Content uploaded by Keith A Seifert
Author content
All content in this area was uploaded by Keith A Seifert on Jun 10, 2022
Content may be subject to copyright.
Available via license: CC BY-NC-ND 4.0
Content may be subject to copyright.
Fungal Systemacs and Evoluon is licensed under a Creave Commons Aribuon-NonCommercial-ShareAlike 4.0 Internaonal License
© 2021 Westerdijk Fungal Biodiversity Instute 177
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal Biodiversity Institute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
Fungal Systemacs and Evoluon
doi.org/10.3114/fuse.2021.07.09
VOLUME 7
JUNE 2021
PAGES 177–196
INTRODUCTION
The genus Hormomyces was introduced by Bonorden (1851)
for a single hyphomycetous species, H. auranacus, collected
on old oak (Quercus sp.) wood in Germany. The protologue
described and illustrated orange, gelanous sporodochia with
branched chains of hyaline, globose conidia; no measurements
for microscopic structures were reported (Fig. 1). The locaon of
Bonorden’s herbarium is uncertain (Staeu & Cowan 1976) and
no type specimen is known to exist for this species. Hormomyces
is rarely menoned in modern taxonomic literature (Seifert et al.
2011). The only modern study is by Tubaki (1976), who reported
on its blasc, acropetal conidium ontogeny and the characters
of H. auranacus in axenic culture based on a strain isolated
from a fallen twig of Tsuga canadensis collected in New York
State, United States. His concept was generally accepted. The
colonies of H. auranacus are conspicuous and disncve but
they may be disregarded as uninteresng “jelly fungi” by those
focusing on microfungi, or discarded as a “trivial asexual morph or
anamorph” by those interested in macrobasidiomycetes. Despite
this lack of academic aenon, there are frequent reports by
eld mycologists, mostly accurately reecng the Tubaki (1976)
concept, e.g. Mushroom Observer includes 42 (Wilson et al. 2020)
and MyCoPortal 180 records (MyCoPortal 2019).
Seven species of Hormomyces were described: H. abiecola,
H. auranacus, H. callorioides, H. fragiformis, H. paridiphylus, H.
pezizoideus and H. peniophorae (supplementary table S1). Two
were rst described in Hypsilophora prior to being transferred to
Hormomyces by Saccardo (1888), namely Hy. fragiformis and Hy.
callorioides. Saccardo (1888), who mostly compiled descripons
from other mycologists and oen did not examine material
himself, considered the main disncon among these species to
be sporodochial colour: orange for H. auranacus, purple for H.
fragiformis and pink for H. callorioides. Lloyd (1916) quesoned
the value of colour to disnguish these species, suggesng that
they might be conspecic without formally synonymizing them.
Taxonomy and phylogeny of the basidiomycetous hyphomycete genus Hormomyces
J. Mack*, R.A. Assabgui, K.A. Seifert#
Biodiversity (Mycology and Microbiology), Agriculture and Agri-Food Canada, 960 Carling Avenue, Oawa, Ontario K1A 0C6, Canada. #Current
address: Department of Biology, Carleton University, 1125 Colonel By Drive, Oawa, Ontario K1S 5B6, Canada.
*Corresponding author: jonathan.mack2@canada.ca
Abstract: The taxonomy of the genus Hormomyces, typied by Hormomyces auranacus, which based on circumstanal
evidence was long assumed to be the hyphomycetous asexual morph of Tremella mesenterica (Tremellales, Tremellomycetes)
or occasionally Dacrymyces (Dacrymycetales, Dacrymycetes), is revised. Phylogenies based on the three nuc rDNA markers
[internal transcribed spacers (ITS), 28S large ribosomal subunit nrDNA (28S) and 18S small ribosomal subunit nrDNA (18S)],
based on cultures from Canada and the United States, suggest that the genus is synonymous with Tulasnella (Cantharellales,
Agaricomycetes) rather than Tremella or Dacrymyces. Morphological studies of 38 fungarium specimens of Hormomyces,
including the type specimens of H. callorioides, H. fragiformis, H. paridiphilus and H. peniophorae and examinaon of the
protologues of H. abiecola, H. auranacus and H. pezizoideus suggest that H. callorioides and H. fragiformis are conspecic
with H. auranacus while the remaining species are unlikely to be related to Tulasnella. The conidial chains produced by H.
auranacus are similar to monilioid cells of asexual morphs of Tulasnella species formerly referred to the genus Epulorhiza.
The new combinaon Tulasnella auranaca is proposed and the species is redescribed, illustrated and compared with
similar fungi. The ecological niche of T. auranaca and its possible relaonship to orchid root endophytes is discussed. A key
to asexual genera with similar conidium ontogeny to T. auranaca is provided.
Key words:
Dacrymyces
Oosporidium
Tremella
Tulasnella
1 new taxon
Citaon: Mack J, Assabgui RA, Seifert KA (2021). Taxonomy and phylogeny of the basidiomycetous hyphomycete genus Hormomyces. Fungal
Systemacs and Evoluon 7: 177–196. doi: 10.3114/fuse.2021.07.09
Received: 20 November 2020; Accepted: 21 January 2021; Effectively published online: 12 February 2021
Corresponding editor: P.W. Crous
Fig. 1. A copy of the lectotype gure for Hormomyces auranacus, a
reproducon of g. 234, taf. XI from Bonorden (1851).
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
178
McNabb (1969) synonymized H. callorioides under H. fragiformis,
re-emphasizing their exclusion from Hypsilophora, which he
considered the correct generic name for the asexual morph of
the fungus now known as Erythricium salmonicolor (Corciales).
McNabb did not propose a synonymy of H. fragiformis with
H. auranacus, and the former name has oen been used for
specimens collected in North America (MyCoPortal 2019),
irrespecve of sporodochial colour. Tubaki (1976) accepted only
H. auranacus in the genus, although he did not crically revise
the other named species.
In their compilaon of hyphomycete genera, Seifert et al.
(2011) listed two other genera as synonyms of Hormomyces:
Sphaerocolla (following the opinions of von Höhnel 1917; Donk
1962) and Hormisciopsis. Sphaerocolla Karsten (1892) comprises
S. auranaca from Finland from living Betula bark, reported
as producing large, euse, orange sporodochia up to 10 cm
long, with branched chains of globose conidia 3‒9 μm diam,
reminiscent of H. fragiformis or H. auranacus. Hormisciopsis
Sumsne (1914) was proposed for Ho. gelanosa, producing
red, gelanous sporodochia on wood collected in Pennsylvania,
with branching chains of globose to ellipsoidal conidia 6‒10 ×
5‒6 μm. The descripon corresponds well with H. fragiformis
and H. auranacus, and the illustraon is very similar to those
of H. auranacus provided by Lloyd (1916) and H. fragiformis
by Patouillard (1900). Although Sumsne (1914) compared
Hormisciopsis gelanosa to Hormiscium, he was apparently
unaware of Hormomyces.
The taxonomic relaonships of Hormomyces were a
maer of debate, although it has usually been regarded as a
basidiomycete. Patouillard (1900) suggested that Hormomyces
is the budding state of a Dacrymyces. Lloyd (1916) disagreed
but did not provide an alternave classicaon. That same
year, Saccardo suggested that H. auranacus might be the
asexual morph of Tremella mesenterica (Saccardo 1916).
Bresadola (1932) reiterated this putave connecon in a short
note, reporng that the fungus he examined had conidia up
to 3 μm long but he did not illustrate it; unfortunately, no
specimens were menoned. Donk (1962) also suggested a
relaonship between Tr. mesenterica and H. auranacus,
nong that immature Tr. mesenterica also produced conidia.
McNabb (1969) suggested that this connecon was “currently
accepted in Europe.” Later, however, Pippola & Koranta
(2008) described the asexual morph of Tr. mesenterica as
producing chains of ellipsoidal conidia (1.8−)2.2‒4.5(−5.9)
× (1.6−)1.8‒3.8(−4.2) μm, originang from clamped
conidiogenous cells, which matches the dimensions given by
Bresadola (1932). The characters diverge signicantly from
H. auranacus as described by Bonorden (1851), i.e. with
globose conidia and no clamp connecons. Tubaki (1976)
also disagreed with this supposed connecon, remarking that
many asexual morphs of Tremella species are yeasts, while his
culture of H. auranacus was lamentous. Thus, the purported
asexual-sexual morph connecon was a speculaon that was
never established experimentally and was contradicted by
subsequent observaons. Given their dierent ecological
niches, H. auranacus on roen wood and Tr. mesenterica as
a mycoparasite usually on rather solid wood, it is unlikely that
the two were seen in close proximity.
In 2015, we isolated a culture from a freshly collected specimen
of H. auranacus and our inial 18S nrDNA sequences obtained from
that culture suggested an anity of Hormomyces with Tulasnella
rather than Tremella or Dacrymcyes. The genus Tulasnella contains
about one hundred sexual species, most of which occur on wood,
and most known asexual species are usually isolated from orchid
roots or liverworts. The basidiomes are usually thin and waxy
and the basidia have four basally swollen sterigmata delimitated
from the probasidium by a septum. So far, no asexual species of
Tulasnella have been recorded from wood. The morphology and
ontogeny of the conidial chains of H. auranacus are similar to
the monilioid hyphae of the orchid mycorrhizal Tulasnella asexual
morphs formerly aributed to Epulorhiza (Roberts 1994), and
together with its dikaryoc hyphae, support a relaonship with
Tulasnellaceae. In this paper, our goal is to clarify the family and
genus level classicaons of this fungus using Bayesian Inference
(BI) and Maximum Likelihood (ML) analyses of nuc rDNA regions
and genes, and to evaluate the morphological characters of H.
auranacus and the other described species of the genus based
on studies of types and supplementary specimens and cultures.
Should Hormomyces be considered disnct from or a synonym of
Tulasnella? And if H. auranacus is classied in Tulasnella, might
it be the asexual morph of a known sexual species, or idencal
with one of the other asexual species previously aributed to
Epulorhiza? Because H. auranacus is apparently lignicolous,
understanding its relaonship with other Tulasnella species and
mycorrhizal species formerly classied in Epulorhiza may provide
insight into ecological paerns in this family.
MATERIALS AND METHODS
Cultures, specimens and morphological examinaon
Fresh specimens of H. auranacus were collected in 2014 and
2015 near Oawa, Ontario, Canada, with addional specimens
and one culture provided by colleagues; all material studied is
listed in the Specimens Examined paragraphs of the Taxonomy
secon. Cultures were obtained by squashing a small fragment
of a sporodochium and making a slurry that was further diluted
with sterile dH2O. Ten 20 μL drops of the diluon were pipeed
onto malt extract agar (MEA, recipe from Raper and Thom 1949),
using BD Bacto Malt Extract, and 15 g/L BD Bacto Agar, with the
addion of 0.1 g/L ZnSO4.7H2O and 0.005 g/L CuSO4.5H2O, and
examined 24 h later for germinang conidia, which were then
transferred individually to new MEA plates to reduce the risk of
contaminaon. Thereaer, we did not aempt to make single
spore isolaons because the conidia produced in vivo remain
in strongly coherent chains and can be separated only with
diculty. No evidence of contaminaon of the cultures by other
fungi or bacteria was evident under the dissecng microscope
or by light microscopy of mounts from the original isolates.
Culture characters were observed by growing all strains on
MEA and oatmeal agar (OA; Gams et al. 1987).
For each strain and medium, one plate was incubated under
nrUV light for 16 h and in darkness for 8 h per day at ambient RT
(varying between 20−25 °C), and another in darkness in a 25 °C
incubator. Specimens were inoculated at a single, central point in
a 90 mm polystyrene Petri dish. All cultures were then examined
and measured every 7 d for 4 wk, with coloraon noted on days
14 and 28. To determine cardinal temperatures, two strains
were grown in darkness at temperatures ranging from 5−40 °C,
at increments of 5 °C (except 37 °C was used instead of 35 °C),
and measured every 7 d for 4 wk. Culture photographs were
taken with an Olympus Tough TG-5 camera (Olympus, Tokyo)
with black velvet as a background.
© 2021 Westerdijk Fungal Biodiversity Instute
Taxonomy and phylogeny of Hormomyces
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
179
Herbarium specimens, including available types, were
borrowed from BPI (26 specimens), DAOM (7), K(M) (5) and
HKAS (1) (herbarium acronyms follow Thiers 2019).
Microscopic observaons of living specimens were made
using ssue mounted in water. Herbarium specimens were
rehydrated with a small drop of dH2O for 10 min, then small
fragments of sporodochia were removed using jewellers’ forceps
and heated in 85 % lacc acid for ve minutes on an electric hot
plate. Herbarium specimens and cultures were examined using
an Olympus SZX12 dissecng microscope and BX50 compound
microscope (Olympus, Tokyo), and photographed using Innity
2 or Innity X USB microscope cameras, using Innity Capture
soware (Lumenera, Oawa). Specimen and colony colours were
described using the alphanumeric codes and names (with inial
capitals) used by Kornerup & Wanscher (1976). Photographic
plates were assembled using Photoshop v. 5.5 (Adobe Systems,
San Jose, CA).
To demonstrate dikaryoc nuclei, hyphae from a 9-d-old
culture of DAOMC 251988 grown on MEA were mounted in 10
μL of SYTO 13 green uorescent nucleic acid stain (Invitrogen,
Carlsbad, California) on a microscope slide. Aer the placement
of the cover glass, the sample was le in darkness for 30 min at
37 °C, then examined with a Nikon ECLIPSE E800 uorescence
microscope (Nikon, Tokyo) using the UV2 seng. Pictures were
taken with a Nikon DS-Ri2 camera (Nikon, Tokyo).
For each specimen, 50 conidia were measured, and mean
and standard errors are provided. Q values for conidia were
calculated as length divided by width. To assess the possible
signicance of conidial dimensions as a diagnosc character
for species idencaon, means (with upper and lower limits
represented by standard error, and outliers in brackets) were
compared for all specimens. All calculaons were made with
Excel 2016 (Microso, Redmond).
DNA extracon, sequencing and phylogenec analysis
Genomic DNA was extracted from pure cultures of H.
auranacus using the DNeasy UltraClean Microbial Kit (Qiagen,
Hilden), following the manufacturer’s protocol. Permission
was not obtained to aempt extracon of genomic DNA from
specimens loaned by fungaria. For preliminary phylogenec
placement of an early isolate of H. auranacus (DAOMC
252084), a paral sequence of the 18S nrRNA gene was
generated using primers NS1 and NS4, and an amplicaon
prole of 95 °C for 10 min for the inial denaturing of the DNA
template, then 40 cycles with denaturaon at 95 °C for 60 s,
annealing at 56 °C for 45 s and extension at 72 °C for 90 s, with
a nal extension at 72 °C for 10 min. Because of the relaonship
with Tulasnellaceae (Cantherellales) suggested by these results,
we tried a Tulasnella-specic ITS4 primer designed by Taylor
& McCormick (2008) in combinaon with ITS5; this resulted
in sporadic and low yield amplicaon for our strains of H.
auranacus. Amplicaon of the 28S nrRNA gene with LROR
and either LR8 or LR5 invariably failed or yielded mulple PCR
bands. Amplicaon was eventually achieved using V9G as the
forward primer and LR3 as the reverse primer. See Results for
primer references. The PCR prole had an inial denaturaon
at 94 °C for 90 s, ve cycles of denaturaon at 94 °C for 45 s,
annealing at 56 °C for 45 s and extension at 72 °C for 60 s.
Annealing temperatures were then decreased by 1 °C every
ve cycles unl reaching 51 °C, which was used for another 30
cycles, with a nal extension of 10 min, for a total of 55 cycles.
Our sequences of H. auranacus were edited and trimmed
using Geneious v. 11.1.5 (Biomaer, Auckland). BLAST analyses
of all three nrDNA markers indicated a relaonship to reference
sequences in Tulasnellaceae, which guided our sampling for
subsequent phylogenec analyses. Our sequences were aligned
using MUSCLE v. 3.8.425 (Edgar 2004) in datasets containing
sequences of Cantharellales downloaded from GenBank (Table
1 for ITS, Table 2 for 28S), sampled to include all available taxa
of Tulasnellaceae and a few similar, mostly ITS, environmental
sequences and unidened species uncovered during BLAST
searches, along with selected representaves of other genera
in the order. We also used an ITS and paral 28S sequence of
H. auranacus (NBRC 30400, the culture referred to by Tubaki
1976) published in the NBRC culture collecon database (NITE
Biological Resource Center 2019), which were not deposited
in GenBank. Reference sequences of Craterellus tubaeformis
were used as the outgroup for the ITS analysis, which examined
relaonships among species of Tulasnella, Epulorhiza and H.
auranacus. A reference sequence of Uslago maydis was
used as the outgroup for the LSU analysis, which focused on
the relaonship between Hormomyces and Tulasnella in the
Cantharellales, and tested prior hypotheses of relaonships
between Hormomyces and Tremella or Dacrymyces.
Independent phylogenec analyses were conducted using
the Maximum Likelihood (ML) and the Bayesian Inference (BI)
algorithms for both markers. The ML analysis was done with
PHYML v. 3.0 using the GTR + G + I model as the most suitable
model for both 28S and ITS (Guindon et al. 2010). For BI,
JModelTest v. 0.1.1 (Darriba et al. 2012) was used to determine
the most suitable model, GTR + G for both ITS and 28S. The BI
analyses were run using MrBayes v. 3.2 (Ronquist et al. 2012), with
four simultaneous Markov chains run unl the average standard
deviaon of split frequency reached < 0.01. Convergence was
assessed when the standard deviaon of split frequency reached
< 0.01. Sampling frequency was 1 in 500 generaons with the
rst 25 % of the trees discarded as burnin. Trees were visualized
using FigTree v. 1.4.3 (Rambaut 2016) and modied using Adobe
Illustrator 10 (Adobe, San Jose) and PowerPoint 2016 (Microso,
Redmond). The alignments and phylogenec trees were deposited
in TreeBASE (Treebase.org Study ID: 25624 and 27256). Proposed
new names and typicaons were deposited in MycoBank (MB)
and the MycoBank typicaon (MBT) database (Westerdijk Fungal
Biodiversity Instute, Utrecht).
RESULTS
Phylogenec analysis
An inial 1 045 bp sequence of the 5’ end of the 18S nrRNA
gene of DAOMC 252084 (deposited as GenBank MN719097)
indicated a relaonship of H. auranacus with Tulasnella,
with a 99.2 % similarity to an AFTOL generated sequence of
Tulasnella violea (AY707097), based on a query coverage
of 99 %, with sequence similaries of about 80–99 % with
other Tulasnellaceae, mostly with query coverages of about
55 %. The distance tree accompanying the BLAST search was
consistent with the close placement of our sequence in this
family. Because the taxon sampling for 18S sequences of
Tulasnellaceae is so sparse in GenBank, with only three named
species among the 32 reference sequences available, we did
not pursue further 18S analyses.
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
180
Table 1. ITS sequences retrieved from GenBank or newly generated during this study.
Species Strain no. Origin Host GenBank
accession no.
Reference
Ceratobasidium albasitensis EaB-T2 − − AJ427398 Gonzalez, unpublished
C. angussporum CBS 568.83 Eyre Peninsula, SA,
Australia
Pterostylis muca
endophyte
AJ427403 Gonzalez, unpublished
C. cereale C13 − Tricum aesvum AJ302009 Gonzalez et al. (2002)
C. cornigerum C6 − Erigeron canadensis AJ301902 Gonzalez et al. (2002)
C. ramicola CBS 758.79TFlorida, USA Piosporum, leaf AJ427404 Gonzalez, unpublished
C. stevensii CBS 477.82 Kentucky, USA Malus domesca, twig AJ427405 Gonzalez, unpublished
Craterellus tubaeformis S9 − − MH394713 Jensen-Vargas & Marizzi
(2018)
1D3 Kunigami, Okinawa,
Japan
−AB973729 Matsuoka, unpublished
Tulasnella albida KC 110 − − AY373294 McCormick et al. (2004)
T. amonilioides − − − JF907600 Almeida et al. (2014)
T. anacula 13o004 Mt. Hambeak,
South Korea
Platanthera chlorantha KT164598 Direct submission
T. asymetrica MA FF305808
Clone C002
Australia Thelymitra epipactoides KC152347 Cruz et al. (2014)
MAFF 305808
Clone C005
Australia Thelymitra epipactoides KC152348 Cruz et al. (2014)
MAFF305808
Clone C009
Australia Thelymitra epipactoides KC152349 Cruz et al. (2014)
T. auranaca DAOMC 251988 Pennsylvania, USA Roen wood MK626686 This study
DAOM 970795
DAOMC 251989 Tennessee, USA Roen wood and
Crepidotus spp.
MK626533 This study
PBM4158
DAOMC 252083 Victoriaville,
Quebec, Canada
Fomitopsis betulina MK626687 This study
DAOM 970821
DAOMC 252084 Oawa, Ontario,
Canada
Roen Populus wood This study
DAOM 970822 MK626567
DAOMC 252086 Montreal, Quebec,
Canada
Roen wood MK593626 This study
DAOM 970819
DAOMC 252085 Oawa, Ontario,
Canada
Roen wood MK626568 This study
DAOM 970820
NBRC 30400 New York, USA Twig of Tsuga canadensis Sequence not in
Genbank
NITE Biological Resource
Center, 2019
T. australiensis CLM 031 New York, USA Arthrochilus KF476602 Arin et al. (2020)
oreophilus
CLM 1945TNowra, NSW,
Australia
Cryptostylis erecta root MT003730 Arin et al. (2020)
CLM 2004 Northern Sydney
NSW, Australia
Cryptostylis erecta root MT003715 Arin et al. (2020)
T. calospora CBS 326.47 − − AY373298 McCormick et al. (2004)
Ch5-3 − − HM450045 Idris (2010)
T. concentrica CLM 2071 Morton NP, NSW,
Australia
Cryptostylis leptochila root MT036547 Arin et al. (2020)
CLM 2098TNowra, NSW,
Australia
Cryptostylis erecta root MT003744 Arin et al. (2020)
CLM2198 Bunyip SP, Vic,
Australia
Cryptostylis leptochila root MT036533 Arin et al. (2020)
T. cumulopunoides MAFF 245682 Tsukuba City,
Ibaraki, Japan
Spiranthes sinensis LC175323 Fujimori et al. (2019)
© 2021 Westerdijk Fungal Biodiversity Instute
Taxonomy and phylogeny of Hormomyces
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
181
Table 1. (Connued).
Species Strain no. Origin Host GenBank
accession no.
Reference
T. danica KC 388 − − AY373297 McCormick et al. (2004)
T. deliquescens MAFF 244717 − Spiranthes sinensis LC175329 Fujimori et al. (2019)
T. densa CLM 2110 Bulahdelah, NSW,
Australia
Cryptostylis hunteriana MT036526 Arin et al. (2020)
CLM 2111 Bulahdelah, NSW,
Australia
Cryptostylis hunteriana MT036525 Arin et al. (2020)
CLM 2117TBulahdelah, NSW,
Australia
Cryptostylis hunteriana MT036520 Arin et al. (2020)
T. dentrica MAFF 244709T−Spiranthes sinenis LC175308 Fujimori et al. (2019)
T. eichleriana KC 852 − − AY373292 McCormick et al. (2004)
K(M) 143600 England, UK Wood of decorcated
sapling
KC152381 Cruz et al. (2014)
T. ellipsoidea MAFF 245686 Tsukuba City,
Ibaraki, Japan
Spiranthes sinensis LC175315 Fujimori et al. (2019)
T. epiphyca AERO_3.2 − − JF907598 Almeida et al. (2014)
T. irregularis CBS 574.83TNT, Australia Dendrobium dicupum root MH861654 Vu et al. (2019)
T. occidentalis CLM 1938T Boyanup, WA,
Australia
Cryptostylis ovata root MT008096 Arin et al. (2020)
CLM 1942 Boyanup, WA,
Australia
Cryptostylis ovata root MT008092 Arin et al. (2020)
CLM 1943 Boyanup, WA,
Australia
Cryptostylis ovata root MT008091 Arin et al. (2020)
T. prima CLM 159TBlue Mountains,
NSW, Australia
Chiloglos trilabra KF476556 Linde et al. (2013)
CLM 377 Kanangra Boyd NP,
NSW, Australia
Chiloglos a. jeanesii KF476544 Linde et al. (2013)
5O5.III.3 −Chiloglos dyphilla HM196792 Roche et al. (2010)
SRBG01.II.3 Australian Naonal
Botanical Garden,
Acton, ACT,
Australia
Chiloglos trapeziformis HM196793 Roche et al. (2010)
T. pruinosa DAOM 17641 Ontario, Canada Sporophore on Populus sp. AY373295 McCormick et al. (2004)
T. punctata CLM 2012 Northern Sydney,
NSW, Australia
Cryptostylis subulata root M T0 0 8 1 2 4 Arin et al. (2020)
CLM 2017TNorthern Sydney,
NSW, Australia
Cryptostylis subulata root MT008122 Arin et al. (2020)
CLM 2018 Northern Sydney,
NSW, Australia
Cryptostylis subulata root MT008121 Arin et al. (2020)
T. rosea CLM 1770 WA, Australia Spiculaea ciliata root MN947568 Arin et al. (2020)
CLM 1773TWA, Australia Spiculaea ciliata root MN947569 Arin et al. (2020)
CLM 1774 WA, Australia Spiculaea ciliata root MN947570 Arin et al. (2020)
T. secunda CLM 274 Talbot, WA,
Australia
Paracaleana triens KF476580 Linde et al. (2013)
CLM 222 Talbot, WA,
Australia
Paracaleana minor KF476568 Linde et al. (2013)
CLM 009TTalbot, WA,
Australia
Drakaea elasca KF476575 Linde et al. (2013)
Tulasnella sp. ECU 5 DC 225 Ecuador Branch KC152397 Cruz et al. (2014)
DC 225 Ecuador Branch KC152398 Cruz et al. (2014)
Tulasnella sp. ECU 6 DC 185 Ecuador Branch KC152401 Cruz et al. (2014)
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
182
Table 1. (Connued).
Species Strain no. Origin Host GenBank
accession no.
Reference
DC 262 Ecuador Branch KC152409 Cruz et al. (2014)
Tulasnella sp. DC 294 C009 Germany Roen wood KC152387 Cruz et al. (2014)
DC 294 C016 Germany Roen wood KC152394 Cruz et al. (2014)
CLM 084 Australia Arthrochilus oreophilus KF476594 Linde et al. (2013)
CLM 085 Australia Arthrochilus oreophilus KF476595 Linde et al. (2013)
T. sphagne 12033.1TKosciuszko NP”
NSW, Australia
Chiloglos a. valida KY095117 Linde et al. (2017)
13102.1 Kosciuszko NP”
NSW, Australia
Chiloglos turfosa KY445924 Linde et al. (2017)
13065.2 Kosciuszko NP”
NSW, Australia
Chiloglos sp. KY445925 Linde et al. (2017)
T. tomaculum KC 429 − − AY373292 McCormick et al. (2004)
K(M)123675 England, UK − KC152380 Cruz et al. (2014)
T. violea DC 177 Ecuador Decaying wood KC152414 Cruz et al. (2014)
DC 292 Germany Decaying wood KC152412 Cruz et al. (2014)
DC 292 Germany Decaying wood KC152435 Cruz et al. (2014)
DC 293 Germany Decaying wood KC152437 Cruz et al. (2014)
KC 851 − − AY373293 McCormick et al. (2004)
K(M) 164256 England, UK Underside of Fagus
sylvaca log
KC152411 Cruz et al. (2014)
T. warcupii CLM 007 Atherton,
Tablelands, QLD,
Australia
Arthrochilus oreophilus KF476600 Linde et al. (2013)
CLM 022 Australia Arthrochilus oreophilus KF476601 Linde et al. (2013)
CLM 028 Australia Arthrochilus oreophilus KF476599 Linde et al. (2013)
TIndicates type specimens.
Table 2. Gene sequences (28S) retrieved from GenBank, and newly generated in this study.
Species Strain no. Origin Host GenBank
accession no.
Reference
Agaricus bisporus CBS 151.46 − − MH867670 Vu et al. (2019)
Botryobasidium botryosum AFTOL-ID 604 − − DQ089013 Nilsson, unpublished
Bo. isabellinum GEL2109 − − AF393047 Nilsson, unpublished
Bo. subcoronatum GEL 1286 − − AF287850 Binder & Hibbe (2002)
Burgella lutea Etayo 27623TBolivia Corcolous lichens KC336075 Diederich et al. (2014)
Bu. avoparmeliae JL192-01 Oklahoma, USA Flavoparmelia balmorensis DQ915469 Lawrey et al. (2007)
Burgoa moriformis VCH 33TInisherk, Crom,
Fermanagh,
Ireland
Salix bark DQ915477 Lawrey et al. (2007)
Cantharellus addaiensis BB 96.010 Zambia − KM484680 Shao et al. (2014)
Ca. alpes BB 07.019TUSA − KF294627 Buyck et al. (2014)
Ca. amethysteus 993/estades − − MG450679 Buyck et al. (2018)
Ca. cibarius CC15SWE Sweden Betula JX030441 Foltz et al. (2013)
Ca. ferruginasecens GE sn France − KM484681 Shao et al. (2014)
Ca. formosus BB 13.163 USA − KM484683 Shao et al. (2014)
Ca. laterius JJ NC-Canth 2 USA − KM484686 Shao et al. (2014)
Ca. longisporus ER 107 Madagascar − KM484688 Shao et al. (2014)
Ca. minor BB 07.057 USA − KF294632 Buyck et al. (2014)
Ca. texensis BB O7.018TUSA − KF294626 Buyck et al. (2014)
© 2021 Westerdijk Fungal Biodiversity Instute
Taxonomy and phylogeny of Hormomyces
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
183
Table 2. (Connued).
Species Strain no. Origin Host GenBank
accession no.
Reference
Ceratobasidium
bulbillifaciens
Eichler-Cezanne
8193
Germany Bark of Acer platanoides KC336073 Diederich et al. (2014)
C. bulbilllifaciens Eichler-Cezanne
8067
−Bark of Fraxinus KC336071 Diederich et al. (2014)
C. globisporum CBS 569.83TQueensland
Australia
−MH873365 Vu et al. (2019)
C. pseudocornigerum CBS 568.83TAustralia − MH873364 Vu et al. (2019)
C. ramicola Java 11 Java Theobroma cacao HQ424243 Samuels et al. (2012)
C. theobromae South Sulawesi 1 South Sulawesi Peole of Theobroma cacao KU319575 Samuels et al. (2012)
South Sulawesi 6 South Sulawesi Peole of Theobroma cacao KU319577 Samuels et al. (2012)
South Sulawesi 11 South Sulawesi Theobroma cacao HQ424241 Samuels et al. (2012)
South Sulawesi 10 South Sulawesi Theobroma cacao HQ424242 Samuels et al. (2012)
Ceratorhiza oryzae-savae CBS 439.80 Japan Oryza sava MH873047 Vu et al. (2019)
Clavulina amazonensis AMV1973 Colombia Pseudomonotes tropenbosii KT724123 Vasco-Palacios (2016)
Cl. cinerea KHL 11694 Lammi, Finland −AM259211 Nilson et al. (2006)
Cl. cf. cristata BB 12.083 Italy − KM484694 Shao et al. (2014)
Cl. purpurascens ZP-3065 China Soil MK564124 Wu et al. (2019)
Clavucilium delectabile KHL 11147 Norway −AY586688 Larsson et al. (2004)
Craterellus cinereombratus JOH4 Columbia Pseudomonotes tropenbosii KT724159 Vasco-palacios (2016)
Cr. lutescens BB 13.048 Canada KM484696 Shao et al. (2014)
Cr. tubaeformis BB 1324 USA − KM484697 Shao et al. (2014)
BB 07.293 Slovakia − KF294640 Buyck et al. (2014)
Dacrymyces chrysospermus FPL11353 − − AF287855 Hibbe et al. (2000)
D. sllatus CBS 195.48 France −MH867857 Vu et al. (2019)
Gloeotulasnella cysdiophora KW 2871 − − AY585831 Sheerson et al. (2005)
Haplotrichum conspersum AFTOL ID 1766 − − DQ521414 Matheny et al.
unpublished
Hydnum elatum FRI62309 Kampung Jelawat-
Tasik Bera Pahang
Malaysia
−KU612691 Feng et al. (2016)
H. ellipsosporum FD3281 Switzerland − KX086217 Beenken, unpublished
H. magnorufescens 161209 Slovenia − KU612669 Feng et al. (2106)
H. rufescens BB 07.340 Slovakia − KM484698 Shao et al. (2014)
H. versterholi HKAS92342 Yulong snow
mountain, Yunnan,
China
− KU612646 Feng et al. (2016)
Minimedusa obcoronata CBS 120605 Thailand Eucalyptus camaldulensis GQ303309 Cheewangkoon et al.
(2009)
Mulclavula mucida DSH96-056 − −AF287875 Hibbe et al. (2000)
M. mucida TUB 011734 − − EU909345 Krause et al. (2011)
M. vernalis GB-BN-1 Sweden − AM259214 Nilsson et al. (2006)
Rhizoctonia occosa CBS 337.36TIndonesia −MH867319 Vu et al. (2019)
R. quercus CBS 313.35TItaly Root of quercus pedunculata MH867202 Vu et al. (2019)
R. repens CBS 298.32 Netherlands Orchis morio MH866781 Vu et al. (2019)
Schizophyllum commune MUT 4875 Mediterranean Sea Flabellia peolata MF115832 Poli et al. (2018)
Sistotrema adnatum FCUG 700 − −DQ898699 Moncalvo et al. (2006)
S. biggisae FCUG 782 − − DQ898697 Moncalvo et al. (2006)
S. coronilla AFTOL-ID 618 − − DQ457641 Moncalvo et al. (2006)
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
184
Table 2. (Connued).
Species Strain no. Origin Host GenBank
accession no.
Reference
S. hypogaeum CBS 394.63TAustralia Soil MH869926 Vu et al. (2019)
S. oblongisporum FCUG 2117 − − DQ898703 Moncalvo et al. (2006)
S. sernanderi CBS 926.70 − −AF518650 Hibbe & Binder (2002)
Sistotremella brinkmanii CBS 186.39 Michigan, USA − MH867474 Vu et al. (2019)
Sistotremella perpusilla CBS 126048 North Carolina,
USA
Abies MH875516 Vu et al. (2019)
Thanatephorus cucumeris AFTOL-ID 2022 − − DQ917658 Matheny et al. unpubl.
CBS 340.51 England, UK − MH868410 Vu et al. (2019)
Tremella macrobasidiata AM453 Portugal Lecanora chlorotera KT334595 Zamora et al. (2016)
Tr. mesenterica AM30 Wedin, Sweden −JN043569 Millanes et al. (2011)
CBS:6973TVancouver, Brish-
columbia, Canada
Alnus rubra KY109900 Vu et al. (2016)
T. anacula UAMH 5428 Alberta, Canada Roots of Calypso bulbosa AY243520 Taylor et al. (2003)
T. asymmetrica MAFF P305806 Thelymitra luteocilium DQ388046 Suarez et al. (2006)
T. auranaca DAOMC 251988 Pennsylvania, USA Roen wood MK627511 This study
DAOM 970795
DAOMC 251989 Tennessee, USA Roen wood and Crepidotus
spp.
MK627512 This study
PBM 4158
DAOMC 252083 Victoriaville,
Quebec, Canada
Fomitopsis betulina MK627513 This study
DAOM 970821
DAOMC 252084 Oawa, Ontario,
Canada
Roen Populus wood MK627514 This study
DAOM 970822
DAOMC 252086 Montreal, Quebec,
Canada
Roen wood MK627515 This study
DAOM 970819
DAOMC 252085 Oawa, Ontario,
Canada
Roen wood MK627516 This study
DAOM 970820
T. calospora SPRR.R2 India Paphiopedilum druryi MN271391 Parthibhan &
Rammasubu (2020)
T. eremophila 13062 MD − Euphorbia ocinarum KJ701189 Crous et al. (2015)
T. irregularis CBS 574.83 NT, Australia Dendrobium dicuphum AY243519 Taylor et al. (2003)
T. phuhinrongklaensis SDBR-CMU-CR41T− − MF427703 Rachanarin et al. (2018)
SDBR-CMU-CR42 − − MF427704 Rachanarin et al. (2018)
SDBR-CMU-CR43 − − MF427705 Rachanarin et al. (2018)
SDBR-CMU-CR44 − − MF427706 Rachanarin et al. (2018)
T. pruinosa DAOM 17641 Richmond Hill,
Ontario, Canada
Populus sp. AF518662 Hibbe & Binder (2002)
Tulasnella sp. GEL 4461 − − AJ406436 Langer (2001)
GEL 4745 − − AJ406436 Langer (2001)
GEL 5130 − − DQ898731 Moncalvo et al. (2006)
T. violea DAOM 222001 − − AY293216 Binder et al. (2005)
AFTOL-ID 1879 − − DQ520097 Garnica & Weiß,
unpublished
Uslago maydis CBS 358.32 − − MH866814 Vu et al. (2019)
TIndicates type specimens or ex-type strains.
© 2021 Westerdijk Fungal Biodiversity Instute
Taxonomy and phylogeny of Hormomyces
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
185
Our inial aempts to amplify ITS and 28S separately from
cultures of H. auranaca using universal primers, or a putave
Tulasnella-specic ITS primer (Taylor & McCormick 2008), were
unsuccessful, with only faint or mulple bands visualized.
Diverse techniques such as annealing point gradients from 60–
55 °C, a touchdown PCR of 40 cycles each at 57 and 55 °C, and
altering primer and DNA concentraons were all unsuccessful in
amplifying the DNA. This was solved using the forward primer
V9G, slightly upstream from the ITS locus at the end of the 18S
(de Hoog & Gerrits van den Ende 1998) along with the reverse
primer LR3, slightly downstream from the LROR primer on the
28S (Raja et al. 2017). Sequences of this fragment showed that
H. auranacus DAOMC 251989 has mismatched binding sites in
the ITS4, ITS5, ITS1F and LROR priming regions. For subsequent
amplicaon and sequencing, we designed the new primers
ITS4_hormo, ITS5_hormo and LROR_hormo (Table 3), correcng
the mismatches idened by our rst sequence. This enabled
the roune amplicaon and sequencing of both markers.
The sequences of our six strains of Hormomyces were very
similar. For the ITS (Fig. 2), four of the strains had idencal
sequences; DAOMC 251989 had a single nucleode inseron,
and DAOMC 252084 diered from the other strains by 3−4
nucleodes. For the 28S (Fig. 3), the dierences between
each strain were no more than two nucleodes, resulng in
similaries > 99.5 %.
All analyses of both genes conrmed the phylogenec
relaonship with Tulasnellaceae, Cantharellales, suggested by
the inial 18S sequence, remote from the previously proposed
relaves of H. auranacus in Tremellales or Dacrymycetales. This
directed our sampling of taxa to test whether Hormomyces was
nested within or disnct from exisng genera of Tulasnellaceae.
All BI and ML analyses resulted in all strains of H. auranacus
forming a monophylec clade nested within Tulasnella and
separate from other genera of Cantherellales. In the ITS analysis,
H. auranacus belongs with high support to a clade including
various Tulasnella species including T. violea, T. eichleriana and
several orchid root endophytes. Unfortunately our BI analysis of
the ITS loci tends to result in polytomy for this clade, although
each species remains phylogenecally coherent and disnct.
The exact sister group of T. auranaca in this clade is unclear.
A phylogenec analyses of the ITS locus by Arin et al. (2020),
which used sequences of H. auranacus obtained during our
study, also suggested the placement of H. auranaca in the
same clade within Tulasnella, but sister to two unidened
Tulasnella species from Ecuador.
Our 28S analysis also nests H. auranacus within Tulasnella,
suggesng it is sister to Tulasnella sp. GEL4461, with a dierence
of 47 bp (94.6 % similarity). Based on a MegaBLAST search of
GenBank, the closest idened match for the LSU locus was
Tulasnella obscura (AJ406435, idenes = 485/517(94 %), 7
gaps (1 %) with a 57 % query cover). Other matches were less
than 85 % similar and with an E value below 1e-100.
Based on our analyses, Tulasnella appears to be monophylec
(with the excepon of Tulasnella eremophila), forming two
disnct clades with high stascal support in the ITS phylogeny,
and possibly four disnct clades in the 28S phylogeny. Because
only six species of Tulasnellaceae, including our own, have
sequences for both ITS and 28S, a concatenated analysis was
not aempted. All of the asexual species previously referred
as Epulorhiza currently sequenced using the ITS and LSU loci
are easily separated from H. auranacus, suggesng that H.
auranacus is a disnct species of Tulasnella.
Comparison of herbarium specimens of H. auranacus,
H. fragiformis and H. callorioides
All of the examined specimens idened as H. auranacus, H.
fragiformis or H. callorioides had similar micromorphology and no
disnct separaon was detected based on an extensive analysis of
conidial sizes (Supplementary Fig. S1). Measurements overlapped
with the lectotype specimen of H. fragiformis [(7–)7.5–9.5(–11) ×
6‒7.5(–8.5) μm (mean 8.66 ± 0.1 × 6.75 ± 0.1, Q 1.29, n = 50)] and
the holotype of H. callorioides [(7–)7.5‒9.5(–11) × (5–)5.5‒6.5(–
7) μm (mean 8.45 ± 0.1 × 6.21 ± 0.1, Q 1.37, n = 50)], with the
average conidial size for all examined specimens being 8.43 ± 0.1
× 6.37 μm ± 0.1 (Supplementary Fig. S2).
Although the protologue of H. callorioides described its
sporodochia as pink (Kalchbrenner & Cooke 1880), our examinaon
of the holotype showed dried sporodochia that were terracoa
to dark brown. The original pigments may have degraded over
the years or darkened with preservaon. The colours observed
on the lectotype of H. fragiformis designed by McNabb (1969)
Table 3. Primer names and sequences used for this study, including the new primers ITS5_hormo, ITS4_hormo and LROR_hormo and the Tulasnella-
specic ITS4 primer, ITS4_tul, with melng temperature (Tm) in degrees Celsius. Point mutaons are in bold, nucleode addions are in bold and
underlined and nucleode deleons are shown as a blank space with a bold underline.
Sequence (5’ to 3’) Tm (°C) Reference
V9G TTACGTCCCTGCCCTTTGTA 56 de Hoog & Gerrits van den Ende (1998)
ITS5 GGAAGTAAAAGTCGTAACAAGG 51 White et al. (1991)
ITS5_hormo GGAAGTACAAGTCGTAACAAGG 53 This study
ITS4 TC CTC CGC T TAT TGATATGC 52 White et al. (1991)
ITS4_tul CCGCCAGATTCACACATTGA 55 Taylor & McCormick (2008)
ITS4_hormo TCCTCCGCTGAATAATATGC 52.1 This study
LROR ACCCGCTGAACTTAAGC 52 Moncalvo et al. (2000)
LROR_hormo ACCCGCTTGA_TTTAAGC 50 This study
LR3 CCGTGTTTCAAGACGGG 53 Moncalvo et al. (2000)
LR3R GTCTTGAAACACGGACC 50 Moncalvo et al. (2000)
LR5 TCCTGAGGGAAACTTCG 51 Moncalvo et al. (2000)
LR8 CACCTTGGAGACCTGCT 54 Hopple & Vilgalys (1999)
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
186
and holotype of H. callorioides, both in dry specimens and aer
rehydraon, were within the same range as that we saw in our
own specimens and those preserved in BPI and DAOM. We found
no evidence to support a hypothesis that sporodochial colour
can be used to disnguish these three putave species when the
specimens were examined side by side. Similarly, there were no
other morphological or microscopic characters that allowed the
disncon of the several specimens idened as H. fragiformis
or H. auranacus, or the holotype of H. callorioides, despite the
disjunct geographical locaons among the three species.
Taxonomy
The genus Tulasnella was proposed for protecon against
Epulorhiza and Hormomyces by Stalpers et al. (2021), in accordance
of the Shenzhen code (Turland et al. 2018). The remaining names in
Epulorhiza were transferred to Tulasnella there. Here, the generic
descripon of Tulasnella is emended to include the asexual morph
characters for taxa described in Hormomyces and Epulorhiza.
Tulasnella J. Schröt., Kryptogamen-Flora von Schlesien 3.1(25–
32): 397. 1888. nom. cons. prop.
Synonyms: Hormomyces Bonord., Handb. Allgem. mykol.
(Stugart): 150. 1851 (asexual synonym).
Prototremella Pat., J. Bot., Paris 2: 269. 1888, de Donk 1966.
Pachysterigma Johan-Olsen ex Bref., Unters. Gesammtgeb.
Mykol. (Liepzig) 8: 5. 1888, de Donk 1966.
Muciporus Juel, Bih. K. svenska VetenskAkad. Handl., Afd.: 23.
1897, de Donk 1966.
Gloeotulasnella Höhn. & Litsch., Wiesner Festschri (Wien): 57.
1908, de Donk 1966.
Hormisciopsis Sumst., Mycologia 6: 32. 1914 (asexual synonym).
Epulorhiza R.T. Moore, Mycotaxon 29: 94. 1987 (asexual
synonym).
Typicaon: Tulasnella lilacina J. Schröt. 1888.
Basidiomes (when present) crust-like, oen on roen wood,
leaves or lier, oen pinkish or purple. Hymenium composed
0.3
Tulasnella amonilioides JF907600
Tulasnella sphagneti KY445924
CLM 031 Tulasnella austaliensis KF476602
Craterellus tubaeformis AB973729
MAFF 305808 Tulasnella asymmetrica KC152348
DC 293 Tulasnella violea KC152437
MAFF 245686 Tulasnella ellipsoideaLC175315
CLM 1938 Tulasnella occidentalis MT008096 T
K(M) 123675 Tulasnella tomaculum KC152380
KC 429 Tulasnella tomaculum AY373296
DC 177 Tulasnella violea KC152414
CLM 2111 Tulasnella densa MT036525
CLM 2117 Tulasnella densa MT036520 T
DC 262 Tulasnella sp. ECU 6KC152409
KC 852 Tulasnella eichleriana AY373292
CBS 574.83 Tulasnella irregularisMH861654 T
Ceratobasidium albasitensis AJ427398
MAFF 244717Tulasnella deliquescens LC175329
DAOMC 252084 Tulasnella aurantiaca MK626567
MAFF 305808 Tulasnella asymmetrica KC152347
CLM 2110 Tulasnella densa MT036526
CLM 1943 Tulasnella occidentalis MT008091
CLM 2018 Tulasnella punctata MT008121
Ceratobasidium cornigerum AJ301902
Tulasnella epiphytica JF907598
KM 164256 Tulasnella violea KC152411
DC 225 Tulasnella sp. ECU 5KC152398
MAFF 24470 Tulasnella dentriticaLC175308 T
Tulasnella calospora HM450045
CLM 2098 Tulasnella concentrica MT036530
CLM 274 Tulasnella secunda KF476580
Craterellus tubaeformis MH394713
CLM 1774 Tulasnella roseaMN947570
CLM 085 Tulasnella sp. KF476595
Tulasnella calospora HM4500
MAFF 245682 Tulasnella cumulopuntioidesLC175323
CLM 2017 Tulasnella punctata MT008122 T
MAFF 305808 Tulasnella asymmetrica KC152349
NBRC 30400 Tulasnella aurantiaca
DAOMC 225086 Tulasnella aurantiaca MK593626
DAOMC 225085 Tulasnella aurantiaca MK626568
DAOMC 251998 Tulasnella aurantiaca MK626686
CBS 758.79 Ceratobasidium ramicola AJ427404 T
Tulasnella albida AY373294
Tulasnella sphagneti KY445925
CLM 1770 Tulasnella roseaMN947568
Ceratobasidium cereale AJ302009
DC 292 Tulasnella violea KC152412
CLM 1773 Tulasnella roseaMN947569 T
CBS 477.82 Ceratobasidium stevensenii AJ427405
Tulasnella pruinosa AY373295
Tulasnella anaticula KT16459
CLM 022 Tulasnella warcupiiKF476601
DC 185 Tulasnella sp. ECU 6KC152401
DC 294 Tulasnella sp. KC152387
DC 294 Tulasnella sp. KC152394
DC 292 Tulasnella violea KC152435
CLM 1945 Tulasnella australiensis MT003730 T
KC 388 Tulasnella danica AY373297
KC 851 Tulasnella eichleriana AY373293
CLM 009 Tulasnella secunda KF476575 T
CLM 2198 Tulasnella concentrica MT036533
CLM 377 Tulasnella prima KF476544
CLM 159 Tulasnella prima KF476556 T
505.III.5 Tulasnella prima HM196803
CBS 568.83 Ceratobasidium angustisporum AJ427403
CLM 2004 Tulasnella australiensis MT003715
CLM 007 Tulasnella warcupiiK F476600
*/*
CLM 028Tulasnella warcupii KF476599
*/*
94/90
*/99
*/*
*/*
*/*
*/*
CLM 1942 Tulasnella occidentalis MT008092
* CLM 084Tulasnella sp. KF476594
98/91
-/0.72
78/73
*/*
84/79
*/
CLM 2012Tulasnella punctata MT008124
*/*
85/96
*/*
*/99
-/-
*/*
97/77
*/*
DAOMC 251989 Tulasnella aurantiaca MK626533
Tulasnella sphagneti KY095117 T
86/-
88/92
DC 225 Tulasnella sp. ECU 5KC152397
93/98
SRBG01.II.3 Tulasnella prima HM196793
*/*
*/0.93
CLM 2071 Tulasnellac oncentrica MT036547 T
*/*
*/*
*/99
96/90
79/88
*/*
-/0.86
*/98
99/*
*/*
83/*
*/
*/*
*/99
*/*
*/*
*/99
81/81
*/*
*/*
CLM 222 Tulasnella secunda KF476568
DC 292 Tulasnella violea KC152412
DAOMC 225083 Tulasnella aurantiaca MK626687
*/*
*/*
Tulasnella
Ceratobasidium
Outgroup
Fig. 2. Phylogenec tree for species of Tulasnella and Ceratobasidium for the ITS region, based on Bayesian inference analysis using MrBayes. The
values above the branches are Bayesian posterior probabilies/maximum likelihood bootstrap values. Bootstrap values of ≥ 70 % and Bayesian
posterior probabilies of ≥ 0.70 are shown with bootstrap values of 100 % and Bayesian posterior probability of 1.00 replaced by an asterisk (*). T
indicates type specimens.
© 2021 Westerdijk Fungal Biodiversity Instute
Taxonomy and phylogeny of Hormomyces
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
187
of hyphae with or without clamps depending on the species,
subhymenial structures oen absent. Basidia with four
sterigmata that are strongly swollen at the base, each separated
by a septum from the clavate basal cell, which oen collapses.
Basidiospores variably shaped, from globose to helicoid;
secondary conidia occasionally produced on germinang
primary spores (Ingold 1984). Septa with central dolipores
with connuous parenthesomes. Asexual morphs (when
present) forming mycorrhizae with orchid roots or liverworts, or
conspicuous orange to red pustulate, gelanous, sporodochia on
roen wood. Stroma absent. Conidia in blasc, acropetal chains,
which are dichotomously branched in some species, and arise
directly from submerged hyphae or in sporodochia. Conidia
aseptate, smooth or with minute pits, globose, subglobose,
ellipsoidal to barrel-shaped, aseptate, hyaline, someme with
orange droplets. Somac hyphae dikaryoc (Currah et al.
1990), lacking clamp connecons when associated with asexual
structures. Scleroa occasionally produced.
Notes: The sexual morphs of Tulasnella are well-characterized
by the producon of thin, resupinate basidiomes on decaying
substrates. They have unique “tulasnelloid” basidia with a
basally swollen sterigma separated by a septum from the
club-shaped basal cell, which usually collapses (Roberts 1994).
Ultrastructure of dolipore septa is oen used as a character
to support class-level classicaon of Basidiomycota (Celio et
al. 2006). Comparavely few exemplars are studied for each
class and the character is rarely used for genus or species level
classicaons, which tend to be supported by DNA sequencing
(e.g. Almeida et al. 2014, Linde et al. 2017, Arin et al. 2020).
We did not examine septal ultrastructure in this study. Most
known asexual morphs of Tulasnella are characterized by the
producon of acropetal chains of conidia, and for most of the
known asexual species, a relaonship with orchids. Tulasnella
auranaca is the excepon because it grows on wood.
Apart from the species formerly included in Epulorhiza,
a few other asexual states are described for other species of
Tulasnellaceae but lack the characterisc monilioid conidial
0.3
ZP 3065 Clavulina purpurascens MK564124
FCUG 782 Sistotrema biggsiae DQ898697
Cantharellus addaiensis KM484680
Botryobasidium subcoronatum AF287850
CBS 313.35
Ustilago maydis
MH866814
Tulasnella irregularis AY243519
SPRR.R2 Tulasnella calospora MN271391
Multiclavula mucida EU909345
Schizophyllum commune MF115832
JL 192 01 Burgella flavoparmeliae DQ915469
Etayo 27623 Burgella lutea KC336075 T
JOH 4 Craterellus cinerofimbriatus KT724159
BB 13.125 Craterellus cf. tubaeoformis KM484697
Tulasnellaanaticula AY243520
Dacrymyces chrysopermus AF287855
CBS 298.32 Rhizoctonia repens MH866781
FCUG 2117 Sistotrema oblongisporum DQ898703
CB S151.46 Agaricus bisporus MH867670
Multiclavula mucida AF287875
AFTOL ID 618 Sistotrema coronillaDQ457641
CBS 120605 Minimedusa obcoronata GQ303309
CBS 926.70 Sistotrema sernanderi AF518650
CBS 394.63 Sistotrema hypogaeum MH869926 T
DAOM 222001 Tulasnella violeaAY293216
AFTOL ID 1766 Haplotrichum conspersum DQ521414
BB 07.293 Craterellus tubaeformis KF294640
Tulasnella phuhinrongklaensis MF427706
Tulasnella phuhinrongklaensis MF427703 T
Tulasnella phuhinrongklaensis MF427705
Clavulicium delectabile AY586688
Cantharellus ferruginascens KM484681
Cantharellus amethysteus MG450679
Cantharellus roseocanus KM484690
CC15SWE Cantharellus cibarius JX030441
Cantharellus longisporus KM484688
GEL 2090 Botryobasidium candicans AJ406441
FRI 62309 Hydnum elatum KU612691
AFTOL ID 604 Botryobasidium botryosum DQ089013
Cantharellus lateritius KM484686
FCUG 700 Sistotrema adnatum DQ898699
CBS 6973 Tremella mesentericaKY109900 T
KHL 11694 Clavulina cinerea AM259211
AMV 1973 Clavulina amazonensis KT724123
BB 13.048 Craterellus cf. lutescens KM484696
GEL 5130 Tulasnellasp.DQ898731
AM 30 Tremella mesentericaJN043569
CBS 186.39 Sistotrema brinkmanii MH867474
Cantharellus formosus KM484683
AFTOL ID 1879 Tulasnella violea DQ50097
AM 453 Tremella macrobasidiataKT334595
BB 12.083 Clavulina cf. cristata KM484694
Tulasnella phuhinrongklaensis MF427704
GEL 4461 Tulasnella sp.AJ406436
CBS 126048 Sistotremella perpusilla MH875516
Multiclavula vernalis AM259214
MAFF P305806 Tulasnellaasymetrica DQ388086
Hydnum rufescens KM484698
GEL 4745 Tulasnella sp.AJ406437
FD 3281 Hydnum ellipsosporum KX086217
161209 Hydnum magnorufescens KU612669
13062MD Tulasnella eremophila KJ701189
Botryobasidium isabellinum AF393047
Thanatephorus theobromae HQ424242
KW 2871 Gloeotulasnella cystidiophora AY585831
BB 07.019 Cantharellus altipes KF294627 T
CBS 568.83 Ceratobasidium pseudocornigerum MH873364 T
CBS 313.35 Rhizoctonia quercus MH867202 T
CBS 337.36 Rhizoctonia floccosa MH867319 T
Ceratobasidium theobromae KU319575
Ceratobasidium theobromae KU319577
Thanatephorus theobromae HQ424241
DAOMC 252084 Tulasnella aurantiaca MK627514
DAOMC 251988 Tulasnella aurantiaca MK627511
DAOMC 252085 Tulasnella aurantiaca MK627516
DAOMC 252086 Tulasnella aurantiaca MK627515
DAOMC 251989 Tulasnella aurantiaca MK627512
DAOMC 252083 Tulasnella aurantiaca MK627513
HKAS 922342 Hydnum vesterholtii KU612646
CBS 439.80 Ceratorhiza oryzae-sativae MH873047
CBS 569.83 Ceratobasidium globisporum MH873365 T
CBS 132236 Ceratobasidium sp. KC336071
CBS 129339 Ceratobasidium bulbillifaciens KC336073
Ceratobasidium ramicola HQ424243
DAOM 17641 Tulasnella pruinosaAF518662
BB 07.018 Cantharellus texensis KF294626 T
BB 07.057 Cantharellus minor KF294632
-/*
66/87
99/*
*/*
-/-
98/96
*/-
93/-
99/98
*/*
*/*
99/85
*/*
*/*
-/*
98/99
79/-
*/*
*/99
*/99
*/*
*/*
96/*
88/92
*/*
94/94
*/*
99/*
98/97
Cantharellales
Cantharellales
Agaricales
Dacrymycetales
Tremellales
Outgroup
Tulasnella
CBS 195.48 Dacrymyces stillatus MH867857
Burgoa moriformis DQ915477
CBS 340.51 Thanatephorus cucumeris MH868410
AFTOL ID 2022 Thanatephorus cucumeris DQ917658
Fig. 3. Phylogenec tree for species of Cantharellales including species of Tulasnella for the 28S gene, based on Bayesian inference analysis using
MrBayes. The values above the branches are Bayesian posterior probabilies/maximum likelihood bootstrap values. Bootstrap values of ≥ 70 % and
Bayesian posterior probabilies of ≥ 0.70 are shown with bootstrap values of 100 % and Bayesian posterior probability of 1.00 replaced by an asterisk
(*).T indicates type specimens.
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
188
chains of T. auranaca. Tulasnella valenni, which grows
on roen wood, is reported to produce single apiculate,
obclavate or fusiform conidia terminang irregularly lanceolate
conidiogenous cells (Van de Put & Antonissen 1996). This is an
unusual character state for a member of Tulasnellaceae and this
asexual-sexual connecon needs to be conrmed experimentally
to eliminate the possibility that the observed conidia might have
been those of a mycoparasite; for that reason, we did not include
these deviang character states in the generic diagnosis above.
Slbotulasnella conidiophora, described from palm fronds but
to date unsequenced, can be disnguished by its synnematous
conidiomata and ellipsoidal ameroconidia produced in slimy
masses from percurrently proliferang conidiogenous cells
(Bandoni & Oberwinkler 1982).
Seifert et al. (2011) synonymized the monotypic Hormisciopsis
with Hormomyces based on the protologue, and we include it as
a synonym of Tulasnella above. We did not examine specimens
of Hormisciopsis gelanosa, but the protologue (Sumsne 1914)
provides observaons that are idencal to what we have seen
in specimens of T. auranaca. Seifert et al. (2011) followed von
Höhnel (1917) and Donk (1962) in synonymizing Sphaerocolla
with Hormomyces. However, re-examinaon of the protologue
and slides from the holotype of S. auranaca (on Betula,
Musala, June; H herb. Karsten PAK 3341; Supplementary Fig.
S3), the type species of Sphaerocolla, suggests this was an
error. Although the micromorphology is similar, the conidia of
S. auranaca are slightly oblate rather than slightly ellipsoidal,
and the fungus is reminiscent of the poorly-documented yeast
O. margariferum, which occurs on slime uxes on trees
(Kurtzman 2011), a similar ecological niche to that reported
for S. auranaca on living Betula trees. A notable dierence is
that O. margariferum produces endospores, which we did not
observe in the material of S. auranaca, but these are apparently
produced only in culture (Smith 1997) and no cultures of S.
auranaca were isolated. Therefore, S. auranaca should be
considered disnct from T. auranaca and may be conspecic
with O. margariferum.
Based on our nuc rDNA phylogenies, Hormomyces is
congeneric with Tulasnella, but appears to be disnct from
all sequenced species of the laer genus. Therefore, a new
combinaon is proposed:
Tulasnella auranaca (Bonord.) J. Mack & Seifert, comb. nov.
MycoBank MB832426. Fig. 4.
Synonyms: Hormomyces auranacus Bonord., Handb. Allgem.
mykol. (Stugart): 150. 1851.
Typicaon: g. 234, taf. XI, in Bonorden 1851, Handb. Allgem.
mykol. (Stugart): (lectotype, proposed here MBT388543,
reproduced here as Fig. 1).
Hypsilophora callorioides Kalchbr. & Cooke, Grevillea 9: 18. 1880.
Hormomyces callorioides (Kalchbr. & Cooke) Sacc., Syll. fung.
(Abellini) 6: 813. 1888.
Hypsilophora fragiformis Cooke, in Farlow, Appalachia 3: 247.
1884
Hormomyces fragiformis (Cooke) Sacc., Syll. fung. (Abellini) 6:
182. 1888.
Hormisciopsis gelanosa Sumst., Mycologia 6: 32. 1914.
Basidiomes unknown. Sporodochia euse, oen pustulate,
conuent in masses up to 5 cm long, occasionally more, or rarely
solitary and <1 cm long, gelanous or carlaginous when fresh,
waxy when dried, colours variable, from deep orange to garnet
red when fresh, ranging from blonde to brown with various
shades of orange and red when dry. Hyphae immersed, septate,
branched, 2–4 μm wide, dikaryoc, binucleate (Supplementary
Fig. S4), clamp connecons absent, no stroma formed.
Conidiophores arising from hyphal cells, clamp connecon
absent. Conidia blasc, in monilioid, branched acropetal chains,
branching bifurcate, paern variable, occurring mainly near the
base of the chains, with usually fewer than ve conidia between
bifurcaons, the terminal chains typically longer, oen with up to
15 conidia and occasionally more, chains not readily separang
into individual conidia. Conidia hyaline, oen with conspicuous
orange guules when fresh, aseptate, smooth, subglobose
to ellipsoidal or occasionally globose, oen truncate, variable
in length and width, (4.5‒)7.5‒9.5(‒13) × (4‒)5.5‒7(‒8.5) μm
(mean 8.4 ± 0.1 × 6.4 ± 0.1, Q 1.31), thick-walled with walls ~1
μm thick.
Colony diam aer 14 d, on MEA with near-UV (spectral range
300‒400 nm) 30−50 mm on MEA in darkness 30−50 mm on CMA
with near-UV 25−45 mm, on CMA in darkness 30−50 mm, on OA
with near-UV 55−65 mm, on OA in darkness 40−55 mm. Colonies
at, oen immersed, lamentous, oen circular or irregular with
undulate margins. Hyphae 2–5 μm wide. Sporodochia produced
aer 1−2 wk abundantly on OA, and in some strains on MEA,
sterile on CMA, concolorous with mycelium, or more vibrantly
coloured, especially when exposed to light: on CMA with near-
UV aer one month Salmon (6A4) to Pinkish White (9A2) in four
strains and Cognac (6E7) in one; on CMA in darkness white,
Blonde (5C4), Pinkish White (9A2) or Cognac (6E7); on MEA
with near-UV white in four strains and Tangerine (6B7) in one;
on MEA in darkness white in four strains and Yellowish White
(4A2) in one; on OA under near-UV Greyish Red (7B4) to Pastel
Red (8−9A5); on OA in darkness Pale Yellow (3A3) to Orange
White (5A2) or Pale Orange (6A3). Conidia similar to those in
vivo but slightly longer and narrower, (6.5‒)7.5‒10(‒12.5) ×
(4‒)5‒6.5(‒8) μm (mean 9 ± 0.5 × 5.8 ± 0.3, Q 1.57± 0.1).
Cardinal temperatures: Opmum 25 °C, minimum <5 °C,
maximum 30−37 °C. Growth does not resume in cultures le for
1 mo at 37 °C, when moved to an incubator at 20 °C.
Distribuon: Widely distributed in eastern North America,
known from Ontario and Québec south to North Carolina and
Tennessee and westward to Ohio. Tulasnella auranaca is
known from western North America (one specimen collected in
Arizona), Europe (Austria, Germany) and South Africa (Western
Cape).
Habitat: Lignicolous and apparently saprobic, reported on
roen wood of conifers (Thuja) and angiosperms such as
species of Populus, Platanus, Liquidambar and Vaccinum. It
somemes overgrows other fungi such as Fomitopsis betulina
and Crepidotus spp.
Specimens examined (*indicates specimens that were cultured): As
Hormomyces auranacus: Austria, Salzburg, Salzburg, on bark of roen
wood, 1880, E.A. Rau (BPI 726623). Canada, Ontario, Oawa, Portobello
Park, on roen wood, probably Populus sp., Aug. 2014, J. Mack (DAOM
970822); ibid., Jul. 2015 (*DAOMC 252084); Oawa, on roen wood,
probably Populus sp., 15 Jul. 2017, J. Mack (DAOM 970820, *DAOMC
252085); Quebec, Montreal, on roen wood, 25 Oct. 2018, G. Carer, isol.
J. Mack (DAOM 970818, *DAOMC 252086); Victoriaville, on Piptoporus
© 2021 Westerdijk Fungal Biodiversity Instute
Taxonomy and phylogeny of Hormomyces
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
189
Fig. 4. Tulasnella auranaca. A, B. Appearance of fresh sporodochia on roen wood. C. Detail of dried sporodochia. D. Detail of rehydrated sporodochia.
E–G: 28-d-old culture, E on CMA with near-UV, F on OA with near-UV, G on OA in darkness. H, K. Living conidial chains in water. I, J. Conidial chains
from culture on OA for 27 d under near-UV. L. Conidial chains in lacc acid. Scale bars: C−D = 500 μm, H, K−L = 10 μm, I, J = 20 μm.
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
190
betulinus, 13 Jun. 2016, B. Forer, isol. J. Mack (DAOM 970821, *DAOMC
252083). South Africa, on bark of unidened tree, undated, V. Duthie
Augusta (BPI 702911). USA, Arizona: Portal, Greenhouse Canyon, on
roen wood of Platanus sp., 26 Aug. 1956, J.L. Lowe & R.L. Gilbertson
(BPI 726600); Kentucky, Crienden, on roen wood, 11 Jul. 1910, C.G.
Lloyd (BPI 702908); Maryland, Great Falls, on roen wood, 10 Oct.
1936, J.A. Stevenson (BPI 726621); Great Falls, on roen log, 17 Oct.
1936, J.A. Stevenson (BPI 726619); Patuxent Wildlife Refuge, on wood of
Liquidambar styraciua, Jul. 1952, F. Berry (BPI 726599); Sligo, on roen
wood and polypores, 16 Oct. 1936, V.K. Charles & E.E. Dick (BPI 726619);
New York, Adirondack Mountains, Paul Smiths, on roen wood, 21 Sep.
1927, H.M. Fitzpatrick (BPI 702905); Greenport, on bark of Vaccinium sp.,
3 May 1921, L. Roy (BPI 702904); North Carolina, Macon County, Highland,
Mirror Lake Rd, on a fallen branch, 27 Aug. 1989, R.J. Bandoni no. 8495
(DAOM 970797, as Hormomyces sp.). Pennsylvania, Meadville, on roen
wood, 1922, E.C. Smith (BPI 702909); no locaon, on roen wood, 2018,
D. Newman, isol. J. Mack (*DAOMC 251988); Tennessee, Great Smoky
Mountains Naonal Park, Cosby, on roen wood and Crepidotus spp.,
27 May 2018, B.P Matheny, isol. B.P. Matheny (received as a culture,
*DAOMC 251989); West Virginia, Fairmont, on roen wood, no date,
A. Boutlou (BPI 702903). As Hormomyces fragiformis: Canada, Ontario,
Coopers Falls, on roen log, 16 Sep. 1952, R.F. Cain (DAOM 82339);
South of Poageville, on hardwood plank, 6 Jul. 1954, R.F. Cain (DAOM
52048); New Durham, on decaying log, 11 Nov. 1930, R.F. Cain (DAOM
81729). USA, New Hampshire, Shelburne, on dead wood and polypore,
Jun. 1883, M.C. Cooke K(M) 257483 (holotype); Maryland, Grand Falls,
on roen wood, 11 Oct. 1936, J.A. Stevenson (BPI 726622); Missouri,
Perryville, Jun. 1883, C.H. Demetrio (BPI 726620); North Carolina:
Asheville, on roen wood, 1918, C.G. Lloyd (BPI 726625), Winston-
Salem, on bark of roen wood, 4 Jul. 1936, P.O. Schallert (BPI 726626);
Ohio, Cincinna, on bark, 3 Oct. 1920, C.G. Lloyd (BPI 702914); Chapel
Hill, 14 Jan. 1924, on rong deciduous wood, J.N. Couch (UNC 7236, in
DAOM); Vermont, Middlebury, on dead wood, 20 Aug. 1896, E.A. Burt
(BPI 702913); Virginia, W slope of Mt. Elliot, Augusta Co., on roen wood,
17−21 Jul. 1936, J.A. Stevenson (BPI 726617); Rapidan River, Shenandoah
Naonal Park, roen wood, 24 Sep. 1936, J.A. Stevenson (BPI 726616);
West Virginia, Fairmont, on bark of roen wood, no date, A. Boutlou (BPI
626624). As Hormomyces callorioides: South Africa, Somerset West, on
rong wood, no date, MacOwan (holotype K(M) 257481).
Notes: Tulasnella auranaca is characterized by orange to red
sporodochia growing on wood or rarely, on other fungi, and the
producon of ellipsoidal conidia generally shorter than 10 μm.
No sexual morph is known. While most species of Tulasnella
occur on roen wood (Roberts 1994), unl now their asexual
morphs have only been reported as symbionts of orchids or
liverworts. Most of these symbioc Tulasnella spp. have conidia
> 10 μm long. The conidia of T. auranaca are most similar to
those of T. epiphyca, which are also < 10 μm long and occur
in branched, monilioid chains; those of T. epiphyca, however,
have pied walls (Pereira et al. 2003). Like T. auranaca, T.
calendulina also produces orange colonies in culture, but its
monilioid cells are larger (Zelmer & Currah 1995). Monilioid
chains have been reported from basidiomes of T. violea, but
the component cells are also >10 μm long (Roberts 1994).
Sporodochial asexual morphs resembling T. auranaca include
Oosporidium margariferum (Euroomycetes, Ascomycota),
which also produces gelanous sporodochia with long, branched
chains of globose conidia, but diers by yeast-like growth in
culture and its habit on living woody plants (Kurtzman 2011).
Calloria fusarioides (Dermateaceae, Heloales, Ascomycota;
asexual morph formerly known as Cylindrocolla urcae), also
produces gelanous, orange sporodochia with long, branched
acropetal chains but its conidia are cylindrical (Seifert et al. 2011).
Heteromycophaga glandulosa (tentavely Tremellomycetes, cf.
Weiß et al. 2014), a parasite of basidiomes of Exidia glandulosa,
produces clavate conidia aached to conidiogenous cells by
a clamp connecon (Roberts 1997); it is unclear from the
protologue whether the conidia are single or formed in chains.
Tulasnella auranaca grows easily on standard mycological
media and grows in vitro between 5 and 30 °C, suggesng that
it may be well-adapted to grow in dierent biomes. Most of the
specimens examined were collected between May to October,
suggesng that T. auranaca has a long sporulang season,
which generally correlates with its opmum growth temperature
of 25 °C in temperate climates. However, this species can also
occur during the winter, as an examined specimen was collected
in January.
Aer studying the available types of all described Hormomyces
species and many other specimens, only H. fragiformis and H.
callorioides were appropriately placed in Tubaki’s (1976) concept
of Hormomyces. Aer careful studies of sporodochial coloraon
and conidial dimensions (Supplementary Fig. S1), we tentavely
consider these two taxa to be conspecic with H. auranacus in
agreement with Lloyd (1916). As far as we have been able to
determine by microscopy, the herbarium specimens from Europe
and South Africa are idencal to the North America material. The
colour variaons we observed by growing cultures on dierent
media in darkness or light, reweng of sporodochia on ca. 30
herbarium specimens, and evaluaon of approximately 35–40
photographs of both dried and fresh specimens on Mushroom
Observer (Wilson et al. 2020), suggests that the colour disncons
used by previous authors, who examined only a few specimens, may
not be diagnosc. However, the taxonomic signicance of colour
dierences should be re-evaluated if addional evidence suggests
the existence of crypc, phylogenec species within T. auranaca.
The cultures we examined and sequenced were all from North
America and form a phylogenecally coherent clade. Bonorden’s
H. auranacus was described from Europe. Unfortunately,
despite the many collecng excursions by the senior author in
the Netherlands in the mid-1980s, two visits to South Africa in
1996 and 2006, and requests to both professional and amateur
colleagues to watch for this fungus over the past ve years,
we were unable to obtain fresh specimens or cultures of T.
auranaca-like asexual morphs from Europe or Africa. Whether
phylogenecally disnct species might occur in other parts of
the world remains unknown, and we chose to exercise cauon
and not to propose any of the currently available material to
epitypify T. auranaca. In any case, Bonorden’s illustraon
(reproduced here as Fig. 1), must serve as the lectotype (Art.
9.12, Turland et al. 2018) as proposed in the nomenclator
above. If future studies of crypc species support geographic
separaon, then H. fragiformis may be the appropriate name for
material from North America, and H. callorioides for specimens
from South Africa.
As reviewed in the Introducon, T. auranaca oen was
considered the asexual morph of Tremella mesenterica (McNabb
1969). Based on our phylogenec results, the descripon of the
asexual morph of Tr. mesenterica by Pipolla & Koranta (2008)
and the yeast-like rather than lamentous growth of the laer
in cultures (Fenwick 1995), this speculave connecon is clearly
untrue. The sexual morph of T. auranaca, if extant, remains
unknown, but would be expected to have typical Tulasnella
basidiomes and basidia.
© 2021 Westerdijk Fungal Biodiversity Instute
Taxonomy and phylogeny of Hormomyces
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
191
Excluded species
Only H. auranacus, H. fragiformis and H. callorioides, discussed
above, conform with the Tubaki (1976) concept of Hormomyces,
now merged with Tulasnella. The remaining described species
are discussed here.
Hormomyces abienus P. Karst., Hedwigia 29: 271. 1890.
Synonym: ? Dacrymyces deliquescens Nees, 1816, de Kennedy
1958.
We did not examine the type specimen. Kennedy (1958)
considered H. abienus a synonym of Dacrymyces deliquescens.
McNabb (1973) synonymized D. deliquescens with D. sllatus
and described the asexual morph of D. sllatus, which produces
gelanous, orange sporodochia with chains of arthroconidia
8‒16 × 2.5‒5.5 μm, similar to the conidial dimensions of H.
abienus reported by Karsten (1890). Neither Kennedy (1958)
nor McNabb (1973) examined the holotype of H. abienus and
our request to examine the specimen in H remained unanswered;
the synonymy remains tentave for this reason.
Hormomyces paridiphilus M. Zang & S.L. Wang, Acta bot. Yunn.
19: 324. 1997.
This species was reported as a inhabitant of tubers of Paris
polyphylla v a r. yunnanensis (Melanthiaceae) in China (Zang &
Wang 1997). The holotype consists of fragments of uncertain
composion overgrown by a dry, greyish oidiodendron-like
hyphomycete with chains of light brown, subglobose, nely
ornamented conidia (2‒)2.5‒3(‒3.5) × (1.5‒)2‒2.5 μm (mean
2.78 ± 0.4 × 2.35 ± 0.1, Q 1.18, n = 50). Globose chlamydospores-
like structures (7‒)9‒13(‒15) × (5‒)6‒10 μm (mean 10.1 ± 0.6 ×
7.89 ± 0.4, Q 1.3, n = 15) composed of oblong, pale brown cells,
2‒4(‒6.5) × (1‒)1.5‒3.5 μm (mean 3.03 ± 0.1 × 2.13 ± 0.1, Q 1.45)
were also observed, growing singly and terminally on hyphae. It
seems unlikely that the authors would have misinterpreted the
Oidiodendron as a Hormomyces, and dimensions of the observed
conidia do not match the protologue; it seems more likely that
the original specimen was overgrown by this mould later on. The
species will have to be re-collected to re-evaluate its taxonomy.
Unl then, the taxon should be considered a nomen dubium.
Specimen examined: China, Yunnan, on tubers of Paris polyphylla var.
yunnanensis, 10 Sep. 1995, S.L. Wang (holotype HKAS 30237).
Hormomyces peniophorae P. Roberts, Mycotaxon 63: 214, 1997.
The holotype consisted of twigs covered with basidiomes of
Peniophora lycii, with inconspicuous gelanous sporodochia
~1 mm diam forming pale spots on the hymenium. Conidia,
conidiophores and haustoria consistent with those described by
Roberts (1997) were observed. However, because the conidia
are not formed in chains, there is no morphological reason
to include this fungus in Hormomyces, and the presence of
“tremellaceous” haustoria described and mycoparasic ecology
are more suggesve of Tremellales than Cantharellales. Because
the haustoria are terminal, Roberts (1997) suggested a possible
relaonship of his species with the genus Sirotrema. However,
the species of Sirotrema parasize hosts in Rhysmataceae,
and its species have clamp connecons and yeast-like asexual
morphs (Bandoni 1986). Hormomyces peniophorae should
be recollected, cultured and sequenced before changes are
proposed to its classicaon.
Specimens examined: UK, England, Devon, Scadson woods, Torquay, as
a mycoparasite of Peniophora lycii growing on Rubus idaeus, 21 Jan.
1996, P. Roberts (holotype K(M):337706); Slapton woods, mycoparasite
of Peniophora lycii growing on Ulmus, 10 Dec. 1994, P. Roberts
(K(M):33198).
Hormomyces pezizoideus Speg., Boln Acad. nac. Cienc. Córdoba
2: 467. 1889.
The holotype specimen (LPS 28379) could not be provided on
loan, but with the kindness of the curators, we were able to
examine Spegazzini’s pencil drawing and a macro photograph of
the specimen. These suggest a fungus with reddish sporodochia
and branched chains of cuboidal or globose conidia ~1.5‒2 μm
diam, growing on a bamboo. These limited observaons do
not allow accurate idencaon of the species, but the small
conidial size and bamboo habitat suggest it is not congeneric
with T. auranaca.
DISCUSSION
Our taxonomic and phylogenec revision of the hyphomycete
genus Hormomyces provides the evidence for the formal
synonymy with Tulasnella (Cantharellales) proposed by Stalpers
et al. (2021), and the transfer of the type species H. auranacus
to the laer genus. We consider two described species to be
synonyms of T. auranacus based on type studies, and one
species described in Hormisciopis is considered a synonym based
on its protologue. Tulasnella auranaca is a relavely common
fungus in temperate North America, conspicuous because of its
gelanous orange to reddish sporodochia and abundant globose
to ellipsoidal conidia in branched, acropetal chains. While
this combinaon of characters is diagnosc for T. auranaca,
other sporodochial fungi with either Basidiomycetous or
Ascomycetous anies could be confused with T. auranaca.
A key to similar genera is provided below. The species grows
on roen wood and occasionally overgrows wood-decaying
fungi such as Fomitopsis betulina and Crepidotus sp. We
did not observe microscopic structures that might indicate
mycoparasism, such as haustoria, in any specimens, suggesng
that T. auranaca somemes opportuniscally overgrows eshy
basidiomes without parasizing them. Hormomyces species are
somemes recorded from unusual substrates. One specimen of
a Hormomyces sp. was reported from the palm Rhopalostylis
sapida (McKenzie et al. 2004). A single strain idened as H.
auranacus was isolated from the surface of a hibernang bat
(Myos septentrionalis) collected in a cave in New Brunswick,
Canada (Vanderwolf et al. 2013). We did not examine either of
these collecons.
As described above, sporodochial colour is variable in this
species. Our interpretaon is that dierences in colours of
sporodochia constute infraspecic variaon related to age or
environmental factors, and there are presently no correlaons
noted with other characters. In several other fungi, pigmentaon
is inuenced by abioc factors such as light, (e.g. Yu & Fischer
2018). Other sporodochial hyphomycetes, such as Clonostachys
rosea, are well-known to produce conidiomata with variable
colouraon, ranging from yellow to orange, pink to red (Schroers
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
192
Key to genera of hyphomycetes similar to Tulasnella auranaca (A = Ascomycota, B = Basidiomycota, U = unknown).
1. Clamp connecons present on hyphae .............................................................................................................. Heteromycophaga (B)
1’. Clamp connecons absent on hyphae ................................................................................................................................................ 2
2. No sporodochia produced ................................................................................................................................................................... 3
2’. Sporodochia produced ........................................................................................................................................................................ 5
3. Spe demaaceous ................................................................................................................................................... Phaeomonilia (A)
3’. Spe hyaline ........................................................................................................................................................................................ 4
4. Producing large, inated conidiogenous cells, oen on Eucalyptus ........................................................................... Quambalaria (B)
4’. Conidia arising from simple hyphae conidia in long branched chains, only known from cultures derived from ascospores
........................................................................................................................................................ Chaenothecopsis haematopus (A)
5. Conidia not in chains ........................................................................................................................................................................... 6
5’. Conidia in chains that may be branched ............................................................................................................................................. 8
6. Sporodochia cup-shaped, conidiogenous cells not in chains .......................................................................................... Ditangium (B)
6’. Sporodochia not cup-shaped, conidiogenous cells in chains .............................................................................................................. 7
7. Conidiogenous cells clavate .......................................................................................................................................... Algonquinia (U)
7’. Conidiogenous cells cuneiform .......................................................................................................................... Catenocuneiphora (U)
et al. 1999), with a striking bluish green colour dening C.
rosea f. catenulata (Schroers 2001). Variaon and overlapping
characters in basidiome colour or micromorphology are also
problems for the idencaon of basidiomes of Tulasnella
species in the absence of DNA sequencing (Cruz et al. 2014).
When this species was known as H. auranacus, it
was frequently considered the asexual morph of Tremella
mesenterica. However, all nuc rDNA analyses condently place
this species in Tulasnella among sequences idened as T. violea.
The laer species is oen considered a synonym of T. lilacina,
the type species of Tulasnella, but this synonymy has not yet
been evaluated by DNA sequencing. Sequences aributed to T.
violea appear to be monophylec in the ITS phylogenec tree,
with the excepon of a single strain that may be a misidened
strain of T. eichleiriana. In the 28S tree, the two GenBank
sequences labelled as T. violea are polyphylec but the strains
sampled are dierent from those in the ITS trees and it is
unclear whether one or both are misidened. Based on our ITS
phylogenec analysis, Tulasnella appears to be divided into two
clades with T. auranaca in the same clade, with high support,
as all the sequences labelled as T. violea. If the synonymy of T.
violea and T. lilacina is eventually conrmed, and the concept
of the species is claried, it is probable that Hormomyces would
remain a synonym of Tulasnella.
Unl very recently, only nuc rDNA sequences were available
for Tulasnella species. Sequences for the nuc glutamate
synthase gene (C4102), and mito ATP synthase (C14436) were
introduced by Arin et al. (2020) for species from Australia
belonging to a clade within Tulasnella that includes orchid
root endophytes and possibly T. auranaca. Only a few RNA
polymerase subunit I (RPB1) and RNA polymerase subunit II
(RPB2) sequences are available (Matheny et al. 2006, Moncalvo
et al. 2006). A phylogenecally robust generic concept and any
subdivision of Tulasnella into segregate genera will require the
generaon of addion sequences covering the enre family,
possibly using C4102 and C14436. Even if such studies jusfy
spling Tulasnella into segregate genera, it is probable that
Hormomyces would stay nested within any narrower concept
of the genus. Understanding the phylogenec structure and
species concepts in the core clade of Tulasnella around the
type species clearly requires increased sampling and crical
study. The inclusion of strictly asexual species in such analyses
should provide addional phylogenec and morphological
characters and perhaps some clarity as future revisions proceed.
The eventual taxonomic fate of Epulorhiza is less certain. The
type species, E. repens (= Tulasnella calospora), and the other
sequenced species of Epulorhiza are in the second ITS clade
within Tulasnella, but this grouping is less evident in the 28S
phylogeny. Therefore, it is possible that Epulorhiza could be re-
instated if Tulasnella were divided.
Tulasnella species form mycorrhizae with several types of
plants, especially several genera of orchids (Currah et al. 1997,
Dearnaley et al. 2012, Almeida et al. 2014, Linde et al. 2017,
Oberwinkler et al. 2017, Fujimori et al. 2019, Arin et al. 2020),
and liverworts (Preußing et al. 2009). Using mito 28S, Almeida
et al. (2014) showed that the species formerly included in the
asexual genus Epulorhiza, namely T. amonilioides, T. epiphyca,
T. albertaensis and T. anacula, do not form their own disnct
clade, but are distributed across Tulasnella. In their phylogenec
analysis, strains idened as the type species of Epulorhiza, E.
repens or its sexual morph T. calospora, are polyphylec, and
most of the clades represent unnamed endophytes isolated from
orchid roots. We wonder whether T. auranacus may also be
able to infect orchid roots because closely related species such
as T. prima, T. secunda, T. warcupii, T. australiensis, T. rosea and
several others occur in that niche (Linde et al. 2017, Arin et al.
2020). Cantharellales are known for accelerated evoluon of
their nuc rDNA loci (Moncalvo et al. 2006) and the mutaons in T.
auranaca at the binding sites for the universal nuc rDNA primers,
ITS4, ITS5 and LROR, may explain why it has not been detected in
environmental samples. Dierent mutaons in ITS primer binding
sites of Tulasnella species were reported by Cruz et al. (2011),
who designed specic primers dierent than those we designed
for our study. Our modied primers for T. auranacus (Table 3)
may be interesng to try for DNA surveys of orchid mycorrhizae
or for the detecon of related crypc species.
© 2021 Westerdijk Fungal Biodiversity Instute
Taxonomy and phylogeny of Hormomyces
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
193
ACKNOWLEDGMENTS
We are grateful to Dr. M. Smith from the Carleton University for his
mentorship to JM during this project. We thank Gwenael Carer,
Bibianne Forn, P. Brandon Matheny and Danny Newman for collecng
fresh specimens, and are indebted to the curators of BPI, DAOM, H,
HKAS, and K(M) for lending the specimens used in this study. We are
grateful to Dr. S. Redhead for advice on taxonomic and nomenclatural
maers, Amy Rossman and colleagues for helping us resolve the
nomenclatural status of Hormomyces and Epulorhiza, Franck Stefani
for assistance with uorescence microscopy and the Oawa Research
and Development Centre Molecular Technologies Laboratory for DNA
sequencing services. We appreciate the eorts of Jorge Chayle, Hugo
Madrid and Francisco Kuhar to help us clarify the characters of H.
pezizoideus. Thanks to Ms. D. Castronovo, Harvard University Faculty
of Arts & Sciences, for providing a clean copy of Bonorden’s original
illustraon of H. auranacus.
Conict of interest: The authors declare that there is no conict
of interest.
REFERENCES
Almeida PRM, van den Berg C, Góes-Neto A (2014). Epulorhiza
amonilioides sp. nov.: A new species of orchid mycorrhiza from
Brazil. NeoDiversity 7: 1−10.
Arin A, May TW, Linde CC (2020). New species of Tulasnella associated
with Australian terrestrial orchids in the Cryptostylidinae and
Drakaeinae. Mycologia DOI: 10.1080/00275514.2020.1813473
Bandoni RJ, Oberwinkler F (1982). Slbotulasnella: A new genus in the
Tulasnellaceae. Canadian Journal of Botany 60: 1875−1879.
Bandoni RJ (1986). Sirotrema: A new genus in the Tremellaceae.
Canadian Journal of Botany 64: 668−676.
Binder M, Hibbe DS, Larsson KH, et al. (2005). The phylogenec
distribuon of resupinate forms across the major clades of
mushroom-forming fungi (Homobasidiomycetes). Systemacs and
Biodiversity 3: 113−157.
Bonorden HF (1851). Handbuch der allgemeinen Mykologie.
Schweizerbart’sche Verlagshandlung. Stugart, Germany.
Bresadola G (1932). Iconographia mycologica. Società Botanica Italiana
23: 1100−1150.
Buyck B, Kau F, Eyssarer G, et al. (2014). A mullocus phylogeny for
worldwide Cantharellus (Cantharellales, Agaricomycedae). Fungal
Diversity 64: 101−121.
Buyck B, Antonín V, Chakraborty D, et al. (2018). Cantharellus sect.
Amethysni in Asia. Mycological Progress 17: 917−924.
Celio GJ, Padamsee M, Dennger BTM, et al. (2006). Assembling the
fungal tree of life: construcng the structural and biochemical
database. Mycologia 98: 850−859.
Cheewangkoon R, Groenewald JZ, Summerell BA, et al. (2009).
Myrtaceae, a cache of fungal biodiversity. Persoonia 23: 55−85.
Crous PW, Wingeld MJ, Guarro J, et al. (2015). Fungal Planet descripon
sheets: 320–370. Persoonia 34: 167–266.
Cruz D, Suárez JP, Koke I, et al. (2011). Dening species in Tulasnella
by correlang morphology and nrDNA ITS-5.8S sequence data of
basidiomata from a tropical Andean forest. Mycological Progress
10: 229−238.
Cruz D, Suárez JP, Kole I, et al. (2014). Crypc species revealed by
molecular phylogenec analysis of sequences obtained from
basidiomata of Tulasnella. Mycologia 106: 708−722.
Currah RS, Smreciu EA, Hambleton S (1990). Mycorrhizae and
8. Sporodochia gelanous or slimy .......................................................................................................................................................... 9
8’. Sporodochia dry ................................................................................................................................................................................ 14
9. Conidia 1-septate .............................................................................................................................................. Dacrymyces sllatus (B)
9’. Conidia aseptate ............................................................................................................................................................................... 10
10. On orchid roots, liverworts or slime uxes on trees ........................................................................................................................ 11
10’. In beetle galleries, or on roen wood or mushrooms .................................................................................................................... 12
11. Endophyc on orchid roots, or liverworts .............................................................................. Tulasnella (excluding T. auranaca)(B)
11’. On slime uxes on living trees .................................................................................................................................. Oosporidium (A)
12. In beetle galleries ........................................................................................................................................................... Raaelea (A)
12’. On roen wood, lier or roen mushrooms .................................................................................................................................. 13
13. Conidia cylindrical .............................................................................................................................................................. Calloria (A)
13’. Conidia mostly ellipsoidal ........................................................................................................................... Tulasnella auranaca (B)
14. Conidia yellow and with a very thick cell wall ...................................................................................................... Sphaerosporium (A)
14’. Conidia not as above ....................................................................................................................................................................... 15
15. Parasic on fresh fruits ...................................................................................................................................................... Monilia (A)
15’. Not parasic of fresh fruits ............................................................................................................................................................. 16
16. Conidia cuneiform ................................................................ Hyaloscypha (asexual morphs formerly included in Pseudaegerita)(A)
16’. Conidia ellipsoidal to fusiform, not cuneiform ................................................................................................................................ 17
17. Conidia hyaline .............................................................................................................................................................. Cylindrium (A)
17’. Conidia pigmented .................................................................................................................................................... Hoornsmania (U)
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
194
mycorrhizal fungi of boreal species of Platanthera and Coeloglossum
(Orchidaceae). Canadian Journal of Botany 68: 1171−1181.
Currah RS, Zeler LW, McInnis TM (1997). Epulorhiza inquilina sp. nov.
from Platanthera (Orchidaceae) and a key to Epulorhiza species.
Mycotaxon 61: 335−342.
Darriba D, Taboada GL, Doallo R, et al. (2012). jModelTest 2: More
models, new heuriscs and parallel compung. Nature Methods 9:
772.
Dearnaley, JWD, Martos, F, Selosse, MA (2012). Orchid mycorrhizas:
molecular ecology, physiology, evoluon and conservaon aspects.
In: Fungal Associaons (B. Hock, ed.) Springer- Verlag, Berlin,
Germany: 207–230
Diederich P, Lawrey JD, Capdet M, et al. (2014). New lichen-associated
bulbil-forming species of Cantharellales (Basidiomycetes). The
Lichenologist 46: 333−347.
Donk MA (1962). The generic names proposed for Hymenomycetes. —
XII. Deuteromycetes. Taxon 11:75−104.
Donk MA (1966). Checklist of European hymenomycetous
Heterobasidiae. Persoonia 4: 145−335.
Edgar RC (2004). MUSCLE: mulple sequence alignment with high
accuracy and high throughput. Nucleic Acids Research 32:
1792−1797.
Feng B, Wang XH, Ratkowsky D, et al. (2016). Mullocus phylogenec
analyses reveal unexpected abundant diversity and signicant
disjunct distribuon paern of the Hedgehog Mushrooms (Hydnum
L.). Scienc Reports 6: 25586.
Fenwick GA (1995). Tremella mesenterica in laboratory culture.
Mycologist 9: 124−126.
Foltz MJ, Perez KE, Volk TJ (2013). Molecular phylogeny and morphology
reveal three new species of Cantharellus within 20 m of one another
in western Wisconsin, USA. Mycologia 105: 447−461.
Fujimori S, Abe JP, Okane I, et al. (2019). Three new species in the genus
Tulasnella isolated from orchid mycorrhiza of Spiranthes sinensis
var. amoena (Orchidaceae). Mycoscience 60: 71−81.
Gams W, van der Aa HA, van der Plaats-Niterink AJ, et al. (1987). CBS
Course of Mycology, 3rd ed. Baarn and Del, the Netherlands.
Centraalbureau voor Schimmelcultures.
González V, Salazar O, Julián MC, et al. (2002). Ceratobasidium
albasitensis: A new Rhizoctonia-like fungus isolated in Spain.
Persoonia 17: 601−614.
Guindon S, Gascuel O (2003). A simple, fast and accurate method to
esmate large phylogenies by maximum-likelihood. Systemac
Biology 52: 696−704.
Guindon S, Dufayard JF, Lefort V, et al. (2010). New algorithms and
methods to esmate maximum-likelihood phylogenies: Assessing
the performance of PhyML 3.0. Systemac Biology 59: 307−321.
Hibbe DS, Luz-Beatrice G, Donoghue MJ (2000). Evoluonary
instability of ectomycorrhizal symbioses in basidiomycetes. Nature
407: 506−508.
Hibbe DS, Binder M (2002). Evoluon of complex fruing-body
morphologies in homobasidiomycetes. Proceedings of the Royal
Society of London. Series B: Biological Sciences 269: 1963−1969.
Hoog GS de, Gerrits van den Ende AHG (1998). Molecular diagnoscs
of clinical strains of lamentous Basidiomycetes. Mycoses 41:
183−189.
Hopple JS, Vilgalys R (1999). Phylogenec relaonships in the mushroom
genus Coprinus and dark-spored allies based on sequence data
from the nuclear gene coding for the large ribosomal subunit
RNA: Divergent domains, outgroups, and monophyly. Molecular
Phylogenecs and Evoluon 13: 1−19.
Idris NA (2010). Idencaon of a mycorrhiza isolate from
Paphiopedilum barbatum (Lindl.) Ptzer from ex situ locaon and
determinaon of its growth-enhancing capabilies. Thesis. Instute
of Science, Universi Putra Malaysia, Malaysia
Ingold CT (1984). Paerns of ballistospore germinaon in Tilleopsis,
Auricularia and Tulasnella. Transcripon of the Brish Mycological
Society 83: 583‒591.
Jensen-Vargas E, Marizzi C (2018). DNA barcoding for idencaon
of consumer-relevant fungi sold in New York: A powerful tool for
cizen sciensts? Food 7: 87.
Kalchbrenner K, Cooke MC (1880). South African fungi. Grevillea 9:
17−34.
Karsten PA (1890). Fragmenta mycologica XXXI. Hedwigia 29: 270−273.
Karsten PA (1892). Fragmenta mycologica XXXVIII. Hedwigia 31:
292−296.
Kennedy LL (1958). The genus Dacrymyces. Mycologia 50: 896−915.
Kornerup A, Wanscher JH (1978). Methuen Handbook of Colour. 3rd ed.
Eyre Methuen, London, UK.
Krause C, Garnica S, Bauer R, et al. (2011). Aneuraceae (Metzgeriales)
and tulasnelloid fungi (Basidiomycota): A model for early steps in
fungal symbiosis. Fungal Biology 115: 839−851.
Kurtzman CP (2011). Protomyces Unger (1833). In: The Yeasts: A
Taxonomic Study, Volume 2. (Kurtzman CP, Fell JW, Boekout T, eds).
Elsevier, Amsterdam, the Netherlands: 725−731.
Langer EJ (2001). Phylogeny of non-gilled and gilled basidiomycetes
— DNA sequence inference, ultrastructure and comparave
morphology. PhD thesis. University of Tübingen, Germany.
Larsson KH, Larsson E, Kõljalg U (2004). High phylogenec diversity
among corcioid homobasidiomycetes. Mycological Research 108:
983−1002.
Lawrey JD, Binder M, Diederich P, et al. (2007). Phylogenec diversity
of lichen-associated homobasidiomycetes. Molecular Phylogenecs
and Evoluon 44: 778−789.
Lefort V, Longueville JE, Gascuel O (2017). SMS: Smart Model Selecon
in PhyML. Molecular Biology and Evoluon 34: 2422−2424.
Linde CC, Phillips RD, Crisp MD, et al. (2013). Congruent species
delineaon of Tulasnella using mulple loci and methods. New
Phytologist 201: 6−12.
Linde CC, May TW, Phillips RD, et al. (2017). New species of Tulasnella
associated with terrestrial orchids in Australia. IMA Fungus 8:
27−47.
Lloyd CG (1916). Hormomyces auranacus. Mycological Wrings 5:
170.
Matheny BP, Gossman JA, Zalar P, et al. (2006). Resolving the
phylogenec posion of the Wallemiomycetes: An enigmac
major lineage of Basidiomycota. Canadian Journal of Botany 84:
1794−1805.
McCormick MK, Whigham DF, O’Neil J (2004). Mycorrhizal diversity in
photosynthec terrestrial orchids. New Phytologist 163: 425−438.
McKenzie EHC, Buchanan PK, Johnston PR (2004). Checklist of fungi on
Nikau palm (Rhopalostylis sapida and R. baueri var. cheesemanii), in
New Zealand. New Zealand Journal of Botany 42: 335−355.
McNabb RFR (1969). The identy of Hypsilophora. Transacons of the
Brish Mycological Society 52: 506−509.
McNabb RFR (1973). Taxonomic studies in the Dacrymycetaceae VIII.
Dacrymyces Nees ex Fries. New Zealand Journal of Botany 11:
461−524.
Millanes AM, Diederich P, Ekman S, et al. (2011). Phylogeny and character
evoluon in the jelly fungi (Tremellomycetes, Basidiomycota, Fungi).
Molecular Phylogenecs and Evoluon 61: 12−28.
Moncalvo JM, Lutzoni FM, Rehner SA, et al. (2000). Phylogenec
relaonships of agaric fungi based on nuclear large subunit
ribosomal DNA sequences. Systemac Biology 49: 278−305.
Moncalvo JM, Nilsson RH, Koster B, et al. (2006). The cantharelloid
© 2021 Westerdijk Fungal Biodiversity Instute
Taxonomy and phylogeny of Hormomyces
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
195
clade: Dealing with incongruent gene trees and phylogenec
reconstrucon methods. Mycologia 98: 937−948.
MyCoPortal (2019). hp://mycoportal.org/portal/index.php.
Nilsson RH, Larsson KH, Larsson E, et al. (2006). Fruing body-guided
molecular idencaon of root-p mantle mycelia provides strong
indicaons of ectomycorrhizal associaons in two species of
Sistotrema (Basidiomycota). Mycological Research 110: 1426−1432.
NITE Biological Resource Center (NBRC) (2019). hps://www.nite.
go.jp/nbrc/catalogue/NBRCCatalogueDetailServlet?ID=NBRC&C
AT=00030400.
Oberwinkler F. Cruz D, Suárez JP (2017). Chapter 12. Biogeography
and ecology of Tulasnellaceae. In: Biogeography of Mycorrhizal
Symbiosis (Tedersoo L, ed). Springer. Switzerland: 237−271.
Parthibhan S, Ramasubbu R (2020). Mycorrhizal and endophyc
fungal associaon in Paphiopedilum druryi (Bedd.) Stein — A strict
endemic and crically endangered orchid of the Western Ghats.
Ecological Genecs and Genomics 16: 100059.
Patouillard N (1900). Essai taxonomique sur les familles et les genres
des Hyménomycètes. Imprimerie et Lithographie L. Declume, Lon-le
Saunier, France.
Pereira OL, Rollemberg CL, Borges AC, et al. (2003). Epulorhiza
epiphyca sp. nov. isolated from mycorrhizal roots of epiphyc
orchids in Brazil. Mycoscience 44: 153−155.
Pippola E, Koranta H (2008). The genus Tremella (Basidiomycota,
Tremellales) in Finland. Annales Botanici Fennici 45: 401−434.
Poli A, Vizzini A, Prigione V, et al. (2018). Basidiomycota isolated from
the Mediterranean Sea — Phylogeny and putave ecological roles.
Fungal Ecology 36: 51−62.
Preußing M, Nebel M, Oberwinkler F, et al. (2010). Diverging diversity
paerns in the Tulasnella (Basidiomycota, Tulasnellales) mycobionts
of Aneura pinguis (Marchanophyta, Metzgeriales) from Europe
and Ecuador. Mycorrhiza 20: 147−159.
Rachanarin C, Suwannarach N, Kumla J, et al. (2016). A new
endophyc fungus, Tulasnella phuhinrongklaensis (Cantharellales,
Basidiomycota) isolated from roots of the terrestrial orchid,
Phalaenopsis pulcherrima. Phytotaxa 374: 99−109
Raja HA, Miller AN, Pearce CJ, et al. (2017). Fungal idencaon
using molecular tools: A primer for the natural products research
community. Journal of Natural Products 80: 756−770.
Rambaut A (2016). FigTree v. 1.4.0. hp://tree.bio.ed.ac.uk/soware/
gtree/.
Raper KB, Thom C (1949). Manual of the Penicillia. The Williams &
Wilkins Company, Balmore, United States.
Roberts P (1994). Globose and ellipsoid-spored Tulasnella species from
Devon and Surrey, with a key to the genus in Europe. Mycological
Research 98: 1431−1452.
Roberts P (1997). New Heterobasidiomycetes from Great Britain.
Mycotaxon 63: 195−216.
Roche SA, Carter RJ, Peakall R, et al. (2010). A narrow group of
monophylec Tulasnella (Tulasnellaceae) symbiont lineages are
associated with mulple species of Chiloglos (Orchidaceae):
Implicaons for orchid diversity. American Journal of Botany 97:
1313−1327.
Ronquist F, Teslenko M, van der Mark P, et al. (2012). MrBayes3.2:
Ecient Bayesian phylogenec inference and model choice across
a large model space. Systemac Biology 61: 539−542.
Saccardo PA (1888). Sylloge Hymenomycetum, Vol. II. Polyporeae,
Hydneae, Thelephoreae, Clavarieae, Tremellineae. Sylloge
Fungorum 6: 1−928.
Saccardo PA (1916). Hymeniales (ceterae Agaricaceae, Polyporaceae,
Hydnaceae, Thelephoraceae, Tremellaceae). Flora Italica
Cryptogama Fungi 1: 577−1386.
Samuels GJ, Ismaiel A, Rosmana A, et al. (2012). Vascular Streak Dieback
of cacao in Southeast Asia and Melanesia: In planta detecon of the
pathogen and a new taxonomy. Fungal Biology 116: 11−23.
Schroers H-J, Samuels GJ, Seifert KA, et al. (1999). Classicaon of
the mycoparasite Gliocladium roseum in Clonostachys as C. rosea,
its relaonship to Bionectria ochroleuca, and notes on other
Gliocladium-like fungi. Mycologia 91: 365−385.
Schroers H-J (2001). A monograph of Bionectria (Ascomycota,
Hypocreales, Bionectriaceae) and its Clonostachys anamorphs.
Studies in Mycology 46: 1−211.
Seifert K, Morgan-Jones G, Gams W, et al. (2011). The Genera of
Hyphomycetes. CBS Biodiversity Series no. 9: 1–997. CBS-KNAW
Fungal Biodiversity Centre, Utrecht, Netherlands.
Shao SC, Buyck B, Hofsteer V, et al. (2014). Cantharellus hygrophorus,
a new species in subgenus Afrocantharellus from tropical
Southwestern China. Cryptogamie, Mycologie 35: 283−291.
Sheerson RP, Weiß M, Kull T, et al. (2005). High specicity generally
characterizes mycorrhizal associaon in rare lady’s slipper orchids,
genus Cypripedium. Molecular Ecology 14: 613−626.
Smith MT (1997). Oosporidium Stautz. In: The yeasts — A taxonomic
study (Kurtzman C, Fell JW, eds). Elsevier. Amsterdam, The
Netherlands: 598−599.
Spegazzini C (1889). Fungi Puiggariani. Pugillus 1. Bolen de la Academia
Nacional de Ciencias en Córdoba 11: 381−622.
Staeu FA, Cowan RS (1976). Taxonomic literature. Vol. 1: A−G. 2nd ed.
Bohn, Scheltema & Hollemam, Netherlands, Utrecht.
Stalpers JA, Redhead S, Rossman AY, et al. (2021). Compeng sexual-
asexual generic names in the Agaricomycona (Basidiomycota),
with recommendaons for use. IMA Fungus: In press.
Suárez JP, Weiß M, Abele A, et al. (2006). Diverse tulasnelloid fungi
form mycorrhizas with epiphyc orchids in an Andean cloud forest.
Mycological Research 110: 1257−1270.
Sumsne DR (1914). New or interesng fungi. Mycologia 6: 32−36.
Taylor DL, Bruns TD, Szaro TM, et al. (2003). Divergence in mycorrhizal
specializaon within Hexalectris spicata (Orchidaceae), a non-
photosynthec desert orchid. American Journal of Botany 90:
1168−1179.
Taylor DL, McCormick MK (2008). Internal transcribed spacer primers
and sequences for improved characterizaon of basidiomycetous
orchid mycorrhizas. New Phytologist 177: 1020−1033.
Thiers B (2019). Index Herbariorum: A global directory of public
herbaria and associated sta. New York Botanical Garden’s Virtual
Herbarium. hp://sweetgum.nybg.org/science/ih/.
Tubaki K (1976). Cultural and taxonomical studies on Hormomyces
auranacus. Transacons of the Mycological Society of Japan 17:
243−247.
Turland NJ, Wiersema JH, Barrie FR, et al. (eds.) (2018). Internaonal
Code of Nomenclature for algae, fungi, and plants (Shenzhen
Code) adopted by the Nineteenth Internaonal Botanical Congress
Shenzhen, China, July 2017. Regnum Vegetabile 159. Koeltz
Botanical Books. Glashüen, Germany.
Van de Put K, Antonissen I (1996). Tulasnella’s uit Vlaanderen. Bijdrage
tot de kennis van de Heterobasidiomyceten in Vlaanderen.
Sterbeeckia 17: 44−69.
Vanderwolf KJ, McAlpine DF, Malloch D, et al. (2013). Ectomycota
associated with hibernang bats in eastern Canadian caves prior to
the emergence of White-nose Syndrome. Northeastern Naturalist
20: 115−130.
Vasco-Palacios M (2016). Ectomycorrhizal fungi in Amazonian tropical
forests in Colombia. Thesis. Utrecht University, Netherlands.
Von Höhnel F (1917). Mykologische Fragmente. Annales Mycologici 15:
293−383.
© 2021 Westerdijk Fungal Biodiversity Instute
Mack et al.
Editor-in-Chief
Prof. dr P.W. Crous,Westerdijk Fungal BiodiversityInstitute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.
E-mail:p.crous@westerdijkinstitute.nl
196
Vu D, Groenewald M, de Vries M, et al. (2019). Large scale generaon
and analysis of lamentous fungal DNA barcodes boosts coverage
for kingdom fungi and reveals thresholds for fungal species and
higher taxon delimitaon. Studies in Mycology 92: 135−154.
Weiß M, Bauer R, Sampaio JP, et al. (2014). Tremellomycetes and related
groups. In: The Mycota: Systemacs and Evoluon (McLaughlin DJ,
Spatafora JW, eds). Springer-Verlag Berlin, Germany: 331−355.
White TJ, Bruns T, Lee S, et al. (1990). Amplicaon and direct
sequencing of fungal ribosomal RNA genes for phylogenecs. In:
PCR protocols: A guide to the methods and applicaons (Innis MA,
Gelfand DH, Sninsky JJ, et al., eds). Academic Press, New York,
United states: 315−322.
Wilson N, Hollinger J, et al. (2020). Mushroom Observer. hps://
mushroomobserver.org/
Wu CL, He Y, Yan J, et al. (2019). Two new species of Clavulina
(Cantharellales) from southwestern China based on morphological
and molecular evidence. Mycological Progress 18: 1071−1078.
Yu Z, Fischer R (2018). Light sensing and responses in fungi. Nature
Review Biology 17: 25−36.
Zamora JC, Millanes AM, Wedins M, et al. (2016). Understanding
lichenicolous heterobasidiomycetes: New taxa and reproducve
innovaons in Tremella s.l. Mycologia 108: 381−396.
Zang M, Wang SL (1997). A new species of the genus Hormomyces from
China — Hormomyces paridiphilus. Acta Botanica Yunnanica 19:
324−324.
Zelmer CD, Currah RS (1995). Ceratorhiza pernacatena and Epulorhiza
calendulina spp. nov.: Mycorrhizal fungi of terrestrial orchids.
Canadian Journal of Botany 73: 1981−1985.
Supplementary Material: hp://fuse-journal.org/
Figure S1. Mean conidial dimensions (with error bars represenng
standard error) for all herbarium specimens and cultures examined,
with the holotype of H. fragiforme represented by orange bars and the
holotype of H. callorioides represented by green bars.
Figure S2. Lectotype of H. fragiformis (A, C, E) and holotype of H.
callorioides (B, D, F). A, B. Rehydrated sporodochia. C−F. Conidial chains.
Scale bars: A, B = 500 μm. C−F = 10 μm.
Figure S3. Conidia and conidial chains. A. Oosporidium sp. (DAOM
970823) idened using DNA sequencing. B. Holotype of Sphaerocolla
auranaca (H). Both have similar conidial morphology and dimensions,
suggesng that S. auranaca may be conspecic with Oosporidium
margariferum. Scale bar = 10 μm.
Figure S4. Nuclear staining of hyphae of DAOMC 251988, showing
dikaryoc, binucleate hyphae, A, using near-UV light showing the
stained nuclei and B with regular light. Scale bar = 20 μm.
Table S1. Species, geographical locaon, host and herbaria for known
type specimens of Hormomyces species.
