Biallelic DAB1 Variants Are Associated With Mild Lissencephaly and Cerebellar Hypoplasia

Abstract

Objective
We aimed to identify pathogenic variants in a girl with epilepsy, developmental delay, cerebellar ataxia, oral motor difficulty, and structural brain abnormalities with the use of whole-exome sequencing.

Methods
Whole-exome trio analysis and molecular functional studies were performed in addition to the clinical findings and neuroimaging studies.

Results
Brain MRI showed mild pachygyria, hypoplasia of the cerebellar vermis, and abnormal foliation of the cerebellar vermis, suspected for a variant in one of the genes of the Reelin pathway. Trio whole-exome sequencing and additional functional studies were performed to identify the pathogenic variants. Trio whole-exome sequencing revealed compound heterozygous splice variants in DAB1 , both affecting the highly conserved functional phosphotyrosine-binding domain. Expression studies in patient-derived cells showed loss of normal transcripts, confirming pathogenicity.

Conclusions
We conclude that these variants are very likely causally related to the cerebral phenotype and propose to consider loss-of-function DAB1 variants in patients with RELN-like cortical malformations.

Full text

ARTICLE OPEN ACCESS
Biallelic DAB1 Variants Are Associated With Mild
Lissencephaly and Cerebellar Hypoplasia
Daphne J. Smits, MD, Msc, Rachel Schot, BSc, Martina Wilke, PhD, Marjon van Slegtenhorst, PhD,
Marie Claire Y. de Wit, MD, PhD, Marjolein H.G. Dremmen, MD, MSc, William B. Dobyns, MD, PhD,
A. James Barkovich, MD, PhD, and Grazia M.S. Mancini, MD, PhD
Neurol Genet 2021;7:e558. doi:10.1212/NXG.0000000000000558
Correspondence
Dr. Mancini
g.mancini@erasmusmc.nl
Abstract
Objective
We aimed to identify pathogenic variants in a girl with epilepsy, developmental delay, cerebellar
ataxia, oral motor difficulty, and structural brain abnormalities with the use of whole-exome
sequencing.
Methods
Whole-exome trio analysis and molecular functional studies were performed in addition to the
clinical findings and neuroimaging studies.
Results
Brain MRI showed mild pachygyria, hypoplasia of the cerebellar vermis, and abnormal foliation
of the cerebellar vermis, suspected for a variant in one of the genes of the Reelin pathway. Trio
whole-exome sequencing and additional functional studies were performed to identify the
pathogenic variants. Trio whole-exome sequencing revealed compound heterozygous splice
variants in DAB1, both affecting the highly conserved functional phosphotyrosine-binding
domain. Expression studies in patient-derived cells showed loss of normal transcripts, con-
firming pathogenicity.
Conclusions
We conclude that these variants are very likely causally related to the cerebral phenotype and
propose to consider loss-of-function DAB1 variants in patients with RELN-like cortical
malformations.
From the Department of Clinical Gene tics (D.J.S., R.S., M.W., M.S., G.M .S.M.), ErasmusMC University Medic al Center Rotterdam; Department of Child Neurology (M.C.Y.W.) and
Department of Radiology (M.H.G.D.), So phia Children’s Hospital, ErasmusMC Uni versity Medical Center Rotterdam, the Netherlands; Department of Pediatric s (W.B.D.), University of
Washington; Department of Neurolog y (W.B.D.), University of Washington, Seattle; Center for Integrative Brain Research (W.B.D.), Seattle Children’s Research Insti tute, WA; De-
partment of Human Genetics (W.B.D.), Unive rsity of Minnesota, Minneapolis; Departm ent of Radiology and Biomedical Imaging (A.J .B.), University of California, San Franci sco; and
ENCORE Expertise Center for Neurodevelo pmental Disorders (M.C.Y.W., M.H.G .D., G.M.S.M.), ErasmusMC Universi ty Medical Center, Rotterdam, the Net herlands.
Go to Neurology.org/NG for full disclosures. Funding information is provided at the end of the article.
The Article Processing Charge was funded by the authors.
This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivativesLicense 4.0 (CC BY-NC-ND), which permits downloading
and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.
Copyright © 2021 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1

The Disabled-1 (DAB1) gene encodes a key regulator in
Reelin signaling, a critical pathway mediating correct posi-
tioning of neurons within the developing brain.
1,2
In mice,
both Dab1 and Reln are essential for proper cortical layering
during embryonic development. Binding of Reelin to the li-
poprotein receptors VLDLR and APOER2 on the neuronal
surface leads to phosphorylation of DAB1 and activates
downstream signaling cascades. Dab1-depleted mice present
with a phenotype comparable to Reelin-deficient mice, in-
cluding disruption of neuronal layering in the cerebral cortex,
hippocampus, and cerebellum.
3
Yet, human loss-of-function (LoF) mutations in DAB1 have
not been described, whereas biallelic LoF mutations in RELN
(OMIM #600514) are well known to cause a similar pheno-
type as seen in the murine counterpart. Recessive RELN
variants cause a distinctive lissencephaly, associated with
prominent hypoplasia of the pons, the cerebellar hemispheres,
and the vermis.
4
A similar but milder phenotype is described
for VLDLR (OMIM #192977) variants.
5
The only human
disease related to DAB1 is spinocerebellar ataxia type-37
(SCA37, OMIM #615945), caused by (ATTTC)
n
insertions
in the 59UTR of DAB1.
6
Several studies show that SCA37
occurs through gain-of-function (GoF) mechanisms, of which
only 1 is directly related to DAB1 expression because the
insertion results in overexpression of DAB1 protein and al-
ternative DAB1 transcripts.
7
Here, we report a patient with biallelic LoF variants in DAB1,
presenting with RELN-like malformations including mild
lissencephaly and cerebellar hypoplasia.
Methods
Consent
The study was approved by the local IRBs (Erasmus MC
Rotterdam, protocol METC-2012387). Written informed
consent to participate in this study was obtained from the
parents of the participant.
Whole-Exome Sequencing
Whole-exome sequencing (WES) was performed on the
Agilent Sure Select platform (Clinical research Exome Cap-
ture), run on HiSeq (101bp paired-end, Illumina), using the
diagnostic certified pipeline of the department of Clinical
Genetics, ErasmusMC, Rotterdam. The average coverage is
;50×. Data are demultiplexed by the Illumina Software
CASAVA. Reads are mapped with the program BWA (bio-bwa.
sourceforge.net/). Variants are detected with the Genome
Analysis Toolkit (broadinstitute.org/gatk/). The Variant
Calling File is filtered in Alissa Interpret.
Sanger Sequencing
Amplification reactions were conducted according to stan-
dard methods and purified with ExoSAP-IT (USB). Direct
sequencing was performed with Big Dye Terminator chem-
istry (Applied Biosystems). DNA fragment analysis was per-
formed with capillary electrophoresis on an ABI3130 Genetic
Analyzer (Applied Biosystems) with the software package
Seqscape (Applied Biosystems).
Quantitative Reverse Transcription PCR
Fibroblasts from skin biopsies were grown in DMEM (10%
fetal bovine serum, 1% L-glutamine, and 1% penicillin/
streptomycin) at 37°C and 5% CO
2
,followedbyRNAiso-
lation using the RNeasy mini kit (QIAGEN). RNA was reverse
transcribed with the iScript cDNA synthesis kit (Bio-Rad
Laboratories). Quantitative reverse transcription PCR was
performed using iTaq Universal SYBR Green Supermix
(Bio-Rad) and the following primer sequences: DAB1_rt
_c307_1F:TCGGGATTGATGAAGTTTCC;DAB1_rt_c307_
1R:AGCCTCAAACACAATGTACTGG;DAB1_rt_c67_
2F:GAGGATGCTCTGGGCTAGG;DAB1_rt_c67_2R:
AAAGATTTTGATTCCTCCAAAGG.
Data Availability
WES data are deposited at the ISO certified diagnostic labo-
ratory of the Department of Clinical Genetics, Erasmus MC,
in respect to the family’s privacy.
Results
Case Report
The affected individual was born at term after an uneventful
delivery from unrelated healthy parents. In infancy, she had
gastrointestinal reflux and excessive crying. She tolled over at 8
months, sat unsupported at 14 months, and walked at age 3
years. Cognitive development initially raised no concern, but
during the first years, learning problems became apparent and
she now attends special school (IQ: 50–60). The onset of focal
epilepsy was at age 6 years; seizure semiology was loss of
awareness, staring, without clear motor signs. Oxcarbazepine
(8 mg/d) reduced seizure frequency, but absences persist once/
twice a week without additional signs. Physical examination at
age 11 years showed mild cerebellar ataxia, oculomotor apraxia,
mild dysmetria of the upper extremities, impaired tandem gait,
impaired facial muscle coordination, dysarthria, instability dur-
ing Romberg test, dysdiadokokinesis, squint, mild pyramidal
signs, joint hypermobility, normal muscular tone, and sym-
metrically low deep tendon reflexes. Head circumference was −1
SD; weight and height were within the normal range. Standard
EEG at age 10 years showed no epileptic activity, normal pos-
terior activity, excess of theta and delta waves in frontopolar,
Glossary
GoF = gain of function; LoF = loss of function; PTB = phosphotyrosine binding; WES = whole-exome sequencing.
2Neurology: Genetics | Volume 7, Number 2 | April 2021 Neurology.org/NG

frontal, and temporal areas with occasional sharp waves in
frontotemporal regions (left more than right), and normal
photic stimulation response. Brain MRI at age 12 years showed
cortical malformations reminiscent of RELN-related malfor-
mations, including mild pachygyria, i.e., decreased number of
gyri with moderately thickened cortex (more prominent in the
frontal lobes), mildly thin corpus callosum, enlarged peri-
vascular spaces, and mildly enlarged lateral ventricles. The cer-
ebellar vermis was hypoplastic and showed abnormal foliation.
Abnormal foliation was observed to a lesser extent in the cer-
ebellar hemispheres. The pons, the basal ganglia, and the hip-
pocampal folding were normal (figure 1).
Genomic Analysis and Expression Studies
High-resolution genomic microarrays showed normal female
pattern. Sanger sequencing of RELN was normal. WES trio
analysis identified compound heterozygosity for DAB1 splice site
variants. The first variant (Chr1(GRCh37):g.57756635C>A
Figure 2 Functional Analysis of DAB1 Variants
(A) RT-PCR of DAB1 mRNA from the affected
individual(p) and 5 age- and sex-matched control
samples(c1-5). Primers were designed to amplify
a product of 450 bp for the 67+1G>T variant and
a product of 470 bp for the 307-2A>T variant. For
the 67+1G>T variant, an alternative mRNA splice
product is formed in the affected individual,
which could be explained by the deletion of exon
4 (exon 4 contains 203 bp). (B) Structural model
of the DAB1 PTB domain. The panel (B.a) shows
the structure of the entire domain. Localization
of the deleted amino acids is depicted in the
other panels (B.b–B.d). (C) Sanger sequencing
results of the c.307-2A>T transcript. PTB =
phosphotyrosine binding; RT-PCR = reverse
transcription PCR.
Figure 1 Brain MRI
Brain MRI of the affected individual with axial
T2-weighted images (A–E), coronal T2-weighted
images (F and G), and midsagittal T1-weighted
image (H). Mild and diffuse cortical pachygyria
more prominent in the frontal lobes (arrow in
A and D), mildly thin corpus callosum (H, arrow),
hypoplasia and abnormal foliation of cerebellar
hemispheres (E and F, arrow head) and more
pronounced vermis hypoplasia (H, arrow head),
enlarged perivascular spaces (A–G), and lateral
ventricles (B and G, arrow), all reminiscent of an
RELN/VLDLR pattern.
Neurology.org/NG Neurology: Genetics | Volume 7, Number 2 | April 2021 3

NM_021080.3 c.67+1G>T, p.?) is located in the splice donor
site of intron 4 and has never been reported in GnomAD. Splice
prediction programs (MaxEntScan, NNSPLICE, GeneSplicer)
predict an in-frame deletion of exon 4. Of interest, this deletion
eliminates the ATG initiation site and the corresponding Kozak
consensus sequence. Reverse transcription PCR on cDNA-
derived from fibroblasts confirmed that the c.67+1G>T variant
leads to a shorter, but stable, transcript (figure 2A). The second
variant (Chr1(GRCh37):g.57538089T>A NM_021080.3
c.307-2A>T, r.307_315del9 p.Ala103_Gln105del) affects the
splice acceptor site of intron 6, resulting in an in-frame deletion
of 3 amino acids of exon 7, which are part of a β-sheet forming
the highly conserved phosphotyrosine-binding (PTB) domain
(figure 2B). Sanger sequencing confirmed this deletion (figure
2C). Heterozygosity was confirmed for both parents. Despite
database searches (genematcher.org) and international contacts
(Neuro-MIG), we did not identify another individual with a
similar phenotype.
Discussion
Here, we report an individual with biallelic splice variants in
DAB1. Given the RELN-like phenotype at MRI and the
similarities of our patient with RELN/VLDRL-associated
phenotypes, we conclude that the observed DAB1 variants are
very likely related to the cerebral malformations in our
patient.
4,5
The DAB1 splice variants in our patient result in
alternative transcripts affecting the highly conserved PTB
domain. Translation of any DAB1 isoform containing this
domain from the c.67+1G>T transcript is unlikely because it
eliminates the methionine start codon. The c.307-
2A>Tp.Ala103_Gln105del variant results in a protein con-
taining this domain, but with a deletion of 3 amino acids, most
likely altering protein folding. Although the precise effect of
this deletion on protein structure and binding capacities re-
mains unclear, the heterozygote parent carrying the c.67+1-
G>T p.? variant is healthy, supporting the additional
pathogenic effect of the c.307-2A>Tp.Ala103_Gln105del
variant.
In vitro, the PTB domain binds to cytoplasmic tails of the
VLDLR and apoER2. This interaction is essential because
binding of Reelin to these receptors induces DAB1 tyrosine
phosphorylation and subsequent activation of downstream
signaling pathways. Mice lacking the DAB1 PTB domain
show almost complete absence of distinct cell layers in the
cortex, a small and unfoliated cerebellum, and abnormal
neuronal layering in the hippocampus.
3
GoF mechanisms have been previously described in relation
to DAB1 autosomal dominant mutations, causing SCA37.
6
Although our patient presents with mild cerebellar ataxia,
most of the phenotypic features are very distinguishable from
SCA37.
7,8
The proposed mechanisms causing SCA37 (e.g.,
DAB1 overexpression, RNA foci formation) are very distinct
from the effect of the LoF variants described here, which
explains the phenotypic differences and the early age at onset
in our patient. Our results indicate that DAB1 LoF variants
should be considered in patients with RELN-like cortical
malformations at MRI. In addition, we propose inclusion of
DAB1 in diagnostic exome panels devoted to brain malfor-
mations, intellectual disability, and epilepsy.
Acknowledgment
The authors thank the patient family for participation in the study.
The Neuro-MIG network, (COST Action CA16118 neuro-MIG.
org), fostered interaction among the authors D.J. Smits, M. Wilke,
W.B. Dobyns, A.J. Barkovich, and G.M.S. Mancini.
Study Funding
No targeted funding reported.
Disclosure
The authors report no disclosures. Go to Neurology.org/NG
for full disclosures.
Publication History
Received by Neurology: Genetics September 3, 2020. Accepted in final
form December 2, 2020.
Appendix Authors
Name Location Contribution
Daphne J.
Smits, MD,
Msc
ErasmusMC University
Medical Center,
Rotterdam, the
Netherlands
Writing the draft and
performing the
experiments
Rachel Schot,
BSc
ErasmusMC University
Medical Center,
Rotterdam, the
Netherlands
Performing the
experiments and revising
Martina
Wilke, PhD
ErasmusMC University
Medical Center,
Rotterdam, the
Netherlands
Analysis of data and
revising
Marjon van
Slegtenhorst,
PhD
ErasmusMC University
Medical Center,
Rotterdam, the
Netherlands
Analysis of data and
revising
Marie Claire
Y. de Wit, MD,
PhD
ErasmusMC University
Medical Center,
Rotterdam, the
Netherlands
Acquisition of data and
revising
Marjolein
H.G.
Dremmen,
MD, MSc
ErasmusMC University
Medical Center,
Rotterdam, the
Netherlands
Analysis of data and
revising
William B.
Dobyns, MD,
PhD
University of Minnesota,
Minneapolis
Supervision, interpretation
of data, and revising
A. James
Barkovich,
MD, PhD
University of California,
San Francisco
Supervision, interpretation
of data, and revising
Grazia M.S.
Mancini, MD,
PhD
ErasmusMC University
Medical Center,
Rotterdam, the
Netherlands
Supervision, formulation
of research goals,
interpretation of data, and
writing the draft
4Neurology: Genetics | Volume 7, Number 2 | April 2021 Neurology.org/NG

References
1. Howell BW, Lanier LM, Frank R, Gertler FB, Cooper JA. The disabled 1
phosphotyrosine-binding domain binds to the internalization signals of trans-
membrane glycoproteins and to phospholipids. Mol Cell Biol 1999;19:5179–5188.
2. Zhang JH, Zhao YF, He XX, et al. DCC-mediated Dab1 phosphorylation participates in
the multipolar-to-bipolar transition of migratingneurons. Cell Rep 2018;22:3598–3611.
3. Howell BW, Hawkes R, Soriano P, Cooper JA. Neuronal position in the developing
brain is regulated by mouse disabled-1. Nature 1997;389:733–737.
4. Hong SE, Shugart YY, Huang DT, et al. Autosomal recessive lissencephaly with
cerebellar hypoplasia is associated with human RELN mutations. Nat Genet 2000;26:
93–96.
5. Valence S, Garel C, Barth M, et al. RELN and VLDLR mutations underlie two
distinguishable clinico-radiological phenotypes. Clin Genet 2016;90:545–549.
6. Loureiro JR, Oliveira CL, Mota C, et al. Mutational mechanism for DAB1 (ATTTC)n
insertion in SCA37: ATTTT repeat lengthening and nucleotide substitution. Hum
Mutat 2019;40:404–412.
7. Corral-Juan M, Serrano-Munuera C, Rabano A, et al. Clinical, genetic and neuro-
pathological characterization of spinocerebellar ataxia type 37. Brain 2018;141:
1981–1997.
8. Seixas AI, Loureiro JR, Costa C, et al. A pentanucleotide ATTTC repeat insertion in
the non-coding region of DAB1, mapping to SCA37, causes spinocerebellar ataxia.
Am J Hum Genet 2017;101:87–103.
Neurology.org/NG Neurology: Genetics | Volume 7, Number 2 | April 2021 5

DOI 10.1212/NXG.0000000000000558
2021;7; Neurol Genet
Daphne J. Smits, Rachel Schot, Martina Wilke, et al.
Hypoplasia
Variants Are Associated With Mild Lissencephaly and CerebellarDAB1Biallelic
This information is current as of January 21, 2021
reserved. Online ISSN: 2376-7839.
Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology.. All rights
an open-access, online-only, continuous publication journal. Copyright Copyright © 2021 The Author(s).
is an official journal of the American Academy of Neurology. Published since April 2015, it isNeurol Genet

Services
Updated Information & http://ng.neurology.org/content/7/2/e558.full.html
including high resolution figures, can be found at:
References http://ng.neurology.org/content/7/2/e558.full.html##ref-list-1
This article cites 8 articles, 1 of which you can access for free at:
Subspecialty Collections
http://ng.neurology.org//cgi/collection/mri
MRI http://ng.neurology.org//cgi/collection/developmental_disorders
Developmental disorders http://ng.neurology.org//cgi/collection/cerebellum
Cerebellum http://ng.neurology.org//cgi/collection/all_genetics
All Genetics http://ng.neurology.org//cgi/collection/all_epilepsy_seizures
All Epilepsy/Seizures
following collection(s):
This article, along with others on similar topics, appears in the
Permissions & Licensing
http://ng.neurology.org/misc/about.xhtml#permissions
its entirety can be found online at:
Information about reproducing this article in parts (figures,tables) or in
Reprints http://ng.neurology.org/misc/addir.xhtml#reprintsus
Information about ordering reprints can be found online:
reserved. Online ISSN: 2376-7839.
Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology.. All rights
an open-access, online-only, continuous publication journal. Copyright Copyright © 2021 The Author(s).
is an official journal of the American Academy of Neurology. Published since April 2015, it isNeurol Genet