Ectomycorrhizal and Dark Septate Fungal Associations of Pinyon Pine Are Differentially Affected by Experimental Drought and Warming

Abstract

Changing climates can cause shifts in temperature and precipitation, resulting in warming and drought in some regions. Although each of these factors has been shown to detrimentally affect forest ecosystems worldwide, information on the impacts of the combined effects of warming and drought is lacking. Forest trees rely on mutualistic root-associated fungi that contribute significantly to plant health and protection against climate stresses. We used a six-year, ecosystem-scale temperature and precipitation manipulation experiment targeted to simulate the climate in 2100 in the Southwestern United States to quantify the effects of drought, warming and combined drought and warming on the root colonization (abundance), species composition and diversity of ectomycorrhizal fungi (EMF), and dark septate fungal endophytes in a widespread woodland tree, pinyon pine (Pinus edulis E.). Our results show that pinyon shoot growth after 6 years of these treatments was reduced more by drought than warming. The combined drought and warming treatment reduced the abundance and diversity of EMF more than either treatment alone. Individual ectomycorrhizal fungal taxa, including the drought tolerant Cenococcum geophilum, were present in all treatments but the combined drought and warming treatment. The combined drought and warming treatment also reduced the abundance of dark septate endophytes (DSE), but did not affect their diversity or species composition. The current year shoot growth of the trees correlated positively with ectomycorrhizal fungal diversity, highlighting the importance of diversity in mutualistic relationships to plant growth. Our results suggest that EMF may be more important than DSE to aboveground growth in P. edulis, but also more susceptible to the negative effects of combined climate stressors.

Full text

Frontiers in Plant Science | www.frontiersin.org 1 October 2020 | Volume 11 | Article 582574
ORIGINAL RESEARCH
published: 20 October 2020
doi: 10.3389/fpls.2020.582574
Edited by:
Boris Rewald,
University of Natural Resources and
Life Sciences Vienna, Austria
Reviewed by:
Rodica Pena,
University of Reading, UnitedKingdom
Christoph Rosinger,
Technical University of Cologne,
Germany
*Correspondence:
Catherine Gehring
catherine.gehring@nau.edu
Specialty section:
This article was submitted to
Functional Plant Ecology,
a section of the journal
Frontiers in Plant Science
Received: 12 July 2020
Accepted: 23 September 2020
Published: 20 October 2020
Citation:
Gehring C, Sevanto S, Patterson A,
Ulrich DEM and Kuske CR (2020)
Ectomycorrhizal and Dark Septate
Fungal Associations of Pinyon Pine
Are Differentially Affected by
Experimental Drought and Warming.
Front. Plant Sci. 11: 582574.
doi: 10.3389/fpls.2020.582574
Ectomycorrhizal and Dark Septate
Fungal Associations of Pinyon Pine
Are Differentially Affected by
Experimental Drought and Warming
CatherineGehring
1
*, SannaSevanto
2, AdairPatterson
1, DanielleE.M.Ulrich
3 and
CherylR.Kuske
4
1 Department of Biological Sciences and Center for Adaptable Western Landscapes, Northern Arizona University, Flagstaff,
AZ, United States, 2 Earth and Environmental Science Division, Los Alamos National Laboratory, Los Alamos, NM,
UnitedStates, 3 Department of Ecology, Montana State University, Bozeman, MT, United States, 4 Bioscience Division,
LosAlamos National Laboratory, Los Alamos, NM, United States
Changing climates can cause shifts in temperature and precipitation, resulting in warming
and drought in some regions. Although each of these factors has been shown to
detrimentally affect forest ecosystems worldwide, information on the impacts of the
combined effects of warming and drought is lacking. Forest trees rely on mutualistic
root-associated fungi that contribute signicantly to plant health and protection against
climate stresses. Weused a six-year, ecosystem-scale temperature and precipitation
manipulation experiment targeted to simulate the climate in 2100in the Southwestern
UnitedStates to quantify the effects of drought, warming and combined drought and
warming on the root colonization (abundance), species composition and diversity of
ectomycorrhizal fungi (EMF), and dark septate fungal endophytes in a widespread
woodland tree, pinyon pine (Pinus edulis E.). Our results show that pinyon shoot growth
after 6years of these treatments was reduced more by drought than warming. The
combined drought and warming treatment reduced the abundance and diversity of EMF
more than either treatment alone. Individual ectomycorrhizal fungal taxa, including the
drought tolerant Cenococcum geophilum, were present in all treatments but the combined
drought and warming treatment. The combined drought and warming treatment also
reduced the abundance of dark septate endophytes (DSE), but did not affect their diversity
or species composition. The current year shoot growth of the trees correlated positively
with ectomycorrhizal fungal diversity, highlighting the importance of diversity in mutualistic
relationships to plant growth. Our results suggest that EMF may bemore important than
DSE to aboveground growth in P. edulis, but also more susceptible to the negative effects
of combined climate stressors.
Keywords: climate change, dark septate endophytes, dryland ecosystems, ectomycorrhizal fungi, fungal diversity,
pinyon pine, root-associated fungi, tree drought response

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 2 October 2020 | Volume 11 | Article 582574
INTRODUCTION
Changes in climate, including the combined eects of increased
drought and warming temperatures, are signicantly aecting
temperate forest ecosystems (Allen C. D. et al., 2010). ese
stressors have already resulted in widespread tree mortality
across the western United States (Breshears et al., 2005, 2009;
Van Mantgem et al., 2009; Anderegg et al., 2013; Williams
et al., 2013) and there is concern that signicant shis in the
spatial extent and distribution of numerous tree species are
imminent (e.g., Iversone and Prasad, 1998; Morin etal., 2018).
However, there is also evidence that trees can acclimate to
warming and drying conditions (Nicotra etal., 2010; Way and
Yamori, 2014; Grossiord etal., 2017a, 2018a,b). Based on niche
models, intraspecic dierences among trees in morphological
and physiological traits can be substantial enough to alter
predictions of future plant distributions (Ikeda et al., 2017).
Microbial plant mutualists, such as root-associated fungi,
signicantly aect plant responses to climate change (reviewed
by Kivlin etal., 2013; Mohan etal., 2014; Bennett and Classen,
2020). Many dominant temperate tree species form associations
with ectomycorrhizal fungi (EMF), a diverse assemblage of
ascomycete and basidiomycete fungi that improve host plant
access to soil nutrients and water and provide protection from
some pathogens in exchange for xed carbon (Smith and Read,
2008). ese fungi may buer plants against climate change,
but their activities and buering ability can be aected by hot
and dry conditions. erefore, it is important to understand
how root-colonizing fungi respond to environmental changes
and to link those responses to the growth and survival of
their plant hosts.
Ectomycorrhizal fungal responses to drought or warming
have been studied in several ecosystems, but studies examining
the combined eects of drought and heat stress on EMF and
EMF-host plant relationships remain rare. Improvement of host
plant drought tolerance by EMF has been widely documented
and reviewed (Lehto and Zwiazek, 2010; Kivlin et al., 2013;
Mohan et al., 2014; Gehring et al., 2017) with the strongest
support for an indirect mode of action through improved host
nutrition (Lehto and Zwiazek, 2010). However, drought has
also been documented to lead to changes in EMF abundance,
biomass, community composition and activity in pines (Karst
et al., 2014). e eects of experimental warming on EMF
have been less studied with an emphasis on temperate and
arctic ecosystems with variable results (Mohan et al., 2014).
However, temperature can be an important force structuring
EMF communities, even when dierences among sites in host
species and associated plant communities are taken into account
(Miyamoto et al., 2018; Koizumi and Nara, 2019).
e roots of many plant species, including some of those
that host EMF, also are colonized by dark septate endophytes
(DSE), ascomycete fungi grouped by the morphology of their
highly melanized hyphae within host roots (Jumpponen and
Trappe, 1998). Unlike EMF, DSE appear to lack a particular
materials-exchange interface with the plant, however they may
increase host plant resource uptake, particularly of organic
nutrient sources (Newsham, 2011). DSE are also hypothesized
to be tolerant of environmental stresses such as heat, cold,
drought and salinity (Berthelot et al., 2019) and may play a
role in the “fungal loop” that is thought to reduce carbon and
nutrient losses in arid ecosystems by cycling them within biotic
pools (Collins et al., 2008). However, there has been little
research on the function of DSE in a climate change context.
Kivlin etal. (2013) noted signicant negative eects of inoculation
with DSE on plant responses to warming in a meta-analysis
but acknowledged that the results were heavily inuenced by
a single study of one fungal species (Phialocephala fortinii)
and two plant species (Picea abies and Betula pendula). On
the other hand, inoculation with DSE improved host plant
responses to drought in the studies reviewed by Kivlin et al.
(2013) and both positive and negative eects on plant biomass
have been observed in more recent work on a species of arid
land grass (Li et al., 2018). As with EMF, few studies have
assessed the consequences of multiple climate changes on
DSE-host plant relationships.
In this study, weused an ecosystem-scale eld manipulation
experiment to examine the consequences of drought and warming
temperatures, alone and in combination, for the EMF and
DSE communities associated with pinyon pine, Pinus edulis,
a western UnitedStates tree species that occupies a large area
of semi-arid landscape where it occurs with co-dominant
members of the genus Juniperus. Warm temperatures combined
with extreme drought resulted in signicant P. edulis mortality
across 12,000km2 of the southwestern UnitedStates in 2002–2003
(Breshears et al., 2005). us, P. edulis has become a model
for studies of the physiological basis of plant drought susceptibility
(McDowell et al., 2008, 2016; Adams etal., 2009; Plaut et al.,
2012; Limousin et al., 2013; Dickman et al., 2014; Sevanto
etal., 2014), intraspecic variation in drought tolerance (Sthultz
et al., 2009a), the biotic and abiotic legacy eects of drought
induced mortality (Peltier et al., 2016; Mueller et al., 2019),
and the contribution of EMF to survival and growth during
drought (Gehring et al., 2014, 2017). However, the individual
and combined eect of warming and drought stresses on EMF
communities have not been examined and DSE have not been
studied in P. edulis. Pinus edulis is oen the only associate
for EMF across most of its distribution in the southwestern
United States (Gehring et al., 2016), while juniper and many
grass and shrub species that occupy pinyon-juniper woodlands
are colonized by DSE (Gehring, unpublished data).
We tested the following hypotheses: H1: e combined
eects of drought and warming on EMF abundance, diversity
and community composition will exceed the eect of either
drought or heat stress alone. Warming temperatures are expected
to exacerbate the eects of drought on trees in the coming
years and weexpect negative impacts of these combined stressors
on plant symbionts. H2: Drought and/or warming stress will
have greater negative eects on EMF than DSE because DSE
are well known for their ability to tolerate stressful conditions
(Berthelot et al., 2019). H3: Declines in EMF diversity with
drought and warming will be strongly negatively associated
with P. edulis aboveground growth. Species of EMF vary in their
functional characteristics including the environmental conditions
they can tolerate (Sthultz etal., 2009b; Miyamoto et al., 2018),

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 3 October 2020 | Volume 11 | Article 582574
the extent to which they colonize the soil [e.g., dierent
hyphal exploration types (Tedersoo and Smith, 2013)], and
the types of soil resources they are able to utilize (Fre y,
2019). We predict that loss of EMF diversity will result in
reduced functional diversity of EMFs and consequently lower
plant growth because of reduced resource access capacity.
We do not make a similar prediction for DSE because of
their uncertain function in P. edulis.
MATERIALS AND METHODS
Experimental Methods and Sampling
To examine the eects of drought and warming on EMF and
DSE in P. edulis, roots were sampled from trees that had been
under ambient (control), drought (~50% reduction in
precipitation), warming (temperature 5°C above ambient) and
a combination of drought and warming treatments for 6 years
at the Los Alamos Survival-Mortality (SUMO) experiment located
in Los Alamos County, New Mexico (35.49°N, 106.18°W,
2175 m a.s.l). e SUMO site, established in summer 2012,
consists of ve treatments with 5–6 trees per treatment. ese
treatments are: control with trees experiencing ambient temperature
and precipitation, heat with trees inside open-top chambers
where temperature was maintained constantly at 4.8°C above
ambient temperature, drought with trees located within a
precipitation exclusion structure constructed of polyethylene
troughs about 1.5 m above the soil surface covering ~50% of
the ground area and directing ~45% of the precipitation o
the site, a combined drought and heat treatment, and a chamber
control treatment with open-top chambers kept at ambient
temperature (not used in this study which thus has four treatments
and 20 trees total; see Pangle et al., 2012; Adams et al., 2015).
e site is located in a native pinyon-juniper woodland
close to the transition zone to Ponderosa pine forest, with
vegetation dominated by pinyon pine (P. edulis Engelm.) and
one-seed juniper [Juniperus. monosperma (Engelm.) Sarg.], with
shrubby Gambel oak (Quercus gambelii Nutt.) and an occasional
ponderosa pine (Pinus ponderosa C. Lawson) occurring in the
vicinity. e climate is semi-arid, with a mean annual temperature
of 10.4°C (1987–2017) and a mean annual precipitation of
358 mm (1987–2017) of which about 50% falls during the
North American Monsoon season from July to September (Los
Alamos Weather Machine1). e year of our root sampling,
2018, was warmer (average temperature 12.5°C) and drier
(annual precipitation 255 mm) than the 30-year average with
the monsoon precipitation prior to our sampling accounting
for 42% (106 mm) of the total annual precipitation, and the
average temperature of June and July at the typical range of
20–21°C. e soils are Hackroy clay loam derived from volcanic
tu with a typical prole of 0–8cm of sandy loam, 8–40 cm
of clay loam and 40–150 cm bedrock. Soil depth at the site
ranges from 40 to 80cm (Soil Survey Sta, Natural Resources
Conservation Service, UnitedStates Department of Agriculture2).
1
https://weathermachine.lanl.gov/
2
http://websoilsurvey.nrcs.usda.gov
Mature P. edulis trees, were randomly selected for the
treatments. All of the trees were >3 cm in diameter and
averaged 56 ± 5 years of age based on tree cores (Grossiord
et al., 2017b). e selected trees in the drought treatment
were located at least 10m from the border of the precipitation
exclusion structure (equivalent to two times the height of the
tallest tree in the drought treatment). In the heat treatment,
the footprints of the open-top chambers ranged from 6 to
20 m2, and contained between one and ve trees located at
a minimum distance of 1.5 m from the chamber boundary
and at least 5 m from any target trees in other treatments.
e drought and ambient treatments form two dierent plots
with closest target trees >80m apart. While some root outgrowth
from target trees in the combined drought and heat treatment
to drought treatment or from warming treatment to ambient
might have occurred, any mixing between other treatments is
highly unlikely because of the distances, and most of the root
system of each tree can be expected to have resided with the
assigned treatment. Both P. edulis and J. monosperma were
included in the experiment, and sometimes shared a chamber,
but we present data only on P. edulis here. Previous studies
conducted at this site found no dierences in physiological
responses between trees in the control and chamber control
treatments, suggesting no indirect eect of the chambers on
plant function (Adams etal., 2015; Garcia-Forner etal., 2016;
Grossiord et al., 2017a,b). erefore, we focused our sample
collection only on control (n = 5), heat (n = 4), drought
(n = 6) and combined drought and heat treatments (n = 5).
In addition to the eects on precipitation and air temperature,
the treatments inuence soil temperature measured continuously
at the base of all target trees with thermocouples installed at
5, 10, 15 and 30 cm depths. e drought treatment alone had
negligible eect (<0.1°C) on soil temperature while the warming
treatment increased soil temperature on average by 3.6°C. In
April 2016, the coverage of the precipitation exclusion structure
was briey increased to 90% by adding additional clear polymer
troughs to increase the stress experienced by the trees. To
prevent excessive heating of the soil surface and airspace below
the troughs, thermal bubble insulation was installed underneath
the polymer troughs, and portable blower fans (TE-CF2421,
Triangle, Jacksonville, AR, UnitedStates) were placed throughout
the drought and drought and heat treatments. To ensure the
eectiveness of the cooling, soil temperature was additionally
measured continuously (RT-1, Decagon Devices Inc., Pullman,
WA, UnitedStates) over a 0–30cm depth at the base of each
tree. Mean daily soil temperature under the structure was on
average 1.4 ± 0.9°C higher than ambient conditions (see
Grossiord et al., 2017a), which was clearly cooler than in the
heated treatment (3.6°C above ambient). e additional
precipitation exclusion was removed in April 2017, and the
precipitation exclusion returned to the original ~45% coverage
prior to our sampling. With this change the soil temperatures
under the drought structure were similar to ambient as before.
In August of 2018, we assessed plant growth, and harvested
roots from four to six pinyons from each treatment for root
colonization analysis. Plant growth was determined by measuring
the length of the current year shoot of ten randomly selected

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 4 October 2020 | Volume 11 | Article 582574
branches per tree using calipers. For root analyses, wecollected
a minimum of 200 cm ne roots (<2 mm in diameter) at a
depth of 0–30 cm, pooled from two locations per tree. Roots
were collected right at the tree base and well within each
treatment footprint, traced to the focal tree, carefully excavated
using a trowel, and placed in a cooler prior to transport to
Northern Arizona University where they were stored at −20°C
until processing. Root colonization by EMF was measured on
each sample by counting the number of living ectomycorrhizal
root tips relative to non-colonized root tips based on dierences
in their morphology as described in Gehring and Whitham
(1991). Living ectomycorrhizal root tips (~75/tree) were then
removed and examined under a dissecting microscope at 20X
magnication to categorize them morphologically based on
color, texture, hyphal quantity and structure (Agerer, 1991).
Hyphal exploration type was assessed by observing each
morphotype for emanating hyphae and presence of rhizomorphs
(Agerer, 1991; Tedersoo and Smith, 2013), in addition to utilizing
the Agerer (2006) categorization of EMF genera. Two
morphotypes had not been observed in previous studies of P.
edulis in the Gehring lab and were hand sectioned to look
for a Hartig net, the specialized exchange structure characteristic
of EMF (Smith and Read, 2008). Root tips were stored in
separate tubes by morpohotype/tree at −20°C until molecular
analysis of fungal communities.
To assess DSE colonization, a sample of the remaining ne
roots from each sample (~50cm, lacking EMF colonized root
tips) was cleared for 20 min in boiling 10% KOH and then
le an additional 12 h at room temperature in fresh 10%
KOH followed by several rinses in tapwater. Around 10-1 cm
segments of root were mounted on glass slides, and observed
using a compound microscope at 400× magnication. e
presence of melanized, septate hyphae and microsclerotia were
used as indicators of DSE and quantied using the grid-line
intersect method (McGonigle etal., 1990) using ~100 intersections
per sample. Root samples were not stained as melanized hyphae
were clearly visible without this step as observed in other
study systems (Liu et al., 2017; Hughes et al., 2020). e
remaining ne roots were stored at −20°C until molecular
analysis of fungal communities.
Molecular Characterization of Fungal
Communities
Standard methods for DNA extraction, PCR, and Sanger sequencing
for EMF root tips were used (e.g., Gehring etal., 2017; Patterson
et al., 2018). Briey, we extracted DNA from one to ve root
tips (depending on availability) of every fungal morphotype found
on every tree using the High Molecular Weight DNA Extraction
protocol of Mayjonade et al. (2016). We performed polymerase
chain reaction (PCR) under conditions described by White et al.
(1990) and Gardes and Bruns (1993), to amplify the internal
transcribed spacer (ITS) region of the rRNA of the fungal genome
with the ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS4
(TCCTCCGCTTATTGATATGC) primer pair as in White et al.
(1990) and Gardes and Bruns (1993), using KAPA Taq Hotstart
(Kapa Biosystems, Wilmington, MA 01887, United States).
Successfully amplied PCR product was puried and then cycle
sequenced using BigDye Terminator Mix 3.1 (ermo Fisher
Scientic Inc.). Sequencing was performed on an ABI 3730xl
Genetic Analyzer (Applied Biosystems, Foster City, California,
United States) at the Environmental Genetics and Genomics
Laboratory at Northern Arizona University. When amplication
or sequencing of a morphotype was unsuccessful, an additional
root tip from that morphotype from that tree was processed.
We sequenced the ne roots described above to assess DSE
community characteristics using the Illumina platform.
We extracted DNA from 2.0 g wet mass samples (one per
tree) using DNeasy Plant Extraction Kits (Qiagen, Valencia,
CA, United States). PCR was performed using primers and
conditions described by Taylor et al. (2016) to amplify the
ITS region of the rRNA of the fungal genome with the ITS4-FUN
and 5.8S-FUN primer pair (Taylor et al., 2016) using Phusion
High-Fidelity DNA Polymerase (New England Biolabs, Ipswich,
MA, United States). PCR products were checked on a 1%
agarose gel, pooled, diluted 10-fold, and used as the template
in the subsequent tailing reaction with region-specic primers
including the Illumina ow cell adapter sequences and an
eight-nucleotide barcode. Products of the tailing reaction were
puried with carboxylated SeraMag Speed Beads (Sigma-Aldrich,
St. Louis, Missouri, UnitedStates) at a 1:1v/v ratio as described
in (Rohland and Reich, 2012), and quantied by PicoGreen
uorescence. Equal quantities of the reaction products were
then pooled. e library was bead-puried once again (1:1
ratio), quantied by qPCR using the Library Quantication
Kit for Illumina (Kapa Biosciences, Woburn, Massachussetts,
United States), and loaded at 9 pM (including a 30% PhiX
control) onto an Illumina MiSeq instrument (Illumina, San
Diego, California, United States) using 2 × 150 paired-end
read chemistry.
Data Analysis
DNA sequences of EMF root tips were aligned and trimmed
in Bioedit (Hall, 1999) and identied to the genus or species
level using the Basic Logical Alignment Search Tool (BLAST;
Altschul etal., 1990) and UNITE (Kõljalg etal., 2013) databases.
We considered sequence similarity of ≥98% to published
sequences indicative of species-level identity and 95–97%
indicative of genus-level identity (Kõljalg et al., 2013).
For the DSE data set, the forward and reverse reads of
ITS sequences were stitched using FastqJoin (Aronesty, 2011)
and quality filtered using the software package Quantitative
Insights into Microbial Ecology v 1.9 (QIIME; Caporaso
et al., 2010) using a Phred score cut-off value of 20. DNA
sequences were extracted using ITSx (Bengtsson-Palme etal.,
2013), and OTUs were picked using SWARM (Mahé et al.,
2014) with a local clustering threshold value of 3. The most
abundant sequence for each operational taxonomic unit
(OTU) was aligned with PyNAST (Caporaso et al., 2010)
against the UNITE (ITS; Nilsson etal., 2019) database using
a 97% similarity cutoff, and taxonomy was assigned using
BLAST (Altschul etal., 1990). Community composition data
generated from amplicon counts were CSS-normalized and
OTU tables were filtered to putative DSE taxa including

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 5 October 2020 | Volume 11 | Article 582574
the following orders: Helotiales, Xylariales, Pleosporales, Sordariales,
Hypocreales and Chaetosphaeriales (Grünig et al., 2008).
Community composition of EMF and DSE was compared
among treatments using separate Permutational MANOVAs
(PERMANOVA) with the Bray-Curtis dissimilarity index in
Primer 7 (Primer-e Ltd., Ivybridge, United Kingdom). e
Shannon diversity (H′ log base e) was calculated for EMF and
DSE using Primer 7 and compared among treatments using a
one-way ANOVA in SPSS (IBM SPSS v. 20) followed by a
Tukey’s test to locate treatment dierences. Data on EMF
colonization, DSE colonization, and shoot growth also were
analyzed using one-way ANOVAs followed by Tukey’s tests.
Hyphal exploration type was evaluated using a MANOVA in SPSS.
RESULTS
EMF Colonization and Community
Composition
Root colonization by EMF was, on average, 50% lower in
trees that experienced both drought and warming than in
trees that experienced ambient conditions (F3,16 = 3.573,
p = 0.038; Figure 1A). Colonization by EMF was intermediate
in the drought only or warming only treatments (Figure 1A).
Similar patterns were observed with Shannon diversity which
was, on average, 4.4X greater on control trees than trees in
the combined drought and warming treatment (F3,16 = 4.389,
p=0.02; Figure1B). Again, trees that experienced only drought
or warming were intermediate, but closer to the ambient
treatment than to the combined treatment (Figure 1B).
e root tip EMF community consisted of 12 species, seven
members of the Phylum Ascomycota and ve members of the
phylum Basidiomycota (Ta b l e  1 ; Figure 2). Low species richness
and dominance by fungi in the Ascomycota is typical of P. edulis
(Gehring et al., 2014; Patterson et al., 2018). e two members
of the Ascomycota not observed in previous studies of P. edulis
(e.g., Patterson et al., 2018; Mueller et al., 2019), Cercophora sp.
and Helotiales sp. produced consistent morphotypes with obvious
fungal mantles, but microscopy indicated poorly formed Hartig
nets. ese fungi were rare. ey were observed in only one
treatment each where they made up less than 2% of the community,
but they were included in subsequent statistical analyses despite
the poorly formed Hartig net. Recent research indicates that EM
fungi can still carry out critical functions even without a functional
Hartig net (Sa etal., 2019). Members of the Heliotiales can form
associations with ectomycorrhizas (Nakamura et al., 2018) and
it is possible that this is what we observed.
While overall EMF community composition was similar
among treatments (pseudo F3,19= 1.35, p= 0.163), individual
taxa were signicantly aected by the combined drought and
warming treatment (Figure2). e relative abundance of both
Cenococcum sp. and Tomentella sp. varied among treatments
owing to their absence from the combined drought and
warming treatment (Cenococcum sp. pseudo F3,19 = 1.72,
p = 0.021, Tomentella sp. pseudo F3,19 = 1.97, p = 0.005;
Figure 2). Only contact and short hyphal exploration types
were observed, with short exploration type dominating in all
treatments [mean (S.E.) % short exploration type for control
trees = 79.3 (10.48) for drought only trees = 100 (0.0), for
heat only trees = 90.6 (8.04) and for drought and heat
combined = 86.3 (13.6); F3,16 = 0.982, p = 0.462].
DSE Colonization and Community
Composition
As with EMF, root colonization by DSE was negatively aected
by the combined drought and warming treatment. Colonization
by DSE was high (~75%, on average) in the ambient, drought
and warming treatments, but was ~20% lower in the combined
drought and warming treatment (F3,16=4.532, p=0.018; Figure3A).
e root DSE community consisted of 101 OTUs, with most
of these (57%) occurring at less than 1% relative abundance in
any treatment group. irty-two percent of the OTUs were
identied to species, 31% to genus, 9% to family, 20% to order,
and 8% to phylum (Ascomycota). e genus Cladophialophora
had the most OTUs (n = 11) followed by Paraphoma (n = 6),
while the most common OTUs identied at the ordinal level
were found in the Pleosporales and Helotiales, with six OTUs each.
In contrast to observations with EMF, Shannon diversity
at the OTU level was similar in all four treatments (F3,16=0.397,
A
B
FIGURE1 | Mean (+/− 1S.E.) ectomycorrhizal fungal (EMF) colonization (A),
and Shannon diversity index of the EMF communities (B) found in the roots of
pinyon pine trees grown under ambient (control), warming (+4.8°C compared
to ambient), drought (−50% of precipitation) and combined heat and drought
treatments for 6years. Different letters above the bars denote differences
among groups at p<0.05.

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 6 October 2020 | Volume 11 | Article 582574
p =0.757; Figure3B). DSE community composition was also
similar among groups (pseudo F3,16 = 1.35, p = 0.163). is
similarity is illustrated by the relative abundance of the 10
most common OTUs which make up between 36 and 40%
of the community in all four treatments (Figure 4).
Shoot Growth and Relationships to Fungal
Colonization and Diversity
Pinyons growing in ambient conditions had the greatest mean
shoot elongation during the year fungi were sampled, followed
by the warming only treatment (F3,16 = 40.325, p < 0.001;
Figure 5A). Pinyons experiencing drought only or drought
and warming had similar mean shoot lengths, which were
approximately 50% lower than those of pinyons in the ambient
treatment and approximately 40% lower than pinyons in the
warming only treatment (Figure 5A).
Mean shoot length during the growing season in which
fungi were sampled was most strongly positively correlated
with EMF diversity (R2 = 0.3252, F1,18 = 7.022, p < 0.01,
Figure5B), but also positively correlated with EMF colonization
(R2= 0.224, F1,18= 5.128, p =0.035). ere was no association
between shoot growth and DSE colonization (R2 = 0.07,
F1,18=1.486, p=0.239) or DSE diversity (R2=0.006, F1,18=0.104,
p = 0.751, data not shown).
FIGURE2 | Relative abundance of the EMF species found in the roots of pinyon pine trees grown under ambient (control), heat (+4.8°C compared to ambient),
drought (−50% of precipitation) and combined heat and drought treatments for 6years. The species in control and heat treatments resembled each other, while
signicantly fewer species were found in the combined drought and heat treatment.
TABLE1 | Ectomycorrhizal fungal taxa identied on Pinus edulis using ITS sequences.
ID Fungal phylum1Hyphal exploration
type2
Matching GenBank
accession number3
Query coverage%4Identity%5GenBank accession
number6
Cenococcum
geophilum
A Short MK131420.1 100 99 n/a
Cercophora sp. A Short KX171944.1 95 96 MW026419
Clavulina sp. B Short MK627472.1 88 99 MW026416
Geopora pinyonensis A Short KF546493.1 99 99 n/a
Geopora 1 A Short KF546490.1 98 99 n/a
Geopora 2 A Short KF546492.1 98 99 n/a
Helotiales sp. A Short HM488537.1 99 99 n/a
Helvellosebacina sp. B Short KF000456.1 96 97 MW026417
Inocybe sp. B Short MG833870.1 96 97 MW026420
Pezizaceae sp. A Short AJ633598.1 100 97 MW026421
Russula sp. B Contact KM402893.1 97 98 MW026415
Tomentella sp. B Short EU444541.1 92 98 MW026418
1Indicates Ascomycota (A) or Basidiomycota (B).
2Hyphal exploration type based on our observational measurements, Agerer (2006) and Tedersoo and Smith (2013).
3Accession number in NCBI GenBank (https://www.ncbi.nlm.nih.gov/genbank/) that most closely matches the sequences generated in this study.
4Query coverage indicates the percentage of the query sequence that overlaps the reference sequence.
5Identity percent indicates the similarity of the query sequence and the reference sequence across the length of the coverage area.
6DNA sequences of taxa in bold type did not match GenBank sequences at >99% identity with >95% query coverage. These sequences were submitted to GenBank and their
accession numbers provided.

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 7 October 2020 | Volume 11 | Article 582574
DISCUSSION
Declines in Ectomycorrhizal Fungal
Colonization and Diversity
Consistent with our rst hypothesis, root colonization by EMF
was most negatively aected in the combined drought and
warming treatment, but also reduced in the drought or warming
only treatments. Drought alone has been shown to cause
reductions in EM colonization in many of the studies reviewed
by Mohan et al. (2014) and Karst etal. (2014) and in a more
recent study of beech (Fagus sylvatica; Köhler et al., 2018).
e main eect of the drought treatment we implemented was
to reduce precipitation reaching the ground by ~45%. is
reduced the capacity of small precipitation events to replenish
soil moisture reserves so that the relative water content extractable
by plants at the top 30 cm of the soil remained on average
~50% lower compared to control and heat treatments throughout
the experiment. It did not change the absolute maximum
soil moisture content measured during snow melt or aer
the heaviest monsoon rains, or the minimum soil moisture
content measured in the end of the dry season each year.
ese precipitation events and drought periods were strong
enough to drive all the treatments to similar soil moisture
content. But, during less extreme precipitation seasons, drought
treatment caused plant extractable soil moisture content to
uctuate around 20% in the drought treatments compared
to 40% in control and heat treatments (Grossiord et al.,
2017a,b) signicantly reducing water availability in the soil.
Our ndings regarding warming temperatures are dicult
to compare to other research as previous eld studies have
focused on arctic or boreal ecosystems where warming
temperatures frequently led to increased EM colonization (Mohan
et al., 2014; Bennett and Classen, 2020). At our site, the soil
temperatures at 10 cm depth (the average depth from which
roots were collected) can reach up to 60°C even without additional
heating, exceeding the environmental tolerance of many species
of fungi (Maheshwari etal., 2000). Experimental heating increased
temperatures in our study system an average of 4.8°C (Adams
et al., 2015; Garcia-Forner et al., 2016) which increased the
peak temperatures proportionally and reduced the time spent
at below freezing temperatures in the winter by roughly 50%
compared to the ambient and drought treatments. e large
reduction in EM colonization in the combined heat and drought
treatment suggests that sustained warm temperatures or heat
waves during periods of drought may limit the ectomycorrhizal
symbiosis in semi-arid environments. A critical question that
remains is if the reductions in EM colonization we observed
also limit EMF propagule production and viability, and thus
has a lasting eect on the inoculum potential of the soil.
In addition to a sharp decline in the abundance of EMF
in the combined heat and drought treatment, EMF diversity
dropped by more than 75% relative to the ambient control.
Previous studies have documented that EMF diversity declines
with drought (Karst et al., 2014; Mohan et al., 2014) while
studies of warming temperatures have again focused largely
on arctic or boreal systems where results have been mixed
(Mohan et al., 2014; Fernandez et al., 2017). In pinyon pine,
long-term drought resulted in reduced EMF diversity (Sthultz
etal., 2009b; Gehring etal., 2014). Restoring moister conditions
to pinyon pines in the same study area with experimental
watering during drought did not increase EMF diversity,
suggesting that reductions in diversity with drought may belong
term (Patterson et al., 2018). While warming experiments
(Fernandez et al., 2017) and drought (Gehring et al., 2014;
Karst etal., 2014) appear to favor members of the Ascomycota,
their dominance did not dier among treatments in our study.
In fact, one of the more drought tolerant species of fungi,
the ascomycete, Cenococcum geophilum (Pigott, 1982; Jany etal.,
2003), was common (average 31% relative abundance) in the
control, heat and drought treatments, but absent from the
combined heat and drought treatment (Figure 2). However,
members of the genus Geopora, documented to promote drought
tolerance in P. edulis (Gehring et al., 2017) had their highest
abundance in the drought only treatment but also were present
(~25% relative abundance) in the combined heat and drought
treatment. Members of this genus are found in numerous stressful
environments including mine spoils (Hrynkiewicz et al., 2009)
and post-re landscapes (Fujimura etal., 2004) but the mechanisms
A
B
FIGURE3 | Mean (+/− 1S.E.) root colonization by dark septate endophytes
(DSE) (A), and Shannon diversity index of the DSE communities (B) found in
the roots of pinyon pine trees grown under ambient (control), warming
(+4.8°C compared to ambient), drought (−50% of precipitation) and
combined heat and drought treatments for 6years. Different letters above the
bars denote differences among groups at p<0.05.

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 8 October 2020 | Volume 11 | Article 582574
contributing to their success in these challenging environments
are unknown. Studies in cooler, wetter ecosystems, have reported
that warming increased EMF taxa with presumably less
energetically expensive short distance hyphal exploration types
(Fernandez et al., 2017), but EMF taxa with short exploration
types dominated in all treatments in our study, consistent with
previous studies of P. edulis (Patterson et al., 2018).
Small Effect of Treatments on DSE
Colonization by DSE was high in all groups, exceeding 50%,
and only declined slightly in the combined drought and warming
treatment. DSE diversity and species composition was unaected
by any of the temperature and precipitation reduction treatments.
is lack of change relative to the large reductions in diversity
and colonization observed in EMF is consistent with our second
hypothesis. DSE are well known for their high abundance in
stressful environments, including arid lands (Porras-Alfaro etal.,
2008; Porras-Alfaro and Bayman, 2011), and were previously
observed to beless responsive to changes in the abiotic environment
than mycorrhizal fungi (Bueno de Mesquita et al., 2018). DSE
may have been aected to a lesser extent than EMF because of
the stress tolerance of their highly melanized hyphae. One function
of melanin in fungi is protection from harmful environmental
conditions including ultraviolet radiation and temperature extremes
(Butler and Day, 1998). Interestingly, C. geophilum, the EMF
taxon that was common in all treatments but the heat and
drought treatment is also heavily melanized. Melanin inhibition
studies on C. geophilum isolates showed that fungal growth was
negatively aected only when isolates were subjected to osmotic
and desiccation stress (Fernandez and Koide, 2013). Comparative
studies of DSE and EMF like C. geophilum would be helpful to
A
B
FIGURE5 | Mean (+/− 1S.E.) length of the current year shoots observed in
pinyon pine trees in the year of root collection after growing under the control,
heat, drought, and combined drought and heat treatment for 6years (A). The
length of the current year shoots in these trees correlated positively with the
Shannon diversity of the root ectomycorrhizal fungal communities (B).
FIGURE4 | Relative abundance of the 10 most abundant taxa of DSE found in the roots of pinyon pine trees grown under ambient (control), heat (+4.8°C
compared to ambient), drought (−50% of precipitation) and combined heat and drought treatments for 6years. There were no signicant differences in DSE
community composition among treatments.

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 9 October 2020 | Volume 11 | Article 582574
elucidate the importance of melanin to their stress tolerance
and that of their host plants.
Although weobserved DSE taxa commonly found in members
of the Pinaceae like Phialocephala fortinii (Jumpponen and
Trappe, 1998; Grünig etal., 2008), these taxa were less abundant
than members of the genera Chalastospora and Paraphoma
that are better known as plant pathogens than endophytes.
One of the most common genera we observed, Paraphoma,
made up ~5% of all sequences across treatments but we could
not nd reference to its occurrence in members of the Pinaceae.
Paraphoma can cause root rot in crops such as alfalfa resulting
in necrotic lesions (Cao et al., 2020). However, we did not
observe damage to the roots we sequenced or observed
microscopically. Our results highlight how much remains to
be learned about DSE. eir high taxonomic diversity within
the Ascomycota and function along the mutualism-parasitism
axis are well documented (Berthelot et al., 2019), but also
present challenges to understanding their inuence on host
plant growth and survival.
Fungal Relationships to Host Plant Growth
We observed signicant associations between P. edulis
aboveground growth and the abundance and diversity of EMF
but not DSE, consistent with our third hypothesis. Similar
to previous observations at our site (Grossiord etal., 2017b),
current year shoot growth was reduced relative to controls
in the drought and combined drought and heat treatment,
but not in the heat treatment alone (Figure 5). Although
the drought treatment slightly negatively aected EMF
colonization but not diversity, there was a higher correlation
between EMF diversity and growth than EMF colonization
and growth with EMF diversity explaining 32.5% of the
variation. In a study of the EMF communities of P. edulis
that remained following host plant mortality, reduced diversity
due to the absence of EMF in the genus Tube r was associated
with reduced seedling size (Mueller et al., 2019). While our
results suggest that EMF may bemore important to aboveground
growth than DSE, wedid not measure belowground growth.
DSE may have inuenced pinyon root length or biomass,
important contributors to the benecial eects of DSE in
other arid land plant species (Li et al., 2018).
Few studies have experimentally manipulated EMF diversity
to understand mechanisms with mixed results (Baxter and
Dighton, 2001; Jonsson etal., 2001; Hazard etal., 2017). Studies
are even more limited in low moisture, high temperature
environments, but phosphorus uptake eciency was observed
to decrease due to reductions in EMF diversity under low soil
moisture conditions in European beech (Köhler et al., 2018).
At our site, plant phosphorus uptake has not been studied,
but warming increased both nitrication processes and the
amount of nitrate in the root zone, while drought increased
the amount of ammonium, and both these eects were present
in the combined heat and drought treatment (Grossiord etal.,
2018a). ese shis did not have any eect on the N content
of plant tissues, plant N allocation or preference for using
nitrite or ammonium suggesting that nitrogen was not limiting
growth. But, these changes in N dynamics could contribute
to the composition and function of the root-zone microbiome
given the importance of N to EMF communities in many
other ecosystems (Lilleskov et al., 2019). Nitrogen fertilization
increased leaf production and reduced EMF abundance in
P. edulis (Allen M. F. etal., 2010). However, it also was associated
with increased tree mortality in P. edulis during drought, possibly
due to a reduced role of EMF in water uptake (Allen M. F.
et al., 2010). us changes in N dynamics in this study system
could become signicant to plant growth and vitality as drought
and warming continue. In beech (Fagus sylvatica L.), moderate
drought increased the importance of EMF to uptake of inorganic
N, but this eect was EMF species specic, even diering
among members of the same genus (Pena and Polle, 2014).
C. geophilum, the taxon shared between our study and that of
Pena and Polle (2014), did not improve N uptake under drought.
In our study, we cannot determine conclusively if changes
in fungi inuenced host plants or the reverse (or a combination),
but previous studies utilizing the same experiment provide
clues. Over the years, the drought, heat and combined drought
and heat treatments have aected the carbon xation and water
uptake as well as growth of the P. edulis trees. Drought and
combined drought and heat treatments have shown signicantly
lower average stomatal conductance and photosynthesis at
saturation light (Grossiord et al., 2017a, 2018a). ese changes
were combined with delayed initiation of both shoot (Adams
etal., 2015; Grossiord etal., 2017b) and stem growth (Manrique-
Alba etal., 2018) in the combined heat and drought treatment,
reduced needle elongation in both the drought and combined
heat and drought treatments (Grossiord et al., 2017b), and
reduced capacity to replenish stem water reserves in the combined
drought and heat treatment (Grossiord etal., 2017c; Manrique-
Alba et al., 2018). ese observations suggest reduced plant
productivity that could inuence the ability to attract and
maintain mutualistic fungi. While EMF can access nutrients
in soil organic matter through a variety of mechanisms (Frey,
2019) they generally rely on photosynthates from their hosts,
but potentially to varying degrees (Koide et al., 2008). For
example, species richness in EMF associated with European
beech trees was aected by stem girdling that reduced direct
transport of photosynthates to the roots (Pena et al., 2010).
In addition to the protection provided by melanin for DSE,
our observed dierences in drought and heat eects on EMF
and DSE colonization and species richness could be explained
by dierent degree of fungal dependency on plant-produced
carbohydrates between these groups.
At our site, reductions in plant photosynthesis and growth
were accompanied by reduction in leaf-area-specic plant
hydraulic conductivity, but no change in the depth of main
water sources used by the trees (Grossiord et al., 2017a), or
the leaf area: sapwood area ratio (McBranch et al., 2019).
ese ndings suggest that the trees adjusted their water
demand to water availability without changing anatomical
structure or rooting depth, even if the heat and drought treatment
increased competition for water in the main water source layer
by inducing a shi that brought the main water source for
co-occurring grasses to the same layer (Grossiord etal., 2019).
Whether this shi aected DSE communities dierently from

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 10 October 2020 | Volume 11 | Article 582574
EMF communities is unclear, nor do we understand how
the two groups of fungi interact within roots or soil. ere
is evidence that DSE colonization has positive eects on AMF
colonization of grass roots in arid grasslands (Menoyo etal.,
2020), while interactions between EMF and DSE appear to
bespecies and strain specic (Berthelot et al., 2019). In most
pinyon-juniper woodlands, DSE have multiple hosts, while
EMF are restricted to P. edulis; this dierence also may
contribute to the dierent sensitivities of the two groups to
the combined stressors in our study.
CONCLUSION
Our experimental study of the eects of warming and drought
on the fungal communities of an arid land conifer provides
an important contrast to similar studies in cooler, wetter climates.
Heating alone caused little change, but combined heat and
drought had strong negative eects on root-associated fungi.
Our results also indicate that EMF are more sensitive than
DSE, with the former showing declines in both abundance
and diversity. e dierences among root symbionts could
be due to dierences in stress tolerance, host plant specicity,
degree of dependence on plant hosts for carbon, or a combination
of these factors. Our data on aboveground plant growth and
EMF species diversity support the view that EMF are mutualists,
and emphasizes the importance of community diversity rather
than simple abundance to plant vitality. Less is known about
the importance of DSE to plant performance in arid land
trees or how DSE and EMF interact with one another and
thereby aect their shared host. Obtaining this information is
critical for understanding potential acclimation and adaptation
of forest ecosystems to changing climate as well as for predicting
bottle necks and tipping points that inuence forest health.
DATA AVAILABILITY STATEMENT
e raw data supporting the conclusions of this article will
be made available by the authors, without undue reservation.
AUTHOR CONTRIBUTIONS
CG contributed to data collection and analysis and led the
writing of the manuscript. SS helped to construct and maintain
the experiment, contributed to data collection, and helped to
dra the manuscript. AP and DU contributed to data collection
and revised the manuscript. CK initiated the collaboration and
revised the manuscript. All authors contributed to the article
and approved the submitted version.
FUNDING
CG and AP were supported by the Lucking Family Professorship
at NAU, SS and CK were supported by LANL LDRD project
#ER20160373, and DU was supported by Los Alamos Center
of Space and Earth Sciences, Chick Keller postdoctoral fellowship.
ACKNOWLEDGMENTS
We thank all the students, post docs and LANL sta members
that have participated in maintaining the SUMO experiments
over the years.
REFERENCES
Adams, H. D., Collins, A. D., Briggs, S. P., Vennetier, M., Dickman, L. T.,
Sevanto, S., et al. (2015). Experimental drought and heat can delay phenological
development and reduce foliar and shoot growth in semiarid trees. Glob.
Chang. Bio l. 21, 4210–4220. doi: 10.1111/gcb.13030
Adams, H. D., Guardiola-Claramonte, M., Barron-Gaord, G. A., Villegas, C. J.,
Breshears, D. D., Zou, C. B., et al. (2009). Temperature sensitivity of drought-
induced tree mortality portends increased regional die-o under global-
change-type drought. Proc. Nat l. Acad. Sc i. U. S. A. 106, 7063–7066. doi:
10.1073/pnas.0901438106
Agerer, R. (1991). “Characterization of ectomycorrhiza” in Techniques for the
study of mycorrhiza. Vol. 23. eds. J. R. Norris, D. J. Read and A. K. Varma
(Academic Press Limited), 25–73.
Agerer, R. (2006). Fungal relationships and structural identity of their
ectomycorrhizae. Mycol. Prog. 5, 67–107. doi: 10.1007/s11557-006-0505-x
Allen, M. F., Allen, E. B., Lansing, J., Pregitzer, K., Hendrick, R., Ruess, R.,
et al. (2010). Responses to chronic N fertilization of ectomycorrhizal piñon
but not arbuscular mycorrhizal juniper in a piñon-juniper woodland.
J. Arid Environ. 74, 1170–1176. doi: 10.1016/j.jaridenv.2010.05.001
Allen, C. D., Macalady, A. K., Chenchouni, H., Bachelet, D., McDowell, N.,
Vennetier, M., et al. (2010). A global overview of drought and heat-induced
tree mortality reveals emerging climate change risks for forests. For. Ecol .
Manag. 259, 660–684. doi: 10.1016/j.foreco.2009.09.001
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990).
Basic local alignment search tool. J. Mol. Bi ol. 215, 403–410. doi: 10.1016/
S0022-2836(05)80360-2
Anderegg, W. R., Kane, J. M., and Anderegg, L. D. (2013). Consequences of
widespread tree mortality triggered by drought and temperature stress. Nat.
Rep. Clim. C hang. 3, 30–36. doi: 10.1038/NCLIMATE1635
Aronesty, E. (2011). Ea-utils: command-line tools for processing biological
sequencing data. Available at: https://expressionanalysis.github.io/ea-utils/
(Accessed April 2019).
Baxter, J. W., and Dighton, J. (2001). Ectomycorrhizal diversity alters growth and
nutrient acquisition of grey birch (Betula populifolia) seedlings in host–symbiont
culture conditions. New Phytol. 152, 139–149. doi: 10.1046/j.0028-646x.2001.00245.x
Bengtsson-Palme, J., Ryberg, M., Hartmann, M., Branco, S., Wang, Z., Godhe, A.,
et al. (2013). Improved soware detection and extraction of ITS1 and ITS2
from ribosomal ITS sequences of fungi and other eukaryotes for analysis
of environmental sequencing data. Methods Ecol. Evol. 4, 914–919. doi:
10.1111/2041-210X.12073
Bennett, A. E., and Classen, A. T. (2020). Climate change inuences mycorrhizal
fungal-plant interactions, but conclusions are limited by geographical study
bias. Ecology 101:e202978. doi: 10.1002/ecy.2978
Berthelot, C. M., Chalot, C., Leyval, C., and Blaudez, D. (2019). “From darkenss
to light: emergence of the mysterious dark septate endophytes in plant
growth promotion and stress alleviation” in Endophytes for a growing world.
eds. T. Hodkinson, F. M. Doohan, M. J. Saunders and B. R. Murphy
(Cambridge, U.K.: Cambridge University Press).
Breshears, D. D., Cobb, N. S., Rich, P. M., Price, K. P., Allen, C. D., Balice, R. G.,
et al. (2005). Regional vegetation die-o in response to global-change-type drought.
Proc . Natl. Acad. Sci. U. S. A. 102, 15144–15148. doi: 10.1073/pnas.0505734102
Breshears, D. D., Myers, O. B., Meyer, C. W., Barnes, F. J., Zou, C. B., Allen, C. D.,
et al. (2009). Tree die-o in response to global change-type drought: mortality

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 11 October 2020 | Volume 11 | Article 582574
insights from a decade of plant water potential measurements. Front. Ecol .
Environ. 7, 185–189. doi: 10.1890/080016
Bueno de Mesquita, C. P., Martinez Del Río, C. M., Suding, K. N., and
Schmidt, S. K. (2018). Rapid temporal changes in root colonization by
arbuscular mycorrhizal fungi and ne root endophytes, not dark septate
endophytes, track plant activity and environment in an alpine ecosystem.
Mycorrhiz a 28, 717–726. doi: 10.1007/s00572-018-0863-7
Butler, M. J., and Day, A. W. (1998). Fungal melanins: a review. Can. J. Mic robiol.
44, 1115–1136. doi: 10.1139/w98-119
Cao, S., Liang, Q. W., Nzabanita, C., and Li, Y. Z. (2020). Paraphoma root
rot of alfalfa (Medicago sativa L.) in Inner Mongolia, China. Plant Pathol.
69, 231–239. doi: 10.1111/ppa.13131
Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F. D.,
Costello, E. K., et al. (2010). QIIME allows analysis of high-throughput
community sequencing data. Nat. Methods 7, 335–336. doi: 10.1038/
nmeth.f.303
Collins, S. L., Sinsabaugh, R. L., Crenshaw, C., Green, L., Porras-Alfaro, A.,
Stursova, M., et al. (2008). Pulse dynamics and microbial processes in
aridland ecosystems. J. Ecol . 96, 413–420. doi: 10.1111/j.1365-2745.2008.01362.x
Dickman, L. T., McDowell, N. G., Sevanto, S., Pangle, R. E., and Pockman, W. T.
(2014). Carbohydrate dynamics and mortality in a pinon-juniper woodland
under three future precipitation scenarios. Plant Cell Environ. 38, 729–739.
doi: 10.1111/pce.12441
Fernandez, C. W., and Koide, R. T. (2013). e function of melanin in the
ectomycorrhizal fungus Cenococcum geophilum under water stress. Fungal
Ecol. 6, 479–486. doi: 10.1016/j.funeco.2013.08.004
Fernandez, C. W., Nguyen, N. H., Stefanski, A., Han, Y., Hobbie, S. E.,
Montgomery, R. A., et al. (2017). Ectomycorrhizal fungal response to warming
is linked to poor host performance at the boreal-temperate ecotone. Glob.
Chang. Bio l. 23, 1598–1609. doi: 10.1111/gcb.13510
Frey, S. D. (2019). Mycorrhizal fungi as mediators of soil organic matter
dynamics. Annu. Rev. Ec ol. Ev ol. Syst. 50, 237–259. doi: 10.1146/annurev-
ecolsys-110617-062331
Fujimura, K. E., Smith, J. E., Horton, T. R., Weber, N. S., and Spatafora, J. W.
(2004). Pezizalean mycorrhizas and sporocarps in ponderosa pine (Pinus
ponderosa) aer prescribed res in eastern Oregon, USA. Mycorr hiza 15,
79–86. doi: 10.1007/s00572-004-0303-8
Garcia-Forner, N., Adams, H. D., Sevanto, S., Collins, A. D., Dickman, L. T.,
Hudson, P. J., et al. (2016). Responses of two semiarid conifer tree species
to reduced precipitation and warming reveal new perspectives for stomatal
regulation. Plant Cell Environ. 39, 38–49. doi: 10.1111/pce.12588
Gardes, M., and Bruns, T. D. (1993). ITS primers with enhanced specicity
for basidiomycetes – application to the identication of mycorrhizae and
rusts. Mol. Ecol. 2, 113–118. doi: 10.1111/j.1365-294x.1993.tb00005.x
Gehring, C. A., Flores-Rentería, D., Sthultz, C. M., Leonard, T. M.,
Flores-Rentería, L., Whipple, A. V., et al. (2014). Plant genetics and interspecic
competitive interactions determine ectomycorrhizal fungal community
responses to climate change. Mol. Ecol. 23, 1379–1391. doi: 10.1111/mec.12503
Gehring, C. A., Sthultz, C. M., Flores-Rentería, L., Whipple, A. V., and
Whitham, T. G. (2017). Tree genetics denes fungal partner communities
that may confer drought tolerance. Proc. Natl . Acad. Sci . U. S. A. 114,
11169–11174. doi: 10.1073/pnas.1704022114
Gehring, C. A., Swaty, R. L., and Deckert, R. J. (2016). “Mycorrhizas, drought,
and host-plant mortality” in Mycorrhizal mediation of soil-fertility, structure,
and carbon storage. eds. N. C. Johnson, C. A. Gehring and J. Jansa (Elsevier
Inc: Saint Louis, USA), 277–296.
Gehring, C. A., and Whitham, T. G. (1991). Herbivore-driven mycorrhizal
mutualism in insect-susceptible pinyon pine. Nature 353, 556–557.
Grossiord, C., Gessler, A., Reed, S. C., Borrego, I., Collins, A. D., Dickman, L. T.,
et al. (2018a). Reductions in tree performance during hotter droughts are
mitigated by shis in nitrogen cycling. Plant Cell Environ. 41, 2627–2637.
doi: 10.1111/pce.13389
Grossiord, C., Sevanto, S., Adams, H. D., Borrego, I., Chan, A., Collins, A. D.,
et al. (2017a). Tree water dynamics in a drying and warming world. Plant
Cell Environ. 40, 1861–1873. doi: 10.1111/pce.12991
Grossiord, C., Sevanto, S., Adams, H. D., Collins, A. D., Dickman, L. T.,
McBranch, N., et al. (2017b). Precipitation, not air temperature, drives tree
physiology and morphology in semi-arid ecosystems. J. Ecol. 105, 163–175.
doi: 10.1111/1365-2745.12662
Grossiord, C., Sevanto, S., Bonal, D., Borrego, I., Dawson, T. E., Ryan, M. G.,
et al. (2019). Prolonged warming and drought modify belowground interactions
for water among coexisting plants. Tree Physiol. 39, 55–63. doi: 10.1093/
treephys/tpy080
Grossiord, C., Sevanto, S., Dawson, T., Adams, H. D., Collins, A. D., Dickman, L. T.,
et al. (2017c). Warming combined with more extreme precipitation regimes
modies water sources of trees. New Phytol. 213, 584–596. doi: 10.1111/
nph.14192
Grossiord, C., Sevanto, S., Limousin, J. -M., McDowell, N. G., Meir, P.,
Mencuccini, M., et al. (2018b). Manipulative experiments demonstrate how
precipitation change could alter controls of plant water use. Ex p. Environ.
Bot. 152, 19–27. doi: 10.1016/j.envexpbot.2017.12.010
Grünig, C. R., Queloz, V., Sieber, T. N., and Holdenrieder, O. (2008). Dark
septate endophytes (DSE) of the Phialocephala fortinii s.l.–Acephala applanata
species complex in tree roots: classication, population biology, and ecology.
Botany 86, 1355–1369. doi: 10.1139/B08-108
Hall, T. (1999). BioEdit: Biological sequence alignment editor for windows.
Carlsbad, CA, USA: Ibis Biosciences.
Hazard, C., Kruitbos, L., Davidson, H., Taylor, A. F. S., and Johnson, D. (2017).
Contrasting eects of intra- and interspecic identity and richness of
ectomycorrhizal fungi on host plants, nutrient retention and multifunctionality.
New Phytol. 213, 852–863. doi: 10.1111/nph.14184
Hrynkiewicz, H., Baum, C., Niedojadlo, J., and Dahm, H. (2009). Promotion
of mycorrhiza formation and growth of willows by the bacterial strain
Sphingomonas sp.23L on y ash. Biol. Fertil. Soils 45, 385–394. doi: 10.1007/
s00374-008-0346-7
Hughes, A. R., Moore, A. P., and Gehring, C. A. (2020). Plant response to
fungal root endophytes varies by host genotype in the foundation species
Spartina alterniflora. Am . J. Bot . (in press).
Ikeda, D. H., Max, T. L., Allan, G. J., Lau, M. K., Shuster, S. M., and
Whitham, T. G. (2017). Genetically informed ecological niche models
improve climate change predictions. Glob. Chang. Biol . 23, 164–176. doi:
10.1111/gcb.13470
Iversone, L. R., and Prasad, A. M. (1998). Predicting abundance of 80 tree
species following climate change in eastern United States. Ec ol . M on ogr. 68,
465–485. doi: 10.2307/2657150
Jany, J. L., Martin, F., and Garbaye, J. (2003). Respiration activity of
ectomycorrhizas from Cenococcum geophilum and Lactarius sp. in relation
to soil water potential in ve beech forests. Plant Soil 255, 487–494. doi:
10.1023/A:1026092714340
Jonsson, L. M., Nilsson, M. C., Wardle, D. A., and Zackrisson, O. (2001).
Context dependent effects of ectomycorrhizal species richness on tree
seedling productivity. Oikos 93, 353–364. doi: 10.1034/j.1600-0706.20
01.930301.x
Jumpponen, A., and Trappe, J. M. (1998). Dark septate endophytes: a review
of facultative biotrophic root colonizing fungi. New Phytol. 140, 295–310.
doi: 10.1046/j.1469-8137.1998.00265.x
Karst, J., Randall, M. J., and Gehring, C. A. (2014). Consequences for
ectomycorrhizal fungi of the selective loss or gain of pine across landscapes.
Botany 92, 855–865. doi: 10.1139/cjb-2014-0063
Kivlin, S. N., Emery, S. M., and Rudgers, J. A. (2013). Fungal symbionts alter
plant responses to global change. Am. J. Bot. 100, 1445–1457. doi: 10.3732/
ajb.1200558
Köhler, J., Yang, N., Pena, R., Raghavan, V., Polle, A., and Meier, I. C. (2018).
Ectomycorrhizal fungal diversity increases phosphorus uptake eciency of
European beech. New Phytol. 220, 1200–1210. doi: 10.1111/nph.15208
Koide, R. T., Sharda, J. N., Herr, J. R., and Malcolm, G. M. (2008). Ectomycorrhizal
fungi and the biotrophy–saprotrophy continuum. New Phytol. 178, 230–233.
doi: 10.1111/j.1469-8137.2008.02401.x
Koizumi, T., and Nara, K. (2019). Ectomycorrhizal fungal communities in ice-
age relict forests of Pinus pumila on nine mountains correspond to summer
temperature. ISME J. 14, 189–201. doi: 10.1038/s41396-019-0524-7
Kõljalg, U., Nilsson, R. H., Abarenkov, K., Tedersoo, L., Taylor, A. F., Bahram, M.,
et al. (2013). Towards a unied paradigm for sequence-based identication
of fungi. Mol. Ecol. 22, 5271–5277. doi: 10.1111/mec.12481
Lehto, T., and Zwiazek, J. J. (2010). Ectomycorrhizas and water relations of
trees: a review. Mycorrhiza 21, 71–90. doi: 10.1007/s00572-010-0348-9
Li, X., He, X., Hou, L., Ren, Y., Wang, S., and Su, F. (2018). Dark septate
endophytes isolated from a xerophyte plant promote the growth of

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 12 October 2020 | Volume 11 | Article 582574
Ammopiptanthus mongolicus under drought condition. Sci. Rep. 8:7896. doi:
10.1038/s41598-018-26183-0
Lilleskov, E. A., Kuyper, T. W., Bidartondo, M. I., and Hobbie, E. A. (2019).
Atmospheric nitrogen deposition impacts on the structure and function of
forest mycorrhizal communities: a review. Environ. Pollut. 246, 148–162.
doi: 10.1016/j.envpol.2018.11.074
Limousin, J. -M., Bickford, C. P., Dickman, L. T., Pangle, R. E., Hudson, P. J.,
Boutz, A. L., et al. (2013). Regulation and acclimation of leaf gas exchange
in a pino-juniper woodland exposed to three dierent precipitation regimes.
Plant Cell Environ. 36, 1812–1825. doi: 10.1111/pce.12089
Liu, H., Li, T., Ding, Y., Yang, Y., and Zhao, Z. (2017). Dark septate endophytes
colonizing the roots of ‘non-mycorrhizal’ plants in a mine tailing pond and
in a relatively undisturbed environment, Southwest China. J. Plant Interact.
12, 264–271. doi: 10.1080/17429145.2017.1333635
Mahé, F., Rognes, T., Quince, C., de Vargas, C., and Dunthorn, M. (2014).
Swarm: robust and fast clustering method for amplicon-based studies. PeerJ
2:e593. doi: 10.7717/peerj.593
Maheshwari, R., Bharadwaj, G., and Bhat, M. K. (2000). ermophilic fungi:
their physiology and enzymes. Microbiol . Mol. Biol. Rev. 64, 461–488. doi:
10.1128/mmbr.64.3.461-488.2000
Manrique-Alba, A., Sevanto, S., Damas, H. D., Collins, A. D., Dickman, L. T.,
Chirino, E., et al. (2018). Stem radial growth and water storage responses
to heat and drought vary between conifers with dierent hydraulic strategies.
Plant Cell Environ. 41, 1926–1934. doi: 10.1111/pce.13340
Mayjonade, B., Gouzy, J., Donnadieu, C., Pouilly, N., Marande, W., Callot, C.,
et al. (2016). Extraction of high-molecular-weight genomic DNA for long-
read sequencing of single molecules. Biotechniques 61, 203–205. doi:
10.2144/000114460
McBranch, N. A., Grossiord, C., Adams, H. D., Borrego, I., Collins, A. D.,
Dickman, L. T., et al. (2019). Lack of acclimation of leaf: sapwood area
ration in pinon pine and juniper in response to precipitation reduction
and warming. Tree Physiol. 39, 135–142. doi: 10.1093/treephys/tpy066
McDowell, N. G., Pockman, W. T., Allen, C. D., Breshears, D. D., Cobb, N.,
Kolb, T., et al. (2008). Mechanisms of plant survival and mortality during
drought: why do some plants survive while others succumb to drought?
New Phytol. 178, 719–739. doi: 10.1111/j.1469-8137.2008.02436.x
McDowell, N. G., Williams, A. P., Xu, C., Pockman, W. T., Dickman, L. T.,
Sevanto, S., et al. (2016). Multi-scale predictions of massive conifer mortality
due to chronic temperature rise. Nat. Clim . Chang. 6, 295–300. doi: 10.1038/
NCLIMATE2873
McGonigle, T. P., Miller, M. H., Evans, D. G., Fairchild, G. L., and Swan, J. A.
(1990). A new method which gives an objective measure of colonization
of roots by vesicular-arbuscular mycorrhizal fungi. New Phytol. 115, 495–501.
doi: 10.1111/j.1469-8137.1990.tb00476.x
Menoyo, E., Teste, F. P., Ferrero, M. A., and Lugo, M. A. (2020). Associations
between fungal root endophytes and grass dominance in arid highlands.
Funct. Ecol. 45:100924. doi: 10.1016/j.funeco.2020.100924
Miyamoto, Y., Terashima, Y., and Nara, K. (2018). Temperature niche positionand
breadth of ectomycorrhizal fungi: reduced diversity underwarming predicted
by a nested community structure. Glob. Chang. Biol. 24, 5724–5737. doi:
10.1111/gcb.14446
Mohan, J. E., Cowden, C. C., Baas, P., Dawadi, A., Frankson, P. T., Helmick, K.,
et al. (2014). Mycorrhizal fungi mediation of terrestrial ecosystem responses
to global change: mini-review. Fungal Ecol. 10, 3–19. doi: 10.1016/j.
funeco.2014.01.005
Morin, X., Fahse, L., Jactel, H., Scherer-Lorenzen, M., Garcia-Valdes, R., and
Bugmann, H. (2018). Long-term response of forest productivity to climate
change is mostly driven by change in tree species composition. Sci. Rep.
8:5627. doi: 10.1038/s41598-018-23763-y
Mueller, R. C., Scudder, C. M., Whitham, T. G., and Gehring, C. A. (2019).
Legacy eects of tree mortality mediated by ectomycorrhizal fungal
communities. New Phytol. 224, 155–165. doi: 10.1111/nph.15993
Nakamura, N., Tanaka, E., Tanaka, C., and Takeuchi-Kaneko, Y. (2018).
Localization of helotialean fungi on ectomycorrhizae of Castanopsis cuspidata
visualized by in situ hybridization. Mycorrhiza 28, 17–28. doi: 10.1007/
s00572-017-0803-y
Newsham, K. K. (2011). A meta-analysis of plant responses to dark septate
root endophytes. New Phytol. 190, 783–793. doi: 10.1111/j.1469-8137.
2010.03611.x
Nicotra, A. B., Atkin, O. K., Bonser, S. P., Davidson, A. M., Finnegan, E. J.,
Mathesius, U., et al. (2010). Plant phenotypic plasticity in a changing climate.
Trends Plant Sci. 15, 684–692. doi: 10.1016/j.tplants.2010.09.008
Nilsson, R. H., Larsson, K. -H., Taylor, A. F. S., Bengtsson-Palme, J., Jeppesen, T. S.,
Schigel, D., et al. (2019). e UNITE database for molecular identication
of fungi: handling dark taxa and parallel taxonomic classications. Nucleic
Acids Res. 47, D259–D264. doi: 10.1093/nar/gky1022
Pangle, R., Hill, J., Plaut, J., Yepez, E., Elliot, J., Gehres, N., et al. (2012).
Methodology and performance of a rainfall manipulation experiment in a
piñon–juniper woodland. Ecosphere 3:28. doi: 10.1890/ES11-00369.1
Patterson, A. M., Flores-Rentería, L., Whipple, A. V., Whitham, T. G., and
Gehring, C. A. (2018). Common garden experiments disentangle plant genetic
and environmental contributions to ectomycorrhizal fungal community
structure. New Phytol. 221, 493–502. doi: 10.1111/nph.15352
Peltier, D. M. P., Fell, M., and Ogle, K. (2016). Legacy eects of drought in
the southwestern United States: a multi-species syntheses. Eco l. Mono gr. 86,
312–326. doi: 10.1002/ecm.1219/suppinfo
Pena, R., Oermann, C., Simon, J., Naumann, P. S., Gessler, A., Holst, J., et al.
(2010). Girdling aects ectomycorrhizal fungal (EMF) diversity and reveals
functional dierences in EMF community composition in a beech forest.
Appl. Environ. Microbiol. 76, 1831–1841. doi: 10.1128/AEM.01703-09
Pena, R., and Polle, A. (2014). Attributing functions to ectomycorrhizal fungal
identities in assemblages for nitrogen acquisition under stress. ISME J. 8,
321–330. doi: 10.1038/ismej.2013.158
Pigott, C. D. (1982). Survival of mycorrhiza formed by Cenococcum geophilum
Fr. In dry soils. New Phytol. 92, 513–517. doi: 10.1111/j.1469-8137.1982.
tb03409.x
Plaut, J. A., Yepez, E. A., Hill, J., Pangle, R. E., Sperry, J. S., Pockman, W. T.,
et al. (2012). Hydraulic limits preceding mortality in a piñon-juniper woodland
under experimental drought. Plant Cell Environ. 35, 1601–1617. doi: 10.1111/j.
1365-3040.2012.02512.x
Porras-Alfaro, A., and Bayman, P. (2011). Hidden fungi, emergent properties:
endophytes and microbiomes. Annu . Rev. Phytopath ol. 49, 291–315. doi:
10.1146/annurev-phyto-080508-081831
Porras-Alfaro, A., Herrera, J., Sinsabaugh, R. L., Odenbach, K. J., Lowrey, T.,
and Natvig, D. O. (2008). Novel root fungal consortium associated with a
dominant desert grass. Appl. Environ. Microbiol. 74, 2805–2813. doi: 10.1128/
AEM.02769-07
Rohland, N., and Reich, D. (2012). Cost-eective, high-throughput DNA
sequencing libraries for multiplexed target capture. Genome Res. 22, 939–946.
doi: 10.1101/gr.128124.111
Sa, G., Yao, J., Deng, C., Liu, J., Zhang, Y., Zhu, Z., et al. (2019). Amelioration
of nitrate uptake under salt stress by ectomycorrhiza with and without a
hartig net. New Phytol. 222, 1951–1964. doi: 10.1111/nph.15740
Sevanto, S., McDowell, N. G., Dickman, L. T., Pangle, R., and Pockman, W. T.
(2014). How do trees die? A test of the hydraulic failure and carbon starvation
hypotheses. Plant Cell Environ. 37, 153–161. doi: 10.1111/pce.12141
Smith, S. E., and Read, J. D. (2008). Mycorrhizal symbiosis. Cambridge, UK:
Academic Press.
Sthultz, C. M., Gehring, C. A., and Whitham, T. G. (2009a). Deadly
combination of genes and drought: increased mortality of herbivore-
resistant trees in a foundation species. Glob. Chang. Biol. 15, 1949–1961.
doi: 10.1111/j.1365-2486.2009.01901.x
Sthultz, C. M., Whitham, T. G., Kennedy, K., Deckert, R. J., and Gehring, C. A.
(2009b). Genetically based susceptibility to herbivory inuences the
ectomycorrhizal fungal communities of a foundation tree species. New Phytol.
184, 657–667. doi: 10.1111/j.1469-8137.2009.03016.x
Taylor, D. L., Walters, W. A., Lennon, N. J., Bochicchio, J., Krohn, A., Caporaso, J. G.,
et al. (2016). Accurate estimation of fungal diversity and abundance through
improved lineage-specic primers optimized for illumina amplicon sequencing.
Appl. Environ. Microbiol. 82, 7217–7226. doi: 10.1128/AEM.02576-16
Tedersoo, L., and Smith, M. E. (2013). Lineages of ectomycorrhizal fungi
revisited: foraging strategies and novel lineages revealed by sequences from
belowground. Fungal Biol. Rev. 27, 83–99. doi: 10.1016/j.r.2013.09.001
Van Mantgem, P. J., Stephenson, N. L., Byrne, J. C., Daniels, L. D., Franklin, J. F.,
Fulé, P. Z., et al. (2009). Widespread increase of tree mortality rates in the
western United States. Science 323, 521–524. doi: 10.1126/science.1165000
Way, D. A., and Yamori, W. (2014). ermal acclimation of photosynthesis:
on the importance of adjusting our denitions and accounting for thermal

Gehring et al. Combined Climate Changes Affect Fungi
Frontiers in Plant Science | www.frontiersin.org 13 October 2020 | Volume 11 | Article 582574
acclimation of respiration. Photosynth. Res. 119, 89–100. doi: 10.1007/
s11120-013-9873-7
White, T. J., Bruns, T. D., Lee, S. B., and Taylor, J. W. (1990). “Amplication
and direct sequencing of fungal ribosomal RNA genes for phylogenetics”
in PCR protocols – A guide to methods and applications. eds. M. A.
Innis, D. H. Gelfand, J. J. Sninsky and T. J. White (New York: Academic
Press), 315–322.
Williams, A. P., Allen, C. D., Macalady, A. K., Grin, D., Woodhouse, C. A.,
Meko, D. M., et al. (2013). Temperature as a potent driver of regional
forest drought stress and tree mortality. Nat. Clim. Change 3, 292–297. doi:
10.1038/nclimate1693
Conflict of Interest: e authors declare that the research was conducted in
the absence of any commercial or nancial relationships that could beconstrued
as a potential conict of interest.
Copyright © 2020 Gehring, Sevanto, Patterson, Ulrich and Kuske. is is an open-
access article distributed under the terms of the Creative Commons Attribution
License (CC BY). e use, distribution or reproduction in other forums is permitted,
provided the original author(s) and the copyright owner(s) are credited and that
the original publication in this journal is cited, in accordance with accepted academic
practice. No use, distribution or reproduction is permitted which does not comply
with these terms.