ArticlePDF Available

Genetic relationships of Long-nosed Potoroos Potorous tridactylus (Kerr, 1792) from the Bass Strait Islands, with notes on the subspecies Potorous tridactylus benormi Courtney, 1963

Authors:
Greta Frankham at Australian Museum
Greta Frankham
Mark Eldridge at Australian Museum
Mark Eldridge
Linda Neaves at Australian Museum
Linda Neaves
Download full-text PDF
Read full-text
Download citation

Abstract and Figures

Bass Strait is an important biogeographic barrier for Australian mammals, often resulting in significant genetic differentiation between populations on the mainland and Tasmania for species with a trans-Bassian distribution. King and Flinders Islands, in Bass Strait, are the largest remnants of the land bridge that once linked Tasmania with mainland Australia. Due to their remote locality and habitat loss on the islands since European settlement, little is known about the evolutionary movements of species across the former land bridge. Here we present genetic data, generated from museum skins, on the King and Flinders Island populations of Long-nosed Potoroo, Potorous tridactylus (Kerr, 1792) to investigate their affinities with other populations of this species. We also assessed the validity of the subspecies Potorous tridactylus benormi Courtney, 1963 described from King Island. Analysis of two partial mitochondrial DNA genes (CO1, ND2) indicate that potoroos on King and Flinders Islands are more closely related to Tasmanian rather than mainland potoroo populations. Molecular and morphological data from the holotype and paratype of Potorous tridactylus benormi does not support separate taxonomic status and places it within the Tasmanian subspecies Potorous tridactylus apicalis (Gould, 1851). © 2020 Frankham, Neaves, Eldridge. This is an open access article licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original authors and source are credited.
Figures - uploaded by Mark Eldridge
Author content
All figure content in this area was uploaded by Mark Eldridge
Content may be subject to copyright.
Content uploaded by Mark Eldridge
Author content
All content in this area was uploaded by Mark Eldridge on Dec 08, 2020
Content may be subject to copyright.
Papers in Honour of Ken Aplin
edited by
Julien Louys, Sue O’Connor and Kristofer M. Helgen
Helgen, Kristofer M., Julien Louys, and Sue O’Connor. 2020. The lives of creatures obscure,
misunderstood, and wonderful: a volume in honour of Ken Aplin 1958–2019 ..........................149
Armstrong, Kyle N., Ken Aplin, and Masaharu Motokawa. 2020. A new species of
extinct False Vampire Bat (Megadermatidae: Macroderma) from the Kimberley
Region of Western Australia ........................................................................................................... 161
Cramb, Jonathan, Scott A. Hocknull, and Gilbert J. Price. 2020. Fossil Uromys
(Rodentia: Murinae) from central Queensland, with a description of a new
Middle Pleistocene species ............................................................................................................. 175
Price, Gilbert J., Jonathan Cramb, Julien Louys, Kenny J. Travouillon, Eleanor M. A.
Pease, Yue-xing Feng, Jian-xin Zhao, and Douglas Irvin. 2020. Late Quaternary
fossil vertebrates of the Broken River karst area, northern Queensland, Australia ........................ 193
Theden-Ringl, Fenja, Geoffrey S. Hope, Kathleen P. Hislop, and Benedict J. Keaney.
2020. Characterizing environmental change and species’ histories from
stratiedfaunalrecordsinsoutheasternAustralia:aregionalreviewandacase
study for the early to middle Holocene ........................................................................................... 207
Brockwell,Sally,andKenAplin.2020.Faunaontheoodplains:lateHolocene
culture and landscape on the sub-coastal plains of northern Australia ........................................... 225
Hawkins, Stuart, Fayeza Shasliz Arumdhati, Mirani Litster, Tse Siang Lim, Gina Basile,
Mathieu Leclerc, Christian Reepmeyer, Tim Ryan Maloney, Clara Boulanger,
Julien Louys, Mahirta, Geoff Clark, Gendro Keling, Richard C. Willan, Pratiwi
Yuwono, and Sue O’Connor. 2020. Metal-Age maritime culture at Jareng Bori
rockshelter, Pantar Island, eastern Indonesia .................................................................................. 237
Frankham, Greta J., Linda E. Neaves, and Mark D. B. Eldridge. 2020. Genetic
relationships of Long-nosed Potoroos Potorous tridactylus (Kerr, 1792) from
the Bass Strait Islands, with notes on the subspecies Potorous tridactylus
benormi Courtney, 1963 .................................................................................................................. 263
Rowe, Kevin C., Helena A. Soini, Karen M. C. Rowe, Mark Adams, and Milos V.
Novotny. 2020. Odorants differentiate Australian Rattus with increased
complexity in sympatry ................................................................................................................... 271
Louys, Julien, Michael B. Herrera, Vicki A. Thomson, Andrew S. Wiewel, Stephen C. Donnellan,
Sue O’Connor, and Ken Aplin. 2020. Expanding population edge craniometrics
and genetics provide insights into dispersal of commensal rats through
Nusa Tenggara, Indonesia ............................................................................................................... 287
Breed, William G., Chris M. Leigh, and Eleanor J. Peirce. 2020. Reproductive biology
of the mice and rats (family Muridae) in New Guinea—diversity and evolution ......................... 303
Suzuki, Hitoshi. 2020. Evolutionary history of the subgenus Mus in Eurasia with
special emphasis on the House Mouse Mus musculus .................................................................... 317
Richards, Stephen J., and Stephen C. Donnellan. 2020. Litoria aplini sp. nov., a new
species of treefrog (Pelodryadidae) from Papua New Guinea ........................................................ 325
Records of the Australian Museum
volume 72, issue no. 5
25 November 2020
Keywords: taxonomy; mtDNA; marsupial; Potoroidae; phylogeography; biogeography; Tasmania
Corresponding author: Greta J. Frankham Greta.Frankham@Australian.Museum
Received: 3 February 2020 Accepted: 21 August 2020 Published: 25 November 2020 (in print and online simultaneously)
Publisher: The Australian Museum, Sydney, Australia (a statutory authority of, and principally funded by, the NSW State Government)
Citation: Frankham, Greta J., Linda E. Neaves, and Mark D. B. Eldridge. 2020. Genetic relationships of Long-nosed Potoroos Potorous tridactylus (Kerr,
1792) from the Bass Strait Islands, with notes on the subspecies Potorous tridactylus benormi Courtney, 1963. In Papers in Honour of Ken Aplin, ed.
Julien Louys, Sue O’Connor, and Kristofer M. Helgen. Records of the Australian Museum 72(5): 263–270.
https://doi.org/10.3853/j.2201-4349.72.2020.1725
Copyright: © 2020 Frankham, Neaves, Eldridge. This is an open access article licensed under a Creative Commons
Attribution 4.0 International License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any
medium, provided the original authors and source are credited.
Records of the Australian Museum (2020)
vol. 72, issue no. 5, pp. 263–270
https://doi.org/10.3853/j.2201-4349.72.2020.1725
Genetic Relationships of Long-nosed Potoroos
Potorous tridactylus (Kerr, 1792) from the Bass Strait Islands,
with Notes on the Subspecies
Potorous tridactylus benormi Courtney, 1963
,3
1

2

3

Records of the Australian Museum
a peer-reviewed open-access journal
published by the Australian Museum, Sydney
communicating knowledge derived from our collections
ISSN 0067-1975 (print), 2201-4349 (online)
 

trans


     
Potorous tridactylus 
Potorous
tridactylus benormi 
CO1, ND2

 Potorous tridactylus benormi 
Potorous tridactylus apicalis 
Introduction
          

     
   

      

        

        

  et al.,
et al.,et al.,
          


 
 

  
       






   

    
      
  
         
       
       
         

 Mirounga leonina,  Vombatus
ursinusDasyurus maculatus
Dromaius novaehollandiae minor



  


et al.,


Figure 1
   Potorous tridactylus
trans
     


    


   
       
et al.,
 et al.,      
         
       
        
 

 




Potorous tridactylus
benormi       

       
       
      
       



et al 
et al.,
  
         


       
    



         
    
  

        
   
Figure 2Potorous tridactylus benormi 
   
Potorous tridactylus benormi
.
Methods
    
  Potorous tridactylus    
      
 benormi
  benormi     
       
      
      

 
Table 1Cytochrome c oxidase subunit 1NADH dehydrogenase subunit 2

   
Cytochrome c oxidase subunit 1
 CACGCAGGRGCYTCAGTAG  GATAGTAGVAGMAGRACTGCTGT
 ACCACCCGCCCTRTCMCAATATC  CTTCTGGGTGRCCRAAGAATCA
 ACYATRCTATTAACAGACCG  TTACCAGAGTAGTAAGTYAC
TGATTCTTYGGYCACCCAGAAG  TAGGCTCGGGTATCKACRTC
 ACAGTTGGACTRGAYGTAG  ATRAATCCTAGGGCTCATAG
 GTTTTCAGCTGRTTAGCAAC  CCTATWGATAGGACGTAGTGGAAGTG
NADH dehydrogenase subunit 2
 AAATCYTTAACCAACYTATG  GGGAATATRGTGAGAGTTGAG
 GCWATCCTAATAGCYATATCA GATTTGCGTTCGAATGTAGCAAG

et al.,



      
  


        





 CO1
ND2

       
      2   
    Taq  
      
        
     


    

     
    

     
     
   
CO1ND2
et al.CO1
ND2CO1
ND2Osphranter
robustus 


et al.
  
        
     
 
       
et al.





et al.

et al.,



Results
 CO1  ND2    

CO1

   
    
CO1
   
CO1
ND2
   
       
     
       
      
  CO1  ND2


CO1
       
Potorous tridactylus benormi
CO1ND2

     

     


Potorous tridactylus
apicalis
et al 
Figure 3    CO1  Potorous
tridactylus benormi 

Figure 4CO1ND2

 
Discussion
CO1
 ND2 

Potorous
tridactylus apicalis.     
        
     
et al.
     CO1  ND2   
 
Potorous tridactylus tridactylus  

Potorous tridactylustrisulcatus
  
Potorous tridactylus apicalis 
et al.,
 
         
       


         


  
 et al.    
       


       


trans-

Isoodon obesulus
   et al.,   
(Ornithorhynchus anatinus    
et alet al
    Notamacropus rufogriseus
  
       

      

     


        
    Macropus giganteus
et alDromaius novaehollandiae
et al.,
      
 
  

        
  








        
et al., 


      
      

        
 
 CO1ND2  
et al. 
        

  

  

  
      Potorous tridactylus
benormi

   
      
       
Potorous tridactylus apicalis
et al.
        
Potorous tridactylus
benormi 
Potorous tridactylus benormi



        
  
       





  

       

   
       
      

et al.,et al.,


    


        

     

et al 
      
        

     


     
      





et al., 

  



Potorous tridactylus benormi

References

        
 CALMScience

     Potorous tridactylus
tridactylusAustralian
Zoologist
https://doi.org/10.7882/AZ.2018.010
  

https://www.ala.org.au


Nature Conservation: The Role of Remnants
of Native Vegetation



  Potorous tridactylus 
Kangaroos, Wallabies and Rat-kangaroos, 
 

Zoological
Catalogue of Australia. Vol. 5 Mammalia,
 .
       



 Australian
Journal of Zoology
https://doi.org/10.1071/ZO19052

Australian Aviculture



    
Australian Zoologist 
https://doi.org/10.7882/AZ.2020.003

Handbook of the Mammals of the
World Vol.      

           
     
Dasyurus maculatus
Molecular Ecology

https://doi.org/10.1046/j.1365-294x.1999.00745.x

Potorous
tridactylusAustralian Mammalogy

https://doi.org/10.1071/AM10051

       
PotorousMolecular Phylogenetics
and Evolution
https://doi.org/10.1016/j.ympev.2012.05.013

   
     Potorous tridactylus
    
Conservation Genetics
https://doi.org/10.1007/s10592-013-0560-1
         
      
        
Potorous tridactylus
Journal of Biogeography
https://doi.org/10.1111/jbi.12659

 

  Journal of Zoology

https://doi.org/10.1111/j.1469-7998.2011.00854.x
The Birds of King Island

       
     Potorous tridactylus 
Mammalia
https://doi.org/10.1515/mamm.1968.32.1.30


Biodiversity and Conservation
https://doi.org/10.1007/s10531-009-9621-7

Biogeography and Ecology in Tasmania, 
 
https://doi.org/10.1007/978-94-010-2337-5_15
      Taxonomy of Australian
Mammals
https://doi.org/10.1071/9781486300136
    Variation in Island and Mainland
Populations of  and 
(Marsupialia).


Potorous 
Australian Journal of Zoology 
https://doi.org/10.1071/ZO9760573
     The Mammals of
Australia,


Science
https://doi.org/10.1126/science.1059549
 


  Macropus rufogriseus
rufogriseusMolecular Ecology
https://doi.org/10.1046/j.1365-294x.2000.00922.x
     
Potorous tridactylus 
    Australian
Journal of Zoology 
https://doi.org/10.1071/ZO00077
      
Potorous tridactylus 
Australian
Mammalogy 
     Molecular Evolution and
Phylogenetics

      Potorous
tridactylus 
Australian Journal of Zoology
https://doi.org/10.1071/ZO10075

   
Molecular Phylogenetics and Evolution
https://doi.org/10.1006/mpev.2001.0960


Systematic Biology
https://doi.org/10.1093/sysbio/syy032


  
Systematic Biology

https://doi.org/10.1093/sysbio/sys029


Molecular Ecology
https://doi.org/10.1046/j.1365-294x.1998.00334.x

Engaeus
, Geocharax Gramastacus 

Invertebrate Systematics
https://doi.org/10.1071/IS07019
         
  
Crinia signifera
Molecular Phylogenetics and Evolution
https://doi.org/10.1016/j.ympev.2008.01.011


Molecular Biology and Evolution 
https://doi.org/10.1093/molbev/mst197


Biology Letters
https://doi.org/10.1098/rsbl.2017.0617


       
   Molecular Ecology 

https://doi.org/10.1111/j.1365-294X.2010.04730.x
         

 Macropus giganteus.Heredity

https://doi.org/10.1038/sj.hdy.6800293
... As such, the low level of genetic variation across 1000 s of kms in A. floriformis and A. peelei is intriguing. The lack of A. peelei in Tasmania is also interesting, as the other species of Asphondylia on T. arbuscula and S. quinqueflora made it across the Bass Strait, either by over-water dispersal or via land bridges, for example, at the last Glacial Maximum (Frankham et al. 2020;Hope 1994;Lambek and Chappell 2001). The presence of A. floriformis galls and A. sp. ...
Investigating gall midges (Asphondylia), associated microfungi and parasitoids in some chenopod plant hosts (Amaranthaceae) in south-eastern Australia
Article
Full-text available
  • Oct 2021
  • ARTHROPOD-PLANT INTE
The hidden diversity and interactions of gall midges (Cecidomyiidae), their associated microfungal symbiont(s), and parasitoid wasps in temperate saltmarshes have been little studied in Australia. Over a period of two years, we investigated the gall-associated communities of the dominant saltmarsh plants, Tecticornia arbuscula and Salicornia quinqueflora, across south-eastern Australian coastal and inland salt-lake sites. We discovered that i) many gall midge species are more widely distributed than previously thought; ii) co-distribution of species affecting different plant organs on the same host is also widespread; iii) diversity of gall midges (6 species previously named; 5 species identified here as new) and parasitoid wasps (17 sp. prov.) is likely higher than we uncovered; iv) parasitoid wasps associated with gall midges belonged to diverse lineages and appear to be widespread generalists; v) while the microfungus usually associated with most Cecidomyiinae larval chambers is Botryosphaeria dothidea, we discovered a provisional new species of Botryosphaeria associated with a novel Asphondylia sp. in western South Australia. We also show that targeted amplicon sequencing is a valuable tool for investigating all components of multi-trophic level systems. Our research has contributed to a greater understanding of the basic biology of gall midge interactions within temperate saltmarsh ecosystems in southern Australia, and highlights the value of investigating all trophic levels in these complex interactions simultaneously.
View
View
The decline of the Northern Long-nosed Potoroo Potorous tridactylus tridactylus on the far north coast of New South Wales
Article
Full-text available
  • Sep 2018
The Northern Long-nosed Potoroo Potorous tridactylus tridactylus is progressively disappearing from habitat remnants on the far north coast of New South Wales and is in danger of becoming extinct on the northern coastal plain. In this review we show how the speed and scale of coastal development continues to adversely affect the four remaining areas of habitat where the species has been recorded since 2000. As an ecological specialist, the potoroo may be inherently susceptible to decline in a rapidly changing environment and persistence of the species in the coastal zone is now dependent on the success of conservation management practices in four small 'anthropogenic' refugia. © 2018 Royal Zoological Society of New South Wales. All rights reserved.
View
Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7
Article
Full-text available
  • Apr 2018
  • SYST BIOL
Bayesian inference of phylogeny using Markov chain Monte Carlo (MCMC) (Drummond et al., 2002; Mau et al., 1999; Rannala and Yang, 1996) flourishes as a popular approach to uncover the evolutionary relationships among taxa, such as genes, genomes, individuals or species. MCMC approaches generate samples of model parameter values - including the phylogenetic tree -drawn from their posterior distribution given molecular sequence data and a selection of evolutionary models. Visualising, tabulating and marginalising these samples is critical for approximating the posterior quantities of interest that one reports as the outcome of a Bayesian phylogenetic analysis. To facilitate this task, we have developed the Tracer (version 1.7) software package to process MCMC trace files containing parameter samples and to interactively explore the high-dimensional posterior distribution. Tracer works automatically with sample output from BEAST (Drummond et al., 2012), BEAST2 (Bouckaert et al., 2014), LAMARC (Kuhner, 2006), Migrate (Beerli, 2006), MrBayes (Ronquist et al., 2012), RevBayes (Höhna et al., 2016) and possibly other MCMC programs from other domains.
View
Genetic diversity and drivers of dwarfism in extinct island emu populations
Article
Full-text available
Australia's iconic emu (Dromaius novaehollandiae novaehollandiae) is the only living representative of its genus, but fossil evidence and reports from early European explorers suggest that three island forms (at least two of which were dwarfs) became extinct during the nineteenth century. While one of these-the King Island emu-has been found to be conspecific with Australian mainland emus, little is known about how the other two forms-Kangaroo Island and Tasmanian emus-relate to the others, or even the size of Tasmanian emus. We present a comprehensive genetic and morphological analysis ofDromaiusdiversity, including data from one of the few definitively genuine Tasmanian emu specimens known. Our genetic analyses suggest that all the island populations represent sub-populations of mainlandDnovaehollandiaeFurther, the size of island emus and those on the mainland appears to scale linearly with island size but not time since isolation, suggesting that island size-and presumably concomitant limitations on resource availability-may be a more important driver of dwarfism in island emus, though its precise contribution to emu dwarfism remains to be confirmed.
View
View
Growth, development and breeding pattern of the Long-nosed potoroo, Potorous tridactylus (Kerr, 1792) in Tasmania
Chapter
  • Jun 1989
Growth rate and developmental stages of the Long-nosed Potoroo in Tasmania
View
View
Habitat Use and Population Size of The Long-Nosed Potoroo, Potorous tridactylus (Marsupialia: Potoroidae) In A Coastal Reserve, North-Eastern New South Wales.
Article
  • Jan 1997
A 22 ha trap grid was established perpendicular to the dune and swale system of a small coastal reserve c.750 ha (Tyagarah Nature Reserve), to investigate habitat use and the population density of Potorous tridactylus. Trapping records indicated that certain habitat types were favoured over others. Most captures occurred in dry open shrubland and moist open shrubland. Population density was relatively low at 0.23 (known to be alive) and 0.26 (Jolly-Seber method) individuals per hectare. The distribution of P. tridactylus in the reserve was established through the random placement of 235 hair-sampling tubes. It was estimated that P. tridactylus utilised a minimum area of about 340 ha within the reserve. This area multiplied by the population density indicated a population of about 80-90 individuals within Tyagarah Nature Reserve.
View
View
The Biogeography of the Mammals of the Islands of Bass Strait
Chapter
  • Jan 1974
Bass Strait separates the island of Tasmania from the Australian mainland by less than 200 km. The islands of the Strait (Fig. 14.1) are confined to two rises on the east and west while the deepest waters of the Strait lie in the centre (Fig. 1.2). On the eastern margin of Bass Strait a chain of islands runs from the north-eastern corner of Tasmania to Wilsons Promontory in Victoria. The widest water barrier between the islands of this chain is about 50 km, separating the Kent and Furneaux Groups. The major island on the western side of Bass Strait is King Island, mid-way between north-western Tasmania and Cape Otway, Victoria. To the south-east of King the islands of the Hunter Group lie close to the Tasmanian coast. Tasmania, with an area of 67,900 sq km, is much larger than any of the islands in Bass Strait, the largest of which are Flinders (1333 sq km) and King Island (1100 sq km).
View
Evolutionary and contemporary responses to habitat fragmentation detected in a mesic zone marsupial, the long-nosed potoroo ( Potorous tridactylus ) in south-eastern Australia
Article
  • Nov 2015
Aim Outside of Australia's Wet Tropics, studies of the biogeographical patterns of unglaciated Southern Hemisphere mesic environments are limited, and have primarily focused on herpetofauna. In this study mitochondrial DNA (mt DNA ) and microsatellite (nu DNA ) analyses were used to investigate the impact of biogeographical barriers on the evolutionary history of the widespread Australian marsupial Potorous tridactylus , as well as the effect of recent human‐mediated habitat fragmentation. Location Australia; Queensland, New South Wales, Victoria, and Tasmania. Methods Three hundred and fifty‐four individuals from 39 sites (representing 16 regional populations) across the species range were assessed for mt DNA Control Region and microsatellite (10 loci) variation. Genetic diversity, phylogeographical relationships and population structure were examined, as well as evidence for isolation by distance and past population expansion. Results Three highly divergent and reciprocally monophyletic mt DNA lineages were resolved (two mainland, one Tasmanian). A deep phylogeographical break, not associated with any obvious biogeographical barrier, was present on the mainland. Within the northern mainland and Tasmanian lineages, sub‐structuring was coincident with the presence of physical barriers to gene flow. Fine‐scale structuring was also present, with regional populations highly differentiated. Main conclusions This study expands on previous studies of Australia's mesic biome. Major phylogeographical breaks were identified, that dated to the Miocene (within the mainland) and Pliocene (isolation of Tasmanian), and differed from those described for the region's herpetofauna in age or location. The major mainland break appears species specific within this topographically complex region of Australia. Tasmanian populations were isolated from the mainland well before the most recent flooding of Bass Strait. Minor phylogenetic breaks within Tasmanian and northern NSW were associated with known biogeographical barriers. An absence of sub‐structuring within the southern mainland lineage suggests extensive historical connectivity. The presence of regional population structure suggests that post‐European settlement, local populations have become isolated and differentiated.
View