Available via license: CC BY
Content may be subject to copyright.
RESEARCH ARTICLE
Gpr63 is a modifier of microcephaly in Ttc21b
mouse mutants
John Snedeker
1,2
, William J. Gibbons, Jr.
1
, David F. PauldingID
1
, Zakia Abdelhamed
1,3
,
Daniel R. ProwsID
1,4
, Rolf W. StottmannID
1,2,4,5,6
*
1Division of Human Genetics, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio, United States
of America, 2Neuroscience Graduate Program, University of Cincinnati College of Medicine, Cincinnati,
Ohio, United States of America, 3Department of Anatomy and Embryology, Faculty of Medicine (Girl’s
Section), Al-Azhar University, Cairo, Egypt, 4Department of Pediatrics, University of Cincinnati College of
Medicine, Cincinnati, Ohio, United States of America, 5Division of Developmental Biology, Cincinnati
Children’s Hospital Medical Center, Cincinnati, Ohio, United States of America, 6Shriner’s Hospital for
Children - Cincinnati, Cincinnati, Ohio, United States of America
*rolf.stottmann@cchmc.org
Abstract
The primary cilium is a signaling center critical for proper embryonic development. Previous
studies have demonstrated that mice lacking Ttc21b have impaired retrograde trafficking
within the cilium and multiple organogenesis phenotypes, including microcephaly. Interest-
ingly, the severity of the microcephaly in Ttc21b
aln/aln
homozygous null mutants is consider-
ably affected by the genetic background and mutants on an FVB/NJ (FVB) background
develop a forebrain significantly smaller than mutants on a C57BL/6J (B6) background. We
performed a Quantitative Trait Locus (QTL) analysis to identify potential genetic modifiers
and identified two regions linked to differential forebrain size: modifier of alien QTL1
(Moaq1) on chromosome 4 at 27.8 Mb and Moaq2 on chromosome 6 at 93.6 Mb. These
QTLs were validated by constructing congenic strains. Further analysis of Moaq1 identified
an orphan G-protein coupled receptor (GPCR), Gpr63, as a candidate gene. We identified a
SNP that is polymorphic between the FVB and B6 strains in Gpr63 and creates a missense
mutation predicted to be deleterious in the FVB protein. We used CRISPR-Cas9 genome
editing to create two lines of FVB congenic mice: one with the B6 sequence of Gpr63 and
the other with a deletion allele leading to a truncation of the GPR63 C-terminal tail. We then
demonstrated that Gpr63 can localize to the cilium in vitro. These alleles affect ciliary locali-
zation of GPR63 in vitro and genetically interact with Ttc21b
aln/aln
as Gpr63;Ttc21b double
mutants show unique phenotypes including spina bifida aperta and earlier embryonic lethal-
ity. This validated Gpr63 as a modifier of multiple Ttc21b neural phenotypes and strongly
supports Gpr63 as a causal gene (i.e., a quantitative trait gene, QTG) within the Moaq1
QTL.
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 1 / 23
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Snedeker J, Gibbons WJ, Jr., Paulding
DF, Abdelhamed Z, Prows DR, Stottmann RW
(2019) Gpr63 is a modifier of microcephaly in
Ttc21b mouse mutants. PLoS Genet 15(11):
e1008467. https://doi.org/10.1371/journal.
pgen.1008467
Editor: Gregory A. Cox, The Jackson Laboratory,
UNITED STATES
Received: October 11, 2018
Accepted: October 8, 2019
Published: November 15, 2019
Copyright: ©2019 Snedeker et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the manuscript and its Supporting
Information files.
Funding: This work is supported by awards to R.
W.S. from the National Institute of General Medical
Sciences (https://www.nigms.nih.gov; R01GM
112744, R35GM131875). The funder had no role
in study design, data collection and analysis,
decision to publish, or preparation of the
manuscript.
Author summary
TTC21B in humans is a known ciliopathy gene and contributes to the pathophysiology of
a number of ciliopathies. Mice homozygous for a null allele of Ttc21b also have a spectrum
of ciliopathy phenotypes, including microcephaly (small brain). Further work has shown
that the severity of the microcephaly significantly depends on the genetic background of
the mouse model. The genetic mechanisms of the Ttc21b pathophysiology and the inter-
acting gene network remain far from understood. As an initial attempt to understand the
underlying mechanism(s) underlying the variable effects on brain size, we performed a
quantitative trait locus (QTL) analysis and found two regions of genomic significance that
correlated with smaller brain size. We confirmed both QTLs with congenic lines. One of
the two regions was small enough that we considered candidate genes and hypothesized
Gpr63 might be a contributing locus for a number of reasons. We evaluated this hypothe-
sis directly with precise variant creation using genome editing and provide evidence that
Ttc21b and Gpr63 do indeed genetically interact. Thus, we have been able to combine clas-
sical QTL analysis and genome editing to directly test the resulting hypothesis.
Introduction
Primary cilia are microtubule-based organelles known to play essential roles in proper devel-
opment and function of a number of organ systems including the central nervous system
(CNS) [1–4]. Ciliopathies are a class of human diseases caused by pathogenic variants in genes
encoding proteins responsible for the proper form and function of cilia [5–7]. The frequent
presentation of cognitive impairment in ciliopathy patients, in addition to severely compro-
mised brain development in a number of ciliary mutant mouse models, clearly displays the
importance of primary cilia in CNS health and development [8,9]. Primary cilia have been
implicated in transducing and regulating several critical developmental pathways including
SHH, WNT, PDGF, TGFβ/BMP, RTK, and Notch [3,10]. An array of cell surface receptors,
including G-protein coupled receptors (GPCRs), localize to the ciliary membrane to modulate
these pathways and other signaling events [11]. Intraflagellar transport (IFT) proteins are
responsible for the movement of cargo within the cilium with complex-B proteins regulating
anterograde transport from the basal body to the distal tip of the cilium and complex-A pro-
teins regulating retrograde transport [12]. IFT-A proteins have also been shown to specifically
play a role in the trafficking of select GPCRs in and out of the cilium [13–15].
Tetratricopeptide repeat domain 21b (Ttc21b; Thm1; Ift139; MGI 1920918) encodes an
IFT-A protein necessary for the proper rate of retrograde trafficking within the primary cilium
[16]. TTC21B is not part of the “core IFT-A complex” [15]. When TTC21B is reduced, a large
portion of the remaining IFT-A protein subunits remains intact as this “core” complex and
continues to interact with the dynein motor powering retrograde movement. Thus, TTC21B
likely acts to facilitate binding of peripheral cargo proteins to the core proteins of the complex,
thus assisting the transport of these cargo proteins through the cilium. Proper ciliary traffick-
ing is known to be critical for the processing of GLI transcription factors, which are in turn
essential for proper regulation of the SHH pathway [17,18]. Mutant mice homozygous for the
alien (aln) null allele of Ttc21b display impaired processing of GLI3, the primary repressor of
SHH target genes, and consequently show an increase in SHH pathway activity in multiple tis-
sues including the developing forebrain [16,19].
The ciliopathies are only one example of a class of human diseases with broad phenotypic
variability. The advent of genome sequencing is facilitating the study of genes and variants
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 2 / 23
Competing interests: The authors have declared
that no competing interests exist.
affecting disease penetrance and expressivity. The ability to specifically model such modifiers
in experimental organisms like mice with genome editing should allow more in-depth studies
of genetic interactions and their role in human disease. It is well known that genetic back-
grounds of mouse inbred strains can affect phenotypic severity and penetrance of specific
mouse mutations. These differences can be used to detect genetic interactions in complex traits
and begin to understand the mechanisms leading to this variability [20,21]. One example of
genetic background influencing the expressivity of a phenotype is the forebrain malformations
seen in Ttc21b
aln/aln
mutants. Here we present a QTL analysis to further understand the under-
lying pathogenic molecular mechanism leading to the microcephaly. We demonstrate that
Gpr63 interacts with Ttc21b to modify the size of the forebrain in Ttc21b
aln/aln
null mutants
and provide evidence that the Gpr63 mutation is the likely causal variant for the chromosome
4 QTL affecting brain size.
Results
Ttc21b
aln
microcephaly is background dependent
The phenotypes observed in Ttc21b
aln/aln
mutants were first identified as part of an ENU muta-
genesis experiment to identify recessive developmental phenotypes in the perinatal mouse
[22]. A/J mice were treated with the ENU mutagen and the subsequent breeding and mapping
of the causative mutation involved an outcross to the FVB/NJ (FVB) strain [16,22]. Ttc21b
aln/
aln
homozygous mutants on this mixed A/J;FVB background exhibited multiple forebrain and
craniofacial phenotypes (Fig 1A–1D) [16,19]. While the microcephaly phenotype was
completely penetrant, craniofacial phenotypes such as cleft lip and palate were only present in
a minority of embryos. To increase the frequency of craniofacial phenotypes and facilitate
future molecular analyses, the Ttc21b
aln
allele was serially backcrossed onto the C57BL/6J (B6)
strain. The B6 genetic background has previously been shown to be more susceptible to cra-
niofacial phenotypes in a number of studies [23–26]. This initial, exploratory backcross was
done informally and was not genotyped. After the Ttc21b
aln
allele was serially backcrossed to
the B6 background for at least five generations, we noticed the relative size of the forebrain tis-
sues in B6.Cg-Ttc21b
aln/aln
mutants increased substantially as compared to the mutants previ-
ously analyzed, although they remained smaller in all Ttc21b
aln/aln
mutants than control brains
and still lacked olfactory bulbs (Fig 1E and 1F). To confirm this was indeed an effect of varying
the genetic background, the Ttc21b
aln
allele was again serially backcrossed to the FVB back-
ground for at least three generations. Embryonic analysis showed the severity of microcephaly
initially seen was recovered in the new FVB.Cg-Ttc21b
aln/aln
mutants (Fig 1C and 1D). We
measured the forebrain surface area of Ttc21b
aln/aln
mutants on both FVB and B6 genetic back-
grounds (Fig 1G) and saw a 60% decrease in forebrain size in FVB.Cg-Ttc21b
aln/aln
animals as
compared to littermate controls (n = 7 wt and n = 4 aln mutants; p<0.0001), but only a 30%
decrease in B6.Cg-Ttc21b
aln/aln
animals (n = 4 wt and n = 3 aln mutants; p = 0.00033). The
interaction between genetic background and the Ttc21b
aln
allele was analyzed with a 2-way
ANOVA (p = 0.0053).
Given all of this preliminary data, we hypothesized the genetic background effect on
Ttc21b
aln/aln
mutant forebrain size would allow a Quantitative Trait Locus (QTL) analysis to
generate insight into the underlying molecular mechanism(s). In order to generate mice as
genetically uniform as practical prior to performing a QTL analysis, we further backcrossed
both strains of Ttc21b
aln
mice. After at least three further generations of backcrossing onto
FVB (FVB;B6-Ttc21b
aln/aln
) and four generations onto B6 (B6;FVB-Ttc21b
aln/aln
), we per-
formed a genome-wide high-density MegaMUGA SNP scan and confirmed that each strain
was approximately 90% pure (S1 Table). We further purified the FVB and B6 advanced
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 3 / 23
backcross lines with at least two additional backcrosses combined with targeted microsatellite
marker screening of chromosomal areas not yet homozygous for FVB or B6 as identified in
the initial genome scan. This allowed us to create FVB.Cg-Ttc21b
aln/wt
animals that were
>99% FVB and B6.Cg-Ttc21b
aln/wt
animals purified to ~97% B6 background, as assayed by a
GigaMUGA genome SNP scan providing strain-specific sequence information at over 143,000
SNPs [27] (S1 Table).
As we performed this breeding, we continued to note an incompletely penetrant exence-
phaly phenotype in Ttc21b
aln/aln
animals, but the frequency did not appear to significantly dif-
fer between backgrounds (Table 1). We calculated the incidence of exencephaly and found
that maintaining the Ttc21b
aln
allele on either the FVB or B6 genetic backgrounds yielded
exencephaly in ~40% of Ttc21b
aln/aln
mutants (24/58, 41% in FVB;B6-Ttc21b
aln/aln
and 30/65,
46% in B6;FVB-Ttc21b
aln/aln
). Note these embryos were collected for other experimental
Fig 1. Genetic background affects the Ttc21b
aln/aln
microcephaly phenotype. (A-F) Embryos and whole mount brains viewed
from the dorsal aspect from control (A,B, E17.5), FVB;Cg-Ttc21b
aln/aln
mutants (C,D, E18.5), and B6;Cg-Ttc21b
aln/aln
mutants (E,F,
E17.5). (G) Relative forebrain dorsal surface areas between wild-type and Ttc21b
aln/aln
mutants from each genetic background. Data
shown are mean ±95% confidence interval. n = 7, 4, 4, 3 sample points. Scale bars in A-F indicate 1mm.
https://doi.org/10.1371/journal.pgen.1008467.g001
Table 1. Mutant genotype and exencephaly incidence.
Total # Ttc21b
aln/aln
# expected % with exencephaly
aln.B6�(E10.5-E18.5) 193 42 48.25 46
aln.FVB�(E10.5-E18.5) 120 36 30 41
aln.FVB.B6 F2 (E17.5) 607 148 151.75 24
aln.FVB (E17.5) incipient congenic (at >90% purity) 86 22 21.5 95��
Gpr63.N2 (P28) 35 8 8.75 0
Total # Ttc21b
aln/aln
;Gpr63 double mut # expected % with exencephaly
Gpr63
Ser(FVB)/Arg(B6)
;Ttc21b
aln/aln
(E17.5) 142 15 8.875 13
Gpr63
Del/Arg(B6)
;Ttc21b
aln/aln
(E17.5) 142 13 8.875 46
Gpr63
Del/Del
;Ttc21b
aln/aln
(E17.5) 128 8 8 25���
Gpr63
Del/Del
;Ttc21b
aln/aln
(E12.5)���� 72 9 5.375 89
�note these are from crosses before the QTL experiment was being rigorously conducted.
�� exencephaly or earlier lethality
��� 6 of 8 were dead prior to ~E12.5 so no reliable exencephaly incidence measures
���� data are aggregated from Gpr63
Del/wt
;Ttc21b
aln/wt
intercrosses as well as Gpr63
Del/Del
;Ttc21b
aln/wt
xGpr63
Del/wt
;Ttc21b
aln/wt
https://doi.org/10.1371/journal.pgen.1008467.t001
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 4 / 23
purposes as the incipient congenics were being further purified and are on a mixed genetic
background.
We first generated F2 Ttc21b
aln/aln
mutant progeny from a B6.FVB F1 (Ttc21b
aln/wt
)inter-
cross for the QTL analysis. Fifty-four F2 litters were generated, which identified 148 Ttc21b
aln/
aln
mutant embryos from 607 total embryos. We excluded 35 mutants (24%) with exencephaly,
which precluded a measurement of forebrain area. Ninety-six brains from the remaining F2
mutants were micro-dissected and the dorsal surface area of the forebrain was measured.
Whole genome SNP genotyping of each F2 recombinant was carried out using a GigaMUGA
panel and QTL mapping was performed using R/qtl [28] to identify chromosomal regions
linked to differential brain sizes in Ttc21b
aln/aln
mutants. The dataset used in the QTL analysis
is presented in S2 Table and an overview of the QTLs identified and their effects on the pheno-
type is provided in Table 2.
A significant QTL (genomewide p <0.05; LOD 6.1) was mapped to chromosome 4 with its
peak at 27.8 Mb (marker UNC6953268) and a 95% confidence interval spanning 19.5 Mb to 46
Mb (Fig 2A and 2B). This QTL explained 25.1% of the phenotypic variance (Table 2). We have
named this chromosome 4 locus modifier of alien QTL 1 (Moaq1). A second QTL was identi-
fied with a LOD score suggesting significance (genomewide p <0.63; LOD 4.7) and mapped
to chromosome 6 at 93.6 Mb (UNCHS018175) with a 95% confidence interval from 0 to 117.5
Mb (Fig 2A and 2C). This chromosome 6 QTL explained 20.1% of the trait variance and was
named modifier of alien QTL 2 (Moaq2). A third peak was found on chromosome 2 at the
Ttc21b locus, which likely represents the A/J passenger background on which the initial muta-
genesis was performed (Fig 2A). To assess the contribution of each locus to the trait, we deter-
mined the change in LOD score and percent variance explained for the three possible 2-loci
models and the 3-loci model (Table 2). A significant increase in LOD score (>+3) was found
for all comparisons, indicating that all three loci (aln and the 2 modifiers) significantly added
to the phenotype, and together they explained 44.4% of the phenotypic variance. To assess
whether the three loci interacted with each other and/or were additive, we performed a
scantwo analysis in R/qtl (Table 2), using 1,000 permutations to establish the threshold levels
for significance. Results indicated that none of the loci interacted (lod.int for all 3 pairings, not
significant). However, the main effects of both Moaq1 and Moaq2 were independently additive
with aln. The additive effect of Moaq1 and aln was highly significant (lod.add = 9.13) and that
Table 2. Summary of QTL effects.
Locus LOD VE (%) "LOD "VE (%)
Moaq1 (Chr 4) 6.1 25.1 – –
Moaq2 (Chr 6) 4.7 20.1 – –
Ttc21b (Chr2) 4.0 17.1 – –
Moaq1 +29.1 35.2 + 3.05 �+ 10.1
Moaq1 +Ttc21b 9.9 37.4 + 3.79 �+ 12.3
Moaq2 +Ttc21b 7.8 31.0 + 3.09 �+ 10.9
Moaq1 +2+Ttc21b 12.4 44.4 + 3.44 �
, #
+ 9.9
#
LOD scores and phenotypic variance explained (VE) were determined using R/qtl. "LOD and "VE represent the
differences between the respective 1- and 2-loci models, or the 2-and 3-loci models.
�An "LOD score >+3 indicates a significant added contribution to the trait.
#
Difference in LOD score and VE in the 3-loci model is presented as the mean of the three separate comparisons
with their respective 2-loci models.
https://doi.org/10.1371/journal.pgen.1008467.t002
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 5 / 23
for Moaq2 and aln was significant (lod.add = 8.47). Interestingly, main effects of Moaq1 and
Moaq2 were not additive (lod.add = 5.44; significance threshold = 8.29).
We confirmed a correlation between the genetic identity of Moaq1 and Moaq2 and an effect
on forebrain size by comparing the genotype of the peak SNP marker for each QTL with fore-
brain size (Fig 2D and 2F). We first independently assessed F2 mice for genotype at the
peak marker of the Moaq1 locus and found an incremental decrease in brain size among
Ttc21b
aln/aln
-Moaq1
FVB/FVB
animals as compared to Ttc21b
aln/aln
-Moaq1
FVB/B6
or Ttc21b
aln/aln
-
Moaq1
B6/B6
animals (Fig 2D). An overall ANOVA was performed to identify significant differ-
ences among these groups (p<0.0001) followed by a subsequent Tukey’s multiple comparison
test analysis for comparison of each group (Ttc21b
aln/aln
-Moaq2
FVB/FVB
,Ttc21b
aln/aln
-
Moaq2
FVB/B6
and Ttc21b
aln/aln
-Moaq2
B6/B6
) with individual p-values ranging from 0.0145 to
<0.0001 (Fig 2D). To control for a potential litter-based difference, we also compared
only Ttc21b
aln/aln
-Moaq1
FVB/FVB
mutants from litters with Ttc21b
aln/aln
-Moaq1
FVB/B6
or
Ttc21b
aln/aln
-Moaq1
B6/B6
littermates (Fig 2E). Although this analysis necessarily used a smaller
sample size than the non-litter matched comparison (Fig 2D), we again observed a 1.94mm
2
reduction in Ttc21b
aln/aln
-Moaq1
FVB/FVB
animals (p = 0.012).
A similar analysis testing just the Moaq2 locus alone showed a significant variation among
Ttc21b
aln/aln
-Moaq2
FVB/FVB
,Ttc21b
aln/aln
-Moaq2
FVB/B6
and Ttc21b
aln/aln
-Moaq2
B6/B6
animals
(Fig 2F, ANOVA p = 0.0243). However, the subsequent analysis identified less striking differ-
ences between the groups (Fig 2F; p = 0.0255, 0.0547, 0.8654). We again complemented this
with a matched littermate analysis and found Ttc21b
aln/aln
-Moaq2
FVB/FVB
animals had approxi-
mately 20% smaller forebrains than littermates (Fig 2G; p = 0.0101).
Fig 2. QTL analysis. (A) QTL LOD plots with dotted lines displaying genomewide significance scores of p = 0.05 and p = 0.63. (a)
marks the significant QTL peak on chromosome 4, Moaq1, and (b) marks the suggestive Moaq2 peak on chromosome 6. (B)
Chromosome 4 QTL LOD plot and 95% confidence interval shown in red. (C) Chromosome 6 LOD plot and 95% confidence
interval. (D) Analysis of brain size in Ttc21b
aln/aln
homozygous for FVB genome identity, heterozygous for FVB/B6 and homozygous
for B6 genome identity as genotyped by the peak marker for Moaq1. n = 24, 51, 21 sample points. (E) Analysis of brain size only
among littermates in litters with both Ttc21b
aln/aln
-Moaq1
FVB/FVB
and Ttc21b
aln/aln
-Moaq1
FVB/B6 or B6/B6
embryos (n = 15 litters). (F)
Analysis of brain size in animals homozygous for FVB genome identity, heterozygous for FVB/B6 and homozygous for B6 genome
as genotyped by the peak marker for Moaq2. n = 24, 51, 21 sample points. (G) Analysis of brain size only among littermates in litters
with both Ttc21b
aln/aln
-Moaq2
FVB/FVB
and Ttc21b
aln/aln
-Moaq2
FVB/B6 or B6/B6
embryos (n = 6 litters).
https://doi.org/10.1371/journal.pgen.1008467.g002
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 6 / 23
Congenic lines
We produced independent congenic lines to replicate the Moaq1 and Moaq2 loci. We noted in
our original F2 population of 96 mice for the QTL analysis that no Ttc21b
aln/aln
mutants were
homozygous for B6 SNPs over a 10-Mb region on chromosome 14. We hypothesized this rep-
resented a region of the B6 genome that, in combination with homozygosity for the Ttc21b
aln
allele, may lead to either early embryonic lethality and/or exencephaly. Thus, we attempted to
avoid this complication and create FVB congenic lines with Moaq1 and Moaq2 genomic
regions derived from the B6 strain with the hypothesis that the B6 genomic identity of Moaq1
and Moaq2 would increase the size of the Ttc21b
aln/aln
over the size of the congenic FVB
Ttc21b
aln/aln
mutants. B6;FVB-Ttc21b
aln/wt
F1 mice, (obligate heterozygotes across their
genome), were repetitively backcrossed with FVB mice to produce a congenic strain that
approached inbred FVB except for the heterozygous Moaq1 or Moaq2 B6 QTLs (i.e., FVB.Cg-
Moaq1
FVB/B6
and FVB.Cg-Moaq2
FVB/B6
). Mice from each congenic line were then intercrossed
to determine if the B6-derived Moaq1 and/or Moaq2 QTLs could influence forebrain size on
their own. During the process of creating these congenics, we noted that successive genera-
tions of mating onto the FVB background was leading to lethality of Ttc21b
aln/aln
mutants
prior to E17.5 or exencephaly. We observed Ttc21b
aln/aln
mutants on a >99% FVB background
and 21/22 either died prior to E17.5 or had exencephaly precluding measurement of brain size
(Table 1). Note that while we had previously created mice that were largely enriched for FVB,
even as much as 90%, (e.g., Fig 1), the incipient congenics created here for homozygote analy-
sis are the purest FVB-Ttc21b
aln/wt
population created to date. (While creating the mice used
to perform the initial QTL analysis, we had not been intercrossing and dissecting embryos to
create Ttc21b
aln/aln
homozygotes so had not previously identified this effect on the phenotype.)
This suggests a possibility for future work identifying a separate exencephaly modifier from
this population. Given that the increasing incidence of exencephaly precluded an analysis of
forebrain size in the congenic lines (N5 and greater), we analyzed animals from the earlier
backcross generations. Littermate brains were analyzed using paired t-tests to account for
potentially confounding variables, such as length of gestation and/or background differences
based on the generation of backcross. The Moaq1 QTL was found to affect brain size in
FVB;B6-Ttc21b
aln/aln
mutants in the N2 to N5 generations. Ttc21b
aln/aln
-Moaq1
FVB/B6
and
Ttc21b
aln/aln
-Moaq1
B6/B6
animals had larger brains as compared to Ttc21b
aln/aln
-Moaq1
FVB/FVB
(Fig 3A, p = 0.0177), with an average decrease of 2.24mm
2
(Fig 3B). The Moaq2 QTL was also
validated using this strategy and Ttc21b
aln/aln
-Moaq1
FVB/B6
and Ttc21b
aln/aln
-Moaq1
B6/B6
ani-
mals again had larger brains than Ttc21b
aln/aln
-Moaq1
FVB/FVB
(Fig 3C, p = 0.0201), with an
average decrease of 3.40mm
2
(Fig 3D). Thus, we conclude the QTL analysis of just 96 B6;FVB-
Ttc21b
aln/aln
F2 forebrains revealed two validated, novel QTLs that modify the effect of the
Ttc21b
aln/aln
mutation on forebrain size.
Candidate genes for Moaq1 QTL
In order to identify potential candidate causal genes within the ~26.5 Mb Moaq1 QTL, the 253
genes within the 95% confidence interval were analyzed (Fig 4;S3A Table). We initially
focused our analysis on strain-specific missense coding variants. We recognize that this initial
analysis of missense variants, rather than a parallel approach first examining the strain-specific
insertions and/or deletions, introduces some ascertainment bias towards different candidate
genes. We also could include RNA expression analysis of mutants from both background and
look for non-coding regulatory variants within the QTL. However, we initially reasoned that
missense coding variants might be best suited to act as modifiers than more severe protein per-
turbations resulting from insertion/deletion events. We first identified 33 genes with missense
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 7 / 23
polymorphisms when comparing B6 and FVB genomic sequences (S3B Table). The list was
further refined to 21 (S3C Table) by selecting only those genes in which the A/J and FVB SNP
were identical, given the phenotypic similarities in Ttc21b
aln/aln
mutants on those genetic back-
grounds. The remaining missense mutations were analyzed with the SIFT prediction algo-
rithm to assess pathogenicity [29], as well as information on known phenotypes in mouse
models or human disease (OMIM), expression data and other information from the literature
(S3C Table). Four genes were found with predicted deleterious missense mutations (<0.05
SIFT value). We then performed a literature review of these four remaining genes (Table 3,
S3D Table) to identify those previously known to have a role in developmental neurobiology
and narrowed the list to 3 candidates: gamma-glutamyl hydrolase (Ggh, MGI 1329035),G-pro-
tein coupled receptor 63 (Gpr63, MGI 2135884), and origin recognition complex subunit 3
(Orc3, MGI 1354944).Ggh is a lysosomal enzyme with a role in folate metabolism, which is
provocative given the exencephaly noted in Ttc21b
aln/aln
mutants [30]. Furthermore, Ggh is the
only gene in the interval with 2 potentially deleterious missense mutations. Orc3 is a nuclear
localized component of the Origin Recognition Complex [31,32]. While conditional ablation
Fig 3. Congenic line validation of Moaq1 and Moaq2.(A) Forebrain size from Ttc21b
aln/aln
-Moaq1
FVB/FVB
(FVB/
FVB) and Ttc21b
aln/aln
-Moaq1
FVB/B6 or B6/B6
(FVB/B6 or B6/B6). (B) The amount of forebrain reduction in (FVB/B6 or
B6/B6)–(FVB/FVB) brain sizes shows an average decrease of 2.24mm
2
. (C,D) Parallel analyses for Moaq2 animals are
shown.
https://doi.org/10.1371/journal.pgen.1008467.g003
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 8 / 23
of Orc3 in the brain revealed a requirement in proper neural progenitor and radial glial devel-
opment, germline loss of Orc3 led to early embryonic lethality [33]. We next considered any
evidence for these remaining candidate genes within the Moaq1 QTL to have a role in primary
cilia biology. Unlike Ggh or Orc3,Gpr63 is a membrane protein, making it the more attractive
candidate to be a modifier of a mutation in a plasma membrane-based organelle, the primary
cilium. An siRNA screen to identify novel regulators of ciliogenesis in vitro did provide some
evidence Gpr63 may have a role in cilia biology [34]. Gpr63 has been reported to have brain-
specific expression and to be enriched in the forebrain [35,36]. The predicted deleterious poly-
morphic SNP within Gpr63 (rs13477613; NM_030733 c.G1635T; NP_109658 p.R407S; SIFT
Fig 4. An outline of the analysis leading to the hypothesis Gpr63 is a causal gene in the Moaq1 interval.
https://doi.org/10.1371/journal.pgen.1008467.g004
Table 3. Candidate Moaq1 variants.
Gene Location
(Mb)
dbSNP TRANSCRIPT NUCLEOTIDE
CHANGE
AMINO ACID
CHANGE
Mutation Prediction
(SIFT)
Other Information
Ggh 19,981,227 rs46439394 NM_010281.2 A496G D125G Deleterious Involved in folate metabolism
Ggh 19,992,949 rs16796754 NM_010281.2 T1017G F299V Deleterious
Gpr63 24,935,645 rs13477613 NM_030733.3 G1635T R407S Deleterious Adult forebrain expression
Orc3 34,544,654 rs27788317 NM_01159563.1 G667C A212P Deleterious Null allele early embryonic lethal
Zfp292 34,755,239 rs13477642 NM_013889.2 T5097C C1690R Low Confidence
Deleterious
Possible embryonic forebrain
expression
https://doi.org/10.1371/journal.pgen.1008467.t003
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 9 / 23
score of 0.01) is a missense variant altering the coding of amino acid 407 from Arginine, an
amino acid with an electrically charged side chain, in the B6 reference genome to Serine, an
amino acid with a polar uncharged side chain, in the A/J and FVB genomes (Table 3). This
Arginine residue is conserved from frogs to chimpanzees (Fig 5A), although humans have a
Lysine at the orthologous residue in GPR63, an amino acid with an electrically charged side
chain like Arginine. The loss of Arginine from the mouse GPR63 cytoplasmic tail alters a pre-
dicted RxR endoplasmic reticulum (ER) retention signal (Fig 5) [37]. The C-terminus of
GPCRs is understood to play critical roles in protein-protein interactions and regulation of the
receptor [38]. As shown in Fig 6A, the c.G1635T SNP changes the amino acid sequence of the
coat protein complex I (COPI) binding sequence. COPI is a coatomer responsible for the ret-
rograde transport of vesicles from the trans-Golgi network to the cis-Golgi and from the cis-
Golgi to the ER [39,40]. COPI has been implicated in the retrieval of proteins with exposed
RxR motifs [41,42]. These motifs function to retain proteins in the ER until the RxR contain-
ing protein is completely processed and ready to be transported out through the Golgi [37].
Often these proteins escape the RxR retrieval mechanism by masking the motif through inter-
action with another protein, a critical step in preparing the protein for its function which may
include assembling a hetero-multimeric complex [37]. There are candidate motifs for protein
domain interactions on the GPR63 C-tail which could serve in this masking role including:
LPRLPGH, a predicted SH3 binding motif of DLG4, and EHRTV, a predicted PDZ binding
domain of RGS3 [43–46]. We also note a BBSome binding motif which may serve as a poten-
tial ciliary targeting sequence [47].
CRISPR-Cas9 genome editing of Gpr63
A standard approach to reduce the number of candidate genes within a QTL is to narrow the
genetic interval carrying the trait of interest using meiotic recombination. For this, QTL-inter-
val specific recombinants are identified and overlapping sub-congenics produced and tested to
determine the minimal region of effect. This process can be repeated as needed to critically
narrow the candidate interval. We initially pursued this strategy, but the results above show
that the combination of exencephaly and early lethality of congenic FVB.Cg-Ttc21b
aln/aln
mice
will preclude successful implementation unless we could also identify the region contributing
to the exencephaly.
An alternative approach is to directly test hypotheses about candidate sequence variant(s)
with genome editing to create novel transgenic models. We chose to pursue this and targeted
FVB mice to change the rs13477613 polymorphism from FVB sequence (c.1635-T; coding
for Gpr63
Ser(FVB)
) to the reference, non-pathogenic, B6 sequence (c.1635-G; coding for
Gpr63
Arg(B6)
). This allele Gpr63
em1Rstot
, is hereafter referred to as FVB-Gpr63
Arg(B6)
. An added
benefit of CRISPR-Cas9 genome editing is the potential to recover an allelic series from the ini-
tial set of transgenic founders. We recovered and maintained a second allele Gpr63
em2Rstot
(Gpr63
Del
), with an 8-bp deletion resulting in a frameshift mutation that leads to the transla-
tion of 5 missense amino acids and an early stop, thus preventing translation of the last 21
amino acids of the GPR63 C-terminus (Fig 6A). This Gpr63
Del
mutation may disrupt both an
ER retention signal and an RGS3 PDZ binding motif, creating a potentially more deleterious
mutation than Gpr63
Ser(FVB)
[37,43–46].
We first determined that the Gpr63
Arg/Ser
polymorphism did not affect survival or brain
size at E17.5 (Fig 7A, ANOVA p = 0.1743). We also did not see an effect at postnatal day (P) 42
on either forebrain dorsal surface, brain weight or total body weight (Fig 7B–7D, ANOVA
p = 0.9639, 0.7753, 0.9420, respectively). This was expected, given that these are sequence poly-
morphisms found between two commonly maintained inbred strains. We hypothesized the
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 10 / 23
Fig 5. Gpr63 is a conserved gene. Amino acid sequence of GPR63 from multiple species and three inbred strains of
mice. Invariant amino acids are indicated with �. Shading indicates amino acids composing four putative functional
domains in the cytoplasmic tail of GPR63.
https://doi.org/10.1371/journal.pgen.1008467.g005
Fig 6. CRISPR-Cas9 alleles of Gpr63.(A) Nucleotide sequence and Sanger sequencing of Gpr63 in the B6/reference
strain and FVB strain with the c.G1635T SNP. Gpr63
Arg(B6)
is the FVB mouse line with the B6 Thymidine at Gpr63
c.1635. Gpr63
Del
is an 8-bp deletion in the same region of Gpr63. (B) Amino acid sequence of the above lines showing
the R407S polymorphism between B6 (Arg) and FVB (Ser) reverted to B6 (Arg) in the CRISPR transgenic, and the
missense mutation and premature truncation in the Gpr63
Del
allele.
https://doi.org/10.1371/journal.pgen.1008467.g006
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 11 / 23
Gpr63
Del
allele may be more deleterious than the Gpr63
Ser(FVB)
polymorphism alone. We first
determined if this allele affects survival and created animals homozygous for the Gpr63
Del
allele. We recovered Gpr63
Del/Del
mutants in approximately Mendelian ratios at weaning (8/
35) and they survived to adulthood (n = 8) with no discernible phenotypes seen to date. We
measured forebrain dorsal surface, brain weight and body weight at both E17.5 and P42 and
found no change in the Gpr63
Del/Del
mutants (Fig 7E–7L; ANOVA p = 0.2569, 0.6846, 0.6344,
0.6655, respectively). Consistent with the predicted deleterious effects of the SNP at amino
acid 407 seen in both viable and fertile FVB and A/J animals, this suggests that Gpr63 does not
have an essential requirement in development.
Fig 7. Gpr63 alleles do not affect survival or overall brain size and morphology. (A-D) Animals with Gpr63
407Arg/Arg
,
Gpr63
407Arg/Ser
, or Gpr63
407Ser/Ser
do not vary in forebrain area at E17.5 (A) or at P42 in forebrain area (B), brain weight (C) or
overall body weight (D). (E-L) Animals homozygous for the cytoplasmic deletion of Gpr63 (Gpr63
Del/Del
) also have
morphologically normal brains at E17.5 (E,F) and P42 (G,H). (I) Forebrain area at E17.5 is unaffected. At P42, forebrain area
(J), brain weight (K) and overall body weight (L) are unaffected by the deletion allele. Scale bars indicate 2mm in E,F and
5mm in G,H.
https://doi.org/10.1371/journal.pgen.1008467.g007
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 12 / 23
Gpr63 expression in vitro shows ciliary localization
We directly tested the hypothesis that Gpr63 might, at least partially, localize to the primary cil-
ium by measuring in vitro expression of a myc-flag-epitope tagged construct in NIH 3T3 cells
(pCMV6-GPR63-myc). Indeed, we found colocalization of the GPR63 signal with Arl13b as a
marker of the ciliary axoneme (Fig 8A–8C). We were not able to identify a completely reliable
antibody to verify these findings, but saw similar results from an independent GPR63 expres-
sion construct (GPR63-TANGO-FLAG [48], S2 Fig). Site-directed mutagenesis was used to
generate constructs recapitulating the variants seen in vivo (Fig 8D–8I). Overexpression of
either polymorphism of Gpr63 or the Gpr63-deletion construct did not affect the proportion of
ciliated cells (Fig 8M, ANOVA p = 0.067). However, when we expressed either the myc-
Gpr63
Ser
or the myc-Gpr63
Del
construct we saw a reduction in the number of transfected cells
with GPR63 in the primary cilia (Fig 8N, ANOVA p = 0.004). We saw a 65% decrease with
Gpr63
Ser407
as compared with Gpr63
Arg407
(p = 0.011) and a 68% decrease with the Gpr63
Del
construct (p = 0.008). We conclude that the different alleles changing the protein composition
of the GPR63 cytoplasmic tail can alter the subcellular (i.e., ciliary) localization of GPR63.
Alleles of Gpr63 modify Ttc21b
aln/aln
mutant forebrain phenotype
The FVB-Gpr63
Arg(B6)
animals were crossed with FVB.Cg-Ttc21b
aln/wt
(which will have the
FVB allele of Gpr63: Gpr63
Ser(FVB)
)mice to produce FVB.Cg-Ttc21b
aln/wt
;Gpr63
Arg(B6)/Ser(FVB)
double heterozygotes. This cross was designed to directly test the hypothesis that the predicted
pathogenic polymorphism of Gpr63 (i.e., Ser407)contributes to the more severe microcephaly
seen in FVB.Cg-Ttc21b
aln/aln
homozygous mutants. However, we were unable to directly test
this hypothesis. As this experiment was done concurrently with the backcrosses to produce
FVB congenic lines described above, we also found that both FVB.Cg-Ttc21b
aln/aln
;FVB.
Gpr63
Arg(B6)/Arg(B6)
and FVB.Cg-Ttc21b
aln/aln
;FVB.Gpr63
Ser(FVB)/Ser(FVB)
mice have exencephaly
at a high frequency precluding measurement of forebrain size in these animals.
In order to test for a genetic interaction between Gpr63 and Ttc21b, we created FVB.Cg-
Ttc21b
aln/wt
-Gpr63
Del/Ser(FVB)
mice and crossed these with B6.Cg-Ttc21b
aln/wt
(with no modifi-
cation of the Gpr63 locus, e.g., B6.Cg-Ttc21b
aln/wt
-Gpr63
Arg(B6)/Arg(B6
). We hypothesized that
reduced GPR63 function in the resulting F1 FVB;B6-Ttc21b
aln/aln
;Gpr63
Del/Arg(B6)
embryos as
compared to F1 FVB;B6-Ttc21b
aln/aln
-Gpr63
Ser(FVB)/Arg(B6)
will lead to a smaller forebrain in
the F1 FVB;B6-Ttc21b
aln/aln
-Gpr63
Del/Arg(B6)
animals (i.e., deletion of the GPR63 cytoplasmic
tail is more deleterious than a single Ser/Arg amino acid change). Indeed, F1 FVB;B6-
Ttc21b
aln/aln
-Gpr63
Del/Arg(B6)
mice had an approximate 25% decrease in forebrain area (Fig 9;
-2.30 mm
2
; n = 15 and n = 6; p = 0.0019). This experiment demonstrates that alleles of Gpr63
can modify the Ttc21b
aln/aln
forebrain phenotype and supports the conclusion that Gpr63
genetically interacts with Ttc21b.
To further address a possible interaction between Ttc21b and Gpr63, we aimed to create
Ttc21b
aln/aln
;Gpr63
Del/Del
double homozygous mutant animals. Note this experiment was done
in a way that necessitated crosses with differing mixtures of the FVB and B6 background.
Therefore, the Gpr63;Ttc21b double mutant analysis is best considered on a hybrid back-
ground with Gpr63 alleles being the only relevant variable. We recovered 8 Ttc21b
aln/aln
;
Gpr63
Del/Del
embryos at E17.5 and E18.5 from this cross and found that 75% (6/8) were embry-
onic lethal and had died around E12.5. The remaining two had exencephaly precluding mea-
surement of forebrain area.
We further explored this phenotype at ~E12.5 (E10.5–14.5) and recovered 9 Ttc21b
aln/aln
-
Gpr63
Del/Del
double homozygous null embryos (Fig 10F). We saw many of the phenotypes pre-
viously noted in our studies of Ttc21b
aln/aln
mutants. These included 89% (8/9) with
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 13 / 23
exencephaly, and 100% with polydactyly in both the forelimb and hindlimb (9/9). Surprisingly,
we also noted phenotypes never seen in any Ttc21b
aln/aln
mutant. One of the double mutant
embryos had quite dramatic spina bifida aperta (Fig 10G), a severe neural tube defect. 62.5%
(5/8) of the remaining embryos had morphology consistent with the considerably milder spina
bifida occulta. Both of the previously mentioned ~E17.5 double mutant embryos also had obvi-
ous spina bifida occulta (Fig 10J). We then rigorously examined all the embryos recovered
from this cross for spinal neural tube defects (NTD) as this is not a phenotype we had seen in
previous analyses of the Ttc21b
aln/aln
mutants [16,19]. We did not note any spinal NTDs in
Gpr63
Del/Del;
Ttc21b
wt/wt
(Fig 10B; n = 5) or Gpr63
Del/Del;
Ttc21b
aln/wt
embryos (Fig 10D;
n = 13). In Gpr63
wt/wt;
Ttc21b
aln/aln
embryos, we did note a previously unappreciated thickened
neural tissue in one mutant from E10-E14 (Fig 10C; n = 1/9), and a disruption of the overlying
ectoderm possibly consistent with spina bifida occulta from E15-17 (Fig 10H; n = 1/4). Based
on our previous studies with the Ttc21b
aln/aln
mutant where the NTDs were not noticed in
studies performed on similar genetic backgrounds, we believe these to be relatively uncommon
phenotypes in mice with just the Ttc21b
aln
allele [16,19]. Gpr63
Del/wt;
Ttc21b
aln/aln
embryos
with an additional deleterious Gpr63 allele however, showed a significantly increased incidence
of NTDs (Fig 10E and 10I, n = 7/14). However, we never see the spina bifida aperta phenotype
in embryos other than Gpr63
Del/Del;
Ttc21b
aln/aln
double mutants. Even in this genotype, we
have seen it once in this study. We therefore suggest it is a relatively rare phenotype, but is still
restricted to the Gpr63
Del/Del;
Ttc21b
aln/aln
double mutant genotype.
Fig 8. Ciliary localization is altered by overexpression of Gpr63 variants. NIH 3T3 cells were transfected to overexpress
Gpr63
Arg407
(A-C), Gpr63
Ser407
(D-F) or Gpr63
Del
(G-I) constructs. ARL13B was used as a marker of the ciliary axoneme.
(J-L) An untransfected immunocytochemistry control is shown. Small panels show higher magnification of cells
highlighted by white boxes to show cilia with robust, no, or little GPR63 immunoreactivity. (M) Expression of Gpr63 did
not appear to affect the number of cells producing cilia. (N) Gpr63
Ser407
and Gpr63
Del
constructs result in reduced ciliary
accumulation of the epitope-tagged GPR63. Scale bars represent 20μm in A-L and 5μm in the inset panels.
https://doi.org/10.1371/journal.pgen.1008467.g008
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 14 / 23
Fig 9. Gpr63 alleles affect forebrain area in Ttc21b
aln/aln
mutants. Forebrain area in FVB;B6-Ttc21b
aln/aln
;Gpr63
Arg(B6)/Ser(FVB)
E17.5
embryos (n = 16) is larger than FVB;B6-Ttc21b
aln/aln
-Gpr63
Del/Arg(B6)
animals (n = 6), p = 0.0019.
https://doi.org/10.1371/journal.pgen.1008467.g009
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 15 / 23
Thus, we conclude that an allele of Gpr63 with a truncation of the cytoplasmic tail geneti-
cally interacts with Ttc21b, such that double mutants are mostly embryonic lethal at stages
prior to any lethality seen in either single mutant. The remaining animals have an increased
incidence of NTDs unique from either single mutant. The mechanism(s) leading to this lethal-
ity will be the subject of future study. We further suggest that Gpr63 is likely to be a causal gene
within the Moaq1 QTL and reduced function of GPR63 in the FVB and A/J genetic back-
grounds leads to the more severe forebrain phenotype of the Ttc21b
aln/aln
homozygous
mutants on these backgrounds, as compared to those recovered on a B6 inbred background.
Discussion
In this study, we sought to understand the genetic basis for the influence of mouse inbred
strain background on the severity of the Ttc21b
aln/aln
homozygous mutant microcephaly phe-
notype. Our QTL analysis identified two loci (Moaq1,Moaq2) which interact with Ttc21b to
control brain size in Ttc21b
aln/aln
mutants. These were validated by constructing QTL-contain-
ing congenic lines for each. The 95% confidence interval of Moaq1 was small enough to allow
a candidate gene approach, and Gpr63 was selected for further study. Experiments directly
testing Gpr63 function with novel mouse alleles generated with CRISPR-Cas9 genome editing
support our hypothesis that reduced Gpr63 function further compromises embryos lacking
functional Ttc21b. We further demonstrated that Gpr63;Ttc21b double mutants had earlier
lethality than either single mutant as well as novel spina bifida phenotypes.
Meiotic recombination or genome editing
Traditionally, the identification of a QTL is followed by a laborious mapping process and the
creation of congenic strains to validate the QTL and begin to hunt for the truly causal sequence
difference [49,50]. The combination of deeply sequenced inbred mouse strains, combined
with the capabilities conferred by new genome editing tools such as CRISPR-Cas9 to rapidly
Fig 10. Gpr63
del/del
;Ttc21b
aln/aln
double mutants have increased incidence of neural tube defects. Embryos of
multiple genotypes from a Gpr63
del/wt
;Ttc21b
aln/wt
intercross are shown at stages from E10-14 (A-G, K) or E15-17
(H-J). Gpr63
del/del
;Ttc21b
aln/aln
double mutants do not survive to term and show multiple phenotypes which are more
severe than either single mutation including spina bifida aperta (G). (L) Incidence of neural tube closure defects of any
severity in the embryos resulting from the Gpr63
del/wt
;Ttc21b
aln/wt
intercross. Note the dramatic increase in penetrance
in double mutants (8/11) as compared to any other genotype.
https://doi.org/10.1371/journal.pgen.1008467.g010
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 16 / 23
generate sequence specific alterations in novel mouse lines, can potentially greatly facilitate the
identification of causal genetic variants within a QTL. In this case, we identified a potentially
deleterious SNP in Gpr63 on the FVB and A/J genetic backgrounds which may cause reduced
function as compared to the canonical sequence seen in B6 mice. We did pursue a traditional
congenic backcross approach by continued backcrossing to FVB towards creating a true con-
genic line which would be “pure” FVB with only dilution by the Ttc21b
aln
locus itself and the
B6 Moaq1 region. However, this was confounded by the increased incidence of exencephaly
and/or early embryonic lethality seen in Ttc21b
aln/aln
mutants when maintained on the >90%
FVB genetic background. Presumably this increased frequency in exencephaly and/or death
was due to the remaining 10% of the heterozygous genome that was further purified to FVB
during this backcrossing. This is an intriguing finding that could potentially facilitate mapping
those modifiers independently. In parallel, we attempted to bypass the meiotic recombination
and QTL refinement entirely by recreating the specific Gpr63 SNP and determining if it
affected brain size in the Ttc21b mutant background. In the F2 recombinants generated for the
QTL analysis, we did not recover embryos both without exencephaly and homozygosity for B6
at a region on chromosome 14. This suggested to us that the Ttc21b
aln
allele on a pure B6 back-
ground may be early embryonic lethal; therefore, we chose to test our Gpr63 hypothesis by cre-
ating the B6 SNP on an FVB background (FVB Gpr63
Arg(B6)/Ser(FVB)
). Further study has shown
this lack of homozygosity on chromosome 14 was a statistical anomaly with no apparent bio-
logical significance as we have since recovered Ttc21b
aln/aln
mutants with B6 identity across
this region. In contrast, the consequences of creating a pure inbred FVB strain with the Ttc21b
allele was a strain with a high incidence of exencephaly preventing us from testing this Gpr63
hypothesis directly. We are now carrying out a further validation of the Moaq1 and Moaq2
QTL by constructing pure B6 congenics with FVB Moaq1 and Moaq2 intervals.
Gpr63 can localize to the primary cilia but is not essential for development
Our data suggest that the predicted deleterious Gpr63
407Arg(B6)/Ser(FVB)
SNP is not essential for
development. This is consistent with the fact this SNP is present in the reference sequence for
A/J and FVB mice. Furthermore, the deletion of the extreme C-terminus of the GPR63 GPCR
also did not seem to have an effect on survival (Fig 7). This is consistent with data from the
International Mouse Phenotyping Consortium and Knockout Mouse Project that Gpr63 dele-
tion alleles do not affect survival (https://www.mousephenotype.org/data/genes/
MGI:2135884).
We did use two different epitope-tagged expression constructs to demonstrate GPR63 at
least partially localizes to the primary cilium (Fig 8). This is consistent with the BBSome bind-
ing motif located in the C-terminus. We further studied the ciliary localization of different
alleles of Gpr63 in these overexpression experiments and have provided evidence that the Arg/
Ser transition and the cytoplasmic truncation reduced ciliary localization of GPR63 (Fig 8).
Neither of these residues affect the presumed BBSome binding motif, suggesting that other res-
idues contribute to the ciliary targeting of GPR63 through currently unknown mechanisms.
The detailed analysis of this trafficking motif and potential physical interaction with TTC21B
should be the subject of future study.
Gpr63 and Ttc21b genetic interactions
The alleles we generated with CRISPR-Cas9 editing did allow us to demonstrate a genetic
interaction between Gpr63 and Ttc21b. The confounding effects of FVB genetic purity on
exencephaly and the apparent chromosome 14 lethality interval did hamper some of the ini-
tially designed experiments. However, the truncated Gpr63 allele we recovered from our
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 17 / 23
CRISPR-Cas9 studies allowed us to address this hypothesis and we do see that Ttc21b
aln/aln
;
Gpr63
Del/Arg(B6)
embryos have smaller forebrain tissues when compared to Ttc21b
aln/aln
;
Gpr63
Ser(FVB)/Arg(B6
(Fig 9). The best evidence for a genetic interaction between Gpr63 and
Ttc21b, however, is the novel phenotypes seen in the Ttc21b
aln/aln
;Gpr63
Del/Del
embryos. The
lethality of these embryos is earlier than what we observed in Ttc21b
aln/aln
mutants and we
have never previously seen some of the spina bifida phenotypes observed in the Ttc21b
aln/aln
;
Gpr63
Del/Del
embryos.
Here we identify regions of the genome linked to the differential effect of inbred strain
background on the severity of the microcephaly phenotype seen in Ttc21b
aln/aln
mutants. We
follow this up with a new allelic series of Gpr63 and experiments in vitro and in vivo to demon-
strate these polymorphisms do affect Ttc21b phenotypes and Gpr63 function. Although loss of
Gpr63 alone does not seem to cause a significant phenotype, this work suggests Gpr63 may be
a risk factor underlying some of the variability seen in the ciliopathies. The approach taken
here may be quite useful in understanding modifier effects in any number of structural birth
defects.
Materials and methods
Ethics statement
All animals were housed under a protocol approved by the CCHMC Institutional Animal Care
and Use Committee (#2016–0098) in standard conditions. All euthanasia and subsequent
embryo or organ harvests were preceded by Isoflurane sedation. Euthanasia was accomplished
via dislocation of the cervical vertebrae.
Animal husbandry
For embryo collections, noon of the day of vaginal plug detection was designated as E0.5. The
Ttc21b
aln
allele used in this study has been previously published [16]. Ttc21b
aln
mice were seri-
ally backcrossed to C57BL/6J (JAX:000664) and FVB/NJ (JAX:001800) mice to produce strain
specific Ttc21b
aln
mice. Genotyping was performed by PCR, Sanger Sequencing, or Taqman
assays (S4 Table).
Forebrain surface area measurement
Brains were microdissected from embryos and photographed prior to fixation from the dorsal
aspect on a Zeiss Discovery.V8 dissecting microscope. Zeiss Axiovision software was used to
mark the boundaries of the cortical surface area for all brain examined, as shown in S1 Fig.
Cortical surface area was quantified by the Zeiss Axiovision software and recorded. All images
used to quantify surface area for the QTL analysis were taken on the same microscope at the
same magnification.
QTL analysis
GigaMUGA and MegaMUGA genotyping of recombinants was performed by GeneSeek (Neo-
gen; Lincoln, NE). Quality and intensity normalization of the SNP data was checked using rou-
tines provided in the R-package Argyle [51]. Linkage mapping, including scanone and
scantwo analyses, was performed on informative SNP markers and brain sizes (mm
2
) of
ninety-six F
2
recombinants using the R/qtl software package (Broman 2003; Broman and Sen
2009). Threshold levels of significance were established using at least 1,000 permutations of the
respective dataset.
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 18 / 23
Coding differences of candidate genes were compared using the Mouse Genomes Project
website from Wellcome Sanger Trust Institute (https://www.sanger.ac.uk/sanger/Mouse_
SnpViewer/rel-1211, NCBIm37).
CRISPR-Cas9 genome editing
Donor oligonucleotide and guide RNA vector sequences were designed using Benchling
(Benchling, 2016). sgRNAs were validated using Benchling and CRISPRscan with the follow-
ing scores: Benchling-48.5 and CRISPRscan-49 (Benchling, 2016) (Moreno-Mateos, et al.,
2015). The donor oligonucleotide was supplied by Integrated DNA Technologies (sequence
with lower case letters representing coding change: CCATAATCGCTCGATATGTTTCA
AGAGTTCGGTATTCACAACACCGTCCGATGTTCCCCACACACGTAGACGGCAC
TAGGGCGAATgCGTCGcCTTGTaTGcCCgGGGAGCCGTGGCAAGAACT. The sgRNA
(sequence: TCCCTGGTCACACAAGTCGA) was synthesized and injected into FVB mouse
zygotes together with donor oligonucleotide by the CCHMC Transgenic Animal and Genome
Editing Core. Gpr63 mice were made by injection into FVB zygotes. The male founder mice
were genotyped and those with evidence of edited GPR63 loci were bred to FVB-Ttc21b
aln/wt
females. Offspring were analyzed by PCR and Sanger sequencing of approximately 1000 base
pairs of the Gpr63 locus around the sgRNA recognition sequence. Initial crosses were designed
to rapidly assess the hypothesized interaction between Gpr63 and Ttc21b. Carriers for the SNP
allele (Gpr63
Arg(B6)
) were maintained by further breeding to FVB-Ttc21b
aln/wt
females to
immediately ascertain an effect on brain size. These were then further maintained on FVB to
characterize the Gpr63 phenotype in isolation. Carriers for the Gpr63
Del
allele were also bred to
FVB-Ttc21b
aln/wt
(for at least two generations). In order to compare Gpr63
Arg
with the Gpr63
Del
allele, Gpr63
Del
;FVB-Ttc21b
aln/wt
mice heterozygous for both alleles were crossed to B6 wild-
type mice.
Cell culture and transfection
A pCMV6-GPR63-myc (Origene, Rockville, MD) or GPR63-TANGO-FLAG [48] (Addgene.
org) expression plasmid was transfected into NIH 3T3 cells at ~80% confluency using Lipofec-
tamine 3000 and incubated for 2–3 days. The pCMV6-GPR63-myc plasmid has a myc-DDK
tag at the C-terminus of human GPR63 driven by a CMV promoter in the pCMV6 expression
vector. GPR63-TANGO-FLAG is a plasmid designed to express human GPR63 with an N-ter-
minal FLAG tag under the control of a CMV promoter from a Tango vector [48]. Mutations
were made to the pCMV6-GPR63-myc expression plasmid to mimic the Gpr63
Ser
and
Gpr63
Del
mouse alleles (Genscript, Piscataway, NJ). To induce ciliogenesis, cells were grown to
confluency and serum starved. Immunocytochemistry was performed with a mouse anti-myc
(Sigma M4439; 1:500), mouse anti-FLAG (Sigma F3165; 1:500), rabbit anti-Arl13b (Protein-
tech17711-1-AP; 1:500), and anti-mouse acetylated-tubulin (SIGMA T6793; 1:2000) antibod-
ies to detect cilia and GPR63 localization. Secondary antibodies were Alexa Fluor-488, Alexa
Fluor-594 Goat anti-mouse/rabbit (Invitrogen, A11001, A20980; 1:500). Confocal imaging was
performed on a Nikon C2 system and analysis was performed with Nikon Elements software.
Analysis of localization of GPR63-myc was done with Imaris 6.2.1 software. First, a surface
overlying cilia axonemes labeled with Arl13b was initiated in the 488 channel, then another
surface was initiated in the 596 channel to detect the cilia labeled with myc and flag. Finally,
the MATLAB plugin surface-surface colocalization was utilized to detect the areas of colocali-
zation between Arl13b stained cilia and myc-flag tagged cilia axoneme. The number of double
labeled cilia were normalized against the total number of Arl13b stained cilia per field of view.
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 19 / 23
Statistical analysis and One-way ANOVA was performed using GraphPad Prism software. All
samples were blinded to the investigator performing the analysis.
GPR63 protein domain analysis
Features of the GPR63 protein were identified through literature searches and the Modular
Domain Peptide Interaction Server: http://modpepint.informatik.uni-freiburg.de/.
Statistical analysis
GraphPad Prism was used for all graphical analysis. Data are shown as mean ±95% confidence
interval unless otherwise noted. P values are explicitly stated in almost every instance, rather
than asserting significance at a certain conventional threshold (e.g., p = 0.05). Fig 1G: Two-way
ANOVA followed by unpaired t-test of each strain wild-type vs mutant; Figs 2D, 2F,7A–7D,
7I–7L and 7O: One-way ANOVA followed by Tukey’s multiple comparisons when ANOVA
indicates significance; Figs 2E, 2G and 3–paired student t-test; Fig 9 –unpaired students t-test.
Supporting information
S1 Fig. Area measured to determine brain size. Shaded area in B indicates area from brain in
A measured as “forebrain area”.
(TIF)
S2 Fig. GPR63-TANGO-FLAG expression. Transfection of a second GPR63-TANGO-FLAG
expression plasmid [48] indicates ciliary localization similarly to the results with
pCMV6-GPR63-myc.
(TIF)
S1 Table. Genome-wide SNP data. Genome-wide SNP data to determine background purity;
used for initial congenic FVB and B6 strains carrying Ttc21b
aln
allele.
(XLSX)
S2 Table. Genome survey and brain size of F2 mutants. GigaMuga data and brain size of 96
F2 mutants used for initial QTL analysis.
(XLSX)
S3 Table. Analysis of candidate genes within Moaq1 QTL.
(XLSX)
S4 Table. Genotyping primers used in this study.
(XLSX)
Author Contributions
Conceptualization: John Snedeker, Zakia Abdelhamed, Daniel R. Prows, Rolf W. Stottmann.
Data curation: John Snedeker, David F. Paulding, Zakia Abdelhamed, Rolf W. Stottmann.
Formal analysis: John Snedeker, William J. Gibbons, Jr., David F. Paulding, Daniel R. Prows.
Funding acquisition: Daniel R. Prows, Rolf W. Stottmann.
Investigation: John Snedeker, William J. Gibbons, Jr., David F. Paulding, Zakia Abdelhamed,
Daniel R. Prows, Rolf W. Stottmann.
Methodology: John Snedeker, Rolf W. Stottmann.
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 20 / 23
Project administration: John Snedeker, Daniel R. Prows, Rolf W. Stottmann.
Supervision: Rolf W. Stottmann.
Validation: Zakia Abdelhamed.
Visualization: John Snedeker, Zakia Abdelhamed, Daniel R. Prows, Rolf W. Stottmann.
Writing – original draft: John Snedeker, Daniel R. Prows, Rolf W. Stottmann.
Writing – review & editing: John Snedeker, William J. Gibbons, Jr., David F. Paulding, Zakia
Abdelhamed, Daniel R. Prows, Rolf W. Stottmann.
References
1. Guemez-Gamboa A, Coufal NG, Gleeson JG. Primary cilia in the developing and mature brain. Neuron.
2014; 82(3):511–21. Epub 2014/05/09. https://doi.org/10.1016/j.neuron.2014.04.024 PMID: 24811376.
2. Valente EM, Rosti RO, Gibbs E, Gleeson JG. Primary cilia in neurodevelopmental disorders. Nat Rev
Neurol. 2014; 10(1):27–36. Epub 2013/12/04. https://doi.org/10.1038/nrneurol.2013.247 PMID:
24296655.
3. Goetz SC, Anderson KV. The primary cilium: a signalling centre during vertebrate development. Nat
Rev Genet. 2010; 11(5):331–44. Epub 2010/04/17. https://doi.org/10.1038/nrg2774 PMID: 20395968.
4. Hildebrandt F, Benzing T, Katsanis N. Ciliopathies. N Engl J Med. 2011; 364(16):1533–43. Epub 2011/
04/22. https://doi.org/10.1056/NEJMra1010172 PMID: 21506742.
5. Wheway G, Mitchison HM. Opportunities and Challenges for Molecular Understanding of Ciliopathies-
The 100,000 Genomes Project. Front Genet. 2019; 10:127. Epub 2019/03/28. https://doi.org/10.3389/
fgene.2019.00127 PMID: 30915099.
6. Wang L, Dynlacht BD. The regulation of cilium assembly and disassembly in development and disease.
Development. 2018; 145(18). Epub 2018/09/19. https://doi.org/10.1242/dev.151407 PMID: 30224385.
7. Badano JL, Mitsuma N, Beales PL, Katsanis N. The ciliopathies: an emerging class of human genetic
disorders. Annu Rev Genomics Hum Genet. 2006; 7:125–48. Epub 2006/05/26. https://doi.org/10.
1146/annurev.genom.7.080505.115610 PMID: 16722803.
8. Han YG, Alvarez-Buylla A. Role of primary cilia in brain development and cancer. Curr Opin Neurobiol.
2010; 20(1):58–67. Epub 2010/01/19. https://doi.org/10.1016/j.conb.2009.12.002 PMID: 20080044.
9. Reiter JF, Leroux MR. Genes and molecular pathways underpinning ciliopathies. Nat Rev Mol Cell Biol.
2017; 18(9):533–47. Epub 2017/07/13. https://doi.org/10.1038/nrm.2017.60 PMID: 28698599.
10. Wheway G, Nazlamova L, Hancock JT. Signaling through the Primary Cilium. Front Cell Dev Biol. 2018;
6:8. Epub 2018/02/24. https://doi.org/10.3389/fcell.2018.00008 PMID: 29473038.
11. Schou KB, Pedersen LB, Christensen ST. Ins and outs of GPCR signaling in primary cilia. EMBO Rep.
2015; 16(9):1099–113. Epub 2015/08/25. https://doi.org/10.15252/embr.201540530 PMID: 26297609.
12. Prevo B, Scholey JM, Peterman EJG. Intraflagellar transport: mechanisms of motor action, cooperation,
and cargo delivery. FEBS J. 2017; 284(18):2905–31. Epub 2017/03/28. https://doi.org/10.1111/febs.
14068 PMID: 28342295.
13. Fu W, Wang L, Kim S, Li J, Dynlacht BD. Role for the IFT-A Complex in Selective Transport to the Pri-
mary Cilium. Cell Rep. 2016; 17(6):1505–17. Epub 2016/11/03. https://doi.org/10.1016/j.celrep.2016.
10.018 PMID: 27806291.
14. Hirano T, Katoh Y, Nakayama K. Intraflagellar transport-A complex mediates ciliary entry and retro-
grade trafficking of ciliary G protein-coupled receptors. Mol Biol Cell. 2017; 28(3):429–39. Epub 2016/
12/10. https://doi.org/10.1091/mbc.E16-11-0813 PMID: 27932497.
15. Mukhopadhyay S, Wen X, Chih B, Nelson CD, Lane WS, Scales SJ, et al. TULP3 bridges the IFT-A
complex and membrane phosphoinositides to promote trafficking of G protein-coupled receptors into
primary cilia. Genes Dev. 2010; 24(19):2180–93. Epub 2010/10/05. https://doi.org/10.1101/gad.
1966210 PMID: 20889716.
16. Tran PV, Haycraft CJ, Besschetnova TY, Turbe-Doan A, Stottmann RW, Herron BJ, et al. THM1 nega-
tively modulates mouse sonic hedgehog signal transduction and affects retrograde intraflagellar trans-
port in cilia. Nat Genet. 2008; 40(4):403–10. Epub 2008/03/11. https://doi.org/10.1038/ng.105 PMID:
18327258.
17. Huangfu D, Anderson KV. Cilia and Hedgehog responsiveness in the mouse. Proc Natl Acad Sci U S A.
2005; 102(32):11325–30. Epub 2005/08/03. https://doi.org/10.1073/pnas.0505328102 PMID:
16061793.
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 21 / 23
18. Hui CC, Angers S. Gli proteins in development and disease. Annu Rev Cell Dev Biol. 2011; 27:513–37.
Epub 2011/08/02. https://doi.org/10.1146/annurev-cellbio-092910-154048 PMID: 21801010.
19. Stottmann RW, Tran PV, Turbe-Doan A, Beier DR. Ttc21b is required to restrict sonic hedgehog activity
in the developing mouse forebrain. Dev Biol. 2009; 335(1):166–78. Epub 2009/09/08. https://doi.org/10.
1016/j.ydbio.2009.08.023 PMID: 19732765.
20. Doetschman T. Influence of genetic background on genetically engineered mouse phenotypes. Meth-
ods Mol Biol. 2009; 530:423–33. Epub 2009/03/07. https://doi.org/10.1007/978-1-59745-471-1_23
PMID: 19266333.
21. Mackay TF. Epistasis and quantitative traits: using model organisms to study gene-gene interactions.
Nat Rev Genet. 2014; 15(1):22–33. Epub 2013/12/04. https://doi.org/10.1038/nrg3627 PMID:
24296533.
22. Herron BJ, Lu W, Rao C, Liu S, Peters H, Bronson RT, et al. Efficient generation and mapping of reces-
sive developmental mutations using ENU mutagenesis. Nat Genet. 2002; 30(2):185–9. Epub 2002/01/
31. https://doi.org/10.1038/ng812 PMID: 11818962.
23. Dixon J, Dixon MJ. Genetic background has a major effect on the penetrance and severity of craniofa-
cial defects in mice heterozygous for the gene encoding the nucleolar protein Treacle. Dev Dyn. 2004;
229(4):907–14. Epub 2004/03/26. https://doi.org/10.1002/dvdy.20004 PMID: 15042714.
24. Hide T, Hatakeyama J, Kimura-Yoshida C, Tian E, Takeda N, Ushio Y, et al. Genetic modifiers of otoce-
phalic phenotypes in Otx2 heterozygous mutant mice. Development. 2002; 129(18):4347–57. Epub
2002/08/17. PMID: 12183386.
25. Mukhopadhyay P, Brock G, Webb C, Pisano MM, Greene RM. Strain-specific modifier genes governing
craniofacial phenotypes. Birth Defects Res A Clin Mol Teratol. 2012; 94(3):162–75. Epub 2012/03/01.
https://doi.org/10.1002/bdra.22890 PMID: 22371338.
26. Percival CJ, Marangoni P, Tapaltsyan V, Klein O, Hallgrimsson B. The Interaction of Genetic Back-
ground and Mutational Effects in Regulation of Mouse Craniofacial Shape. G3 (Bethesda). 2017; 7
(5):1439–50. Epub 2017/03/11. https://doi.org/10.1534/g3.117.040659 PMID: 28280213.
27. Morgan AP, Fu CP, Kao CY, Welsh CE, Didion JP, Yadgary L, et al. The Mouse Universal Genotyping
Array: From Substrains to Subspecies. G3 (Bethesda). 2015; 6(2):263–79. Epub 2015/12/20. https://
doi.org/10.1534/g3.115.022087 PMID: 26684931.
28. Broman KW, Sen S. A guide to QTL mapping with R/qtl. Dordrecht: Springer; 2009. xv, 396 p. p.
29. Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein func-
tion using the SIFT algorithm. Nat Protoc. 2009; 4(7):1073–81. Epub 2009/06/30. https://doi.org/10.
1038/nprot.2009.86 PMID: 19561590.
30. Greene ND, Stanier P, Copp AJ. Genetics of human neural tube defects. Hum Mol Genet. 2009; 18
(R2):R113–29. Epub 2009/10/08. https://doi.org/10.1093/hmg/ddp347 PMID: 19808787.
31. Bell SP. The origin recognition complex: from simple origins to complex functions. Genes Dev. 2002; 16
(6):659–72. Epub 2002/03/27. https://doi.org/10.1101/gad.969602 PMID: 11914271.
32. Schneider E, Ryan TJ. Gamma-glutamyl hydrolase and drug resistance. Clin Chim Acta. 2006; 374(1–
2):25–32. Epub 2006/07/25. https://doi.org/10.1016/j.cca.2006.05.044 PMID: 16859665.
33. Ma S, Kwon HJ, Johng H, Zang K, Huang Z. Radial glial neural progenitors regulate nascent brain vas-
cular network stabilization via inhibition of Wnt signaling. PLoS Biol. 2013; 11(1):e1001469. Epub 2013/
01/26. https://doi.org/10.1371/journal.pbio.1001469 PMID: 23349620.
34. Wheway G, Schmidts M, Mans DA, Szymanska K, Nguyen TT, Racher H, et al. An siRNA-based func-
tional genomics screen for the identification of regulators of ciliogenesis and ciliopathy genes. Nat Cell
Biol. 2015; 17(8):1074–87. Epub 2015/07/15. https://doi.org/10.1038/ncb3201 PMID: 26167768.
35. Kawasawa Y, Kume K, Nakade S, Haga H, Izumi T, Shimizu T. Brain-specific expression of novel G-
protein-coupled receptors, with homologies to Xenopus PSP24 and human GPR45. Biochem Biophys
Res Commun. 2000; 276(3):952–6. Epub 2000/10/12. https://doi.org/10.1006/bbrc.2000.3569 PMID:
11027574.
36. Lee DK, George SR, Cheng R, Nguyen T, Liu Y, Brown M, et al. Identification of four novel human G
protein-coupled receptors expressed in the brain. Brain Res Mol Brain Res. 2001; 86(1–2):13–22. Epub
2001/02/13. https://doi.org/10.1016/s0169-328x(00)00242-4 PMID: 11165367.
37. Michelsen K, Yuan H, Schwappach B. Hide and run. Arginine-based endoplasmic-reticulum-sorting
motifs in the assembly of heteromultimeric membrane proteins. EMBO Rep. 2005; 6(8):717–22. Epub
2005/08/03. https://doi.org/10.1038/sj.embor.7400480 PMID: 16065065.
38. Bockaert J, Marin P, Dumuis A, Fagni L. The ‘magic tail’ of G protein-coupled receptors: an anchorage
for functional protein networks. FEBS Lett. 2003; 546(1):65–72. Epub 2003/06/28. https://doi.org/10.
1016/s0014-5793(03)00453-8 PMID: 12829238.
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 22 / 23
39. Duden R. ER-to-Golgi transport: COP I and COP II function (Review). Mol Membr Biol. 2003; 20
(3):197–207. Epub 2003/08/02. https://doi.org/10.1080/0968768031000122548 PMID: 12893528.
40. McMahon HT, Mills IG. COP and clathrin-coated vesicle budding: different pathways, common
approaches. Curr Opin Cell Biol. 2004; 16(4):379–91. Epub 2004/07/21. https://doi.org/10.1016/j.ceb.
2004.06.009 PMID: 15261670.
41. Yuan H, Michelsen K, Schwappach B. 14-3-3 dimers probe the assembly status of multimeric mem-
brane proteins. Curr Biol. 2003; 13(8):638–46. Epub 2003/04/18. https://doi.org/10.1016/s0960-9822
(03)00208-2 PMID: 12699619.
42. Zerangue N, Malan MJ, Fried SR, Dazin PF, Jan YN, Jan LY, et al. Analysis of endoplasmic reticulum
trafficking signals by combinatorial screening in mammalian cells. Proc Natl Acad Sci U S A. 2001; 98
(5):2431–6. Epub 2001/02/28. https://doi.org/10.1073/pnas.051630198 PMID: 11226256.
43. Kundu K, Backofen R. Cluster based prediction of PDZ-peptide interactions. BMC Genomics. 2014; 15
Suppl 1:S5. Epub 2014/02/26. https://doi.org/10.1186/1471-2164-15-S1-S5 PMID: 24564547.
44. Kundu K, Costa F, Backofen R. A graph kernel approach for alignment-free domain-peptide interaction
prediction with an application to human SH3 domains. Bioinformatics. 2013; 29(13):i335–43. Epub
2013/07/03. https://doi.org/10.1093/bioinformatics/btt220 PMID: 23813002.
45. Kundu K, Mann M, Costa F, Backofen R. MoDPepInt: an interactive web server for prediction of modular
domain-peptide interactions. Bioinformatics. 2014; 30(18):2668–9. Epub 2014/05/30. https://doi.org/10.
1093/bioinformatics/btu350 PMID: 24872426.
46. Saksela K, Permi P. SH3 domain ligand binding: What’s the consensus and where’s the specificity?
FEBS Lett. 2012; 586(17):2609–14. Epub 2012/06/20. https://doi.org/10.1016/j.febslet.2012.04.042
PMID: 22710157.
47. Klink BU, Zent E, Juneja P, Kuhlee A, Raunser S, Wittinghofer A. A recombinant BBSome core complex
and how it interacts with ciliary cargo. Elife. 2017; 6. Epub 2017/11/24. https://doi.org/10.7554/eLife.
27434 PMID: 29168691.
48. Kroeze WK, Sassano MF, Huang XP, Lansu K, McCorvy JD, Giguere PM, et al. PRESTO-Tango as an
open-source resource for interrogation of the druggable human GPCRome. Nat Struct Mol Biol. 2015;
22(5):362–9. Epub 2015/04/22. https://doi.org/10.1038/nsmb.3014 PMID: 25895059.
49. Drinkwater NR, Gould MN. The long path from QTL to gene. PLoS Genet. 2012; 8(9):e1002975. Epub
2012/10/11. https://doi.org/10.1371/journal.pgen.1002975 PMID: 23049490.
50. Flint J, Valdar W, Shifman S, Mott R. Strategies for mapping and cloning quantitative trait genes in
rodents. Nat Rev Genet. 2005; 6(4):271–86. Epub 2005/04/02. https://doi.org/10.1038/nrg1576 PMID:
15803197.
51. Morgan AP. argyle: An R Package for Analysis of Illumina Genotyping Arrays. G3 (Bethesda). 2015; 6
(2):281–6. Epub 2015/12/20. https://doi.org/10.1534/g3.115.023739 PMID: 26684930.
Gpr63 is a modifier of Ttc21b microcephaly
PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008467 November 15, 2019 23 / 23
