Cellular and Mathematical Analyses of LUBAC Involvement in T Cell Receptor-Mediated NF-κB Activation Pathway

Abstract

The LUBAC ubiquitin ligase complex, composed of the HOIP, HOIL-1L, and SHARPIN subunits, stimulates the canonical nuclear factor-κB (NF-κB) activation pathways through its Met1-linked linear ubiquitination activity. Here we performed cellular and mathematical modeling analyses of the LUBAC involvement in the T cell receptor (TCR)-mediated NF-κB activation pathway, using the Jurkat human T cell line. LUBAC is indispensable for TCR-induced NF-κB and T cell activation, and transiently associates with and linearly ubiquitinates the CARMA1-BCL10-MALT1 (CBM) complex, through the catalytic HOIP subunit. In contrast, the linear ubiquitination of NEMO, a substrate of the TNF-α-induced canonical NF-κB activation pathway, was limited during the TCR pathway. Among deubiquitinases, OTULIN, but not CYLD, plays a major role in downregulating LUBAC-mediated TCR signaling. Mathematical modeling indicated that linear ubiquitination of the CBM complex accelerates the activation of IκB kinase (IKK), as compared with the activity induced by linear ubiquitination of NEMO alone. Moreover, simulations of the sequential linear ubiquitination of the CBM complex suggested that the allosteric regulation of linear (de)ubiquitination of CBM subunits is controlled by the ubiquitin-linkage lengths. These results indicated that, unlike the TNF-α-induced NF-κB activation pathway, the TCR-mediated NF-κB activation in T lymphocytes has a characteristic mechanism to induce LUBAC-mediated NF-κB activation.

Full text

Cellular and Mathematical Analyses
of LUBAC Involvement in T Cell
Receptor-Mediated NF-kB Activation
Pathway
Daisuke Oikawa
1†
, Naoya Hatanaka
2†
, Takashi Suzuki
3
*and Fuminori Tokunaga
1
*
1
Department of Pathobiochemistry, Graduate School of Medicine, Osaka City University, Osaka, Japan,
2
Division of
Mathematical Science, Department of Systems Innovation, Graduate School of Engineering Science, Osaka University,
Osaka, Japan,
3
Center for Mathematical Modeling and Data Science, Osaka University, Osaka, Japan
The LUBAC ubiquitin ligase complex, composed of the HOIP, HOIL-1L, and SHARPIN
subunits, stimulates the canonical nuclear factor-kB (NF-kB) activation pathways through
its Met1-linked linear ubiquitination activity. Here we performed cellular and mathematical
modeling analyses of the LUBAC involvement in the T cell receptor (TCR)-mediated NF-kB
activation pathway, using the Jurkat human T cell line. LUBAC is indispensable for TCR-
induced NF-kB and T cell activation, and transiently associates with and linearly
ubiquitinates the CARMA1-BCL10-MALT1 (CBM) complex, through the catalytic HOIP
subunit. In contrast, the linear ubiquitination of NEMO, a substrate of the TNF-a-induced
canonical NF-kB activation pathway, was limited during the TCR pathway. Among
deubiquitinases, OTULIN, but not CYLD, plays a major role in downregulating LUBAC-
mediated TCR signaling. Mathematical modeling indicated that linear ubiquitination of the
CBM complex accelerates the activation of IkB kinase (IKK), as compared with the activity
induced by linear ubiquitination of NEMO alone. Moreover, simulations of the sequential
linear ubiquitination of the CBM complex suggested that the allosteric regulation of linear
(de)ubiquitination of CBM subunits is controlled by the ubiquitin-linkage lengths. These
results indicated that, unlike the TNF-a-induced NF-kB activation pathway, the TCR-
mediated NF-kB activation in T lymphocytes has a characteristic mechanism to induce
LUBAC-mediated NF-kB activation.
Keywords: linear ubiquitin, LUBAC, mathematical model, NF-kB, T cell receptor, CBM complex
INTRODUCTION
Nuclear factor-kB (NF-kB) is a pivotal transcription factor controlling innate and acquired immune
responses, inflammation, and anti-apoptosis (1,2). Therefore, impaired NF-kB activity is implicated
in diverse diseases, including cancers, metabolic syndrome, and inflammatory, autoimmune, and
neurodegenerative diseases. NF-kB activation is typically classified into canonical and non-
canonical pathways (1,2). The canonical NF-kB pathway is activated by stimulations with
proinflammatory cytokines, pathogen-associated molecular patterns (PAMPs), and antigen
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 6019261
Edited by:
Anne Spurkland,
University of Oslo, Norway
Reviewed by:
Mads Gyrd-Hansen,
University of Oxford, United Kingdom
Koji Yasutomo,
Tokushima University, Japan
*Correspondence:
Takashi Suzuki
suzuki@sigmath.es.osaka-u.ac.jp
Fuminori Tokunaga
ftokunaga@med.osaka-cu.ac.jp
†
These authors have contributed
equally to this work
Specialty section:
This article was submitted to
T Cell Biology,
a section of the journal
Frontiers in Immunology
Received: 02 September 2020
Accepted: 26 October 2020
Published: 23 November 2020
Citation:
Oikawa D, Hatanaka N, Suzuki T and
Tokunaga F (2020) Cellular and
Mathematical Analyses of LUBAC
Involvement in T Cell Receptor-
Mediated NF-kB Activation Pathway.
Front. Immunol. 11:601926.
doi: 10.3389/fimmu.2020.601926
ORIGINAL RESEARCH
published: 23 November 2020
doi: 10.3389/fimmu.2020.601926

receptors, as well as by genotoxicstress.Inthecanonical
pathway, activation of the IkBkinase(IKK)complex,
composed of the IKKaand IKKbkinases and a regulatory
subunit of NEMO, results in the nuclear translocation of NF-
kB factors, composed of homo/hetero-dimers of p50, RelA (p65),
and c-Rel (1,2). In contrast, the noncanonical NF-kB pathway
functions in different aspects of immune and inflammatory
responses through the activation of the IKKadimer, and
predominantly translocates homo/hetero-dimers of p52 and
RelB into the nucleus (3).
The ubiquitin system, composed of ubiquitin-activating
enzyme (E1), ubiquitin-conjugating enzyme (E2), and
ubiquitin ligase (E3), regulates various cellular functions (4,5).
In NF-kB signaling, multiple ubiquitinations, such as Lys(K)63-,
K11-, K48-, and Met(M)1-linked ubiquitin chains, reportedly
function in the course of IKK activation and degradation of
inhibitors of NF-kB, IkBs (6). LUBAC is an E3 complex,
comprising the HOIP (also known as RNF31), HOIL-1L
(RBCK1), and SHARPIN subunits, that specifically generates
the M1-linked linear ubiquitin chain, and activates the canonical
NF-kB pathway through the linear polyubiquitinations of
NEMO and RIP1 upon stimulation by inflammatory cytokines,
such as TNF-aand IL-1b(7–9). Since NEMO contains a linear
ubiquitin-specific binding site, the so called UBAN domain, the
linear ubiquitin chain functions as a scaffold to recruit and
activate the canonical IKK (10,11). LUBAC and its linear
ubiquitination activity participate in several canonical NF-kB
pathways induced by proinflammatory cytokines such as
PAMPs, T cell receptor (TCR), genotoxic stress, and NOD2-
mediated pathways (12,13), but not in the B cell receptor (BCR)-
mediated canonical or the noncanonical NF-kB activation
pathways (14,15).
Importantly, LUBAC binds negative regulators of
deubiquitinases (DUBs), such as OTULIN and the CYLD-
SPATA2 complex, through the N-terminal PUB domain of HOIP
(16–18). OTULIN, an ovarian tumor (OTU)-family DUB, directly
binds to HOIP and exclusively cleaves M1-linked ubiquitin chains.
OTULIN plays crucial roles in limiting cell death and inflammation
(19). In contrast, CYLD is a ubiquitin-specificprotease(USP)-
family DUB that was initially identified as a cylindromatosis tumor
suppressor gene in humans (20). CYLD downregulates the NF-kB
activation pathway by hydrolyzing K63- and M1-linked ubiquitin
chains (21), and regulates innate immune signaling (22).
Importantly, the USP domain of CYLD binds to the PUB domain
of SPATA2, and the PUB-interacting motif (PIM) in SPATA2
associates with the PUB domain of HOIP (18,23–25). Therefore,
LUBAC is a unique E3-DUB complex to scrap-and-build linear
ubiquitin chains.
TCR recognizes major histocompatibility complex (MHC)
molecules expressed on the surface of antigen-presenting cells
(26). In the TCR-mediated NF-kB activation pathway, the
protein tyrosine kinase ZAP70 is initially activated upon co-
stimulation through TCR and CD28 (27), leading to the
activation of protein kinase Cq(PKCq). PKCqphosphorylates
the scaffold protein CARMA1 (CARD-containing MAGUK
protein 1, also called CARD11 and Bimp3) (28,29). The
activated CARMA1 then recruits heterodimers of B cell
lymphoma 10 (BCL10) and the paracaspase mucosa-associated
lymphoid tissue lymphoma translocation protein1 (MALT1) to
form the oligomerized CARMA1-BCL10-MALT1 (CBM)
complex, which functions as a scaffold to activate the NF-kB
and MAP kinase signaling pathways (28,29). In TCR signaling,
LUBAC linearly ubiquitinates BCL10 (30–32), and MALT1
cleaves HOIL-1L upon stimulation (33,34). However, the
detailed functions of LUBAC in the TCR-mediated NF-kB
pathway remain elusive. The stimulation-dependent cytosol-
nucleus oscillation of NF-kB and its effects on gene expression
have been analyzed mathematically (35–38). However, a
mathematical analysis of LUBAC-mediated linear ubiquitination
and OTULIN/CYLD-induced deubiquitination in TCR-mediated
NF-kB activation has not been performed. Therefore, we have
investigated the cellular function and performed a mathematical
simulation for the involvement of LUBAC in the TCR-mediated
NF-kB activation, using the Jurkat human T cell line.
MATERIALS AND METHODS
Plasmids
The open reading frames of human cDNAs were amplified by
reverse transcription-PCR. Mutants of these cDNAs were
prepared by the QuikChange method, and the entire
nucleotide sequences were verified. The cDNAs were ligated to
the appropriate epitope sequences and cloned into the
pcDNA3.1 (Invitrogen), pCAGGS (Addgene), and pGEX-6P-1
(Addgene) vectors. For lentiviral transduction, pCSII-CMV-
RfA-IRES-Blast (RIKEN BioResource Research Center)
was used.
Reagents
The following reagents and kits were obtained as indicated:
recombinant human TNF-a(BioLegend), phorbol 12-myristate
13-acetate (PMA, Sigma-Aldrich), ionomycin (Wako), Human
IL-2 Instant ELISA (eBiosciences), and NE-PER Nuclear and
Cytoplasmic Extraction Reagent Kit (Pierce).
Antibodies
The following antibodies were used for immunoblot analyses: P-
p105 (#4806; 1:1,000), p105 (#3035; 1:1,000), P-p65 (#3033;
1:1,000), p65 (#8242; 1:1,000), P-IkBa(#9246; 1:1,000), IkBa
(#4812; 1:1,000), P-JNK (#4668; 1:1,000), JNK (#9252; 1:1,000),
PARP (#9542; 1:1,000), P-ZAP70 (#2701; 1:1,000), ZAP70
(#3165; 1:2,000), P-IKKa/b(#2697; 1:1,000), CARMA1 (#4435;
1:1,000), MALT1 (#2494; 1:1,000), BCL10 (#4237; 1:1,000),
CYLD (#8462; 1:1,000), OTULIN (#14127; 1:1,000), and GST
(#2622; 1:1,000) were obtained from Cell Signaling. HOIL-1L
(sc-393754; 1:250), IKKa/b(sc-7607; 1:1,000), and c-Myc (sc-40;
1:1,000) were purchased from Santa Cruz Biotechnology. HOIP
(ab125189, Abcam; 1:1,000), NEMO (ab178872, Abcam;
1:3,000), SHARPIN (14626-1-AP, Proteintech; 1:3,000), tubulin
(CLT9002, Cedarlane; 1:3,000), FLAG (clone M2, F1840, Sigma-
Aldrich; 1:1,000), DYKDDDDK (1E6; HRP-conjugate) (015-
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 6019262

22391, Wako; 1:10,000), Myc (#562, MBL; 1:2,000), linear
ubiquitin (clone LUB9, MABS451, Millipore; 1:1,000), and
linear ubiquitin (1F11/3F5/Y102L, Genentech; 1:20,000) were
also used. For immunoprecipitation, the following antibodies
were used: HOIL-1L (sc-49718, Santa Cruz Biotechnology; 3 μg),
c-Myc (sc-40, Santa Cruz Biotechnology; 1 μg), FLAG
(clone M2, F1840, Sigma-Aldrich; 1 μg), MALT1 (sc-46667,
Santa Cruz Biotechnology; 3 μg), CARMA1 (sc-166910, Santa
Cruz Biotechnology; 3 μg), BCL10 (sc-5273, Santa Cruz
Biotechnology; 3 μg), NEMO (200-401-GM7, ROCKLAND; 3
μg), and normal mouse IgG (sc-2025, Santa Cruz Biotechnology;
3 μg). For cell stimulation, agonistic anti-CD3 (300314,
BioLegend) and anti-CD28 antibodies (302914, BioLegend)
were used, and the PE anti-human CD69 antibody (310905,
BioLegend) was utilized for flow cytometry.
Cell Culture and Transfection
Jurkat cells (Clontech) were maintained in RPMI 1640 medium,
containing 10% FBS, 100 IU/ml penicillin G and 100 mg/ml
streptomycin, at 37°C under a 5% CO
2
atmosphere. HEK293T cells
(ATCC) were cultured in DMEM containing 10% fetal bovine serum
(FBS) and antibiotics. Transfection experiments were performed
using Lipofectamine 2000, PEI (polyethylenimine), or TurboFect
(Thermo Fisher). Electroporation of Jurkat cells was performed with
a Gene Pulser Xcell Electroporation System (Bio-Rad) at 250 V with
975 μF. For the stable expression of FLAG-tagged OTULIN-WT in
OTULIN-KO Jurkat cells, lentiviral infection followed by the
selection with 5 μg/ml blasticidin was performed.
Construction of Knockout Cells
The HOIP-deficient RNF31-KO Jurkat cells were constructed as
described previously (39). The gRNA_cloning vector (#41824)
and pCAG-hCas9 (#51142) were obtained from Addgene. The
nucleotide sequences 5’- AACAAGAATTGTAATGACCC -3’in
exon 9 of the human CYLD gene, and 5’- ATTAAGCGTAGCTC
CTGAAA -3’in exon 3 of the human OTULIN gene, were
selected as the targets for the gRNA. These plasmids and a
puromycin-resistant vector (pXS-Puro) were co-electroporated
into Jurkat cells. Two days after transfection, cells were selected
with puromycin for 3 weeks, and then cell clones were obtained
by limiting dilution. The deficiency of the CYLD or OTULIN
protein was confirmed by immunoblotting, and the nucleotide
mutations were confirmed by sequencing.
SDS-PAGE and Immunoblotting
Samples were separated by SDS-PAGE and transferred to PVDF
membranes. After blocking in Tris-buffered saline containing 0.1%
Tween-20 (TBS-T) with 5% skim-milk or bovine serum albumin
(BSA), the membrane was incubated with the appropriate primary
antibodies, which are diluted in TBS-T containing 5% w/v BSA,
followed by an incubation with horseradish peroxidase-conjugated
secondary antibodies (GE Healthcare). The chemiluminescent
images were obtained with an LAS4000 imaging analyzer (GE
Healthcare) or a Fusion Solo S imaging system (Vilber).
Quantification of protein bands was performed with ImageJ
software, according to the manufacturer’s instructions.
Quantitative PCR (qPCR)
Cell lysis, reverse-transcription, and qPCR were performed with
SuperPrepCellLysis,RTKitforqPCR,andPowerSYBRGreen
PCR Master Mix (Life Technologies) respectively, according to the
manufacturer’s instructions. Quantitative real-time PCR was
performed with a Step-One-Plus PCR system (Applied Biosystems)
by the DDCT method, using the following oligonucleotides: NFKBIA
sense, 5’-CGGGCTGAAGAAGGAGCGGC-3’and NFKBIA anti-
sense, 5’-ACGAGTCCCCGTCCTCGGTG-3’;TNFAIP3 sense, 5’-
CATGCATGCCACTTCTCAGT-3’,andTNFAIP3 anti-sense, 5’-
CATGGGTGTGTCTGTGGAG-3’;IL-2 sense, 5’-CTGG
AGCATTTACTGCTGGATTT-3’;IL-2 anti-sense, 5’-TGGT
GAGTTTGGGATTCTTGTAATT-3’;GAPDH sense, 5’-
AGCAACAGGGTGGTGGAC-3’, and GAPDH anti-sense, 5’-
GTGTGGTGGGGGACTGAG-3’.
Flow Cytometry
Parental and HOIP-deficient Jurkat cells were stimulated with
anti-CD3 and anti-CD28 antibodies for 20 h. Afterwards, 2×10
5
cells were stained with the PE-CD69 antibody for 30 min on ice,
washed and analyzed with a FACSVerse flow cytometer, using
the FACSuite software (Becton Dickinson).
Immunoprecipitation and Detection of
Linear Ubiquitination
For the detection of linear ubiquitination, Jurkat cells (5×10
7
cells) were heated at 95°C for 5 min in 1% SDS-containing lysis
buffer, which includes 50 mM Tris-HCl (pH 7.4), 1% NP-40,
0.1% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 2.5 μM
N-ethylmaleimide, and a protease inhibitor cocktail (Roche). The
samples were then diluted 10-fold with SDS-free lysis buffer. For
the protein interaction assay, Jurkat cells (1×10
8
cells) or
HEK293T (5×10
6
cells) were lysed with NP-40 buffer (20 mM
Tris-HCl (pH 7.4), 0.2% NP-40, 150 mM NaCl and protease
inhibitor cocktail). Immunoprecipitation was performed with
the indicated antibody together with protein G agarose beads
(GE Healthcare).
In Vitro Canonical IKK Assay
Parental and OTULIN-deficient Jurkat cells (2×10
7
cells) were
stimulated with PMA and ionomycin for the indicated durations.
The cells were then lysed in buffer, containing 50 mM Tris-HCl
(pH 7.5), 150 mM NaCl, and 1% Triton X-100 (w/v), and
immunoprecipitated with an anti-NEMO antibody and Protein
A Sepharose (GE Healthcare). After extensive washing, the beads
were suspended in buffer containing 50 mM Tris-HCl (pH 7.5)
and 5 mM MgCl
2
. The immunoprecipitates were incubated for
30 min at 30 °C with 5 mg/ml of GST-IkBa(aa 1–54), prepared as
described (40), in a 20 ml reaction, containing 50 mM Tris-HCl
(pH 7.5), 5 mM MgCl
2
, and 1 mM ATP, followed
by immunoblotting.
Statistical Analysis
One-way ANOVA followed by a post-hoc Tukey HSD test was
performed, using the GraphPad Prism software. For all tests, a
Pvalue of less than 0.05 was considered statistically significant.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 6019263

Mathematical Simulation
We constructed mathematical models of NF-kB signaling based on
the law of mass action, as described previously (38). In order to
investigate the effect of the CBM complex on IKK activation in T
cells, the following two models were constructed. The first was the
CBM simplify model (CBM_SM), which includes the reaction of
IKK activation depending on the linear ubiquitin chain of NEMO
and the CBM complex. In this model, we simulated the effect of the
CBM complex on the IKK activation by changing the parameters
related to ubiquitination. The reaction involves the transient
binding of LUBAC with NEMO or CBM, followed by the
LUBAC-mediated linear ubiquitination of the proteins in the
bound state.
L+NEMO !LNEMO, LNEMO !LNEMOu
L+CBM !LCBM, LCBM !LCBMu
After dissociation, the LUBAC-bound NEMO or CBM was
postulated to exist in a temporarily inactive form (prime symbol
(′) represents inactive state).
LNEMO !L+NEMO′
LCBM !L+CBM′
The linear ubiquitin chains are cleaved by DUBs, such as
CYLD and OTULIN. Since CYLD and OTULIN stably bind
LUBAC, LUBAC/NEMOu and NEMOu may have different
deubiquitination coefficients. The model is characterized by the
following equations, and parameters are shown in Table 1;
dCBM
dt =−kCCBM tðÞLtot −LCBM tðÞ−LCBMutðÞð
−LIKK tðÞ−LIKKutðÞÞ
dLCBM
dt =kCCBM tðÞLtot −LCBM tðÞ−LCBMutðÞ−LIKK tðÞð
−LIKKutðÞÞ−uC+lC
ðÞ LCBM tðÞ+dCLCBMutðÞ
dLCBMu
dt =uCLCBM tðÞ−dC+lC
ðÞLCBMutðÞ
dCBMdu 
dt =lCLCBMutðÞ−adCCBMdu tðÞ
dLIK
dt =−kNLtot −LCBM tðÞ−LCBMutðÞ−LIKK tðÞ−LIKKutðÞðÞ
IKKtot −IKKu(t)ð
−LIKK(t)LIKKu(t)−IKKp(t)−IKKup (t)−IKKd(t)IKKdu(t)
−LIKKp(t)−LIKKup(t)−IKKdp(t)−IKKdup (t)Þ−(lc+uN)LIKK(t)
+dN LIKKu(t)+dp LIKKp(t)
−pcLCBMu(t)+CBMdu(t)ðÞLIKK(t)IKKtot
−pi LIKK(t)LIKKu(t)+IKKu(t)+IKKup (t)+IKKdup(t)

dLIKKu
dt =uNLIKK tðÞ−dN+lC
ðÞLIKKutðÞ+dpLIKKup tðÞ
−pCLCBMutðÞ+CBMdutðÞðÞLIKKutðÞIKKtot −pILIKKutðÞIKKtot
dIKKu
dt =−pCLCBMutðÞ+CBMdutðÞðÞIKKutðÞIKKtot
dIKKd
dt =lCLIKK tðÞ+dNIKKdutðÞ+dpIKKdptðÞ
−pCLCBMutðÞ+CBMdutðÞðÞIKKd tðÞIKKtot
−pIIKKd tðÞLIKKutðÞ+IKKutðÞ+IKKup tðÞ+IKKdup tðÞ

dIKKdu
dt =lCLIKKutðÞ−dNIKKdutðÞ+dpIKKdup tðÞ
−pCLCBMutðÞ+CBMdutðÞðÞIKKdutðÞIKKtot −pIIKKdutðÞIKKtot
dIKKp
dt =pc(LCBMu(t)+CBMdu(t)ðÞIKKtot −IKKu(t)−LIKKu(t)ð
−IKKp(t)−IKKup(t)−IKKd(t)IKKdu(t)−LIKKp(t)−LIKKup(t)
−IKKdp(t)−IKKdup(t)ÞIKKtot
+piIKKtot −IKKu(t)−LIKK(t)−LIKKu(t)−IKKp(t)−IKKup (t)

−IKKd(t)−IKKdu(t)−LIKKp(t)−LIKKup (t)−IKKdp(t)
−IKKdup(t)ÞLIKKu(t)+IKKu(t)+IKKup (t)+IKKdup(t)

dLIKKp
dt =pCLCBMutðÞ+CBMdutðÞðÞLIKK tðÞIKKtot
+pILIKK tðÞLIKKutðÞ+IKKutðÞ+IKKup tðÞ+IKKdup tðÞ

−dpLIKKptðÞ+dNLIKKup tðÞ
dLIKKup
dt =pCLCBMutðÞ+CBMdutðÞðÞLIKKutðÞIKKtot +pILIKKutðÞIKKtot
−dp+dN

LIKKup tðÞ
dIKKup
dt =pCLCBMutðÞ+CBMdutðÞðÞIKKutðÞIKKtot +pIIKKutðÞIKKtot
−dp+dN

IKKup tðÞ
dIKKdp
dt =pCLCBMutðÞ+CBMdutðÞðÞIKKd tðÞIKKtot
+pIIKKd tðÞLIKKutðÞ+IKKutðÞ+IKKup tðÞ+IKKdup tðÞ

−dpIKKdptðÞ+dNIKKdup tðÞ
dIKKdup
dt =pCLCBMutðÞ+CBMdutðÞðÞIKKdutðÞIKKtot +pIIKKdutðÞIKKtot
−dp+dN

IKKdup tðÞ
The other model, the CBM detailed model (CBM_DM),
focused only on the ubiquitination reaction of the CBM complex
TABLE 1 | Parameters for CBM_SM.
Symbol Value Unit Description
k
C
1.482817 1/µM CBM-LUBAC association
l
C
0.770128 1/min CBM-LUBAC dissociation
u
C
0.217147 1/min CBM ubiquitination
d
C
0.178648 1/min CBM deubiquitination
k
N
1.210012 1/µM min CBM-NEMO association
l
N
0.813971 1/min CBM-NEMO dissociation
u
N
0.04963 1/min NEMO ubiquitination
d
N
0.399584 1/min NEMO deubiquitination
p
C
0.463834 1/µM^2 min CBM-mediated IKK phosphorylation
p
I
0.085297 1/µM min NEMO-mediated IKK phosphorylation
dp 0.682746 1/min IKK dephosphorylation
Ltot 0.379065 µM amount of LUBAC
CBMtot 2.317712 µM amount of CBM complex
IKKtot 0.178664 µM amount of IKK
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 6019264

to elucidate the mechanisms of timing shift of ubiquitination.
CARMA1, BCL10, and MALT1 were distinguished, and the
reaction coefficients of the ubiquitination of each protein were
compared. The model is characterized by the following equations,
and parameters and variables are shown in Tables 2 and 3;
x0
0tðÞ=−k0x0tðÞLUBAC tðÞ
LUBAC0tðÞ=−k0x0tðÞLUBAC tðÞ
+l0x1tðÞ+x2tðÞ+x3tðÞ+x4tðÞ+x5tðÞ+x6tðÞ+x7tðÞ+x8tðÞðÞ
x0
1tðÞ=k0x0tðÞLUBAC tðÞ−k1x1tðÞ+l1x2tðÞ−k2x1tðÞ+l2x3tðÞ−k3x1tðÞ
+l3x4tðÞ−l0x1tðÞ
x0
2tðÞ=k1x1tðÞ−l1x2tðÞ−k4x2tðÞ+l4x5tðÞ−k5x2tðÞ+l5x6tðÞ−l0x2tðÞ
x0
3tðÞ=k2x1tðÞ−l2x3tðÞ−k6x3tðÞ+l6x5tðÞ−k7x3tðÞ+l7x7tðÞ−l0x3tðÞ
x0
4tðÞ=k3x1tðÞ−l3x4tðÞ−k8x4tðÞ+l8x6tðÞ−k9x4tðÞ+l9x7tðÞ−l0x4tðÞ
x0
5tðÞ=k4x2tðÞ−l4x5tðÞ+k6x3tðÞ−l6x5tðÞ−k10 x5tðÞ+l10 x8tðÞ−l0x5tðÞ
x0
6tðÞ=k5x2tðÞ−l5x6tðÞ+k8x4tðÞ−l8x6tðÞ−k11 x6tðÞ+l11 x8tðÞ−l0x6tðÞ
x0
7tðÞ=k7x3tðÞ−l7x7tðÞ+k9x4tðÞ−l9x7tðÞ−k12 x7tðÞ+l12 x8tðÞ−l0x7tðÞ
x0
8tðÞ=k10 x5tðÞ−l10 x8tðÞ+k11 x6tðÞ−l11 x8tðÞ+k12 x7tðÞ−l12 x8tðÞ−l0x8tðÞ
y0
1tðÞ=al1y2tðÞ+l2y3tðÞ+l3y4tðÞðÞ+l0x1tðÞ
y0
2tðÞ=a−l1y2tðÞ+l4y5tðÞ+l5y6tðÞðÞ+l0x2tðÞ
y0
3tðÞ=a−l2y3tðÞ+l6y5tðÞ+l7y7tðÞðÞ+l0x3tðÞ
y0
4tðÞ=a−l3y4tðÞ+l8y6tðÞ+l9y7tðÞðÞ+l0x4tðÞ
y0
5tðÞ=a−l4y5tðÞ−l6y5tðÞ+l10 y8tðÞðÞ+l0x5tðÞ
y0
6(t)=a (−l5 y6(t)−l8 y6(t)+l11 y8(t)) + l0 x6(t)
y0
7(t)=a (−l7 y7(t)−l9 y7(t)+l12 y8(t)) + l0 x7(t)
y0
8tðÞ=a−l10 y8tðÞ−l11 y8tðÞ−l12 y8tðÞðÞ+l0x8tðÞ
In this study, parameters were set by using a genetic algorithm
(GA) for both CBM_SM and CBM_DM, and the characteristics
of each reaction were analyzed. In addition, in CBM_SM, by
changing the coefficient for ubiquitinating CBM and the
coefficient for ubiquitinating NEMO, the difference between
the activation of IKK via CBM and the activation of IKK via
NEMO was clarified.
RESULTS
LUBAC Is a Crucial Regulator of TCR-
Mediated NF-kB Activation
To investigate the involvement of LUBAC in TCR-mediated NF-
kB activation, we previously constructed HOIP-deficient human
leukemic T cell lymphoblast Jurkat cells (RNF31-KO) (39).
Moreover, wild type (WT)-HOIP was restored in RNF31-KO
cells to construct RNF31-KO+HOIP-WT cells, to exclude the
TABLE 2 | Parameters for CBM_DM.
Symbol Value Unit Description
k
0
0.578 1/µM min CBM-LUBAC association
k
1
0.322 1/min MALT1 of CBM ubiquitination
l
1
0.386 1/min MALT1 of CBM* deubiquitination
k
2
0.133 1/min CARMA1 of CBM ubiquitination
l
2
0.121 1/min CARMA1 of C*BM deubiquitination
k
3
0.106 1/min BCL10 of CBM ubiquitination
l
3
0.124 1/min BCL10 of CB*M deubiquitination
k
4
0.362 1/min CARMA1 of CBM* ubiquitination
l
4
0.105 1/min CARMA1 of C*BM* deubiquitination
k
5
0.182 1/min BCL10 of CBM* ubiquitination
l
5
0.0665 1/min BCL10 of CB*M* deubiquitination
k
6
0.639 1/min MALT1 of C*BM ubiquitination
l
6
0.146 1/min MALT1 of C*BM* deubiquitination
k
7
0.184 1/min BCL10 of C*BM ubiquitination
l
7
0.0213 1/min BCL10 of C*B*M deubiquitination
k
8
0.717 1/min MALT1 of CB*M ubiquitination
l
8
0.260 1/min MALT1 of CB*M* deubiquitination
k
9
0.770 1/min CARMA1 of CB*M ubiquitination
l
9
0.0904 1/min CARMA1 of C*B*M deubiquitination
k
10
0.231 1/min BCL10 of C*BM* ubiquitination
l
10
0.0273 1/min BCL10 of C*B*M* deubiquitination
k
11
0.634 1/min CARMA1of CB*M* ubiquitination
l
11
0.0531 1/min CARMA1 of C*B*M* deubiquitination
k
12
0.334 1/min MALT1 of C*B*M ubiquitination
l
12
1.07 1/min MALT1 of C*B*M* deubiquitination
*ubiquitination state.
TABLE 3 | Variables in CBM_DM.
Variable Molecules
x
0
[CBM]
x
1
[CBML]
x
2
[CBM*L]
x
3
[C*BML]
x
4
[CB*ML]
x
5
[C*BM*L]
x
6
[CB*M*L]
x
7
[C*B*ML]
x
8
[C*B*M*L]
y
0
[CBM’]
y
1
[CBM’]
y
2
[CBM*’]
y
3
[C*BM’]
y
4
[CB*M’]
y
5
[C*BM*’]
y
6
[CB*M*’]
y
7
[C*B*M’]
y
8
[C*B*M*’]
*ubiquitination state, apostrophe (’): inactive state.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 6019265

possibility of off-target depletion. These cells were stimulated
with anti-CD3 and anti-CD28 antibodies, and TCR-mediated
NF-kB activation was examined (Figure 1A). Although efficient
phosphorylation of the canonical NF-kB factors, such as p105,
p65 and IkBa, degradation and regeneration of IkBa,and
intranuclear translocation of p65 were detected in parental
Jurkat and RNF31-KO+HOIP-WT cells upon TCR-stimulation,
NF-kB activation was markedly suppressed in RNF31-KO cells.
These results suggested that the LUBAC activity is indispensable
for the TCR-mediated NF-kB activation. Importantly, the
tyrosine kinase ZAP70, which associates with the TCRzchain
and is activated upon stimulation (27), was similarly
phosphorylated in RNF31-KO and the parental Jurkat cells
upon TCR stimulation (Figure 1B). In contrast, the
phosphorylation of IKKa/b, which represents IKK activation,
was strongly impaired in RNF31-KO cells. Thus, the LUBAC
activity is involved downstream from ZAP70, and upstream
from IKK activation. In the absence of LUBAC activity, the
expression of NF-kB targets, such as TNFAIP3 (which encodes
A20), interleukin-2(IL-2), and NFKBIA (IkBa), and secreted IL-2
were suppressed after TCR stimulation by anti-CD3 and anti-
CD28 antibodies or a combined treatment with PMA and
ionomycin, which mimics TCR stimulation (Figures 1C, D,
Supplementary Figure 1). As a result, the expression of CD69,
a T cell activation marker, was suppressed in TCR-stimulated
RNF31-KO cells (Figure 1E). Collectively, these results indicated
that LUBAC plays a pivotal role in the TCR-mediated NF-kB
activation and T cell activation.
A
B
CD
E
FIGURE 1 | LUBAC is necessary for the TCR-mediated NF-kB activation pathway. (A) Parental Jurkat cells, HOIP-deficient cells (RNF31-KO), or WT-HOIP-restored
RNF31-KO cells (RNF31-KO+HOIP-WT) were stimulated with 1 mg/ml each of anti-CD3 and anti-CD28 antibodies for the indicated periods of time. Cell lysates and
nuclear fractions were immunoblotted with the indicated antibodies. (B) Impaired IKK activation in RNF31-KO cells. WT or RNF31-deficient Jurkat cells were
stimulated and analyzed as in (A), using the indicated antibodies. *nonspecific signal. (C) Reduced expression of TCR-mediated NF-kB target genes in RNF31-KO
cells. Cells were stimulated with anti-CD3 and anti-CD28 antibodies as in (A) for 1 h, and qPCR analyses were performed. (D) LUBAC activity is required for efficient
IL-2 secretion. Cells were stimulated with 5 mg/ml each of anti-CD3 and anti-CD28 antibodies for 18 h, and secreted IL-2 was quantified by ELISA. (E) The
expression of T cell activation marker CD69 was suppressed in RNF31-KO Jurkat cells. WT or RNF31-deficient Jurkat cells were stimulated with 3 mg/ml each of
anti-CD3 and anti-CD28 antibodies for 20 h. The expression of CD69 was analyzed by a flow cytometer. (C, D) Data are shown as Means ±SD (n= 3). ***P<0.001,
****P<0.0001, NS, not significant.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 6019266

LUBAC Binds CBM Complex Through
HOIP
To investigate the involvement of LUBAC in the TCR pathway, we
analyzed the interaction of LUBAC with the CBM complex. Upon
stimulation with PMA/ionomycin, the endogenous LUBAC
transiently binds with the CBM complex in Jurkat cells (Figure
2A). Similarly, TCR stimulation by anti-CD3 and anti-CD28
antibodies also enhanced the association of endogenous LUBAC
and the CBM complex in Jurkat cells (Supplementary Figure 2A).
Co-immunoprecipitation followed by immunoblotting experiments
indicated that HOIP, but not HOIL-1L or SHARPIN, bound to
CARMA1 and MALT1, whereas the direct binding of LUBAC
subunits with BCL10 was negligible (Figure 2B). To identify the
binding sites in HOIP that interact with CARMA1 and MALT1,
various HOIP mutants were constructed (Figure 2C). The results
revealed that the B box (aa 165–289) and PUB (aa 1–164) domains
in HOIP are the binding sites for CARMA1 and MALT1,
respectively (Figures 2D, E). Moreover, the PDZ and SH3 regions
(aa 667–972) of CARMA1 (Figures 2F, G) and the N-terminal death
domain (aa 1–126) of MALT1 were identified as HOIP-binding sites
(Figures 2H, I). We further performed transient co-expression
followed by an immunoprecipitation analysis to investigate the
LUBAC-CBM complex, using WT or HOIP-binding region-
deleted mutants of CARMA1 and/or MALT1 (Supplementary
Figure 2B). The results revealed that the CBM containing the
HOIP-binding region-deleted CARMA1
1–666
or MALT1
127–824
failed to associate with the LUBAC complex, suggesting that the
HOIP-binding sites in CARMA1 and MALT1 are indispensable for
the association of the CBM complex with LUBAC.
The PUB domain of HOIP reportedly binds p97 and DUBs,
such as OTULIN and CYLD-SPTA2 (16,17), and here we
determined that it also binds to the death domain of MALT1. To
examine whether MALT1 binds the PUB domain of HOIP in a
mutually exclusive manner with OTULIN, immunoprecipitation
followed by immunoblotting analyses were performed using PUB
mutants (Figure 3A). Both MALT1 and OTULIN simultaneously
bound the WT-HOIP. In contrast, the Y82A/N85E/N102A mutant
of HOIP, in which the critical OTULIN-binding residues are
replaced (16,17), drastically reduced the OTULIN binding,
although MALT1 binding was not affected. Moreover, neither
MALT1 nor OTULIN could bind the PUB domain-deleted
mutant of HOIP. These results indicated that MALT1 and
OTULIN bind the PUB domain of HOIP in independent
manners. Furthermore, we identified the endogenous association
of CYLD and OTULIN with LUBAC and the CBM complex by the
immunoprecipitation with anti-MALT1 antibody (Figure 3B).
Collectively, these results suggested that LUBAC physiologically
associates with DUBs at the HOIP PUB domain, and further binds
the CBM complex through HOIP upon TCR stimulation to form
signaling complex (Figure 3C).
Linear Ubiquitination of CBM Complex
Predominantly Induces TCR-Mediated
NF-kB Activation
LUBAC reportedly linearly ubiquitinates BCL10 in the CBM
complex (32), whereas the effects of LUBAC on CARMA1 and
MALT1 have not been clarified. Therefore, we performed SDS-
hot lysis followed by immunoprecipitation and immunoblotting
analyses. Unexpectedly, all of the CBM subunits were transiently
linearly ubiquitinated after PMA/ionomycin stimulation of
Jurkat cells with different time courses. Thus, MALT1 was
initially linearly ubiquitinated after 15 min as the maximum,
and subsequently, CARMA1 (20 min) and BCL10 (25 min) were
linearly ubiquitinated (Figure 4A). Indeed, the TCR-induced
linear ubiquitination of MALT1 was abolished in RNF31-KO
cells (Figure 4B), indicating that the LUBAC activity is necessary
for the linear ubiquitination.
We previously showed that NEMO is a physiological
substrate of LUBAC upon TNF-aand IL-1bstimulation
(40), and it functions as a scaffold to recruit other IKK
molecules via its UBAN domain, which specifically binds to
linear ubiquitin chains (10). The recruited and concentrated
IKK molecules are then activated by trans-phosphorylation
(11). Indeed, NEMO was efficiently linearly ubiquitinated
upon TNF-astimulation in Jurkat cells, whereas the linear
ubiquitination of NEMO was suppressed after PMA/
ionomycin-treatment (Figure 4C). In contrast, MALT1 was
linearly ubiquitinated by a PMA/ionomycin-treatment, but
not by TNF-astimulation (Figure 4D). Not only PMA/
ionomycin-treatment, but also the linear ubiquitination of
endogenous MALT1 was detected after stimulation with
anti-CD3 and anti-CD28 antibodies (Figure 4E). These
results suggested that the CBM complex is the major
substrate of LUBAC during TCR-mediated NF-kB
activation. To examine the canonical IKK activity, Jurkat
cells were treated with PMA/ionomycin, and afterwards the
endogenous NEMO was immunoprecipitated and subjected
to an in vitro canonical IKK assay, using GST-IkBaas a
substrate (Figure 4F). The IkBaphosphorylation reached
the maximum after 15 min of stimulation, and declined
thereafter. Collectively, these results suggested that the
linear ubiquitination of the CBM complex by LUBAC
correlates with the canonical IKK activation in the TCR-
mediated NF-kB activation pathway.
OTULIN Is the Predominant Regulator of
TCR-Mediated NF-kB Activation
DUBs, such as OTULIN and the CYLD-SPATA2 complex, bind
to the PUB domain of HOIP and downregulate NF-kB activity
by hydrolyzing the ubiquitin chains (16–18). To examine the
effect of these DUBs on the TCR-mediated NF-kBactivation,
we constructed CYLD-andOTULIN-deficient Jurkat cells
(Supplementary Figure 3). Upon stimulation with anti-CD3
and anti-CD28 antibodies, the phosphorylation of NF-kB
factors, such as p105, IKKa/b,p65,andIkBa, was enhanced
in OTULIN-KO cells as compared with those in parental cells
(Figure 5A). In contrast, similar activation of NF-kBsignaling
factors was detected in CYLD-KO cells. Interestingly, the
phosphorylation of JNK, a MAP kinase, was enhanced in
both CYLD-andOTULIN-KO cells. The restoration of
OTULIN-WT in OTULIN-KO cells canceled the enhanced
phosphorylation of NF-kBsignalingfactorsinOTULIN-KO
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 6019267

A
CD
E
GF
IH
B
FIGURE 2 | The N-terminal domains in HOIP associate with CARMA1 and MALT1. (A) Endogenous association of LUBAC and the CBM complex upon TCR-
stimulation. Jurkat cells were stimulated with 20 ng/ml PMA and 150 ng/ml ionomycin for the indicated time periods. The cells lysates and anti-HOIL-1L
immunoprecipitates were subjected to immunoblotting with the indicated antibodies. (B) HOIP binds CARMA1 and MALT1. Myc-tagged LUBAC subunits and FLAG-
tagged CBM components were co-expressed in HEK293T cells, as indicated. The cell lysates and anti-Myc immunoprecipitates were immunoblotted with the
depicted antibodies. (C) Domain structure and mutants of HOIP. PUB: peptide:N-glycanase/UBA or UBX-containing proteins; ZF: zinc finger; NZF: Npl4-type zinc
finger; UBA: ubiquitin-associated; RING: really interesting new gene; IBR: in-between RING; and LDD: linear ubiquitin determining. (D) The B box domain of HOIP is
crucial for CARMA1-binding. WT and various mutants of Myc-tagged HOIP were co-expressed with FLAG-CARMA1 in HEK293T cells, and immunoprecipitations
followed by immunoblotting analyses were performed as indicated. (E) The PUB domain of HOIP is responsible for MALT1-binding. A similar analysis to that in
Figure 2D was performed, using FLAG-MALT1. (F) Domain structure and mutants of CARMA1. CARD, caspase-recruitment domain; BAR, Bin/Amphiphysin/Rvs;
GBP-C, guanylate-binding protein C‐terminal; PDZ, post synaptic density protein (PSD95)-Drosophila disc large tumor suppressor (Dlg1)-Zonula occludens-1 protein
(ZO-1); SH3, Src homology 3; and GUK, guanylate kinase. (G) The PDZ-SH3 region of CARMA1 binds HOIP. A similar analysis to that in Figure 2D was performed,
using WT and various mutants of FLAG-CARMA1 and Myc-HOIP. (H) Domain structure and mutants of MALT1. Ig, immunoglobulin-like. (I) The death domain in
MALT1 is the HOIP binding site. A similar analysis to that in Figure 2D was performed, using WT and various mutants of FLAG-MALT1 and Myc-HOIP.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 6019268

cells stimulated with anti-CD3 and anti-CD28 antibodies
(Supplementary Figure 4). These results clearly indicated
that OTULIN down-regulates the TCR-mediated NF-kB
activation pathway.
In OTULIN-KO cells, linear ubiquitination of MALT1 was
augmented ~3-fold over that of the parental Jurkat cells (Figures
5B, C). In OTULIN-deficient cells, canonical IKK was transiently
activated with a time course similar to that of the parental cells
(Figure 5D). Moreover, in OTULIN-KO Jurkat cells, the
enhanced linear ubiquitination of NEMO was detected after
TNF-astimulation (Figure 5E). These results suggested that
OTULIN, but not CYLD, plays a major role in the downregulation
of the LUBAC-mediated canonical NF-kBactivationpathwaysin
Jurkat cells.
Mathematical Model for Linear
Ubiquitination-Mediated IKK Activation in
TCR Pathway
To investigate the characteristics of LUBAC in the TCR-
mediated NF-kB activation pathway, we mathematically
considered the reaction of LUBAC-mediated IKK activation
through the linear ubiquitination of NEMO and CBM (Figure
6A). Since IKK is trans-activated by using the linear ubiquitin
chain as a scaffold, the NEMO-mediated activation of IKK
occurs between ubiquitinated IKKs or between ubiquitinated
IKKs and non-ubiquitinated IKKs. On the other hand, the
CBM-mediated activation of IKK occurs by contact between
ubiquitinated CBM and IKKs that are not distinguished by
their ubiquitination state. In addition, the mass conservation
law for the LUBAC and CBM complex holds, because protein
production and degradation are not considered.
The parameters of CBM_SM were set by a genetic
algorithm, using experimental data of the ubiquitinated
CBM complex and phosphorylated IKK obtained in Figures
4and 5(Figure 6B,Table 1). The estimation was performed
1,000 times with the setting to generate 1,000 generations. We
set the estimation results such that the error from the
experimental data is small and the concentrations of
LUBAC, CBM, and IKK were close to the concentrations of
general signal transduction factors (0.1 μM). However, all
of the parameter settings were values larger than 0.1 μM, since
proteins with different molecular weights accumulate and are
locally concentrated on the linear ubiquitin chains, and T cells
are smaller than general somatic cells. Importantly, the
parameters obtained by the GA showed that the CBM
complex is more likely to bind to LUBAC than NEMO
(k
C
>k
N
). Moreover, the ubiquitination rate of the CBM
complex was faster than that of NEMO (u
C
>u
N
). These
results suggested that IKK activation induced by the linear
A
C
B
FIGURE 3 | OTULIN and MALT1 simultaneously bind to the PUB domain of HOIP. (A) WT and various mutants of Myc-HOIP were co-expressed with FLAG-MALT1
and/or FLAG-OTULIN in HEK293T cells, as indicated. Cell lysates and anti-Myc immunoprecipitates were immunoblotted with the indicated antibodies. (B) The
endogenous association of CYLD, OTULIN, LUBAC, and the CBM complex. Jurkat cell lysates were immunoprecipitated with normal mouse IgG or anti-MALT1
antibody, and subjected to immunoblotting by the depicted antibodies. *; nonspecific signal. (C) Schematic illustration of the LUBAC/DUBs-CBM complex
interaction.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 6019269

ubiquitination of the CBM complex plays a major role to
activate IKK in T cells, by the linear ubiquitination of NEMO.
To quantitatively analyze the effect of the CBM complex on
IKK activation, we performed a simulation by changing the
binding rate of LUBAC and CBM (k
C
)orNEMO(k
N
). The
simulation was performed under the following four
conditions (where k
CG
and k
NG
mean the parameter set in
GA) (Figure 6C).
A
BC
EF
D
FIGURE 4 | The CBM complex is linearly ubiquitinated upon TCR stimulation. (A) Parental Jurkat cells were stimulated with 20 ng/ml PMA and 150 ng/ml
ionomycin for the indicated time periods. The heat-denatured cell lysates were immunoprecipitated and immunoblotted with the indicated antibodies. Taking
the maximum intensities of linear ubiquitination as 100%, the relative intensities of the linear ubiquitinated CBM complex are indicated. Means ±SD (n=3).
(B) HOIP is required for linear ubiquitination of MALT1. Parental and RNF31-KO Jurkat cells were stimulated with PMA/ionomycin as in (A),
immunoprecipitated with anti-MALT1, and immunoblotted with the indicated antibodies. (C) Suppressed linear ubiquitination of NEMO in the TCR-mediated
NF-kB activation pathway. Jurkat cells were stimulated with 20 ng/ml PMA and 150 ng/ml ionomycin or 1 µg/ml TNF-afor the indicated time periods, and
cell lysates were immunoprecipitated with an anti-NEMO antibody and then immunoblotted with the depicted antibodies. (D) MALT1 is exclusively linearly
ubiquitinated upon TCR stimulation. A similar analysis to that in Figure 4C was performed after anti-MALT1 immunoprecipitation. (E) Linear ubiquitination of
MALT1 after stimulation with CD3 and CD28. Jurkat cells were stimulated with 5 µg/ml each of anti-CD3 and anti-CD28 antibodies as indicated. The cell
lysates and anti-MALT1 immunoprecipitates were immunoblotted by the indicated antibodies. (F) Transient activation of canonical IKK. Jurkat cells were
stimulated with 20 ng/ml PMA and 150 ng/ml ionomycin for the indicated time periods. After immunoprecipitation with an anti-NEMO antibody, an in vitro
canonical IKK assay was performed using GST-IkBa
1–54
as the substrate. Samples were immunoblotted with the indicated antibodies, and taking the
maximum intensities of P-IkBaas 100%, the relative intensities are indicated. Means ±SD (n=3).(A,B,E)*; nonspecificsignal.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 60192610

A B
C
E
D
FIGURE 5 | OTULIN predominantly downregulates TCR-mediated NF-kBactivationinJurkatcells.(A) Parental, CYLD-deficient (CYLD-KO), and OTULIN-deficient (OTULIN-
KO) Jurkat cells were stimulated with 4 mg/ml each of anti-CD3 and anti-CD28 antibodies for the indicated time periods, and cell lysates were immunoblotted with the
depicted antibodies. (B) Augmented linear ubiquitination of MALT1 in OTULIN-deficient cells. Parental and OTULIN-KO Jurkat cells were stimulated with 20 ng/ml PMA and
150 ng/ml ionomycin for the indicated time periods, and the linear ubiquitination of MALT1 was compared as in Figure 4A.(C) Semi-quantification of MALT1 linear
ubiquitination in OTULIN-KO cells. OTULIN-KO cells were stimulated with PMA and ionomycin, and analyzed as in Figure 4A. Taking the maximum intensities of the linear
ubiquitination of MALT1 in parental Jurkat cells as 100% (closed circles), the relative intensities of linearly ubiquitinated MALT1 in OTULIN-KO cells are indicated (open circles).
Means ±SD (n=3).(D) Transient activation of canonical IKK in OTULIN-KO cells. OTULIN-KO cells were stimulated with PMA and ionomycin, and analyzed as in Figure 4E.
(E) Enhanced linear ubiquitination of NEMO in OTULIN-KO cells upon TNFatreatment. Jurkat and OTULIN-KO cells were stimulated with 1 µg/ml TNF-afor the indicated time
periods,andanalyzedasinFigure 4C.(A–C) *; nonspecificsignal.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 60192611

(i) Fix k
N
and change k
C
kN=kNG
kC=r kCG (r=0:1, 0:2, ⋯,0:9, 1, 2, ⋯, 9, 10)
(ii) Fix k
C
and change k
N
kC=kCG
kN=r kNG (r
=0:1, 0:2, ⋯,0:9, 1, 2, ⋯, 9, 10)
(iii) Change k
C
and k
N
simultaneously in inverse proportion
kC=kCG=1+rcos qðÞr=  1,  2, ⋯,9,10ðÞ
kN=1+rsin qðÞkNG r=  1,  2, ⋯,9,10ðÞ
and
kC=1+rcos qðÞkCG r=  1,  2, ⋯,9,10ðÞ
kN=kNG=1+rsin qðÞr=  1,  2, ⋯,9,10ðÞ
p
2≤q<p

(iv) Change k
C
and k
N
proportionally at the same time
kC=1+rcos qðÞkCG r=1,2,⋯,9,10ðÞ
kN=1+rsin qðÞkNG r=  1,  2, ⋯,9,10ðÞ
and
kC=kCG=1+rcos qðÞr=1,2,⋯,  9,  10ðÞ
kN=kNG=1+rsin qðÞr=  1,  2, ⋯,9,10ðÞ
0≤q<p
2
From the simulation results (i) and (iii), when k
C
is large, the
IKK activation peak rises quickly. Immediately after stimulation,
NEMO-mediated activation occurs earlier, but when the effect of
CBM-mediated activation is greater, the peak maximum is
reached sooner. This is because all IKKs can be activated via
CBM, without depending on the ubiquitination state of NEMO.
In addition, DUBs are stabilized by the ubiquitin chain of CBM,
and thus CBM is rapidly deubiquitinated. Since the activation of
IKK is also reduced, IKK can rapidly switch its active state via
CBM. Furthermore, from the results of simulation (ii), the
activation level decreases when k
N
is small. In other words,
these results suggest that the NEMO-mediated activation of IKK
is responsible for the strength of the response to the stimulus.
A B
C
FIGURE 6 | Mathematical simulation of the effects of linear ubiquitination of the CBM complex and NEMO on the TCR-mediated IKK activation. (A) LUBAC
ubiquitinates NEMO and the CBM complex. In this model, ubiquitination is assumed to be a first-order reaction. (B) Fitting result by GA. Solid lines represent
simulation results, and dots represent experimental data. (C) The simulation results of IKK activation, changing k
C
and k
N
. From the blue line to the red line, k
C
increases under condition (i), and k
N
increases under condition (ii). Condition (iii) is a simulation result when q=p/4. From the blue line to the red line, k
C
increases
and k
N
decreases. Condition (iv) is a simulation result when q=3p/4. From the blue line to the red line, k
C
decreases and k
N
increases.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 60192612

The results from simulation (iv) revealed that when the
ubiquitination of both CBM and NEMO is suppressed, the
activation of IKK also decreases, and the peak timing is
delayed. This reflects the need for rapid responses to external
stimuli in both pathways.
Mathematical Simulation for Linear
Ubiquitination of CBM Complex
Components
Finally, we constructed an expanded model to analyze the timing
deviations in the linear ubiquitinations of CARMA1, BCL10, and
MALT1. By focusing on the linear ubiquitination of the CBM
complex, we constructed a model that distinguishes CARMA1,
BCL10, and MALT1. The amounts of ubiquitinated proteins
were then simulated. If the ubiquitination and deubiquitination
rates of CARMA1, BCL10, and MALT1 were the same values,
then the CBM_DM is represented by the same model as the
CBM_SM, by equating CARMA1, BCL10, and MALT1. In this
model, we assumed that ubiquitination is a first-order reaction
for simplicity (Figure 7A).
As a result of fitting with the GA, the timing shifts of the peaks
of MALT1, CARMA1, and BCL10 could be reproduced (Figure
7B). By focusing on the parameters, we found that MALT1,
CARMA1, and BCL10 have different ubiquitination thresholds
(Tables 2,3). One of the reasons could be that the ubiquitin chain
is extended, thus further stabilizing the ubiquitination. In addition,
the ubiquitinating and deubiquitinating enzymes may evaluate the
states of MALT1, CARMA1, and BCL10. On the other hand, in
this simulation, the increase and decrease of ubiquitination levels
did not match well. Therefore, more detailed modeling of
ubiquitination is needed to solve this problem. Since ubiquitin is
consecutively linked and its activity changes depending on its
length, ubiquitination cannot be expressed well by the assumption
of the first-order reaction. The model could be improved by
considering the production levels of linear (de)-ubiquitination of
MALT1, CARMA1, and BCL10 as a switch-like reaction; for
A B
C
FIGURE 7 | Mathematical model for different linear ubiquitinations of the CBM complex. (A) Detailed reaction pathway of the ubiquitination of the CBM complex. The
red lines show parameters that are larger than the average value. The blue lines show parameters that are smaller than the average value. (B) Fitting results by GA in
the CBM_DM. (C) Fitting results by GA. The ubiquitination reaction is assumed to be a Hill function.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 60192613

example, by applying the Hill equation (Figure 7C). These results
indicated that length of the ubiquitin-linkage allosterically
regulates the generation and degradation of linear ubiquitin chains.
DISCUSSION
T lymphocytes play crucial roles in the host defence against
pathogens and tumors, and TCR recognizes the MHC-bound
antigen peptide fragments derived from them (26). In this study,
we initially identified that LUBAC is indispensable for the TCR-
mediated NF-kB pathway and IL-2–mediated T cell activation
(Figure 1). LUBAC physiologically associates with the CBM
complex, and the PUB and B-box domains of HOIP bind the
death domain in MALT1 and the PDZ-SH3 region in CARMA1,
respectively (Figure 2). The binding of MALT1 to the HOIP
PUB domain did not disturb the association with OTULIN
(Figure 3), indicating that MALT1 simultaneously binds
LUBAC with DUBs, such as OTULIN and CYLD-SPATA2,
through the HOIP PUB domain. The crystal structure of the
PUB-interacting motif (PIM) of OTULIN with the HOIP PUB
domain revealed that several residues, such as Tyr82, Asn85,
Asn101, and Asn102, form hydrogen-bonds with the OTULIN
PIM (16). Importantly, a patient with the Leu72!Pro missense
mutation in the HOIP PUB domain reportedly exhibited
multiorgan autoinflammation, immunodeficiency,
amylopectinosis, and lymphangiectasia with impaired
distributions and functions of T lymphocytes (41), suggesting
that the effects of the mutation may be due to the dysfunctional
binding of LUBAC to the CBM complex. Importantly, the B-box
domain in CYLD is involved in the intermolecular interaction
(42), and the B-box-containing region in HOIP reportedly
affected the dimerization of HOIP (16). Therefore, the deletion
of this region may affect the architecture of LUBAC, resulting in
defective CBM complex binding. Further detailed structural
analyses will be necessary for clarification.
At present, various E3s, such as c-IAP1/2, Cbl-B, STUB1,
NEDD4, ITCH, RNF181, TRAF6, and LUBAC, reportedly
ubiquitinate the CBM components in the TCR- and BCR-
signaling pathways (43). Although LUBAC is dispensable for
the BCR-mediated NF-kB activation pathway, crosstalk between
LUBAC and the CBM complex in B cells has been reported.
Upon BCR stimulation, BCL10 is linearly ubiquitinated by
LUBAC in a TRAF6-induced K63-ubiquitination-dependent
manner (31). Importantly, the Q622L polymorphism in HOIP,
which enhances the LUBAC activity, is associated with activated
B cell-like diffuse large B cell lymphoma (ABC-DLBCL) (44), and
c-IAP-1/2–mediated K63-ubiquitination is involved in the
LUBAC recruitment and the linear ubiquitination of BCL10 in
ABC-DLBCL cells (45). Although some controversy exists
regarding the necessity of the LUBAC catalytic activity for
ABC-DLBCL pathogenesis (30), LUBAC is crucial for B cell
lymphomagenesis through protection against DNA damage-
induced cell death (46). Therefore, the suppression of LUBAC
activity is a suitable therapeutic target for ABC-DLBCL (44,
46,47).
In this study, we identified that in addition to BCL10, MALT1
and CARMA1 are also linearly ubiquitinated by LUBAC (Figure
4), suggesting that the CBM complex components are
physiological substrates for LUBAC. Among them, the linear
ubiquitination of MALT1 seems to precede the canonical IKK
activation. In the case of MALT1, TRAF6-mediated K63-
ubiquitination at the C-terminal portion of Lys residues is
reportedly involved in NEMO recruitment, NF-kB activation,
and IL-2 production (48). Subsequently, A20, a DUB, removes
the K63-ubiquitin chain from MALT1 and thus downregulates
the NF-kB activation pathway (49). Moreover, the
monoubiquitination of K644 in MALT1 by an unknown E3 is
required for the constitutive protease activity of MALT1 (50).
Interestingly, the paracasapase activity of MALT1 cleaves the
Arg
165
-Gly
166
bond of HOIL-1L, and thus abrogates the linear
ubiquitination activity of LUBAC in B cells (51). We could not
detect the MALT1-induced HOIL-1L cleavage upon TCR
stimulation in Jurkat cells during the experimental incubation
period (~90 min); however, prolonged TCR stimulation may
affect the proteostasis of LUBAC.
We determined that OTULIN, but not CYLD, plays a pivotal
role in the suppression of TCR-mediated NF-kB activation in
Jurkat cells, although JNK was activated in either OTULIN-or
CYLD-deficiency (Figure 5). A homozygous mutation in the
OTULIN gene causes autoinflammation, named OTULIN-
related autoinflammatory syndrome (ORAS), which induces
the degradation of LUBAC subunits in T and B cells (52).
Moreover, TCR-induced JNK activation is required for the
MALT1-mediated proteolytic inactivation at Arg324 of CYLD
(53). Thus, these DUBs are involved in the crosstalk regulation of
the TCR-mediated NF-kB activation pathway.
The mathematical analysis of the NF-kB signaling pathway
has provided a novel paradigm for spatiotemporal activation
mechanism, target gene expression, feed-back inhibition, and
cytosol-nucleus oscillation of the transcription factor, and
various mathematical models have been proposed (35–37). In
contrast to TNF-a-mediated NF-kB activation pathway, the
CBM complex, but not NEMO, was preferentially
ubiquitinated by LUBAC upon TCR stimulation (Figure 4),
and the mathematical analysis indicated that linear
ubiquitination of the CBM complex stably promotes IKK
activation (Figure 6). On the other hand, NEMO-mediated
activation of IKK was required to increase the activation level
of IKK. In addition, we identified the differences in the timing of
ubiquitination between CARMA1, BCL10, and MALT1 in the
CBM complex (Figure 4), although its physiological function
was not clear. The mathematical modeling suggested that by
shifting the timing of the MALT1, CARMA1, and BCL10
ubiquitinations, the scaffolding of ubiquitin chains persists, and
IKK can be stably activated due to the allosteric regulation
(Figure 7). Moreover, DUBs, such as OTULIN, can quickly
downregulate IKK and then restore it to the original state. Thus,
these mathematical simulations were effective in characterizing
the experimentally obtained features in TCR-mediated NF-kB
pathway. However, in order to quantitatively analyze the timing
shifts of the CARMA1, BCL10, and MALT1 ubiquitinations, a
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 60192614

model that reflects the detailed mechanism of ubiquitination will
be required.
DATA AVAILABILITY STATEMENT
The original contributions presented in the study are included in
the article/Supplementary Material. Further inquiries can be
directed to the corresponding authors.
ETHICS STATEMENT
The protocols were approved by the Safety Committee for
Recombinant DNA Experiments and the Safety Committee for
Bio-Safety Level 2 (BSL-2) Experiments of Osaka
City University.
AUTHOR CONTRIBUTIONS
DO performed cell biological experiments. NH performed the
mathematical simulation. TS and FT coordinated the study. All
authors wrote and commented on the manuscript, and discussed
the results. All authors contributed to the article and approved
the submitted version.
FUNDING
This work was partly supported by MEXT/JSPS KAKENHI grants
(Nos. JP16H06276 (AdAMS), JP16H06575, JP18H02619, and
JP19K22541 to FT, 16H06576 to TS, and JP18K06967,
JP19H05296, and 20H5337 to DO), Takeda Science Foundation
(FT), a Grant for Research Program on Hepatitis from the Japan
Agency for Medical Research and Development (AMED—
19fk0210050h0001 to FT), GSK Japan Research Grant 2017
(DO), and a grant from the Nakatomi Foundation (DO).
ACKNOWLEDGMENTS
We thank Dr. Eiji Goto, Ms. Wakana Koeda, Ms. Shiori Motoyama,
and Ms. Ayana Sugihara at Osaka City University and Mr. Daisuke
Hamada at Osaka University for technical assistance, and the
Research Support Platform of Osaka City University Graduate
School of Medicine for technical support. We also thank
Genentech Inc. for anti-linear ubiquitin antibody (1F11/3F5/Y102L).
SUPPLEMENTARY MATERIAL
The Supplementary Material for thisarticle can be found online at:
https://www.frontiersin.org/articles/10.3389/fimmu.2020.601926/
full#supplementary-material
REFERENCES
1. Zhang Q, Lenardo MJ, Baltimore D. 30 Years of NF-kB: A Blossoming of
Relevance to Human Pathobiology. Cell (2017) 168(1-2):37–57. doi: 10.1016/
j.cell.2016.12.012
2. Hayden MS, Ghosh S. NF-kB, the first quarter-century: remarkable progress
and outstanding questions. Genes Dev (2012) 26(3):203–34. doi: 10.1101/
gad.183434.111
3. Sun SC. The non-canonical NF-kB pathway in immunity and inflammation.
Nat Rev Immunol (2017) 17(9):545–58. doi: 10.1038/nri.2017.52
4. Hershko A, Ciechanover A. The ubiquitin system for protein degradation. Annu
Rev Biochem (1992) 61:761–807. doi: 10.1146/annurev.bi.61.070192.003553
5. Komander D, Rape M. The ubiquitin code. Annu Rev Biochem (2012) 81:203–
29. doi: 10.1146/annurev-biochem-060310-170328
6. Courtois G, Fauvarque MO. TheManyRolesofUbiquitininNF-kB
Signaling. Biomedicines (2018) 6(2):43. doi: 10.3390/biomedicines6020043
7. Sasaki K, Iwai K. Roles of linear ubiquitinylation, a crucial regulator of NF-kB
and cell death, in the immune system. Immunol Rev (2015) 266(1):175–89.
doi: 10.1111/imr.12308
8. Shimizu Y, Taraborrelli L, Walczak H. Linear ubiquitination in immunity.
Immunol Rev (2015) 266(1):190–207. doi: 10.1111/imr.12309
9. Ikeda F. Linear ubiquitination signals in adaptive immune responses.
Immunol Rev (2015) 266(1):222–36. doi: 10.1111/imr.12300
10. Rahighi S, Ikeda F, Kawasaki M, Akutsu M, Suzuki N, Kato R, et al. Specific
recognition of linear ubiquitin chains by NEMO is important for NF-kB
activation. Cell (2009) 136(6):1098–109.
11. Fujita H, Rahighi S, Akita M, Kato R, Sasaki Y, Wakatsuki S, et al. Mechanism
underlying IkB kinase activation mediated by the linear ubiquitin chain
assembly complex. Mol Cell Biol (2014) 34(7):1322–35. doi: 10.1128/
MCB.01538-13
12. Iwai K, Fujita H, Sasaki Y. Linear ubiquitin chains: NF-kB signalling, cell
death and beyond. Nat Rev Mol Cell Biol (2014) 15(8):503–8. doi: 10.1038/
nrm3836
13. Rittinger K, Ikeda F. Linear ubiquitin chains: enzymes, mechanisms and
biology. Open Biol (2017) 7(4):170026. doi: 10.1098/rsob.170026
14. Sasaki Y, Sano S, Nakahara M, Murata S, Kometani K, Aiba Y, et al. Defective
immune responses in mice lacking LUBAC-mediated linear ubiquitination in
B cells. EMBO J (2013) 32(18):2463–76. doi: 10.1038/emboj.2013.184
15. Tokunaga F, Nakagawa T, Nakahara M, Saeki Y, Taniguchi M, Sakata S, et al.
SHARPIN is a component of the NF-kB-activating linear ubiquitin chain
assembly complex. Nature (2011) 471(7340):633–6. doi: 10.1038/nature09815
16. Elliott PR, Nielsen SV, Marco-Casanova P, Fiil BK, Keusekotten K, Mailand
N, et al. Molecular basis and regulation of OTULIN-LUBAC interaction. Mol
Cell (2014) 54(3):335–48. doi: 10.1016/j.molcel.2014.03.018
17. Schaeffer V, Akutsu M, Olma MH, Gomes LC, Kawasaki M, Dikic I. Binding
of OTULIN to the PUB domain of HOIP controls NF-kB signaling. Mol Cell
(2014) 54(3):349–61. doi: 10.1016/j.molcel.2014.03.016
18. Elliott PR, Leske D, Hrdinka M, Bagola K, Fiil BK, McLaughlin SH, et al.
SPATA2 Links CYLD to LUBAC, Activates CYLD, and Controls LUBAC
Signaling. Mol Cell (2016) 63(6):990–1005. doi: 10.1016/j.molcel.2016.08.001
19. Heger K, Wickliffe KE, Ndoja A, Zhang J, Murthy A, Dugger DL, et al.
OTULIN limits cell death and inflammation by deubiquitinating LUBAC.
Nature (2018) 559(7712):120–4. doi: 10.1038/s41586-018-0256-2
20. Bignell GR, Warren W, Seal S, Takahashi M, Rapley E, Barfoot R, et al.
Identification of the familial cylindromatosis tumour-suppressor gene. Nat
Genet (2000) 25(2):160–5. doi: 10.1038/76006
21. Sato Y, Goto E, Shibata Y, Kubota Y, Yamagata A, Goto-Ito S, et al. Structures
of CYLD USP with Met1- or Lys63-linked diubiquitin reveal mechanisms for
dual specificity. NatStructMolBiol(2015) 22(3):222–9. doi: 10.1038/
nsmb.2970
22. Hrdinka M, Fiil BK, Zucca M, Leske D, Bagola K, Yabal M, et al. CYLD Limits
Lys63- and Met1-Linked Ubiquitin at Receptor Complexes to Regulate Innate
Immune Signaling. Cell Rep (2016) 14(12):2846–58. doi: 10.1016/
j.celrep.2016.02.062
23. Kupka S, De Miguel D, Draber P, Martino L, Surinova S, Rittinger K, et al.
SPATA2-Mediated Binding of CYLD to HOIP Enables CYLD Recruitment to
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 60192615

Signaling Complexes. Cell Rep (2016) 16(9):2271–80. doi: 10.1016/
j.celrep.2016.07.086
24. Schlicher L, Wissler M, Preiss F, Brauns-Schubert P, Jakob C, Dumit V, et al.
SPATA2 promotes CYLD activity and regulates TNF-induced NF-kB
signaling and cell death. EMBO Rep (2016) 17(10):1485–97. doi: 10.15252/
embr.201642592
25. Wagner SA, Satpathy S, Beli P, Choudhary C. SPATA2 links CYLD to the
TNF-areceptor signaling complex and modulates the receptor signaling
outcomes. EMBO J (2016) 35(17):1868–84. doi: 10.15252/embj.201694300
26. Alcover A, Alarcon B, Di Bartolo V. Cell Biology of T Cell Receptor
Expression and Regulation. Annu Rev Immunol (2018) 36:103–25.
doi: 10.1146/annurev-immunol-042617-053429
27. Au-Yeung BB, Shah NH, Shen L, Weiss A. ZAP-70 in Signaling, Biology, and
Disease. Annu Rev Immunol (2018) 36:127–56. doi: 10.1146/annurev-
immunol-042617-053335
28. Thome M, Charton JE, Pelzer C, Hailfinger S. Antigen receptor signaling to
NF-kB via CARMA1, BCL10, and MALT1. Cold Spring Harb Perspect Biol
(2010) 2(9):a003004. doi: 10.1101/cshperspect.a003004
29. Meininger I, Krappmann D. Lymphocyte signaling and activation by the
CARMA1-BCL10-MALT1 signalosome. Biol Chem (2016) 397(12):1315–33.
doi: 10.1515/hsz-2016-0216
30. Dubois SM, Alexia C, Wu Y, Leclair HM, Leveau C, Schol E, et al. A catalytic-
independent role for the LUBAC in NF-kB activation upon antigen receptor
engagement and in lymphoma cells. Blood (2014) 123(14):2199–203.
doi: 10.1182/blood-2013-05-504019
31. Satpathy S, Wagner SA, Beli P, Gupta R, Kristiansen TA, Malinova D, et al.
Systems-wide analysis of BCR signalosomes and downstream
phosphorylation and ubiquitylation. Mol Syst Biol (2015) 11(6):810.
doi: 10.15252/msb.20145880
32. Yang YK, Yang C, Chan W, Wang Z, Deibel KE, Pomerantz JL. Molecular
Determinants of Scaffold-induced Linear Ubiquitinylation of B Cell
Lymphoma/Leukemia 10 (Bcl10) during T Cell Receptor and Oncogenic
Caspase Recruitment Domain-containing Protein 11 (CARD11) Signaling.
J Biol Chem (2016) 291(50):25921–36. doi: 10.1074/jbc.M116.754028
33. Douanne T, Gavard J, Bidere N. The paracaspase MALT1 cleaves the LUBAC
subunit HOIL1 during antigen receptor signaling. J Cell Sci (2016) 129
(9):1775–80. doi: 10.1242/jcs.185025
34. Elton L, Carpentier I, Staal J, Driege Y, Haegman M, Beyaert R. MALT1
cleaves the E3 ubiquitin ligase HOIL-1 in activated T cells, generating a
dominant negative inhibitor of LUBAC-induced NF-kB signaling. FEBS J
(2016) 283(3):403–12. doi: 10.1111/febs.13597
35. Hoffmann A, Levchenko A, Scott ML, Baltimore D. The IkB-NF-kB signaling
module: temporal control and selective gene activation. Science (2002) 298
(5596):1241–5. doi: 10.1126/science.1071914
36. Basak S, Behar M, Hoffmann A. Lessons from mathematically modeling the
NF-kB pathway. Immunol Rev (2012) 246(1):221–38. doi: 10.1111/j.1600-
065X.2011.01092.x
37. Ohshima D, Inoue J, Ichikawa K. Roles of spatial parameters on the oscillation
of nuclear NF-kB: computer simulations of a 3D spherical cell. PloS One
(2012) 7(10):e46911. doi: 10.1371/journal.pone.0046911
38. Hatanaka N, Seki T, Inoue JI, Tero A, Suzuki T. Critical roles of IkBaand
RelA phosphorylation in transitional oscillation in NF-kB signaling module.
J Theor Biol (2019) 462:479–89. doi: 10.1016/j.jtbi.2018.11.023
39. Goto E, Tokunaga F. Decreased linear ubiquitination of NEMO and FADD on
apoptosis with caspase-mediated cleavage of HOIP. Biochem Biophys Res
Commun (2017) 485(1):152–9. doi: 10.1016/j.bbrc.2017.02.040
40. Tokunaga F, Sakata S, Saeki Y, Satomi Y, Kirisako T, Kamei K, et al.
Involvement of linear polyubiquitylation of NEMO in NF-kB activation.
Nat Cell Biol (2009) 11(2):123–32. doi: 10.1038/ncb1821
41. Boisson B, Laplantine E, Dobbs K, Cobat A, Tarantino N, Hazen M, et al.
Human HOIP and LUBAC deficiency underlies autoinflammation,
immunodeficiency, amylopectinosis, and lymphangiectasia. JExpMed
(2015) 212(6):939–51. doi: 10.1084/jem.20141130
42. Xie S, Chen M, Gao S, Zhong T, Zhou P, Li D, et al. The B-box module of
CYLD is responsible for its intermolecular interaction and cytoplasmic
localization. Oncotarget (2017) 8(31):50889–95. doi: 10.18632/
oncotarget.15142
43. Lork M, Staal J, Beyaert R. Ubiquitination and phosphorylation of the
CARD11-BCL10-MALT1 signalosome in T cells. Cell Immunol (2019)
340:103877. doi: 10.1016/j.cellimm.2018.11.001
44. Yang Y, Schmitz R, Mitala J, Whiting A, Xiao W, Ceribelli M, et al. Essential
role of the linear ubiquitin chain assembly complex in lymphoma revealed by
rare germline polymorphisms. Cancer Discovery (2014) 4(4):480–93.
doi: 10.1158/2159-8290.CD-13-0915
45. Yang Y, Kelly P, Shaffer AL,3, Schmitz R, Yoo HM, Liu X, et al. Targeting
Non-proteolytic Protein Ubiquitination for the Treatment of Diffuse Large B
Cell Lymphoma. Cancer Cell (2016) 29(4):494–507. doi: 10.1016/
j.ccell.2016.03.006
46. Jo T, Nishikori M, Kogure Y, Arima H, Sasaki K, Sasaki Y, et al. LUBAC
accelerates B-cell lymphomagenesis by conferring resistance to genotoxic
stress on B cells. Blood (2020) 136(6):684–97. doi: 10.1182/
blood.2019002654
47. Oikawa D, Sato Y, Ohtake F, Komakura K, Hanada K, Sugawara K, et al.
Molecular bases for HOIPINs-mediated inhibition of LUBAC and innate
immune responses. Commun Biol (2020) 3(1):163. doi: 10.1038/s42003-020-
0882-8
48. Oeckinghaus A, Wegener E, Welteke V, Ferch U, Arslan SC, Ruland J, et al.
Malt1 ubiquitination triggers NF-kB signaling upon T-cell activation. EMBO J
(2007) 26(22):4634–45. doi: 10.1038/sj.emboj.7601897
49. Duwel M, Welteke V, Oeckinghaus A, Baens M, Kloo B, Ferch U, et al. A20
negatively regulates T cell receptor signaling to NF-kB by cleaving Malt1
ubiquitin chains. JImmunol(2009) 182(12):7718–28.doi:10.4049/
jimmunol.0803313
50. Pelzer C, Cabalzar K, Wolf A, Gonzalez M, Lenz G, Thome M. The protease
activity of the paracaspase MALT1 is controlled by monoubiquitination. Nat
Immunol (2013) 14(4):337–45. doi: 10.1038/ni.2540
51. Klein T, Fung SY, Renner F, Blank MA, Dufour A, Kang S, et al. The
paracaspase MALT1 cleaves HOIL1 reducing linear ubiquitination by LUBAC
to dampen lymphocyte NF-kBsignalling.Nat Commun (2015) 6:8777.
doi: 10.1038/ncomms9777
52. Damgaard RB, Walker JA, Marco-Casanova P, Morgan NV, Titheradge HL,
Elliott PR, et al. The Deubiquitinase OTULIN Is an Essential Negative
Regulator of Inflammation and Autoimmunity. Cell (2016) 166(5):1215–
1230 e1220. doi: 10.1016/j.cell.2016.07.019
53. Staal J, Driege Y, Bekaert T, Demeyer A, Muyllaert D, Van Damme P, et al. T-
cell receptor-induced JNK activation requires proteolytic inactivation of
CYLD by MALT1. EMBO J (2011) 30(9):1742–52. doi: 10.1038/emboj.2011.85
Conflict of Interest: The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be construed as a
potential conflict of interest.
Copyright © 2020 Oikawa, Hatanaka, Suzuki and Tokunaga. This is an open-access
article distributed under the terms of the Creative Commons Attribution License
(CC BY). The use,distribution or reproduction in other forums is permitted, provided
the original author(s) and the copyright owner(s) are credited and that the original
publicationin this journal is cited, in accordance with accepted academicpractice. No
use, distribution or reproduction is permitted which does not comply with these terms.
Oikawa et al. Linear Ubiquitination of CBM Complex
Frontiers in Immunology | www.frontiersin.org November 2020 | Volume 11 | Article 60192616