Content uploaded by Vyacheslav Vlasenko
Author content
All content in this area was uploaded by Vyacheslav Vlasenko on Dec 06, 2021
Content may be subject to copyright.
A new epiphytic species,
Symphytocarpus macrosporus
(Myxomycetes) from Western
Siberia, Russia
Anastasia Vlasenko
1,*
, Nina Filippova
2
& Vyacheslav Vlasenko
1
1
Central Siberian Botanical Garden, Siberian Branch,
Russian Academy of Sciences, Zolotodolinskaya, 101,
Novosibirsk, RU-630090, Russia;
e-mail: anastasiamix81@mail.ru
2
Yugra State University, Chekhova, 16,
Khanty-Mansiysk, RU-628012, Russia;
e-mail: filippova.courlee.nina@gmail.com
1
Central Siberian Botanical Garden, Siberian Branch,
Russian Academy of Sciences, Zolotodolinskaya, 101,
Novosibirsk, RU-630090, Russia;
e-mail: vlasenkomyces@mail.ru
* Corresponding author: anastasiamix81@mail.ru
Keywords: molecular data, morphology, myxomycetes,
new records, SEM, SSU rDNA gene sequences,
Stemonitidales, taxonomy.
Article info:
Received: 07 August 2020
Accepted: 11 November 2020
Published online: 14 January 2021
Corresponding Editor: Oleg Shchepin
Abstract
A new species Symphytocarpus macrosporus is de-
scribed based on collections made in the Khan-
ty-Mansi Autonomous Area – Yugra, Russia. ir-
ty-two specimens of the new species were isolated
from moist chambers with Picea obovata and Abies
siberica bark. e new species is characterized by
the presence of pseudoaethalia, without cortex,
with peridium remaining as fragments. is new
species clearly diers from previously described
species of the genus by both morphological and mo-
lecular characters. It has large spores, (14)15–17(18)
μm diam. with irregular ornamentation of large
warts. Such a spore size seems to be the largest for
the genus. e holotype specimen of Symphytocar-
pus macrosporus is stored in the M.G. Popov Her-
barium (NSK), Novosibirsk, Russia. It is the rst new
species described within the genus Symphytocarpus
since 1984.
doi:10.29203/ka.2020.505
Karstenia, Volume 58 (2020), Issue 2, pages 393–400
www.karstenia.fi
ORIGINAL
RESEARCH
394
Introduction
e myxomycetes are a group of fungus-like organ-
isms usually present in terrestrial ecosystems. ey
form a well-dened and homogenous group of ap-
proximately 1100 species (Lado 2005–2020). Stud-
ies of soil microbiota show the importance of this
group in ecosystems where they occur. ey serve
as regulators of population size in bacteria, yeasts,
and lamentous fungi, and take part in nutrient
cycling and mineralization (Martin & Alexopoulos
1969, Urich et al. 2008).
e Stemonitidaceae is a large and wide-
spread group of myxomycetes. Since Elias Magnus
Fries established this family in 1829, 19 genera and
around 260 species have been reported worldwide
(Lado 2005–2020). is family is characterized by
dark-colored spore masses, capillitia consisting of
smooth dark threads, prominent columella as well
as the absence of lime in all parts of fruiting body.
Fruiting bodies are sporangiate or stipitate, how-
ever sessile sporangia, aethalia, pseudoaethalia or
plasmodiocarps occasionally occur.
Symphytocarpus is a small genus in the Stemo-
nitidaceae described by Ing and Nannenga-Breme-
kamp (1967), and includes species with pseudoae-
thalia fruiting bodies. is type of fruiting body
is transitional between sporocarp, typical for the
genus Stemonitis Gled., and aethalium, typical for
the genus Amaurochaete Rostaf. (Ing & Nannenga-
Bremekamp 1967).
e genus Symphytocarpus is characterized by
dark compactly-growing sporocarps, partly fusing
in the colony and forming pseudoaethalia; hollow,
rarely at and horny columella; fugacious peridium;
and lack of capillitium surface net. Species of the ge-
nus Symphytocarpus inhabit bark and wood of the
dead trees, litter, mosses, and bark of the living trees.
Eight species of Symphytocarpus are known so
far (Lado 2005–2020). Five of them were found in
Russia: S. impexus Ing et Nann.-Bremek. and S. tre-
chisporus (Berk. ex Torrend) Nann.-Bremek. were
only found in the European part of the country, and
S. amaurochaetoides Nann.-Bremek., S. conuens
(Cooke et Ellis) Ing et Nann.-Bremek. and S. ac-
cidus (Lister) Ing et Nann.-Bremek. were recorded
from the Asian part (Novozhilov 2005, Novozhilov
et al. 2010).
is paper presents morphological, ecological,
and geographical data on the new Symphytocarpus
species and its SSU barcode sequence.
Materials and Methods
Moist-chamber method
e new Symphytocarpus species was isolated us-
ing the moist-chamber method (Gilbert & Martin
1933). Sporocarps were found in 32 Petri dishes on
bark collected from living trees in three localities in
the Khanty-Mansi Autonomous Area – Yugra, in-
cluding 30 isolates from Picea obovata Ledeb. and
2 isolates from Abies sibirica Ledeb. Bark pieces cut
from a living tree at 1.5 meters height were placed
into Petri dishes on single layered filter paper. We
used the new modied technique for cultivating
myxomycetes in moist chambers developed by A.V.
Vlasenko (Vlasenko & Vlasenko 2020), based on a
traditional technique (Härkönen 1977).
Morphological analysis
For the morphological analysis we used Stemi DV4
stereomicroscope, Axiolab E-re light microscope
and Zeiss Axio Imager A1 light microscope (Carl
Zeiss Microscopy, Germany). We used polyvinyl
lactophenol for making permanent microscope
slides, and oil immersion for spore size and orna-
mentation analysis. e SEM micrographs were
produced using Carl Zeiss EVO MA 10 microscope.
Specimens were air-dried and mounted on alumin-
ium stubs with double-sided sticky lm, and then
sputter-coated with gold. e nomenclature of myx-
omycetes used in this work follows the database of
Lado (2005–2020).
DNA extraction and sequencing
We extracted genomic DNA from the whole pseu-
doaethalia which we crushed using tissue grinding
pestles in 1.5 mL centrifuge tubes with added alu-
minium oxide (Al2O3), which we then homogenized
with pestles. To extract nuclear DNA we used the
395
Phyto-Sorb kit (Synthol, Moscow). A fragment of
the 18S rDNA (SSU) region (the rst ca. 600 nucle-
otides) was amplified in PCR using the SNPdetect
modied HS Taq DNA Polymerase (Evrogen, Mos-
cow) and primers developed by V.A. Vlasenko: for-
ward primer DarkPHY1F (TTCTCTCTGAATCTGC)
and two reverse primers DarkPHY1R (CGACTAC-
GAGCGTTTTAAC) and DarkSTE1R (AGAGGCT-
GTTTAGAAC). PCR reactions were performed in
C1000 ermal Cycler (Bio-Rad, USA) and visual-
ized with Gel Doc XR+ Imager (Bio-Rad, USA). DNA
sequencing was performed in the Siberian Branch
of the Russian Academy of Sciences Genomics Core
Facilities (Novosibirsk, Russia).
Sequence comparison
e partial SSU sequence (587 bp) from the new spe-
cies was searched against GenBank with the Nucle-
otide BLAST tool (Altschul et al. 1990). Additional
SSU sequences of other Stemonitidales species were
retrieved from GenBank. We downloaded SSU se-
quences of Amaurochaete comata, Brefeldia maxima,
and four Symphytocarpus species from GenBank to
compare with the new Symphytocarpus species (Table 1).
Sequences were aligned using ClustalW (ompson
et al. 1994) in MEGA X (Kumar et al. 2018).
Results
Taxonomy
Symphytocarpus macrosporus A. Vlasenko,
sp. nov. (Fig. 1).
Mycobank: MB838364
DESCRIPTION: Individual sporangia are curved,
densely heaped in a pulvinate mass, 0.5–1.5 mm tall,
0.15–0.35 mm diameter, sessile or short-stalked, and
stalk up to 0.2 mm tall, black. Pseudoaethalium 0.5–
2.0 mm high and 2–8 mm diam., black. Columella
absent or, when present, opaque, almost black in
reected light, dark brown in transmitted light. Hy-
pothallus inconspicuous, light brown, shiny, color-
ed similarly to the substrate, and reddish-brown,
distinctly warty in transmitted light. Peridium thin,
membranous, mostly fugacious but persisting as a
collar around the base of the sporotheca, forming
round plates (90–120 μm diam.) which are not con-
nected to the capillitium. Margins of the peridial
plates usually perforated. Capillitial threads black
in reected light, dark brown in transmitted light,
branches are connected to the columella and form a
wide-meshed irregular network with membranous
expansions at the nodes and dark pillow-like thick-
enings. Sometimes free ends of capillitial threads
occur at the periphery of the capillitium, rather sti.
Most often, however, sporothecae of the nearby spo-
rangia form a common large-meshed network due
to the merging of peripheral sections of separate
sporangia into a network. Spores free, almost black
in mass, dark brown in transmitted light, globose,
(14)15–17(18) μm diam., distinctly warted. As visi-
ble by SEM, warts are irregularly distributed, dier-
ent in size.
ETYMOL OGY: with large spores.
TYPE: RUSSIA, Khanty-Mansi Autonomous
Area – Yugra, Khanty-Mansiysky district, 22 km
NE of Khanty-Mansiysk, vicinity of Shapsha settle-
ment, coniferous mixed forest, bark of Picea obova-
ta Ledeb., 61.08094° N, 69.45203° E, 64 m, substrate
samples collected 27 Sept. 2017, N.V. Filippova;
moist chamber culture 23 Oct. 2018, A.V. Vlasenko
(holotype NSK 1030478).
Additional specimens examined: Khanty-Man-
si Autonomous Area – Yugra, Khanty-Mansiysky
district, 22 km NE of Khanty-Mansiysk, vicinity of
Shapsha settlement, coniferous mixed forest, bark
of P. o bov ata, 61.06659° N, 69.46899° E, 51 m, sub-
strate samples collected 28 Sept. 2017, N.V. Filippo-
va; moist chamber culture: 13 Feb. 2019, A.V. Vlasen-
ko (NSK 1030500, NSK 1030518); 09 Oct. 2018, A.V.
Vlasenko (NSK 1030483, NSK 1030472, NSK 1030503,
NSK 1030504, NSK 1030505, NSK 1030509); 23 Oct.
2018, A.V. Vlasenko (NSK 1030375, NSK 1030514,
NSK 1030515, NSK 1030531, NSK 1030540, NSK
1030552); 05 Dec. 2018, A.V. Vlasenko (NSK 1030137,
NSK 1030471, NSK 1030494, NSK 1030517, NSK
1030536, NSK 1030549); 21 Dec. 2018, A.V. Vlasen-
ko (NSK 1030484); 31 Dec. 2018, A.V. Vlasenko (NSK
1030512); 10 Jan. 2019, A.V. Vlasenko (NSK 1030548);
16 Jan. 2019, A.V. Vlasenko (NSK 1030487); 22 Jan.
2019, A.V. Vlasenko (NSK 1030495, NSK 1030572);
396
Fig. 1. Symphytocarpus macrosporus (Holotype NSK 1030478). a: Pseudoaethalia (RL), b: sessile sporangium (TL),
c: short-stalked sporangium (TL), d: hypothallus (TL), e-g: capillitium and spores (TL), h: remains of peridium (TL),
i: collapsed spores (SEM), j: capillitium (SEM), k: spore (SEM), l: spore ornamentation (SEM). Scale bars: a = 5 mm,
b = 100 µm, c = 200 µm, d = 20 µm, e, f, g, h = 30 µm, i = 10 µm, j = 100 µm, k = 5 µm, l = 800 nm.
397
10 Mar. 2019, A.V. Vlasenko (NSK 1030493); 06 Sept.
2019, A.V. Vlasenko (NSK 1030474).
Khanty-Mansi Autonomous Area – Yugra, Khan-
ty-Mansiysky district, 22 km SW of Khanty-Mansi-
ysk, vicinity of the Mukhrino Field Station of Ugra
State University, coniferous mixed forest, bark of P.
obovata, 60.89064° N, 68.70323° E, 30 m, substrate
samples collected 19 Oct. 2017, N.V. Filippova, moist
chamber culture 09 Oct. 2018, A.V. Vlasenko (NSK
1030496); ibid, bark of Abies sibirica Ledeb., 60.89064°
N, 68.70323° E, 30 m, substrate samples collected 19
October 2017, N.V. Filippova; moist chamber culture
09 Oct. 2018, A.V. Vlasenko (NSK 1030482); 15 Jan.
2019, A.V. Vlasenko (NSK 1030547).
HAB ITAT: Coniferous forest.
ECOLO GY: Epiphyte. On bark of living trees.
DISTRIBUTION: Currently known only from
Khanty-Mansi Autonomous Area – Yugra.
NCBI GENBANK REFERENCE: MT795958 (par-
tial 18S rDNA).
Morphological identification of
Symphytocarpus macrosporus
e genus Symphytocarpus is characterized by
pseudoaethalia consisting of cylindric sporocarps,
sessile or nearly so, without cortex, peridium some-
times remaining as fragments (Poulain et al. 2012).
S. macrosporus is ecologically and morphological-
ly similar to Amaurochaete comata, both species
inhabit bark of living conifers and have large dark
spores ornamented by warts. Symphytocarpus mac-
rosporus, like other species of the genus, diers from
Amaurochaete species by the absence of a cortex.
Symphytocarpus species can be divided into
three groups by the retaining degree of peridium: 1.
Peridium completely evanescent (S. amaurochae-
toides Nann.-Bremek. and S. trechisporus (Berk. ex
Torrend) Nann.-Bremek.). 2. Peridium partially re-
taining as round plates connected to the capillitium
(S. conuens (Cooke & Ellis) Ing & Nann.-Bremek.,
S. herbaticus Ing, S. impexus Ing & Nann.-Bremek.,
S. syncarpus (Yamash.) Y. Yamam.). 3. Peridium par-
tially retaining as round plates not connected to the
capillitium (S. accidus (Lister) Ing & Nann.-Bremek.,
S. cristatus Nann.-Bremek., and S. macrosporus).
S. macrosporus diers from S. accidus and S.
cristatus in the spore size, as well as in smaller size
of both individual sporangia and pseudoaethalium.
S. macrosporus and other three species of the
genus (S. conuens, S. accidus, and S. syncarpus)
have warty spore ornamentation but they notice-
ably vary in the size of individual sporangia, pseu-
doaethalium, and spores (Table 2).
e species we describe shows similarity with
S. conuens (warty spore ornamentation, capillitia
strands structure) but the two have signicant dif-
ferences in morphology and SSU sequences. Spores
of S. macrosporus are larger than of S. conuens
(Moreno et al. 2020). Peridium of S. macrosporus
partially retains as a collar around the sporotheca
base and as round plates not connected to the capil-
litium, whereas peridium of S. conuens partially re-
tains as round plates connected to the capillitium.
Table 1. Sequences of the genus Symphytocarpus and related genera used in alignment.
Species Herbarium voucher/isolate GenBank accession numbers
Amaurochaete comata AMFD171 AY842031
Brefeldia maxima MM24519 JQ031957
Symphytocarpus amaurochaetoides LE255019 MH930798
Symphytocarpus confluens LE47719 MH930800
Symphytocarpus flaccidus LE47624 MH930801
Symphytocarpus impexus - AY230188
Symphytocarpus macrosporus NSK 1030478 (holotype) MT795958
398
Key to the species of the genus Symphytocarpus and
morphologically similar species Amaurochaete
1. Spores reticulate ……………………………………………………………………………………………………………………2
– Spores warted or spinulose ……………………………………………………………………………………………………4
2. Spores inconsistently reticulate, lilac grey, 8–11 μm diameter, and inconsistent reticulum with very dark,
distinct ridges ………………………………………………………………………………………………………… S. cristatus
– Spores continuously reticulate ……………………………………………………………………………………………… 3
3. Spores spinose-reticulate, lilac-brown in TL, 8–10 μm diameter, reticulum consists of spines connected
by ridges, with 10–12 meshes across the diameter …………………………………………… S. amaurochaetoides
– Spores irregularly banded-reticulate, purple-brown in TL, 10–12 μm diameter including the 0.5 μm
border, forming 8–10 irregular meshes across the diamete……………………………………………S. trechisporus
4. Spores clustered, dark purple-brown in TL, 12–13 μm diameter, densely warted, 6–12 in cluster ………
…………………………………………………………………………………………………………………………… S. syncarpus
– Spores free ………………………………………………………………………………………………………………………… 5
5. Spores smaller than 10 μm ………………………………………………………………………………………………………6
– Spores larger than 10 μm ………………………………………………………………………………………………………8
6. Spores grey in mass, almost colorless in TL, 6.3–8.5 μm diameter, faintly and minutely spinulose…………
…………………………………………………………………………………………………………………………… S. herbaticus
– Spores brown, dark in mass. …………………………………………………………………………………………………7
7. Spores pale-brown in mass, pale red-brown in TL, 7–9 (10) μm diameter, warted, warts pale color…………
………………………………………………………………………………………………………………………………S. accidus
– Spores moderately black in mass, lilac-brown in TL, 8–9 μm diameter, covered by short, distinct dark
spines ……………………………………………………………………………………………………………………… S. impexus
8. Spores up to 12 μm diameter, spores black in mass, purple-brown in TL, distinctly warted. Peridium
retains as rounded, smooth akes, connected to the capillitium …………………………………… S. conuens
– Spores more than 12 μm diameter ………………………………………………………………………………………… 9
9. Spores dark, paler on one side, 12–18 μm diameter, warted to spinulose. Peridium represented by black,
fragile cortex, after crumbling away leaving a mat of numerous irregular columellae with attached woolly
capillitium, and not retaining as round plates …………………………………………… Amaurochaete tubulina
– Spores almost black in mass, dark brown in TL, (14)15–17(18) μm diameter, warted, warts irregularly
distributed, dierent in size by SEM. Cortex absent, peridium partially retains as a collar around the
sporotheca base and as round plates not connected to the capillitium …………………………S. macrosporus
Molecular genetic
identification of
Symphytocarpus macrosporus
We compared a partial S. macrosporus SSU sequence
with those of other species from the genus, as well
as the species Amaurochaete comata and Brefeldia
maxima. Comparison showed that the S. macrospo-
rus nucleotide sequence is very dierent from the
sequences of other compared species (Table 3), which
supports separation of this species.
We provide partial SSU sequence of S. macro-
sporus (GenBank MT795958), which can be used as
a barcode for conrmation of the species identica-
tion in the future.
e new S. macrosporus among species of
the order Stemonitidales T. Macbr. can be identi-
ed by the sequence (5’->3’) “CAGTCCCCCG” in
a conserved region of SSU, and by the sequence
(5’->3’) “CCCTGTTA” in a variable region of the SSU.
Identication is also possible based on PCR re-
action with the species-specic primers developed
by V.A. Vlasenko: forward primer DarkSYMmac1F
(CCCTGTTACGCTTCGGCAT) and reverse primer
DarkSYMmac1R (CGCACGTTCCTTCCAGTATT).
399
Table 2. Morphological comparison among Symphytocarpus macrosporus and related species with warted
ornamentation of the spores.
Species S. macrosporus S. confluens S. flaccidus S. syncarpus
Pseudoaethalia
(height), mm /
(diameter) mm /
color
0.5–2 /
2–8 /
black
2–3 /
5–40 / deep
black
up to 15 /
up to 70
/ rust coloured,
later red-brown
or brown
5 /
5 /
dark brown
Sporocarps
(height), mm
0.5–1.5 2–3 5–15 5
Sporotheca (diameter),
mm
0.15–0.35 0.5 0.5 0.4–0.6
Hypothallus shiny, light brown
and almost
inconspicuous,
merging in color
with woody bark
silvery or
inconspicuous
silvery shine silvery,
well-developed
Peridium fugacious, but often
persisting as a collar
around the base of
the sporoteca and
always remains as
round plates which are
not connected to the
capillitium, brown by TL
fugacious
except for a
number of ±
rounded plates
which are
red-brown by
TL, smooth and
connected to
the capillitium
fugacious except
for the irregular
plates which are
not connected
to the capillitium,
smooth red-
brown by TL
fugacious except
for a number
of ± rounded
plates which are
red-brown by
TL, smooth and
connected to the
capillitium
Capillitium
(meshed reticulum /
membranes /
free ends /
common peripheral
sections of the network
at the neighboring
sporangia)
+ / + / + / + + / + / – / + + / + / + / ++ / + /– / +
Spore (size), μm /
free or clusters /
color / ornamentation
(14)15–17(18) /
free / black in mass,
dark brown by TL
/ distinctly warted.
Warts irregularly
distributed,
dierent in size
(10) 11–13 /
free / black
in mass,
pale purple-
brown by TL
/ distinctly
warted
7–9 (10) / free
/ pale brown in
mass, pale red-
brown by TL /
warted, warts
pale color
12–13 / 6–12 in a
cluster / black in
mass, dark purple-
brown by TL /
densely warted
400
Acknowledgements
The work of A.V. Vlasenko and V.A. Vlasenko was carried out as
part of a State Task to the Central Siberian Botanical Garden,
the Siberian Branch of the Russian Academy of Sciences;
project AAAA-A17-117012610055-3 and partially the work
of A.V. Vlasenko was carried out as part of a RFBR
№ 18-04-01232. Materials from the M.G. Popov Herbarium
(NSK) in Novosibirsk were used.
References
Altschul, S., Gish, W., Miller, W., Myers, E. & Lipman, D.
1990: Basic local alignment search tool. Journal of Molecular
Biology 215: 403–410.
Gilbert, H.C. & Martin, G.W. 1933: Myxomycetes found on
the bark of living trees. Univ. Iowa Stud. Nat. Hist. 15: 3–8.
Härkönen, M. 1977: Corticolous Myxomycetes in three dier-
ent habitats in southern Finland. Karstenia 17: 19–32.
Ing, B. & Nannenga-Bremekamp, N.E. 1967: Notes on Myxo-
mycetes XIII. Symphytocarpus nov. gen. Stemonitacearum. Proc.
Kon. Ned. Akad. Wetensch., Ser. C., Biol. Med. Sci. 70: 217–231.
Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. 2018:
MEGA X: Molecular Evolutionary Genetics Analysis across
computing platforms. Molecular Biology and Evolution 35:
1547–1549.
Lado, C. 2005–2020: An on line nomenclatural information
system of Eumycetozoa. Real Jardín Botánico, CSIC. Madrid,
Spain. http://www.nomen.eumycetozoa.com (Date of access:
25 July 2020).
Martin, G.W. & Alexopoulos, C.J. 1969: The Myxomycetes.
Iowa City: University of Iowa Press., 566 p.
Moreno, G., Castillo, A. & Thüs, H. 2020: Critical revision of
Stemonitis and Symphytocarpus (Myxomycetes) at the Natural
History Museum London (BM). Phytotaxa 458: 257–280.
Novozhilov, Yu.K. 2005: Myxomycetes (class Myxomycetes)
of Russia: taxonomic composition, ecology, geography. Diss.
doct. biol. sciences. 377 p.
Novozhilov, Yu.K., Schnittler, M., Vlasenko, A.V. & Fefelov,
K.A. 2010: Myxomycete diversity of the Altay Mts. (south-
western Siberia, Russia). Mycotaxon 111: 91–94.
Polulain, M., Bozonnet J. & Kohn, A. 2012: Les Myxomycetes.
Sevrier: FMBDS, 1119 p.
Thompson, J.D., Higgins, D.G. & Gibson, T.J. 1994: CLUSTAL
W: improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Research 22:
4673–4680.
Urich, T., Lanzén, A., Qi, J., Huson, D.H., Schleper, C. &
Schuster, S.C. 2008: Simultaneous assessment of soil micro-
bial community structure and function through analysis of the
meta-transcriptome. PLoS ONE 3(6): e2527.
Vlasenko, A. & Vlasenko, V. 2020: First Asian record of
Comatricha anomala, a rare epiphytic corticolous myxomycete.
Karstenia 58: 10–15.
Table 3. Comparison of the S. macrosporus SSU sequence with the sequences of morphologically similar species.
1 2 3 4 5 6
SYMmac/AMAcom 587/1855 596 86 3/8 3/12
SYMmac/BREmax 587/4380 610 96 10/23 1/1
SYMmac/SYMama 587/521 529 229 7/24 9/20
SYMmac/SYMcon 587/380 375 97 3/7 1/7
SYMmac/SYMimp 587/2014 589 111 2/2 5/13
SYMmac/SYMfla 587/387 384 135 7/16 5/9
1 Species acronyms. 2 Sequence length for compared species (bp). 3 Number of positions in the final dataset
(common fragment of the compared sequences). 4 Number of nucleotide substitutions. 5 Number of nucleotide
deletions/Number of base pairs in deletions. 6 Number of nucleotide insertions/Number of base pairs in insertions.
