanning electron microscopy of conidia (C). Neopestalotiopsis formicarum (strain INPA 2916), aspects of
colonies in PDA (D), aspects of conidia (E) and scanning electron microscopy of conidia (F).

GUALBERTO ET AL.
126 • Phytotaxa 489 (2) © 2021 Magnolia Press
FIGURE 4. Nucleotides differences in the ITS, tef1-α and tub2 sequences of Pseudopestalotiopsis gilvanii and closely
related species. Ten nucleotides up and downstream to the nucleotide variation are in light green.
Morphology and morpho-cultural aspects of colonies
Each isolate was grown in PDA medium for 10 days when the following morphological variables of conidia were
taken: length (in µm), width (in µm), septation, absence or presence of basal appendage, number and length of apical
appendages (in µm). The pigment of the median cells was also recorded and classified neither as “concolor” if median
cells showed uniform pigmentation or “versicolor” if median cells showed non-uniform pigmentation. The appearance
of the colonies was classified according to their color and type of mycelium. For each isolate, one hundred conidia
were used to measure its length and width using Carl ZEISS Axio Imager v2.
Scanning electron microscopy (SEM) was used to fine examine the structures of the spores and inoculated leaves.
Samples of isolates grown in PDA medium and those obtained by inoculation of conidia in healthy guarana plants
were pre-fixed in 2.5% glutaraldehyde (9:1, v/v) for 2 hrs followed by dehydration in ethyl alcohol at concentrations
of 50%, 70%, 90%, 95%, and 100% (v/v) for 10 to 15 min, then placed in Critical Point Drying (Baltec-CPD-030) for
complete drying. Samples were assembled in the sample holder of the scanning electron microscope with double-sided
carbon tape and submitted to metalization with gold and visualized under a scanning electron microscope (Model 435,
VP Leo Electronics Systems, Cambridge, UK).
DNA extraction and PCR conditions
The monosporic isolates were grown in enriched PD medium (200 g L-1 potato extract, 10 g L-1 dextrose, 2 g L-1 yeast
extract, 2 g L-1 peptone, 1.5 g L-1 casein) to obtain the mycelial mass. The mycelial mass obtained was vacuum-filtered
and stored at -80 °C. Total DNA was isolated from approximately one gram of mycelial mass following the CTAB
method (Doyle & Doyle 1990). The DNA isolated was quantified using a spectrophotometer (ND-2000, NanoDrop
Technologies, Wilmington, DE, USA) and its integrity inspected in agarose gel 0.8% (m/v).
Primers that amplified fragments of encoding the translation elongation factor 1-α (tef1-α), β-tubulin (tub2) and
internal transcribed spacer (ITS) were used for phylogenetic analysis (Table 1). PCR amplifications were performed in
a final volume of 25 μl containing: 150 ng of the total DNA; 0.5 pmol of each primer; 1X reaction buffer (100 mM Tris-
HCl (pH 8.8 at 25 °C), 500 mM KCl, 0.8% (v/v) Nonidet P40); 2 mM MgCl2; 1 mM dNTPs and 1 U of Taq polymerase
(DNA Express). PCR amplifications consisted of initial denaturation at 94 °C for 3 min, 40 cycles of denaturation at
94 °C for 1 min, annealing according to each primer-specific temperature (Table 1) for 30 secs, elongation at 72 °C

NEW THREAT TO GLOBAL TROPICAL HOSTS Phytotaxa 489 (2) © 2021 Magnolia Press • 127
for 1 min and 30 secs. Final elongation was performed at 72 °C for 5 min. To confirm the amplification of the target
sequences, the PCR products were resolved in agarose gel 1.5 % (m/v), stained with ethidium bromide and then
photographed under UV light on a Molecular Imaging System (Loccus Biotecnologic L-Pix. Chemi) and compared
with a 1 kb ladder (Invitrogen).
FIGURE 5. Pathogenicity assay on guarana plants. Negative control showing absence of symptoms (A) and scanning
electron microscopy of control (B). Symptoms of leaf spot caused by Pseudopestalotiopsis gilvanii, strain INPA 2913
(C) and scanning electron microscopy of inoculated leaf showing conidia, red arrow (D). Symptoms of leaf spot caused
by Neopestalotiopsis formicarum, strain INPA 2016 (E) and scanning electron microscopy of inoculated leaf showing
conidia, red arrow (F), fall of the leaves caused by Ps. gilvanii (G) and N. formicarum (H).

GUALBERTO ET AL.
128 • Phytotaxa 489 (2) © 2021 Magnolia Press
FIGURE 6. Leaf spot symptoms on tropical plants inoculated with Pseudopestalotiopsis gilvanii and Neopestalotiopsis
formicarum, under greenhouse conditions. Presence of symptoms noticed on açaí palms (Euterpe oleraceae and E.
precatoria), oil palm (Elaeis guineenses). Banana (Musa paradisiaca) displayed symptoms for N. formicarum but not
for Ps. gilvanii. Absence of symptoms on rubber trees (Hevea brasiliensis). Uninoculated plants were employed as
control.

NEW THREAT TO GLOBAL TROPICAL HOSTS Phytotaxa 489 (2) © 2021 Magnolia Press • 129
TABLE 1. Characteristics of the primers used for phylogenetic analysis in this study.
Locus Primer/
Direction
Primer sequence 5’ to 3’ References AT Amplicon
Nuclear ITS 5.8S
and 18S partial
rDNA
ITS1/F
ITS4/R
TCCGTAGGTGAACCTGCGG
(White et al. 1990) 55 °C 600~
TCCTCCGCTTATTGATATGC
β-tubulin (tub2)
T1/F AACATGCGTGAGATTGTAAGT (O’Donnell & Cigelnik 1997)
57 °C 800~
Bt-2b/R ACCCTCAGTGTAGTGACCCTTGGC (Glass & Donaldson 1995)
Translation
elongation factor
1-α (tef1-α)
EF1-728/F CATCGAGAAGTTCGAGAAGG (Carbone & Kohn 1999)
54 °C 500~
EF-2/R GGA(G/A)GTACCAGT(G/C)ATCATGTT (O’Donnell et al. 1998)
Sequencing, Alignment and Phylogenetic analyzes
PCR products were treated with a 20% (m/v) polyethylene glycol solution (PEG) and then used for sequencing reactions
that were carried out in a final volume of 10 μl containing: 5 μl of purified PCR products, 2 μl of Big Dye v3.1 (Thermo
Fisher), 2 μl of 5X buffer (Applied Biosystems) and 3.2 pmol of each primer. Sequencing reactions proceeded at 96 °C
for 4 min, followed by 30 cycles at 96 °C for 10 sec, 50 °C for 5 sec and 60 °C for 4 min. Sequencing reactions were
analysed on a 3500 Genetic Analyzer Sequencer (Thermo Fisher).
Consensus sequences were obtained based on the alignment of both forward and reverse sequences using DNA
baser assembly software (http://www.dnabaser.com/). The new sequences obtained were deposited in GenBank (http://
www.ncbi.nlm.nih) under the accession numbers of Table 2.
TABLE 2. Species of Pseudopestiopsis and Neopestalotiopsis used for phylogenetic analyses in this study, strain number,
their host, country and GenBank accession numbers. Generated accessions are marked in bold.
Species Strain number Host Country ITS tub2 tef1-α
Ps. gilvanii INPA 2913 aPaullinia cupana Brazil MN385951 MN385957 MN385954
Ps. gilvanii INPA 2914 aPaullinia cupana Brazil MN385952 MN385958 MN385955
Ps. gilvanii INPA 2915 aPaullinia cupana Brazil MN385953 MN385959 MN385956
Ps. annellata NTUCC 17-030 Camellia sinensis Taiwan MT322087 MT321889 MT321988
Ps. annellata NTUCC 18-068 Camellia sinensis Taiwan MT322089 MT321891 MT321990
Ps. annellata NTUCC 18-069 Camellia sinensis Taiwan MT322090 MT321892 MT321991
Ps. annellata NTUCC 18-070 Camellia sinensis Taiwan MT322091 MT321893 MT321992
Ps. curvatispora MFLUCC 17-1722 Rhizophora mucronate Thailand MK764288 MK764354 MK764332
Ps. curvatispora MFLUCC 17-1723 Rhizophora mucronate Thailand MK764289 MK764355 MK764333
Ps. curvatispora MFLUCC 17-1747 Rhizophora mucronate Thailand MK764290 MK764356 MK764334
Ps. rhizophorae MFLUCC 17-1560 Rhizophora apiculate Thailand MK764291 MK764357 MK764335
Ps. thailandica MFLUCC 17-1724 Rhizophora mucronate Thailand MK764292 MK764358 MK764336
Ps. thailandica MFLUCC 17-1725 Rhizophora mucronate Thailand MK764293 MK764359 MK764337
Ps. ampullaceae LC6618 Camellia sinensis China KX895025 KX895358 KX895244
Ps. camelliae-sinesis LC3490 Camellia sinensis China KX894985 KX895316 KX895202
Ps. chinensis LC3011 Camellia sinensis China KX894937 KX895269 KX895154
Ps. cocos CBS 272.29 Cocos nucifera Java, Indonesia KM199378 KM199467 KM199553
Ps. dawaina MM14-F0015 Unknown Dawei, Myanmar LC324750 LC324751 LC324752
......continued on the next page

GUALBERTO ET AL.
130 • Phytotaxa 489 (2) © 2021 Magnolia Press
TABLE 2. (Continued)
Species Strain number Host Country ITS tub2 tef1-α
Ps. ignota NN 42909 Unknown - KU500020 - KU500016
Ps. indica CBS 459.78 Hibiscus rosa-sinensis - KM199381 KM199470 KM199560
Ps. ixorae NTUCC 17-001.1 Ixora sp. - MG816316 MG816326 MG816336
Ps. jiangxiensis LC4479 Eurya sp. China KX895034 KX895343 KX895229
Ps. kawthaungina MM14-F0083 Unknown Kawthaung,
Myanmar LC324753 LC324754 LC324755
Ps. kubahensis UMAS KUB-P20 Macaranga sp. Sarawak, Malaysia KT006749 - -
Ps. myanmarina NBRC 112264 Averrhoa carambola Dawei, Myanmar LC114025 LC114045 LC114065
Ps. simitheae MFLUCC 12-0121 Pandanus odoratissimus Thailand KJ503812 KJ503815 KJ503818
Ps. simitheae MFLUCC 12-0125 living leaves of Pandanus
odoratissimus Thailand KJ503813 KJ503816 KJ503819
Ps. taiwanensis NTUCC 17-002.1 Ixora sp. Taiwan MG816319 MG816329 MG816339
Ps. taiwanensis NTUCC 17-002.2 Ixora sp. Taiwan MG816320 MG816330 MG816340
Ps. taiwanensis NTUCC 17-002.3 Ixora sp. Taiwan MG816321 MG816331 MG816341
Ps. taiwanensis NTUCC 17-002.4 Ixora sp. Taiwan MG816322 MG816332 MG816342
Ps. theae MFLUCC 12-0055 Camellia sinensis Thailand JQ683727 JQ683711 JQ683743
Ps. vietnamensis NBRC 112252 Fragaria sp. Hue, Vietnam LC114034 LC114054 LC114074
N. formicarum INPA 2916 aPaullinia cupana Brazil MN267737 MN267740 MN313572
N. formicarum INPA 2917 aPaullinia cupana Brazil MN267738 MN267741 MN313573
N. formicarum INPA 2918 aPaullinia cupana Brazil MN267739 MN267742 MN313574
N. acrostichi MFLUCC 17-1754 Acrostichum aureum Thailand MK764272 MK764338 MK764316
N. acrostichi MFLUCC 17-1755 Acrostichum aureum Thailand MK764273 MK764339 MK764317
N. brachiata MFLUCC 17-1555 Rhizophora apiculata Thailand MK764274 MK764340 MK764318
N. petila MFLUCC 17-1738 Rhizophora mucronata Thailand MK764275 MK764341 MK764319
N. petila MFLUCC 17-1737 Rhizophora mucronata Thailand MK764276 MK764342 MK764320
N. rhizophorae MFLUCC 17-1550 Rhizophora mucronata Thailand MK764277 MK764343 MK764321
N. rhizophorae
N. sonneratae
MFLUCC 17-1551 Rhizophora mucronata Thailand MK764278 MK764344 MK764322
MFLUCC 17-1745 Sonneronata alba Thailand MK764279 MK764345 MK764323
N. sonneratae MFLUCC 17-1744 Sonneronata alba Thailand MK764280 MK764346 MK764324
N. thailandica MFLUCC 17-1730 Rhizophora mucronata Thailand MK764281 MK764347 MK764325
N. thailandica MFLUCC 17-1731 Rhizophora mucronata Thailand MK764282 MK764348 MK764326
N. alpapicalis MFLUCC 17-2544 Rhyzophora mucronata Thailand MK357772 MK463545 MK463547
N. alpapicalis MFLUCC 17-2545 symptomatic leaves R.
apiculate Thailand MK357773 MK463546 MK463548
N. aotearoa CBS 367.54 Canvas New Zealand KM199369 KM199454 KM199526
N. asiatica MFLUCC 12-0286 unidentified tree China JX398983 JX399018 JX399049
N. australis CBS 114159 Telopea sp. Australia KM199348 KM199432 KM199537
N. chrysea MFLUCC 12-0261 dead leaves China JX398985 JX399020 JX399051
N. clavispora MFLUCC 12-0281 Magnolia sp. China JX398979 JX399014 JX399045
N. cocoes MFLUCC 15-0152 Cocos nucifera Thailand NR_156312 - KX789689
N. coffea-arabicae HGUP4015 Coffea arabica China KF412647 KF412641 KF412644
N. cubana CBS 600.96 leaf litter Cuba KM199347 KM199438 KM199521
N. ellipsospora MFLUCC 12-0283 dead plant material China JX398980 JX399016 JX399047
N. egyptiaca CBS 140162 Mangifera indica Egypt KP943747 KP943746 KP943748
N. eucalypticola CBS 264.37 Eucalyptus globulus - KM199376 KM199431 KM199551
......continued on the next page

NEW THREAT TO GLOBAL TROPICAL HOSTS Phytotaxa 489 (2) © 2021 Magnolia Press • 131
TABLE 2. (Continued)
Species Strain number Host Country ITS tub2 tef1-α
N. foedans CGMCC 3.9123 unidentified mangrove
plant China JX398987 JX399022 JX399053
N. formicarum CBS 362.72 dead ant Ghana KM199358 KM199455 KM199517
N. formicarum CBS 115.83 Plant debris Cuba KM199344 KM199444 KM199519
N. formicarum PSU-R-L02 Hevea brasiliensis Thailand:
Narathiwat LC521861 LC521875 LC521869
N. formicarum PSU-T-L01 Hevea brasiliensis Thailand:
Narathiwat LC521858 LC521879 LC521873
N. formicarum PSU-T-L02 Hevea brasiliensis Thailand:
Narathiwat LC521859 LC521876 LC521870
N. formicarum PSU-T-L05 Hevea brasiliensis Thailand:
Narathiwat LC521856 LC521877 LC521871
N. honoluluana CBS 114495 Telopea sp. USA KM199364 KM199457 KM199548
N. iraniensis CBS 137768 Fragaria × ananassa Iran KM074048 KM074057 KM074051
N. javaensis CBS 257.31 Cocos nucifera Indonesia KM199357 KM199457 KM199548
N. keteleeria MFLUCC 13-0915 living leaves of Keteleeria
pubescens China KJ503820 KJ503821 KJ503822
N. magna MFLUCC 12-0652 Pteridium sp. France KF582795 KF582793 KF582791
N. mesopotamica CBS 336.86 Pinus brutia Iraq KM199362 KM199441 KM199555
N. musae MFLUCC 15-0776 Musa sp. Thailand NR_156311 KX789686 KX789685
N. natalensis CBS 138.41 Acacia mollissima South Africa NR_156288 KM199466 KM199552
N. piceana CBS 394.48 Picea sp. UK KM199368 KM199453 KM199527
N. piceana CBS 254.32 Cocos nucifera Indonesia KM199372 KM199452 KM199529
N. piceana CBS 225.3 Mangifera indica - KM199371 KM199451 KM199535
N. protearum CBS 114178 Leucospermum
cuneiforme cv. “Sunbird” Zimbabwe JN712498 KM199463 KM199542
N. protearum CMM1357 - - KY549597 KY549632 KY549594
N. rosae CBS 101057 Rosa sp. New Zealand KM199359 KM199429 KM199523
N. rosicola CFCC 51992 Rosa chinensis China KY885239 KY885245 KY885243
N. rosicola CFCC 51993 Rosa chinensis China KY885240 KY885246 KY885244
N. samarangensis MFLUCC 12-0233 Syzygium samarangense Thailand JQ968609 JQ968610 JQ968611
N. saprophytica MFLUCC 12-0282 Magnolia sp. China KM199345 KM199433 KM199538
N. steyaertii IMI 192475 Eucalyptus viminalis Australia KF582796 KF582794 KF582792
N. surinamensis CBS 450.74 soil under Elaeis
guineensis Suriname KM199351 KM199465 KM199518
N. umbrinospora MFLUCC 12-0285 unidentified plant China JX398984 JX399019 JX399050
N. vitis MFLUCC 15-1265 Vitis vinifera cv. “Summer
black” China KU140694 KU140685 KU140676
N. zimbabwana CBS 111495 Leucospermum
cunciforme cv. “Sunbird” Zimbabwe JX556231 KM199456 KM199545
a INPA—National Institute of Amazon Research.
The phylogenetic inference in Pseudopestalotiopsis was performed using the new sequences generated in
the current study with sequences uploaded from NCBI (http: //www.ncbi.nlm.nih) of the other 20 members of the
Pseudopestalotiopsis genus. The sequences of Neopestalotiopsis formicarum were used as outgroup. The phylogenetic
inference in Neopestalotiopsis was conducted with sequences uploaded from NCBI (http: //www.ncbi.nlm.nih) of 38
members of the genus, the new sequences generated in the current study and sequences of Pestalotiopsis diversiseta

GUALBERTO ET AL.
132 • Phytotaxa 489 (2) © 2021 Magnolia Press
as outgroup. For each locus, sequences were aligned using the MUSCLE algorithm and manually edited. Phylogenetic
analysis was performed using concatenated sequences of the three loci (ITS, tub2 and tef1-α) using maximum likelihood
(ML), maximum parsimony (MP) and Bayesian inference (BI). For ML, a Tamura-Nei model with distributed Range
(G) rates was adopted, while for MP a cut-off limit of 95% was established, and a nonparametric bootstrap was done
with 1000 replicates. Both ML and MP were performed using MEGA 7 (Kumar et al. 2016). BI was based on the
model tested by PAUP*4 and Mrmodeltest2 v2 (Nylander 2004). All sites sequenced at the ITS, tub2 and tef1-α were
considered, and the analysis was run for ten million generations, with the first 25% of trees discarded as burn-in, using
the MrBayes v 3.6 tool available at CIPRES (https://www.phylo.org/). Posteriori probability (PP) and tree topology
were visualized with Figtree v 1.3.1 (Rambaut 2009).
Pathogenicity in guarana plant and other economically important hosts
Pathogenicity assay was conducted in four-year-old guarana plants under field conditions. Conidial suspension of the
strains: INPA 2913, INPA 2914, INPA 2915, INPA 2916, INPA 2917 and INPA 2918 were prepared using a concentration
of 1 × 106 conidia/mL. Conidial suspensions were sprayed on leaves of guarana plants previously injured by needles.
Uninoculated guarana plants sprayed with sterile distilled water served as the negative control. The pathogenicity
assays were conducted in triplicate. Three to four days after spraying, and based on a set of symptoms, re-isolation was
performed and pathogenicity was verified by fulfillment of Koch’s postulate.
Subsequently, a pathogenicity assay with the same six strains was also performed with a broad range of economically
important tropical hosts, under greenhouse conditions. Inoculation was performed on seedlings of açaí palms (Euterpe
oleracea Mart. and E. precatoria Mart.), oil palm plants (Elaeis guineensis Jacq.), banana (Musa paradisiaca var.
pavocan) and rubber trees (Hevea brasiliensis). The pathogenicity assay was conducted as the one performed on
the guarana plants. Uninoculated plants sprayed with sterile distilled water served as negative control while guarana
plants were used as a positive control to confirm the viability of the inoculum. The pathogenicity assay was conducted
in triplicate. Two to seven days after spraying, and based on a set of symptoms, re-isolation was performed, and
pathogenicity was verified by fulfillment of Koch’s postulate. The greenhouse experiments were repeated under the
same conditions, to confirm the results.
Results
Phylogenetic analyses
The alignment of concatenated sequences of ITS, tub2 and tef1-α loci used for phylogenetic inference in
Pseudopestalotiopsis, consisted of sequences of the 20 Pseudopestalotiopsis species, sequences of three new strains
(INPA 2913, INPA 2914 and INPA 2915) isolated from the guarana plant, and sequences of the outgroup N. formicarum
(Table 2). The resulting dataset consisted of 1865 characters (ITS: 536, tub2: 812 and tef1-α: 517) including gaps. For
tef1-α, the best fitting model selected by AIC in MrModeltest2 was GTR+I+G, while for ITS and tub2, the model
HKY+G was selected. The phylogenetic tree of the new strains of Pseudopestalotiopsis (INPA 2913, INPA 2914
and INPA 2915) was placed in the clade containing three species: Ps. thailandica, Ps. rhizophorae and Ps. simitheae
(Figure 1).
For the phylogenetic inference in Neopestalotiopsis, alignment of the concatenated sequences of ITS, tub2 and
tef1-α loci, were performed with sequences of the 38 members. The three new strains (INPA 2916, INPA 2917 and INPA
2918) isolated from the guarana plant, were identified as N. formicarum (Figure 2). The resulting dataset comprises
1604 characters (ITS: 452, tub2: 785 and tef1-α: 367) including gaps. For ITS, the best fitting model selected by AIC
in MrModeltest2 was GTR+G, while HKY+G for tub2 and tef1-α.
Taxonomy and Morphology
Pseudopestalotiopsis gilvanii INPA 2913 Silva, Gilvan F.; Gualberto, Gilvana F.; Catarino, Aricleia M., Fernandes,
Thiago S., sp. nov. MycoBank: MB837806

NEW THREAT TO GLOBAL TROPICAL HOSTS Phytotaxa 489 (2) © 2021 Magnolia Press • 133
TABLE 3. Morphological characteristics of the strains of Pseudopestalotiopsis gilvanii and Neopestalotiopsis formicarum of this study and description of others known pestalotioid
species.
Species Conidium size (µm) Apical appendage Basal
appendage
Colony morphology References
N° Length (µm) Top color Reverse
Pseudopestalotiopsis dawaina 22–31 x 8–9.5 3 20.5–33.5 Present Whitish to pinkish Dark brown (Nozawa et al. 2018)
Ps. dawaina INPA 2909 20.4–28.3 x 5.4–9.5 2–3 17.5–32.6 Present Whitish to pinkish White to dark brown (Catarino et al. 2020)
Ps. dawaina INPA 2912 20–30 x 6.2–7.9 2–3 17.9–29.3 Present White White to dark brown (Catarino et al. 2020)
Ps. simitheae 22–30 x 5–6.5 2–4 14.5–26.5 Present White Orange (Song et al. 2014)
Ps. rhizophorae 22–25 x 6.5–7 1–2 20–29 Present White White (Maharachchikumbura et al. 2014)
Ps. thailandica 24.5–30 x 5.5–6 1–3 28–36 Present White White (Maharachchikumbura et al. 2014)
Ps. gilvanii INPA 2913 24–34.3 x 4.6–7.3 2–5 14.8–39.9 Present White White Present study
Ps. gilvanii INPA 2914 21.2–32.9 x 5–7.5 2–5 14.9–40.9 Present White White Present study
Ps. gilvanii INPA 2915 24.2–32.6 x 4.7–7 2–5 15–40.8 Present White White Present study
Neopestalotiopsis formicarum 21–28 x 7.5–9.5 2–3 23–33 Present Whitish to pale honey Whitish to pale honey (Maharachchikumbura et al. 2014)
N. formicarum INPA 2916 19.7–27.8 x 5.5–7.5 2–3 10–23.7 Present Whitish to pale honey Whitish to pale honey Present study
N. formicarum INPA 2917 18.8–28.9 x 5–7 2–3 21.4–23.2 Present White White Present study
N. formicarum INPA 2918 22–30 x 5–6.5 2–3 17.1–28.1 Present White White Present study

GUALBERTO ET AL.
134 • Phytotaxa 489 (2) © 2021 Magnolia Press
Etymology: Refers to the first name of the author who designed this study.
Holotype: INPA 2913
Pycnidial conidiomata on PDA, fusiform, ellipsoid or straight. Concolourous conidia measuring 24.02–34.28 ×
4.63–7.35 µm, 3–5 septa and 2–5 appendages of 14.86–39.92 µm long (Table 3; Figure 3A–C). This strain differs from
Ps. simitheae by tef1-α (9-bp) and tub2 (27 bp) sequence data (Figure 4).
Culture characteristics: Colonies on PDA with 95 mm of diameter after 7 days at a room temperature of ± 25 °C.
Coloration: white with cottony and vigorous aerial mycelium. Numerous black pycnidia in the center of the colony of
reverse white with black dots (Table 3; Figure 3A).
Material examined: Brazil, Amazonas State, Manaus, on leaves of guarana plants (Paullinia cupana var. sorbilis),
11 Sep. 2017, G. F. Gualberto, INPA 2913 (holotype), ex-type living culture (INPA 2013).
Neopestalotiopsis formicarum S.S.N. Maharachchikumbura, K.D. Hyde & P.W. Crous, Studies in Mycology 79:
121. 2104
Conidia comprise five cells (19.7–27.8 × 5.5–7.5 µm) with 3–5 septa and 2–3 appendages (10–23.7 µm). The
colony was whitish to pale honey, vigorous and cottony mycelium. Median cell was versicolor with staining ranging
from olive brown to dark brown. Intense conidia production in PDA medium was also observed by SEM (Table 3,
Figure 3D–F).
Material examined: Brazil, Amazonas State, Manaus, on leaves of guarana plants (Paullinia cupana var. sorbilis),
11 Sep. 2017, G. F. Gualberto, ex-type culture (INPA 2916).
Pathogenicity in guarana plant and other economically important hosts
Leaves of guarana plants inoculated with isolates of Ps. gilvanii and N. formicarum developed necrotic spots within
3–4 days after inoculation (Figure 5C and 5E). The necrosis expands to the foliar limb causing the fall of the leaves
(Figure 5G–H). Control remains asymptomatic (Figure 5A-B). Once the pathogenicity assay was conducted under
field conditions and due to the similarity between anthracnose symptoms caused by C. guaranicola, and leaf spot
symptoms caused by pestalotioid fungi, scanning electron microscopy was adopted, which detected only the presence
of conidia of Ps. gilvanii and N. formicarum (Figure 5D and 5F). The Koch’s postulate was completed by re-isolation
from inoculated guarana plant leaves.
The necrotic spot symptoms observed in guarana leaves were reproduced in açaí palms (E. oleracea and E.
precatoria) and oil palm (E. guineensis). In banana (M. paradisiaca var. pacovan), the necrotic spot symptoms were
observed after inoculation with N. formicarum, while the absence of symptoms was observed after inoculation with
Ps. gilvanii. In rubber trees (H. brasiliensis), the absence of symptoms was also observed after inoculation with Ps.
gilvanii and N. formicarum (Figure 6). To confirm the pathogenicity of the fungal species in these crops, we re-isolated
from the observed symptoms, concluding all stages of Koch’s postulate. The results are summarized in Table 4.
TABLE 4. Summary of pathogenicity of Pseudopestalotiopsis gilvanii and Neopestalotiopsis formicarum for six tropical
plant species.
Botanical species
Fungal species
Pseudopestalotiopsis gilvanii Neopestalotiopsis formicarum
Symptoms
Paullinia cupana + +
Euterpe oleraceae + +
Euterpe precatoria + +
Elaeis guineenses + +
Musa paradisiaca - +
Hevea brasiliensis - -

NEW THREAT TO GLOBAL TROPICAL HOSTS Phytotaxa 489 (2) © 2021 Magnolia Press • 135
Discussion
After six years of taxonomy restructuring of pestalotioid fungi by Maharachchikumbura et al. (2014), the number of
species in Pseudopestalotiopsis increased from 3 to 22 (http://www.indexfungorum.org/). In the present study, six fungal
isolates obtained from necrotic spots on guarana leaves were identified with combine morphological examination and
multi-locus phylogenetic analysis of ITS, tub2 and tef1-α regions. The three strains (INPA 2913, INPA 2914 and INPA
2915) were proposed as a new species named Pseudopestalotiopsis gilvanii and the other three strains (INPA 2916,
INPA 2917 and INPA 2918) were identified as N. formicarum. Phylogenetic inference in Pseudopestalotiopsis placed
Ps. gilvanii basal to a clade composed by Ps. thailandica, Ps. rhizophorae and Ps. simitheae. The differences between
the nucleotides of Ps. gilvanii and Ps. thailandica (ITS: 1.43%, tub2: 4.26% and tef1-α: 2.16%); Ps. gilvanii and Ps.
simitheae (ITS: 0.82%, tub2: 3.4% and tef1-α: 1.74%); Ps. gilvanii and Ps. rhizophorae (ITS: 0.37%, tub2: 3.06% and
tef1-α: 1.55%) supported Ps. gilvanii as a new taxon, as recommended by Jeewon & Hyde (2016). Further, Ps. gilvanii
can also be differentiated from Ps. thailandica, Ps. simitheae and Ps. rhizophorae by longer conidium length, higher
number of apical appendage (Table 3) and by outstanding nucleotide differences in tub2, only one out of 28 nucleotides
were shared by the closely related Ps. gilvanii and Ps. simitheae.
Six strains of N. formicarum have been reported to date (Maharachchikumbura et al. 2014; Pornsuriya et al.
2020). The four most recently described as N. formicarum were isolated from rubber trees in Thailand (Pornsuriya et
al. 2020). These strains formed a clade related to N. formicarum (CBS 362.72 and CBS 115.83), but with low bootstrap
support. The addition of the new strains from the current study better resolved the N. formicarum clade compared to
the phylogenetic tree previously reported (Pornsuriya et al. 2020). Our isolates clustered with CBS 362.72 and CBS
115.83, while the ones obtained from rubber trees formed a distinct clade, suggesting that the Thailand isolates may
be a new species. This hypothesis is also reinforced by contrasting results related to pathogenicity between isolates
identified as N. formicarum in Thailand and Brazil. The ones from Thailand were pathogenic to rubber trees while the
ones from Brazil were not.
The N. formicarum species has so far been reported as a saprophyte on plant debris and dead ants
(Maharachchikumbura et al. 2014). Here, we presented N. formicarum as a broad-spectrum plant pathogen, able
to cause leaf spots on guarana plant, açai palms (E. oleraceae and E. precatoria), banana and oil palm. Switching,
from saprophytic to pathogenic lifestyle, has been reported among other saprophytic species revealing emergent plant
pathogens with a potential impact on crop production (Fisher et al. 2012; Fones & Gurr 2017; Karim et al. 2016). Our
study on pestalotioid fungi shows plant pathogens that could decrease crop production due to a severe set of symptoms,
starting with necrotic spots and progressing to defoliation, as observed in guarana plant (Figure 5G-H). Therefore,
identification and characterization of new plant pathogens are crucial to the establishment of an efficient disease-
management strategy.
The tropical crops evaluated here already suffer from diseases caused by other fungi. Decades have been spent on
research to mitigate their impact, by the development of disease-management plans, and breeding to improve pathogen
resistance. The well-known threats to the banana are Fusarium oxysporum f. sp. cubense (Foc), which causes Fusarium
wilt and Pseudocercospora fijiensis, which cause black Sigatoka (Chen et al. 2019; Churchill 2011). Açaí palms are
attacked by the Colletotrichum species (Castro et al. 2017), while the oil palm is attacked by Ganoderma boninense,
Curvularia oryzae and Phytophthora palmivora (Chong et al. 2017; Sunpapao et al. 2014; Torres et al. 2016).
The main guarana plant pathogens are C. guaranicola and F. decemcellulare (Queiroz et al. 2020) and the Brazilian
breeding program has worked with released cultivars, resistant to them. However, the pestalotioid fungi reported here
were isolated from guarana clones improved for yield and resistance, thus making them the newest risk to guarana
plant production in Brazil and efforts must be taken to prevent the disease from spreading to other guarana growing
locations.
The multi-host ability of Ps. gilvanii and N. formicarum demonstrates the potential risk to important tropical
crops. The understanding of molecular mechanisms of pathogenicity and virulence are critical to the development of
disease control strategies. Our research team is currently working on the whole genome sequence analysis to provide
new insight into the molecular mechanisms of virulence and pathogenicity in pestalotioid fungi described here.

GUALBERTO ET AL.
136 • Phytotaxa 489 (2) © 2021 Magnolia Press
Acknowledgment
This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—Brasil
(CAPES)—Finance Code (88887.200468/2018-00)—PROCAD/AmazonMicro, Amazonas State Research Foundation
(FAPEAM)—Amazonas Estratégico and National Council for Scientific and Technological Development (CNPq).
AMC thank the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—CAPES for a scholarship. The
authors thank Dr. Ricardo Lopes, Dr. Ewerton Rabelo Cordeiro and Dr. Firmino José do Nascimento Filho of Embrapa
Amazônia Ocidental for the supply of seedlings of palm, rubber and guarana trees. The authors also wish to thank José
Wilson dos Santos Meirelles, Lucas Castanhola Dias and Jackieline Souza Veras Lima of National Institute of Amazon
Research for their support on Scanning Electron Microscopy analysis.
References
Alade, G.O., Moody, J.O., Bakare, A.G., Awotona, O.R., Adesanya, S., Lai, D., Debbab, A. & Proksch, P. (2018) Metabolites from
endophytic fungus; Pestalotiopsis clavispora isolated from Phoenix reclinata leaf. Future Journal of Pharmaceutical Sciences 4:
273–275.
https://doi.org/10.1016/j.fjps.2018.10.001
Ayoubi, N. & Pari, S.S. (2016) Morphological and molecular identification of Neopestalotiopsis mesopotamica causing tomato fruit rot.
Journal of Plant Diseases and Protection 123: 267–271.
https://doi.org/10.1007/s41348-016-0042-z
Ayoubi, N. & Soleimani, M.J. (2016) Strawberry fruit rot caused by Neopestalotiopsis iranensis sp. nov., and N. mesopotamica. Current
Microbiology 72: 329–336.
https://doi.org/10.1007/s00284-015-0955-y
Beaufort, B. (2018) La mercatique transatlantique d’un végétal psychoactif, le guaraná, entre remède et alimente (1840-1921). Confins
35: 1–25.
https://doi.org/10.4000/confins.13215
Bonadiman, B. da S.R., Cadoná, F.C., Assmann, C.E., Weis, G.C.C., Alves, A. de O., Duarte, M.F., Chaves, C.M., Chaves, C. do C., Motta,
K.M. dos S., Ribeiro, E.E., Bagatini, M.D. & Cruz, I.B.M. (2017) Guarana (Paullinia cupana): Cytoprotective effects on age-related
eye dysfunction. Journal of Functional Foods 36: 375–386.
https://doi.org/10.1016/j.jff.2017.07.027
Carbone, I. & Kohn, L.M. (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91:
553–556.
https://doi.org/10.1080/00275514.1999.12061051
Carvalho, L.V. do N., Cordeiro, M.F., Line e Lins, T.U., Sampaio, M.C.P.D., Mello, G.S.V. de, Costa, V. de C.M., Marques, L.L.M., Klein,
T., Mello, J.C.P. de, Cavalcanti, I.M.F., Pitta, I. da R., Pitta, M.G. da R. & Rêgo, M.J.B. de M. (2016) Evaluation of antibacterial,
antineoplastic, and immunomodulatory activity of Paullinia cupana seeds crude extract and ethyl-acetate fraction. Evidence-Based
Complementary and Alternative Medicine 2016: 1–7.
https://doi.org/10.1155/2016/1203274
Castro, G.L.S., Júnior, D.D.S., Bueno, A.C.S.O., Silva, G.B. & Silva, G.B. (2017) Anthracnose in açaí palm leaves reduces leaf gas
exchange and chlorophyll a fluorescence. Tropical Plant Pathology 42: 13–20.
https://doi.org/10.1007/s40858-016-0118-0
Catarino, A. de M., Hanada, R.E., Queiroz, C.A. de, Sousa, T.F., Lima, Í.N., Gasparotto, L. & Silva, G.F. da (2020) First report of
Pseudopestalotiopsis dawaina causing spots in Caryota mitis in Brazil. Plant Disease 104: 989.
https://doi.org/10.1094/PDIS-08-19-1771-PDN
Chen, A., Sun, J., Matthews, A., Armas-Egas, L., Chen, N., Hamill, S., Mintoff, S., Tran-Nguyen, L.T.T., Batley, J. & Aitken, E.A.B.
(2019) Assessing variations in host resistance to Fusarium oxysporum f sp. cubense Race 4 in Musa species, with a focus on the
subtropical Race 4. Frontiers in Microbiology 10: 1–13.
https://doi.org/10.3389/fmicb.2019.01062
Chen, Y., Zeng, L., Shu, N., Jiang, M., Wang, H., Huang, Y. & Tong, H. (2018) Pestalotiopsis-like species causing gray blight disease on
Camellia sinensis in China. Plant Disease 102: 98–106.
https://doi.org/10.1094/PDIS-05-17-0642-RE

NEW THREAT TO GLOBAL TROPICAL HOSTS Phytotaxa 489 (2) © 2021 Magnolia Press • 137
Chong, K.P., Dayou, J. & Alexander, A. (2017) Detection and control of Ganoderma boninense in oil palm crop. SpringerBriefs in
Agriculture, pp. 5–13.
https://doi.org/10.1007/978-3-319-54969-9_2
Churchill, A.C.L. (2011) Pathogen profile Mycosphaerella fijiensis,, the black leaf streak pathogen of banana: progress towards
understanding pathogen biology and detection, disease development, and the challenges of control. Molecular Plant Pathology 12:
307–328.
https://doi.org/10.1111/j.1364-3703.2010.00672.x
Cord-Landwehr, S., Melcher, R.L.J., Kolkenbrock, S. & Moerschbacher, B.M. (2016) A chitin deacetylase from the endophytic fungus
Pestalotiopsis sp. efficiently inactivates the elicitor activity of chitin oligomers in rice cells. Scientific Reports 6: 1–11.
https://doi.org/10.1038/srep38018
Costa, L.A. & Gusmão, L.F.P. (2015) Characterization saprobic fungi on leaf litter of two species of trees in the Atlantic Forest, Brazil.
Brazilian Journal of Microbiology 46: 1027–1035.
https://doi.org/10.1590/S1517-838246420140548
Doyle, J. & Doyle, J. (1990) Isolation of plant DNA from fresh tissue. Focus 12: 13–15.
https://doi.org/10.2307/2419362
Fisher, M.C., Henk, D.A., Briggs, C.J., Brownstein, J.S., Madoff, L.C., McCraw, S.L. & Gurr, S.J. (2012) Emerging fungal threats to
animal, plant and ecosystem health. Nature 484: 186–194.
https://doi.org/10.1038/nature10947
Fones, H.N. & Gurr, S.J. (2017) NOXious gases and the unpredictability of emerging plant pathogens under climate change. BMC Biology
15: 1–9.
https://doi.org/10.1186/s12915-017-0376-4
Glass, N.L. & Donaldson, G.C. (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from
filamentous ascomycetes. Applied and Environmental Microbiology 61: 1323–1330.
https://doi.org/10.1128/AEM.61.4.1323-1330.1995
Hlaiem, S., Zouaoui-boutiti, M., Lahbib, M., Jemâa, B., Carthage, U. De, Karray, R.H., Rocca, G. Della, Barberini, S., Danti, R., Ipsp-
cnr, P.P. & Madonna, V. (2018) Identification and pathogenicity of Pestalotiopsis chamaeropis, causal agent of white heather (Erica
arborea) dieback, and in vitro biocontrol with the antagonist Trichoderma sp . Tunisian Journal of Plant Protection 13: 49–60.
Jayawardena, R.S., Liu, M., Maharachchikumbura, S.S.N., Zhang, W., Xing, Q., Hyde, K.D., Nilthong, S., Li, X. & Yan, J. (2016)
Neopestalotiopsis vitis sp. nov. causing grapevine leaf spot in China. Phytotaxa 258: 63–74.
https://doi.org/10.11646/phytotaxa.258.1.4
Jeewon, R. & Hyde, K.D. (2016) Establishing species boundaries and new taxa among fungi: Recommendations to resolve taxonomic
ambiguities. Mycosphere 7: 1669–1677.
https://doi.org/10.5943/mycosphere/7/11/4
Jeewon, R., Ittoo, J., Mahadeb, D., Jaufeerally-Fakim, Y., Wang, H.-K. & Liu, A.-R. (2013) DNA based identification and phylogenetic
characterisation of endophytic and saprobic fungi from Antidesma madagascariense, a medicinal plant in Mauritius. Journal of
Mycology 2013: 1–10.
https://doi.org/10.1155/2013/781914
Jeewon, R., Liew, E.C.Y. & Hyde, K.D. (2002) Phylogenetic relationships of Pestalotiopsis and allied genera inferred from ribosomal
DNA sequences and morphological characters. Molecular Phylogenetics and Evolution 25: 378–392.
https://doi.org/10.1016/S1055-7903(02)00422-0
Jeewon, R., Liew, E.C.Y., Simpson, J.A., Hodgkiss, I.J. & Hyde, K.D. (2003) Phylogenetic significance of morphological characters in the
taxonomy of Pestalotiopsis species. Molecular Phylogenetics and Evolution 27: 372–383.
https://doi.org/10.1016/S1055-7903(03)00010-1
Karim, N.F.A., Mohd, M., Nor, N.M.I.M. & Zakaria, L. (2016) Saprophytic and potentially pathogenic Fusarium species from peat soil in
perak and pahang. Tropical Life Sciences Research 27: 1–20.
Kathiravan, G., Sri Raman, V., Rajangam, B. & Rajasekar, A. (2014) Infra-red spectral analysis of taxol produced by different species of
Pestalotiopsis. Journal of Analytical & Bioanalytical Techniques 5: 1–9.
https://doi.org/10.4172/2155-9872.1000205
Klaiklay, S., Rukachaisirikul, V., Tadpetch, K., Sukpondma, Y., Phongpaichit, S., Buatong, J. & Sakayaroj, J. (2012) Chlorinated chromone
and diphenyl ether derivatives from the mangrove-derived fungus Pestalotiopsis sp. PSU-MA69. Tetrahedron 68: 2299–2305.
https://doi.org/10.1016/j.tet.2012.01.041
Kumar, S., Stecher, G. & Tamura, K. (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular
biology and evolution 33: 1870–1874.
https://doi.org/10.1093/molbev/msw054

GUALBERTO ET AL.
138 • Phytotaxa 489 (2) © 2021 Magnolia Press
Liu, H., Liu, S., Guo, L., Zhang, Y., Cui, L. & Ding, G. (2012) New furanones from the plant endophytic fungus Pestalotiopsis besseyi.
Molecules 17: 14015–14021.
https://doi.org/10.3390/molecules171214015
Maharachchikumbura, S.S.N., Hyde, K.D., Groenewald, J.Z., Xu, J. & Crous, P.W. (2014) Pestalotiopsis revisited. Studies in Mycology
79: 121–186.
https://doi.org/10.1016/j.simyco.2014.09.005
Marzall-Pereira, M., Savi, D.C., Bruscato, E.C., Niebisch, C.H., Paba, J., Aluízio, R., Ferreira-Maba, L.S., Galli-Terasawa, L.V., Glienke,
C. & Kava, V. (2019) Neopestalotiopsis species presenting wide dye destaining activity: report of a mycelium-associated laccase.
Microbiological Research 228: 126299.
https://doi.org/10.1016/j.micres.2019.126299
Morales-Rodríguez, C., Dalla Valle, M., Aleandri, M.P. & Vannini, A. (2019) Pestalotiopsis biciliata, a new leaf pathogen of Eucalyptus,
spp. recorded in Italy. Forest Pathology 49: 1–7.
https://doi.org/10.1111/efp.12492
Norphanphoun, C., Jayawardena, R.S., Chen, Y., Wen, T.C., Meepol, W. & Hyde, K.D. (2019) Morphological and phylogenetic
characterization of novel pestalotioid species associated with mangroves in Thailand. Mycosphere 10: 531–578.
https://doi.org/10.5943/mycosphere/10/1/9
Nozawa, S., Ando, K., Phay, N. & Watanabe, K. (2018) Pseudopestalotiopsis dawaina sp. nov. and Ps. kawthaungina sp. nov.: two new
species from Myanmar. Mycological Progress 17: 865–870.
https://doi.org/10.1007/s11557-018-1398-1
Nylander, J.A.A. (2004) MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre Uppsala University.
O’Donnell, K. & Cigelnik, El. (1997) Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium
are nonorthologous. Molecular Phylogenetics and Evolution 7: 103–116.
https://doi.org/10.1006/mpev.1996.0376
O’Donnell, K., Kistler, H.C., Gigelnik, E. & Ploetz, R.C. (1998) Multiple evolutionary origins of the fungus causing Panama disease of
banana: Concordant evidence from nuclear and mitochondrial gene genealogies. PNAS 95: 2044–2049.
https://doi.org/10.1073/pnas.95.5.2044
Pornsuriya, C., Chairin, T., Thaochan, N. & Sunpapao, A. (2020) Identification and characterization of Neopestalotiopsis fungi associated
with a novel leaf fall disease of rubber trees (Hevea brasiliensis) in Thailand. Journal of Phytopathology: 416–427.
https://doi.org/10.1111/jph.12906
Queiroz, C.A. de, Matos, K. da S., Lobo, I.K.C., Sousa, S.B. de, Muniz, C.R., Yamagishi, M.E.B., Zocolo, G.J., Hanada, R.E., Gasparotto,
L., Sousa, N.R., Andrade, E.V. de, Cordeiro, I.B., Melo, A.A.M. & Silva, G.F. da (2020) Morpho-anatomical and molecular
characterization of the oversprouting symptoms caused by Fusarium decemcellulare in guarana plants (Paullinia cupana var.
sorbilis). Tropical Plant Biology 13: 274–286.
https://doi.org/10.1007/s12042-020-09256-1
Rambaut, A. (2009) FigTree v1.3.1: Tree figure drawing tool. PeerJ 2: e281.
Rangel, M.P., Mello, J.C.P. De & Audi, E.A. (2013) Evaluation of neurotransmitters involved in the anxiolytic and panicolytic effect of the
aqueous fraction of Paullinia cupana (guaraná) in elevate T maze. Revista Brasileira de Farmacognosia 23: 358–365.
https://doi.org/10.1590/S0102-695X2013005000024
Riga, R., Happyana, N. & Hakim, E.H. (2019) Chemical Constituents of Pestalotiopsis microspora HF 12440. Journal of Applied
Pharmaceutical Science 9: 108–124.
https://doi.org/10.7324/JAPS.2019.90116
Russell, J.R., Huang, J., Anand, P., Kucera, K., Sandoval, A.G., Dantzler, K.W., Hickman, D.S., Jee, J., Kimovec, F.M., Koppstein,
D., Marks, D.H., Mittermiller, P.A., Núñez, S.J., Santiago, M., Townes, M.A., Vishnevetsky, M., Williams, N.E., Vargas, M.P.N.,
Boulanger, L.A., Bascom-Slack, C. & Strobel, S.A. (2011) Biodegradation of polyester polyurethane by endophytic fungi. Applied
and Environmental Microbiology 77: 6076–6084.
https://doi.org/10.1128/AEM.00521-11
Shu, J., Yu, Z., Sun, W., Zhao, J., Li, Q., Tang, L., Guo, T., Huang, S., Mo, J., Hsiang, T. & Luo, S. (2020) Identification and characterization
of pestalotioid fungi causing leaf spots on mango in southern China. Plant Disease 104: 1207–1213.
https://doi.org/10.1094/PDIS-03-19-0438-RE
Silveira, A.K., Moresco, K.S., Gomes, H.M., Morrone, M. da S., Grun, L.K., Gelain, D.P., Pereira, L. de M., Giongo, A., Oliveira, R.R. de
& Moreira, J.C.F. (2018) Guarana (Paullinia cupana Mart.) alters gut microbiota and modulates redox status, partially via caffeine
in Wistar rats. Phytotherapy Research 32: 2466–2474.
https://doi.org/10.1002/ptr.6185

NEW THREAT TO GLOBAL TROPICAL HOSTS Phytotaxa 489 (2) © 2021 Magnolia Press • 139
Song, Y., Tangthirasunun, N., Maharachchikumbura, S.S.N., Jiang, Y., Xu, J., Hyde, K.D. & Wang, Y. (2014) Novel Pestalotiopsis species
from Thailand point to the rich undiscovered diversity of this chemically creative genus. Cryptogamie, Mycologie 35: 139–149.
https://doi.org/10.7872/crym.v35.iss2.2014.139
Sunpapao, A., Kittimorakul, J. & Pornsuriya, C. (2014) Disease Note: Identification of Curvularia oryzae as cause of leaf spot disease on
oil palm seedlings in nurseries of Thailand. Phytoparasitica 42: 529–533.
https://doi.org/10.1007/s12600-014-0390-9
Torres, G.A., Sarria, G.A., Martinez, G., Varon, F., Drenth, A. & Guest, D.I. (2016) Bud rot caused by Phytophthora palmivora: A
destructive emerging disease of oil palm. Phytopathology 106: 320–329.
https://doi.org/10.1094/PHYTO-09-15-0243-RVW
Tsai, I., Chung, C., Lin, S., Hung, T., Shen, T.-L., Hu, C.-Y., Hossein, W.N. & Ariyawansa, H.A. (2020) Cryptic diversity, molecular
systematics and pathogenicity of Pestalotiopsis and allied genera causing grey blight disease of tea in Taiwan, with description of a
new species of Pseudopestalotiopsis. Plant Disease.
https://doi.org/10.1094/PDIS-05-20-1134-RE
Wang, Y., Ran, S.F., Maharachchikumbura, S.S.N., Al-Sadi, A.M., Hyde, K.D., Wang, H.L., Wang, T. & Wang, Y.X. (2017) A novel
Pestalotiopsis species isolated from Bulbophyllum thouars in Guangxi Province, China. Phytotaxa 306: 96–100.
https://doi.org/10.11646/phytotaxa.306.1.9
White, T., Bruns, T., Lee, S. & Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics.
In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. & White, T. (Eds.) PCR protocols: a guide to methods and applications. Academic Press
(Elsevier), Amsterdam, pp. 315–322.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Xu, J., Ebada, S.S. & Proksch, P. (2010) Pestalotiopsis a highly creative genus: Chemistry and bioactivity of secondary metabolites.
Fungal Diversity 44: 15–31.
https://doi.org/10.1007/s13225-010-0055-z
Yu, X., Müller, W.E.G., Meier, D., Kalscheuer, R., Guo, Z., Zou, K., Umeokoli, B.O., Liu, Z. & Proksch, P. (2020) Polyketide derivatives
from mangrove derived endophytic fungus Pseudopestalotiopsis theae. Marine Drugs 18: 1–15.
https://doi.org/10.3390/md18020129
Yuan, C., Ding, G., Wang, H.Y., Guo, Y.H., Shang, H., Ma, X.J. & Zou, Z.M. (2017) Polyketide-terpene hybrid metabolites from an
endolichenic fungus Pestalotiopsis sp. BioMed Research International 2017.
https://doi.org/10.1155/2017/6961928
Zhao, J., Zhang, D., Liu, T., Liu, W., Pan, L., Liao, N. & Liu, D. (2020) First report of Pseudopestalotiopsis and Neopestalotiopsis species
causing leaf spot of Camellia chrysantha in China. Plant Disease: 3–5.
https://doi.org/10.1094/PDIS-03-20-0598-PDN
Zhou, J., Diao, X., Wang, T., Chen, G., Lin, Q., Yang, X. & Xu, J. (2018) Phylogenetic diversity and antioxidant activities of culturable
fungal endophytes associated with the mangrove species Rhizophora stylosa and R. mucronata in the South China Sea. PLoS ONE
13.
https://doi.org/10.1371/journal.pone.0197359
View publication statsView publication stats