The fatty acid binding protein FABP7 is required for optimal oligodendrocyte differentiation during myelination but not during remyelination

Abstract

The major constituents of the myelin sheath are lipids, which are made up of fatty acids (FAs). The hydrophilic environment inside the cells requires FAs to be bound to proteins, preventing their aggregation. Fatty acid binding proteins (FABPs) are one class of proteins known to bind FAs in a cell. Given the crucial role of FAs for myelin sheath formation we investigated the role of FABP7, the major isoform expressed in oligodendrocyte progenitor cells (OPCs), in developmental myelination and remyelination. Here, we show that the knockdown of Fabp7 resulted in a reduction of OPC differentiation in vitro. Consistent with this result, a delay in developmental myelination was observed in Fabp7 knockout animals. This delay was transient with full myelination being established before adulthood. FABP7 was dispensable for remyelination, as the knockout of Fapb7 did not alter remyelination efficiency in a focal demyelination model. In summary, while FABP7 is important in OPC differentiation in vitro, its function is not crucial for myelination and remyelination in vivo.

Full text

RESEARCH ARTICLE
The fatty acid binding protein FABP7 is required for optimal
oligodendrocyte differentiation during myelination but not
during remyelination
Sarah Foerster
1
| Alerie Guzman de la Fuente
1
| Yoshiteru Kagawa
2
|
Theresa Bartels
1
| Yuji Owada
2
| Robin J. M. Franklin
1
1
Wellcome-Medical Research Council
Cambridge Stem Cell Institute, Jeffrey Cheah
Biomedical Centre, University of Cambridge,
Cambridge, UK
2
Department of Organ Anatomy, Tohoku
University Graduate School of Medicine,
Sendai, Japan
Correspondence
Robin J. M. Franklin, Wellcome-Medical
Research Council Cambridge Stem Cell
Institute, Jeffrey Cheah Biomedical Centre,
University of Cambridge, Cambridge, UK.
Email: rjf1000@cam.ac.uk
Present Address
Alerie Guzman de la Fuente, Wellcome-
Wolfson Institute for Experimental Medicine,
Queen's University Belfast, 97 Lisburn Road,
Belfast, BT9 7JL, UK.
Funding information
Dr. Miriam and Sheldon G. Adelson Medical
Research Foundation; European Committee for
Treatment and Research in Multiple Sclerosis;
Japan Society for the Promotion of Science;
Medical Research Council; Multiple Sclerosis
Society; Wellcome
Abstract
The major constituents of the myelin sheath are lipids, which are made up of fatty
acids (FAs). The hydrophilic environment inside the cells requires FAs to be bound to
proteins, preventing their aggregation. Fatty acid binding proteins (FABPs) are one
class of proteins known to bind FAs in a cell. Given the crucial role of FAs for myelin
sheath formation we investigated the role of FABP7, the major isoform expressed in
oligodendrocyte progenitor cells (OPCs), in developmental myelination and
remyelination. Here, we show that the knockdown of Fabp7 resulted in a reduction
of OPC differentiation in vitro. Consistent with this result, a delay in developmental
myelination was observed in Fabp7 knockout animals. This delay was transient with
full myelination being established before adulthood. FABP7 was dispensable for
remyelination, as the knockout of Fapb7 did not alter remyelination efficiency in a
focal demyelination model. In summary, while FABP7 is important in OPC differentia-
tion in vitro, its function is not crucial for myelination and remyelination in vivo.
KEYWORDS
fatty acid binding protein, myelination, remyelination, OPC
1|INTRODUCTION
The myelin sheath of the central nervous system (CNS) has a unique
molecular composition that distinguishes it from other cell mem-
branes: it comprises 71–81% of lipids, which include cholesterols
(26%), galactolipids (31%), and phospholipids (44%) (Norton &
Poduslo, 1973). The specific lipid composition allows close compac-
tion of the myelin sheath, creating a highly ordered, hydrophobic
barrier that enables myelin to function as an electric insulator
(Simons & Nave, 2015).
Fatty acids (FAs) are the building blocks of the galactolipids and
phospholipids found in myelin. To maintain water solubility and prevent
aggregation, FAs are bound to proteins in the cytoplasm (Cistola, Hamil-
ton, Jackson, & Small, 1988). There are ten FA binding proteins (FABPs),
of which FABP3, FABP5, and FABP7 are expressed in the CNS (Owada,
Yoshimoto, & Kondo, 1996). FABP7 is mainly expressed in astrocytes
(Owada et al., 1996) and oligodendrocyte progenitor cells (OPCs; Sharifi
et al., 2013), a progenitor cell giving rise to mature oligodendrocytes
Sarah Foerster and Alerie Guzman de la Fuente are joint first authors.
Received: 11 October 2019 Revised: 10 January 2020 Accepted: 23 January 2020
DOI: 10.1002/glia.23789
This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,
provided the original work is properly cited.
© 2020 The Authors. Glia published by Wiley Periodicals, Inc.
Glia. 2020;1–11. wileyonlinelibrary.com/journal/glia 1

(OLs) in development and in response to injury (Franklin & ffrench-Con-
stant, 2017). OPCs isolated from Fabp7 knockout (Fabp7KO) mice
have impaired differentiation in vitro (Sharifi et al., 2013). In animal
models of primary demyelination, Fabp7 expression is increased in
CNS resident cells (Bannerman, Hahn, Soulika, Gallo, & Pleasure,
2006; Huang et al., 2011; Kipp et al., 2011). However, the impor-
tance of FABP7 in the OPCs biology in vivo is not well understood.
In this study, we found that the pattern of FABP7 expression
closely follows the timeline of myelination during postnatal develop-
ment. This suggested a role in developmental myelination which was
confirmed by a delay in developmental myelination in Fabp7 knockout
mice. From early adulthood onward, the expression of FABP7 was
dramatically reduced and the protein was only re-expressed following
a demyelinating insult. However, Fabp7KO mice showed no effect on
the remyelination capacity of OPCs.
2|MATERIALS AND METHODS
2.1 |Animal husbandry
Animal experiments conformed to the UK Animals (Scientific Pro-
cedures) Act 1986 and were approved by the Cambridge University
local ethical committees before licensing by the UK Home Office.
The animals were housed under standard laboratory conditions
on a 12 hr light/dark cycle with constant access to food and
water. Fabp7KO mice were obtained from the Owada laboratory,
Tohoku University, Japan (Owada et al., 2006). Demyelination
experiments in the Fabp7KO animals were performed at Tohoku
University, Japan. The experimental protocol for performing
demyelinating lesions was reviewed by the ethics committee for
Animal Experimentation of Tohoku University Graduate School of
Medicine and carried out according to the guidelines for animal
experimentation of the Tohoku University Graduate School of
Medicine and under the law and notification requirements of the
Japanese government.
2.2 |Isolation of primary OPCs
OPCs were isolated from neonatal (P7–P30),2months,3months,
9 months, 12 months, or 24 months old Sprague Dawley rats as publi-
shed previously (Neumann et al., 2019; Segel et al., 2019). Briefly, brains
were digested in a papain solution (34U/ml, Worthington) containing
DNAseTypeIV(20μg/ml, Gibco) for 30–40 min at 37C.Thetissuewas
then triturated into a single cell suspension in Half (made in house) sup-
plemented with B27 (1×, Gibco) and sodium pyruvate (2 mM, Gibco).
After trituration, the single cell suspension was filtered through a 70 μm
strainer and separated from debris by gradient density centrifugation
(800 g, 20 min, RT) using 22.5% Percoll
®
(GE Healthcare). The cell pellet
was then subjected to red blood cell lysis using the red blood cell lysis
buffer(Sigma)for2min.Finally,OPCs were purified using the anti-A2B5
microbeads MACS
®
cell separation system according to the
manufacturer's protocol (Miltenyi Biotech). If used for Western blot anal-
ysis, obtained OPCs were resuspended in IP lysis/wash buffer (25 mM
Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, and 5% glyc-
erol; Thermo-Fisher Scientific). If used for qRT-PCR analysis, obtained
OPCs were resuspended in TRIzol Reagent (Thermo-Fisher Scientific).
2.3 |Isolation of OPCs using mixed glia culture
OPCs were obtained from P0–P3 old Sprague Dawley rats following
the protocol of McCarthy and de Vellis (McCarthy & de Vellis, 1980).
Briefly, the cortex was digested in a papain solution (34U/ml,
Worthington) for 1 hr at 37C. Digestion was stopped by adding
DMEM (Gibco) supplemented with 10% FBS (Biosera) and the tissue
was spun at 300 g for 5 min. The tissue was resuspended in DMEM
with 10% FBS and 1% penicillin/streptomycin and cells from two brains
were plated in a poly-D-lysine (Sigma) coated T75 flask. Mix glial cells
were cultured at 37Cand5%CO
2
for 10 days with media changes
every 3 days. After 10 days in vitro (DIV), the flasks were subjected to a
shake off protocol to separate OPCs from the rest of the glial cells
(McCarthy & de Vellis, 1980). OPCs were cultured in OPC medium
(DMEM F12 (Gibco), 2 mM sodium pyruvate (Gibco), 60 μgN-acetyl-
cysteine (Sigma-Aldrich), 5 μg/ml insulin (Gibco), 21 mM D-glucose
(Sigma-Aldrich), 50 μg/ml apo-transferrin (Sigma-Aldrich), 16.1 μg/ml
putrescine (Sigma-Aldrich), 40 ng/ml sodium–selenite (Sigma-Aldrich),
and 60 ng/ml progesterone (Sigma-Aldrich) with daily addition of
10 ng/ml PDGF-AA and 10ng/ml bFGF (PeproTech) at 37Cand5%
CO
2
. Cells were plated on poly-D-lysine coated coverslips at a density
of 20,000 cells/13 mm coverslip. Each n-number represents an OPC
isolation from independent mix glial cell culture preparations on differ-
ent days, each preparation performed from four individual P0–P3 old
Sprague Dawley rats.
2.4 |Fabp7 siRNA knockdown
OPCs isolated from mixed glial cell cultures were cultured for 2 DIV with
growth factors, then the medium was changed to OPC medium without
penicillin/streptomycin overnight. Cells were transfected with 50 nM
FABP7 siRNA or equivalent non-targeting control (GE Healthcare) using
1% Lipofectamine siRNAMAX (Invitrogen) diluted in Opti-MEM (Gibco)
according to the manufacturer's protocol. Six hours after transfection, the
medium was replaced by OPC medium without growth factors, thyroxine
and triiodothyronine. After 48 hr of transfection, cells were fixed with 4%
(w/v) PFA for 10 min if used for immunocytochemistry staining, lysed in
IP lysis/wash buffer (Thermo-Fisher Scientific) if used for Western blot
analysis or TRIzol Reagent (Thermo-Fisher Scientific) if used for qPCR.
2.5 |Immunocytochemistry
After siRNA treatment, cells were blocked with 5% normal donkey
serum (NDS) (Sigma-Aldrich) supplemented with 0.1% Triton X-100
2FOERSTER ET AL.

(Sigma-Aldrich) in PBS for 1 hr at RT. Then cells were incubated for
1 hr at RT with primary antibodies (Mouse anti-CNPase antibody,
1:500 (C5922, Sigma-Aldrich); Rabbit anti-Olig2 antibody, 1:500
(AB9610, Millipore); or rat anti-MBP antibody, 1:500 (MCA4095,
Serotec)) in 5% NDS with 0.1% Triton X-100. After three washes, the
cells were incubated with the appropriate Alexa Flour secondary anti-
bodies (1:500, Life-technologies) diluted in 5% NDS with 0.1% Triton
X-100 for 1 hr at RT. Nuclei were stained with Hoechst (2μg/ml,
Sigma-Aldrich) for 10 min at RT, before the coverslips were mounted
using Fluoromount G (Southern Biotech).
2.6 |Western blot
Protein lysates were mixed with NuPage loading buffer and NuPage
reducing agent (DTT) (Life-technologies) according to manufacturer's
protocol and boiled for 10 min at 95C. After denaturation, 5 μgof
each sample were loaded on 4–12% Bolts Gels (Life Technologies)
and the gels were subjected to electrophoresis at 120 V for 2 hr. In
the sumoylation and ubiquitination experiments, 1 μg ubiquitin (U-
100H, R&D Systems) and Sumo 1, 2, and 3 (K700, R&D Systems)
were loaded as control. The gels were then transferred onto a metha-
nol preactivated PVDF membrane (Millipore) using a wet transfer tank
(Bio-Rad) and 1×NuPage transfer buffer (Life-technologies) with 20%
ethanol for 90 min at 100 V. The PVDF membrane was then blocked
in blocking buffer (TBS blocking agent 1:1 (Li-Cor) with TBS (Fischer
scientific)-0.1% Tween (Sigma-Aldrich) or 5% skimmed milk in TBST
(TBS with 0.1% Tween)) for 1 hr at RT. PVDF membranes were incu-
bated overnight at 4C with the primary antibodies (Rabbit anti-BLBP,
1:500 (ab32423, Abcam); Mouse anti-actin, 1:5000 (A5441, Sigma);
Mouse anti-actin (sc-47778, SantaCruz Biotechnology); Mouse anti-
ubiquitin, 1:200 (sc8017, Santa Cruz); or mouse anti-sumo1 antibody,
1:500 (sc5308, Santa Cruz). Subsequently the membranes were incu-
bated with secondary antibodies (Donkey anti-rabbit 680, 1:10,000
(926_38073, Li-Cor); donkey anti-mouse 800, 1:10,000 (926_32212,
Li-Cor); goat anti-mouse IgG-HRP conjugated (AP307P, Millipore) or
goat anti-mouse IgG-HRP conjugated (AP124P, Millipore)). If appro-
priate, membranes were then incubated with an actin-peroxidase anti-
body, 1:25,000 (A3854, Sigma) for 20 min at RT. Fluorescent and
HRP signals were detected using the Odyssey apparatus (Li-Cor) with
an exposure time of 2 min.
2.7 |Phosphorylation and glycosylation
experiments
Cells were lysed in IP lysis/wash buffer (Thermo-scientific) without
the addition of protease and phosphatase inhibitors. For glycosylation
analysis, 5 μg OPC lysates were then subjected to digestion for 1 hr at
37C with EndoH enzyme or EndoH glycobuffer (NEB) alone as con-
trol. For phosphorylation analysis, 5 μg of OPC lysate were subjected
to digestion for 30 min at 30C with Lambda protein phosphatase or
10×NeBuffer Protein MetalloPhosphatases (PMP) and MnCl
2
only as
control. The OPC lysates were then boiled for 10 min at 95C and fur-
ther processed for Western Blot as described above.
2.8 |Real-time qPCR
RNA was isolated from cultured OPCs according to the RNAeasy Mini
Kit (74104, Qiagen). All RNA samples were stored at −80C prior to
further processing. cDNA was generated using the QuantiTect
Reverse Transcription Kit according to the instructions of the manu-
facturer (205310, Qiagen). For RT-qPCR, Fabp7 primers (forward
(50à30): AAGATGGTCGTGACTCTTAC; reverse (50à30): GGAA
ACCAAGTTGTCAAAAG) were used at a concentration of 400 μM.
The efficiency of the primer was greater than ~95% as determined by
serial dilutions of OPC cDNA. cDNA, primers, and the SYBR Green
Master Mix (204141, Qiagen) were mixed as instructed by the manu-
facturer, and RT-qPCR and melting curve analysis were performed on
Life Technologies' QuantStudio 6 Flex Real-Time PCR System. Fold
changes in gene expression were calculated using the ΔΔCt method
in Microsoft Excel.
2.9 |Toxin induced (lysolecithin) demyelination
model in the spinal cord
For spinal cord lysolecithin lesions 2–3 months old wild type and
homozygous Fabp7 knockout mice (Owada et al., 2006) were used.
Demyelination was induced in the caudal thoracic ventral funiculus of
the spinal cord by injection of 1% (v/v) lysolecithin as previously
described (Fancy et al., 2009).
2.10 |Immunohistochemistry
Mice were terminally anaesthetized and fixed by intracardiac perfu-
sion at 5, 10, or 21 days post lesion (dpl) induction using 4% (w/v)
PFA. Spinal cords were removed, postfixed in 4% (w/v) PFA overnight
at 4C, cryoprotected with 20% (w/v) sucrose for 24–48 hr, embed-
ded, frozen in OCT medium and stored at −80C. Tissues were sec-
tioned at 12 μm and collected onto poly-L-lysine-coated glass slides.
12 μm cryo-sections were dried at RT and then rehydrated in PBS.
After rehydration, slides were postfixed for 10 min with 4% (w/v) PFA
and then washed 3×10 min with PBS. Sections were blocked with
5% NDS and 0.1% Triton X-100 for 1 hr at RT. In case the mouse-anti
APC antibody was used, the slides were blocked using the MOM Kit
according to the manufacturer's instructions (BMK-2202, Vector Lab-
oratories). After blocking, slides were incubated with primary anti-
bodies in blocking solutions overnight at 4C (Rabbit anti-OLIG2,
1:500 (AB9610, Millipore); Goat anti-SOX10, 1:100 (sc365692, Santa
Cruz); Rabbit anti-Ki67, 1:500 (ab16667, Abcam); or mouse anti-APC,
1:300 (OP80, Millipore). Slides were then incubated with the
appropriate Alexa Fluor
®
secondary antibodies 1:500 (Life Technolo-
gies) for 2 hr at RT. Nuclei were stained with Hoechst (2 μg/ml,
FOERSTER ET AL.3

Sigma-Aldrich) for 10 min at RT, before the coverslips were mounted
using Fluoromount G (Southern Biotech).
2.11 |Toluidine blue staining
For toluidine blue and electron microscopy experiments, mice were
terminally anaesthetized and fixed by intracardiac perfusion at 14 and
21 days post lesion (dpl) using 4% (w/v) glutaraldehyde. Spinal cords
were removed and postfixed in 4% (w/v) glutaraldehyde overnight at
4C. The tissue was dehydrated in a series of ethanol washes (1×70%
EtOH for 15 min, 1×95% EtOH for 15 min, and 3×100% EtOH for
10 min (Sigma)), washed twice in propylene oxide for 15 min and incu-
bated in a one-to-one mix of propylene oxide and resin (50% resin,
34% dodecenyl succinic anhydride (DDSA), 16% methyl nadic anhy-
dride (MNA), 2% 2,4,6-Tris(dimethylaminomethyl)phenol (DMP-30),
all (v/v), TAAB Laboratories) for at least 3 hr at RT. The tissue was
then incubated twice in pure resin for 12 hr at RT, before samples
were embedded in plastic containers in fresh resin and hardened for
2 days at 60C. Samples were cut into 0.75 μm resin sections and sec-
tions were then stained for 30 s with toluidine blue at 65C on a heat
plate. The toluidine blue images were blindly ranked by two indepen-
dent assessors, who ranked them according to their level of demyelin-
ation and remyelination. In resin sections, remyelinated axons can be
readily distinguished from normally myelinated axons outside the
lesion by the thinness of the myelin sheath. Within the lesion,
remyelinated axons can be distinguished from demyelinated axons
because the former have myelin sheaths recognizable as a dark
staining rim around the axon. The highest rank was given to the ani-
mal exhibiting the highest proportion of remyelinated axons. If it was
not possible to differentiate two animals using this method then they
were given the same rank. In this method, no attempt is made to
assign a value to the proportion of remyelination, but simply to estab-
lish how a section from an individual animal ranks relative to others.
FIGURE 1 FABP7 expression in OPCs. (a) Western blot of FABP7 expression in acutely isolated OPCs at different developmental time points
(P = postnatal day). (b) Quantification of FABP7 protein expression normalized to actin (one-way ANOVA, p= .0001, Bonferroni post hoc test;
(1) P7 versus P14, p= .0010; (2) P7 versus P21, p= .0003, (3) P7 versus P30, p= .0003; n= 3, mean ± SEM). (c) Western blot of FABP7
expression in ageing OPCs: note the higher molecular weight band appearing in adult OPCs. (d) Quantification of FAPB7 protein expression of
the lower and higher molecular weight bands normalized to actin (low molecular weight band: one-way ANOVA, p< .0001, Bonferroni posthoc
test; Neo (P7) vs 3, 9, and 24 months, p<0.0001; High molecular weight band: one-way ANOVA, p= .0366, Bonferroni posthoc test; Neo
(P7) verssus 3 months, p= .0300; n= 3, mean ± SEM). (e) qPCR quantification of the relative expression of Fabp7 mRNA in ageing OPCs
normalized to Pop4 (housekeeping gene) (one-way ANOVA; p< .0001, Bonferroni post hoc test; (1) Neo (P7) versus 2 and 12 months, p< .0001;
(2) 2 versus 12 months, p= .0030; n= 3, mean ± SEM)
4FOERSTER ET AL.

2.12 |Quantification
To quantify in vitro proliferation and differentiation assays, five ran-
domly chosen areas of the coverslip were imaged per condition with
the 20×objective of the SP5 Leica confocal with a 512 ×512 resolu-
tion and 2 μm stacks. Counting was performed manually using the cell
counter plugin in ImageJ (Version 2.0.0-rc-68/1.52 hr). To quantify
remyelination efficiency, three lesions per animal were imaged with
the 20×objective (SPR Leica Confocal) at a 512 ×512 resolution and
2μm stacks. Using ImageJ software (Version 2.0.0-rc-68/1.52 hr), the
lesion area was delineated and measured, and the number of different
cell types within the lesion was counted manually with the cell coun-
ter plugin. To quantify OPC differentiation during developmental
myelination, white matter of three sections per animal were imaged
using the 20×objective (Leica SP5 confocal) at 512 ×512 resolution
with 2 μm stacks. The area of interest was measured using Image the
FIGURE 2 Fabp7 siRNA knockdown affects OPC differentiation. (a) Western blot of FABP7 expression in OPCs in vitro after siRNA
knockdown compared to scrambled siRNA control. NT = non-targeting siRNA. DHA = docosahexaenoic acid. (b,c) Quantification of FABP7
protein (b) or mRNA (c) expression after siRNA treatment compared to scrambled siRNA control (unpaired Student's t-test, p= .0135 (b); unpaired
Student's t-test, p= .0239 (c); n= 3, mean ± SEM). (d) Immunocytochemistry staining for OLIG2, CNPase, and MBP (marker of differentiated
oligodendrocytes) in mixed glia derived OPCs after Fabp7 siRNA knockdown. (Scale bar: 100 μm) (e–g) Quantification of the percentage of DAPI
+
cells expressing OLIG2 (e), OLIG2
+
cells expressing CNPase (f) or MBP (g) (unpaired Student's t-test, p= .0701 (f ), p= .0291 (g); n=3,
mean ± SEM)
FOERSTER ET AL.5

FIGURE 3 Developmental myelination in the spinal cord is delayed in Fabp7 knockout mice. (a) Immunohistochemistry staining for OLIG2
and APC (marker of differentiated oligodendrocytes) in the ventral white matter of the spinal cord of WT and Fabp7KO mice at P7 and P14 (Scale
bar: 100 μm). (b) Quantification of OLIG2
+
cells per area in the whole spinal cord of WT and Fabp7KO mice at P7 and P14 (unpaired Student's
t-test, p= .3430 (P7) and p= .1089 (P14); n=5–6, mean ± SEM). (c) Quantification of the percentage of OLIG2
+
APC
+
in the white matter of the
spinal cord of WT and Fabp7KO mice at P7 and P14 (unpaired Student's t-test, p= .0435 (P7) and p= .1439(P14); n=5–6, mean ± SEM).
(d) Toluidine blue staining of the ventral spinal cord in WT and Fabp7KO mice at P7 and P14 (Scale bar: 50 μm). White squares highlight areas
shown in the higher magnification insets. (e) Quantification of the number of myelinated axons per area in the ventral white matter at P7 and P14
(unpaired Student's t-test, p= .009 (P7); n= 3 (P7), n= 2 (P14), mean ± SEM)
6FOERSTER ET AL.

J software and the number of cells positive for the indicated marker
proteins within the area of interest was counted manually. Toluidine
blue staining was imaged using 63×objective of the Zeiss Apotome
with a 2048 ×2048 resolution. White matter of three sections per
animal were imaged and the number of myelinated axons in the white
matter were manually counted using the cell counter plugin in ImageJ
(Version 2.0.0-rc-68/1.52 hr). Western blots were quantified by mea-
suring the integrated density of each of the bands by the quantifica-
tion tool in the Image studio software (Version 4.0, Li-Cor).
2.13 |Statistics
Statistical analysis was performed using the Prism 7.0 and 8.0
(GraphPad Software) and SPSS Statistics 20.0 (IBM). Mean ± SEM are
shown in all the graphs. The data were analyzed for normal distribu-
tion using D'Agostino-Pearson omnibus and Shapiro–Wilk normality
test. If the number of biological replicates was low (n < 4), normality
was calculated using normality via residuals. A two-tailed unpaired
Student's t-test was performed to assess the statistical significance
between two groups. In case the data were not normally distributed, a
U-Mann–Whitney test was performed. When comparing more than
two groups, a one-way Anova test was used followed by a Tukey's
posthoc test. If the sample was not normally distributed, a Kruskal–
Wallis test combined with a Dunn's posthoc test was carried out.
Remyelination ranking was evaluated using a U-Mann–Whitney test.
Western-blot data were analyzed using a one-way ANOVA and the
corresponding Bonferroni posthoc test. qPCR data were analyzed
using a one sample t-test. In case the data were shown in percentages,
adequate arcsin conversion was done prior to the unpaired Student's
t-test.
3|RESULTS
FABP7 was highly expressed in OPCs isolated from rat brain at post-
natal day 7 (P7; Figure 1a,b). However, with postnatal development,
FABP7 protein expression steadily declined, reaching significance as
early as P14 (P7 vs. P14, p= .001, Bonferroni posthoc test; Figure 1a,
b). From P30, a higher molecular weight of FABP7 is detected at
40 kDa (Figure 1a,c). This is likely attributable to posttranslational
changes as the adult form of FABP7 is more glycosylated and phos-
phorylated compared to its neonatal counterpart (Figure S1a).
Ubiquitination and sumoylation do not contribute to the high molecu-
lar weight band in young adult OPCs (Figure S1b,c). With ageing,
Fabp7 mRNA and protein expression continue to decrease until it is
undetectable in the aged rat (Figure 1c–e). The antibody used for the
Western Blot analysis was specific to FABP7 protein as we did not
detect FAPB7 protein in Fabp7KO animals, as it has been reported in
a previous publication (Figure S1d; Driessen et al., 2018).
As FABP7 is highly expressed in neonatal OPCs (Figure 1), we
investigated its role in OPC proliferation and differentiation by
FIGURE 4 Developmental myelination in the brain is also delayed in Fabp7 knockout mice. (a) Immunohistochemistry staining for OLIG2 and
APC in the corpus callosum of WT and Fabp7KO mice at P7 and P14 (Scale bar: 100 μm). (b) Quantification of OLIG2
+
cells per area in the corpus
callosum of WT and Fabp7KO mice at P7 and P14 (unpaired Student's t-test, p= .9307 (P7) and p= .3601 (P14); n=4–5, mean ± SEM).
(c) Quantification of the percentage of OLIG2
+
APC
+
cells in the white matter of the corpus callosum of WT and Fabp7KO mice at P7 and P14
(unpaired Student's t-test, p= .0001 (P7) and p= .0045 (P14); n=4–5, mean ± SEM)
FOERSTER ET AL.7

knocking down Fabp7 in vitro using siRNA. siRNA knockdown
(KD) efficiency was >75% both on protein (Figure 2a,b) and RNA
(Figure 2c) level. Mixed glial culture-derived neonatal OPC cultures
contained 90% Olig2
+
cells (Figure 2d,e), minimizing any possible
indirect effect on OPCs from Fabp7KD in other CNS cell types
in vitro. Knockdown of Fabp7 in these mixed glial culture-derived neo-
natal OPCs resulted in a 2.2-fold reduction of OPC differentiation into
CNP
+
/OLIG2
+
mature oligodendrocytes in differentiation medium
FIGURE 5 FABP7 is not essential for remyelination. (a) Schematic drawing of lysolecithin induced demyelination in the ventral white matter
of the spinal cord. (b) Immunohistochemistry staining for OLIG2 and APC in the lesion in the ventral white matter of WT and Fabp7KO mice at
14 days post lesion (dpl) (Scale bar: 100 μm). (c) Quantification of OLIG2
+
cells per area in the lesion of WT and Fabp7KO mice at 14dpl (unpaired
Student's t-test, p= .4371; n= 5, mean ± SEM) (d) Quantification of the percentage of OLIG2
+
APC
+
cells in the lesion of WT and Fabp7KO mice
at 14dpl (unpaired Student's t-test, p= .3154; n= 5, mean ± SEM) (e,g) Toluidine blue staining of the lesion in WT and Fabp7KO mice at 14dpl
(e) and 21dpl (g) (Scale bar: 25 μm). (f,h) Ranking analysis of remyelination efficiency in WT and Fabp7KO mice at 14dpl (f ) and 21dpl
(h) (U-Mann–Whitney test, p= .8571 (f), p= .2000 (h); n= 3-4, mean ± SEM)
8FOERSTER ET AL.

from which the growth factors PDGF and FGF-2 were removed (WT:
73% CNP
+
/OLIG2
+
cells, Fabp7KD: 33% CNP
+
/OLIG2
+
cells, p= .07,
unpaired Student's t-test; Figure 2d,f). Similarly, the proportion of
OPCs differentiating into MBP
+
/OLIG2
+
myelin-sheath forming oligo-
dendrocytes is also significantly reduced (WT: 27% MBP
+
/OLIG2
+
cells, Fabp7KD: 5% MBP
+
/OLIG2
+
cells, p= .03, unpaired Student's t-
test) (Figure 2d,g). These findings concur with a study by Sharifi and
colleagues, whose data was also consistent with a role for FABP7 in
OPC differentiation (Sharifi et al., 2013). In the same publication it
was also shown that the knockout of Fabp7 (Fabp7KO) affected the
OPC proliferation capacity in vitro (Sharifi et al., 2013). In agreement
with this study, we found that, while the number of SOX10
+
cells
stays constant (Figure S2a,b), Fabp7KD led to a reduction of the pro-
portion of SOX10
+
oligodendrocyte lineage cells that expressed KI67
(WT: 72% SOX10
+
/KI67
+
cells, Fabp7KD: 61% SOX10
+
/KI67
+
cells,
p= .03, unpaired Student's t-test; Figure S2a,c).
Given that the expression pattern of FABP7 is reminiscent of the
timeline of developmental myelination (Figure 1) and FABP7 contrib-
utes to OPC differentiation in vitro (Figure 2), we investigated
whether the knockout of Fabp7 altered developmental myelination.
The global homozygous knockout of Fabp7 did not affect the density
of oligodendrocyte lineage cells, identified by the expression of OLIG2
(Figure 3a,b). However, Fabp7KO mice showed a significantly reduced
percentage of APC
+
/OLIG2
+
mature oligodendrocytes in the spinal
cord at P7 (WT: 40% APC
+
OLIG2
+
,Fabp7KO: 32% APC
+
OLIG2
+
,
p= .04, unpaired Student's t-test; Figure 3a,c). This corresponded with
a decreased number of myelinated axons in the spinal cord at P7 (WT:
78977 myelinated axons/mm
2
,Fabp7KO: 67110 myelinated axons/
mm
2
,p= .009, unpaired Student's t-test; Figure 3d,e). However, this
hypomyelination was transient, as the percentage of mature APC
+
/
OLIG2
+
oligodendrocytes, as well as the number of myelinated axons,
was not significantly different in the spinal cord of WT or Fabp7KO
mice at P14 (Figure 3a–e). As in the spinal cord, the percentage of
APC
+
/OLIG2
+
mature oligodendrocytes was significantly decreased in
the corpus callosum of Fabp7KO animals at P7 (WT: 47% APC
+
/
OLIG2
+
,Fabp7KO: 31% APC
+
/OLIG2
+
,p= .0001, unpaired Student's
t-test) and P14 (WT: 81% APC
+
/OLIG2
+
,Fabp7KO: 66% APC
+
/
OLIG2
+
,p= .0045, unpaired Student's t-test; Figure 4a,c), while no
differences were detected in the density of OLIG2
+
oligodendrocyte
lineage cells (Figure 4a,b). The extended period of delayed myelination
in the corpus callosum compared to the spinal cord is possibly due to
a later onset of myelination in the corpus callosum. Unlike in the
already published data (Sharifi et al., 2013) and our own in vitro
results (Figure S2a,c), OPC proliferation was not altered by the
absence of FABP7 in the spinal cord at P7 and P14 (Figure S2d,e).
These data indicate that FABP7 plays a role in OPC differentiation,
but not proliferation, during development.
OPCs generate oligodendrocytes not only during developmental
myelination, but also for remyelination in response to demyelinating
injury. Given the involvement of FABP7 in OPC differentiation during
developmental myelination (Figures 3 and 4) and that FABP7 expres-
sion is increased at 14 days post lesion (dpl) during remyelination
(Huang et al., 2011), we next asked whether FABP7 also plays a role
in response to a toxin-induced demyelination. To assess the
remyelination capacity of Fabp7KO OPCs, we created a demyelinating
lesion in the ventral spinal cord white matter of young adult mice by
direct injection of lysolecithin (Figure 5a). There was no difference in
the density of OLIG2
+
oligodendrocyte lineage cells in the lesion
(Figure 5b,c), neither in the percentage of APC
+
/OLIG2
+
mature oligo-
dendrocytes at 14 dpl (Figure 5b,d). Similarly, unbiased ranking of the
proportion of remyelinated axons in the lesion did not show any sig-
nificant difference between WT and Fabp7KO animals at 14 and
21 dpl (Figure 5e–h). Additionally, we also did not find a difference in
the proliferation capacity of OPCs in WT and Fabp7KO after a demye-
linating insult (Figure S3a–c), indicating that the loss of FABP7 in oli-
godendrocyte lineage cells does not impede their remyelination
capacity.
4|DISCUSSION
4.1 |FABP7 is involved in OPC differentiation
in vitro
Here we confirm that FABP7 plays a role in OPCs differentiation
in vitro (Figure 2), which agrees with an earlier study using a different
experimental approach (Sharifi et al., 2013). The mechanism by which
FABP7 modulates OPC differentiation are not known and require fur-
ther exploration. FABP7 has high binding affinities to doco-
sahexaenoic acid (DHA, 22:6(n−3)), α-linolenic acid (LA, 18:2(n−6)),
and eicosapentaenoic acid (EPA, 20:5(n−3); Balendiran et al., 2000),
thereby playing a central role in the intracellular transport of these
FAs to various cellular organelles. In astrocytes, FABP7 can bind to
PPAR-γ(Tripathi et al., 2017) and modulate ERK phosphorylation
(Yasumoto et al., 2018), both pathways involved in OPC maturation
and differentiation (Fyffe-Maricich, Karlo, Landreth, & Miller, 2011;
Saluja, Granneman, & Skoff, 2001). However, whether the same path-
ways are employed in oligodendrocyte lineage cells to regulate their
differentiation potential remains to be addressed.
4.2 |FABP7 is dispensable for OPC differentiation
in vivo
In Fabp7KO animals, developmental myelination was delayed at P7,
but oligodendrocyte numbers recovered to physiological levels at P14
in the spinal cord (Figure 3). This delay in developmental myelination
might be caused by a direct effect on the OPCs as suggested by the
in vitro data (Figure 2). However, as the major FABP7 expressing cell
type in the CNS are astrocytes it is also feasible that an indirect effect
of the Fabp7KO in astrocytes attenuates OPC differentiation. Indeed,
mice lacking connexin 47 and 30, preventing the coupling of astrocytes
to oligodendrocytes, leads to a transient reduction in the number of
oligodendrocytes and thinner myelin sheaths (Tress et al., 2012).
In the demyelination model, however, we did not observe a simi-
lar delay of OPC differentiation in Fabp7KO animals (Figure 5). While
FOERSTER ET AL.9

it is possible that a potential delay in OPCs differentiation in response
to demyelination was not detected due to the time point chosen for
analysis (14 and 21 days post lesion, Figure 5), there might also be
differences in the FA transport between developmental myelination
and remyelination. For example, changes in the lipid composition in
the myelin sheath formed in remyelination have been reported
(Wilson & Tocher, 1991), that might render FABP7 dispensable for
remyelination.
Nevertheless, regardless of whether there is an undetected delay
in OPC differentiation after demyelination, the absence of FABP7
does not have a long-term effect on either developmental myelination
or remyelination in vivo. A reason for its dispensability could be a
compensatory mechanism in which other FABP isoforms, also physio-
logically expressed in the brain, are upregulated. However, no increase
in FABP3/5 expression in response to Fabp7 knockout has been
observed in development and early adulthood (Owada et al., 2006),
rendering the compensation by other FABP isoforms unlikely. As long
chain FAs would aggregate in the cytoplasm, an alternative FA trans-
port pathway must exist in oligodendrocytes. Elucidating these FA
transport pathways in oligodendrocytes could provide new therapeu-
tic targets to enhance OPC differentiation as FAs are crucial for the
production of many myelin sheath components.
ACKNOWLEDGMENTS
This work was supported by grants from the UK Multiple Sclerosis
Society, the Adelson Medical Research Foundation, the Japan Society
for the Promotion of Science (JSPS) KAKENHI Grant and a core sup-
port grant from the Wellcome Trust and M.R.C. to the Wellcome-
Medical Research Council Cambridge Stem Cell Institute. A.G.F. was
also supported by an ECTRIMS postdoctoral fellowship from July
2018. S.F. and T.B. were also supported by a Wellcome-Trust PhD
studentship.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
DATA AVAILABILITY STATEMENT
The data supporting the findings of this study are available from the
corresponding author upon request.
ORCID
Sarah Foerster https://orcid.org/0000-0002-2585-0621
Robin J. M. Franklin https://orcid.org/0000-0001-6522-2104
REFERENCES
Balendiran, G. K., Schnütgen, F., Scapin, G., Borchers, T., Xhong, N.,
Lim, K., …Sacchettini J. C. (2000). Crystal structure and thermody-
namic analysis of human brain fatty acid-binding protein. The Journal
of Biological Chemistry,275(35), 27045–27054 http://doi.org/10.
1074/jbc.M003001200
Bannerman, P., Hahn, A., Soulika, A., Gallo, V., & Pleasure, D. (2006).
Astrogliosis in EAE spinal cord: Derivation from radial glia, and rela-
tionships to oligodendroglia. Glia,55(1), 57–64 http://doi.org/10.
1002/glia.20437
Cistola, D. P., Hamilton, J. A., Jackson, D., & Small, D. M. (1988). Ionization
and phase behavior of fatty acids in water: Application of the Gibbs
phase rule. Biochemistry,27(6), 1881–1888.
Driessen, T. M., Zhao, C., Saenz, M., Stevenson, S. A., Owada, Y., &
Gammie, S. C. (2018). Down-regulation of fatty acid binding protein
7 (Fabp7) is a hallmark of the postpartum brain. Journal of Chemical
Neuroanatomy,92,92–101 http://doi.org/10.1016/j.jchemneu.2018.
07.003
Fancy, S. P. J., Baranzini, S. E., Zhao, C., Yuk, D.-I., Irvine, K.-A., Kaing, S., …
Rowitch D. H. (2009). Dysregulation of the Wnt pathway inhibits
timely myelination and remyelination in the mammalian CNS. Genes &
Development,23(13), 1571–1585 http://doi.org/10.1101/gad.
1806309
Franklin, R. J. M., & ffrench-Constant, C. (2017). Regenerating CNS
myelin—From mechanisms to experimental medicines. Nature
Reviews. Neuroscience,18(12), 753–769 http://doi.org/10.1038/nrn.
2017.136
Fyffe-Maricich, S. L., Karlo, J. C., Landreth, G. E., & Miller, R. H. (2011). The
ERK2 mitogen-activated protein kinase regulates the timing of oligo-
dendrocyte differentiation. The Journal of Neuroscience: The Official
Journal of the Society for Neuroscience,31(3), 843–850 http://doi.org/
10.1523/JNEUROSCI.3239-10.2011
Huang, J. K., Jarjour, A. A., Oumesmar, B. N., Kerninon, C., Williams, A.,
Krezel, W., …Franklin R. J. M. (2011). Retinoid X receptor gamma sig-
naling accelerates CNS remyelination. Nature Neuroscience,14(1),
45–53 http://doi.org/10.1038/nn.2702
Kipp, M., Clarner, T., Gingele, S., Pott, F., Amor, S., van der Valk, P., &
Beyer, C. (2011). Brain lipid binding protein (FABP7) as modulator of
astrocyte function. Physiological Research,60(Suppl 1), S49–S60.
McCarthy, K. D., & de Vellis, J. (1980). Preparation of separate astroglial
and oligodendroglial cell cultures from rat cerebral tissue. The Journal
of Cell Biology,85(3), 890–902 http://doi.org/10.1083/jcb.85.3.890
Neumann, B., Baror, R., Zhao, C., Segel, M., Dietmann, S., Rawji, K. S., …
Franklin R. J. M. (2019). Metformin Restores CNS Remyelination
Capacity by Rejuvenating Aged Stem Cells. Cell Stem Cell,25(4),
473–485.e8 http://doi.org/10.1016/j.stem.2019.08.015
Norton, W. T., & Poduslo, S. E. (1973). Myelination in rat brain: Changes
in myelin composition during brain maturation. Journal of Neurochemistry,
21(4), 759–773 http://doi.org/10.1111/j.1471-4159.1973.tb07520.x
Owada, Y., Abdelwahab, S. A., Kitanaka, N., Sakagami, H., Takano, H.,
Sugitani, Y., …Kondo, H. (2006). Altered emotional behavioral
responses in mice lacking brain-type fatty acid-binding protein gene.
The European Journal of Neuroscience,24(1), 175–187 http://doi.org/
10.1111/j.1460-9568.2006.04855.x
Owada, Y., Yoshimoto, T., & Kondo, H. (1996). Spatio-temporally differen-
tial expression of genes for three members of fatty acid binding pro-
teins in developing and mature rat brains. Journal of Chemical
Neuroanatomy,12(2), 113–122.
Saluja, I., Granneman, J. G., & Skoff, R. P. (2001). PPAR delta agonists stim-
ulate oligodendrocyte differentiation in tissue culture. Glia,33(3),
191–204.
Segel, M., Neumann, B., Hill, M. F. E., Weber, I. P., Viscomi, C., Zhao, C., …
Chalut, K. J. (2019). Niche stiffness underlies the ageing of central ner-
vous system progenitor cells. Nature,573(7772), 130–134 http://doi.
org/10.1038/s41586-019-1484-9
Sharifi, K., Ebrahimi, M., Kagawa, Y., Islam, A., Tuerxun, T., Yasumoto, Y., …
Owada, Y. (2013). Differential expression and regulatory roles of FABP5
and FABP7 in oligodendrocyte lineage cells. Cell and Tissue Research,
354(3), 683–695 http://doi.org/10.1007/s00441-013-1730-7
Simons, M., & Nave, K.-A. (2015). Oligodendrocytes: Myelination and Axo-
nal Support. Cold Spring Harbor Perspectives in Biology,8(1), a020479
http://doi.org/10.1101/cshperspect.a020479
Tress, O., Maglione, M., May, D., Pivneva, T., Richter, N., Seyfarth, J., …
Willecke, K. (2012). Panglial gap junctional communication is essential
for maintenance of myelin in the CNS. The Journal of Neuroscience: The
10 FOERSTER ET AL.

Official Journal of the Society for Neuroscience,32(22), 7499–7518
http://doi.org/10.1523/JNEUROSCI.0392-12.2012
Tripathi, S., Kushwaha, R., Mishra, J., Gupta, M. K., Kumar, H., Sanyal, S., …
Bandyopadhyay, S. (2017). Docosahexaenoic acid up-regulates both
PI3K/AKT-dependent FABP7-PPARγinteraction and MKP3 that
enhance GFAP in developing rat brain astrocytes. Journal of Neuro-
chemistry,140(1), 96–113 http://doi.org/10.1111/jnc.13879
Wilson, R., & Tocher, D. R. (1991). Lipid and fatty acid composition is
altered in plaque tissue from multiple sclerosis brain compared with
normal brain white matter. Lipids,26(1), 9–15.
Yasumoto, Y., Miyazaki, H., Ogata, M., Kagawa, Y., Yamamoto, Y., Islam, A.,
…Owada, Y. (2018). Glial fatty acid-binding protein 7 (FABP7) regu-
lates neuronal leptin sensitivity in the hypothalamic arcuate nucleus.
Molecular Neurobiology,491(7424), 357–313 http://doi.org/10.1007/
s12035-018-1033-9
SUPPORTING INFORMATION
Additional supporting information may be found online in the
Supporting Information section at the end of this article.
How to cite this article: Foerster S, Guzman de la Fuente A,
Kagawa Y, Bartels T, Owada Y, Franklin RJM. The fatty acid
binding protein FABP7 is required for optimal oligodendrocyte
differentiation during myelination but not during
remyelination. Glia. 2020;1–11. https://doi.org/10.1002/glia.
23789
FOERSTER ET AL.11