Content uploaded by Alessandro Catenazzi
Author content
All content in this area was uploaded by Alessandro Catenazzi on Sep 20, 2019
Content may be subject to copyright.
Content uploaded by Alessandro Catenazzi
Author content
All content in this area was uploaded by Alessandro Catenazzi on Sep 17, 2019
Content may be subject to copyright.
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN 1175-5334 (online edition)
Accepted by H. Zaher: 14 Aug. 2019; published: 16 Sept. 2019 129
Zootaxa 4671 (1): 129–138
https://www.mapress.com/j/zt/
Copyright © 2019 Magnolia Press Article
https://doi.org/10.11646/zootaxa.4671.1.10
http://zoobank.org/urn:lsid:zoobank.org:pub:B4441448-ED8F-4690-A2F1-286E911025C2
Arcanumophis, a new genus and generic allocation for
Erythrolamprus problematicus (Myers 1986), Xenodontinae (Colubridae)
from the Cordillera de Carabaya, southern Peru
CHRISTOPHER R. SMAGA1, ALEX TTITO2,3,4 & ALESSANDRO CATENAZZI1,5,6
1Department of Zoology, Southern Illinois University, Carbondale, USA. E-mail crsmaga@yahoo.com
2Museo de Biodiversidad del Perú, Cusco, Perú. E-mail jalexttito@gmail.com
3Museo de Historia Natural, Universidad Nacional de San Antonio Abad, Plaza de Armas s/n (Paraninfo Universitario) Cusco, Perú
4Departamento de Ecología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago, Chile
5Centro de Ornitología y Biodiversidad, Lima, Perú
6Florida International University, Miami, USA. E-mail acatenaz@fiu.edu
Abstract
The systematics of South American Xenodontinae snakes has experienced large changes and improvements as a result of
recent studies employing molecular data. Herein we assess the status of the rare Peruvian snake species, Erythrolamprus
problematicus (Dipsadidae, Xenodontinae, Xenodontini), previously known from a single specimen collected in 1950.
Based on new morphological and molecular data from a second specimen that we collected, we confirmed the presence of
a crease in the rostral scale, mentioned in the original description (a unique trait among the Xenodontini), and recovered
E. problematicus as the sister-taxon of all other Xenodontini, instead of nested among the current Erythrolamprus.
Therefore, our phylogenetic results justify the erection of a new genus to accommodate the species.
Key words: snake, South America, Xenodontini
Resumen
La sistemática de las serpientes Xenodontinae de Sudamérica ha experimentado grandes cambios y mejoras como
resultado de estudios filogenéticos empleando datos moleculares. Aquí consideramos a una especie rara de serpi-
ente peruana, Erythrolamprus problematicus, (Dipsadidae, Xenodontinae, Xenodontini), conocida previamente a
partir de un único espécimen colectado en 1950. Basados en nuevos datos obtenidos de un segundo ejemplar que
colectamos en Perú, confirmamos la observación hecha en la descripción original con respecto a la presencia de un
pliegue en la escala rostral, un rasgo que es único entre los Xenodontini. Usando secuencias parciales de los genes
12S y 16S rRNA, encontramos que la especie no está anidada dentro del género Erythrolamprus. En cambio, nuestra
filogenia indica que E. problematicus es el grupo hermano a todos los demás Xenodontini. Por lo tanto, proponemos
la creación de un nuevo género para acomodar la especie.
Introduction
The tribe Xenodontini comprises a clade of South American snakes, nested within the family Xenodontinae
Bonaparte (1945). The taxonomy of this tribe has changed substantially due to the results of recent phylogenetic
studies mostly based on molecular data (e.g., Zaher et al. 2009, Vidal et al. 2010, Grazziotin et al. 2012). In the
most comprehensive of these works, Grazziotin et al. (2012) recognized three genera in the tribe Xenodontini:
Xenodon Boie (1826), Erythrolamprus Boie (1826), and Lygophis Fitzinger (1843). According to this system, the
genus Erythrolamprus is the most diverse in terms of snake morphology and ecology. Although it lacks any known
morphological synapomorphies, future studies might bring new taxonomic proposals to split the group into less
inclusive clades deserving recognition at the generic level.
SMAGA ET AL.
130 · Zootaxa 4671 (1) © 2019 Magnolia Press
Myers (1986) described Eythrolamprus problematicus on the basis of the holotype collected in 1950 in the
montane forest of the Cordillera de Carabaya, Puno Department, Peru, using the presence of apical disks on the
hemipenial lobes to allocate the species in the tribe Xenodontini (Jenner & Dowling 1985). However, Myers (1986)
found no morphological traits supporting the allocation of the species to any genus in the group, tentatively accom-
modating it in the genus Liophis Wagler (1830) (the most diverse genus of the tribe at the time and presently in the
synonymy of Erythrolamprus). During a field expedition to the abandoned mine at Santo Domingo, on 8 June 2016,
in the upper reaches of a tributary of the Inambari River near Paco Pacuni, Department of Puno, Peru (Fig. 1) we
collected a snake that we identified as a second specimen of E. problematicus.
Based on new data recovered from this specimen, we conducted a phylogenetic analysis of Xenodontini with
29 terminals in the tribe, including partial sequences of mitochondrial markers 12S and 16S rRNA of E. problemati-
cus. Our results reject the allocation of the species to Erythrolamprus, recovering it as the sister group of all other
members of the tribe. Such a topology supports the designation of a new genus to accommodate E. problematicus,
which we describe herein.
Material and methods
Specimens examined. We examined the holotype of E. problematicus at the Field Museum of Natural History, Chi-
cago, USA (FMNH 64733) and compared it with the specimen from Santo Domingo, Puno, Peru, deposited in the
collection of Centro de Ornitología y Biodiversidad, Lima, Peru (CORBIDI 18731). Additional material examined
is listed in Appendix 1.
Molecular analyses. We extracted DNA using the gMax Mini Kit (IBI Scientific, Peoria, IA, USA) from
muscle tissue obtained prior to formalin fixing of E. problematicus (CORBIDI 18731). We amplified the 12S and
16S rRNA genes using the following primers (all 5’–3’ sequences): for 12S, L1091mod (CAAACTAGGATTA-
GATACCCTACTAT) and H1557mod (GTACRCTTACCWTGTTACGACTT) from Zaher et al. (2009) and for
16S, 16Sar (CGCCTGTTTATCAAAAACAT) and 16Sbr (CCGGTCTGAACTCAGATCACGT) from Alfaro et al.
(2007). We added 0.4% Triton X-100 to improve amplification quality. For 16S, temperatures and times were one
cycle for 3 minutes at 94°C, 35 cycles of 30 seconds at 94°C, 45 seconds at 54°C and 45 seconds at 72°C, and one
cycle for 5 minutes at 72°C. For 12S, one cycle for 2 minutes at 94°C, 10 cycles of 20 seconds at 94°C, 45 seconds
at 60°C, and 45 seconds at 72°C, 35 cycles of 20 seconds at 94°C, 45 seconds at 54°C, 45 seconds at 72°C, and one
cycle for 3 minutes at 72°C. Post-PCR product was purified with Exosap-IT (Affymetrix, Santa Clara, CA), and sent
to MCLAB (San Francisco, CA) for sequencing.
We downloaded the 12S and 16S sequences for the 28 available species of Xenodontini, along with two out-
groups, Pseudalsophis dorsalis and P. elegans, which are sister taxa to the Xendontini clade (Grazziotin et al.
2012; Zaher et al. 2018). Genbank accession numbers are given in Appendix 2. We aligned the sequences for all
genes using the MAFFT alignment tool in Geneious (Katoh & Standley 2013), and concatenated the 12S and 16S
sequences, obtaining a sequence of 575 bases with 361 identical sites. We then performed a rapid bootstrap analy-
sis using RAxML (Stamatakis 2014) with a bootstrap value of 1000 and the GTR+GAMMA model of evolution.
Because 12S and 16S are available for a large number of taxa, this analysis allowed us to maximize the number of
terminals.
This published article and the nomenclatural acts it contains have been registered in ZooBank, the online reg-
istration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be resolved and the associated
information viewed through any standard web browser by appending the LSID to the prefix http://zoobank.org/. The
LSID for this publication is: urn:lsid:zoobank.org:pub:A3C315B4-4007-4BBE-988C-57768BD0E87F.
Results
Specimen CORBIDI 18731 shares with the holotype of E. problematicus (Myers 1986) its general morphology,
small size (total length 210–275 mm, tail length = 40–51 mm), body proportions (tail length 18–19% of total), color
pattern (dark brown dorsum, cream white venter, two stripes on the lateral surface of head passing below the eye
NEW GENUS OF ANDEAN SNAKE Zootaxa 4671 (1) © 2019 Magnolia Press · 131
FIGURE 1. Map of southern Peru showing the type locality at San Juan del Oro, Province of Sandia (red square), and the new
locality at the abandoned mine of Santo Domingo, Province of Carabaya (white circle), both locations in Department of Puno.
SMAGA ET AL.
132 · Zootaxa 4671 (1) © 2019 Magnolia Press
and ending on mouth corner, two cream white nuchal spots posterior to parietals, two pale paravertebral stripes; see
Figures 2 and 3), as well as diagnostic scalation traits (eight infralabials and smooth dorsal rows, with the excep-
tion of eight supralabials in CORBIDI 18731 as opposed to seven in FMNH 64733; see Figure 4). Furthermore, the
rostrum of CORBIDI 18731 exhibits a horizontal crease which was more visible when the snake was alive (Figs.
4, 5). Myers (1986) observed this rostral crease in the holotype but could not rule out the possibility that the crease
(which he termed “horizontal keel”) was an artifact of preservation. The edge of the crease is much sharper in the
holotype than in CORBIDI 18731, probably due to dehydration of the holotype. However, the position and curved
shape of the crease are identical in both specimens. Therefore, our data support the attribution of CORBIDI 18731
as the second specimen of E. problematicus (Myers 1986).
Our analysis combining the 12S and 16S markers recovered E. problematicus as the sister taxon of all Xenodon-
tini, with high bootstrap support (100%; Fig. 6). In addition, the same dataset recovered a paraphyletic Xenodon,
with X. severus and X. werneri forming a clade that appears as the sister group of the genus Lygophis. Therefore,
based on (i) the presence of apical disks on the hemipenial lobes, allowing the placement of E. problematicus in the
tribe Xenodontini (Myers 1986); (ii) the phylogenetic position of E. problematicus as an independent lineage from
all other Xenodontini genera, and (iii) the autapomorphic presence of a crease on the rostral scale of both known
specimens of E. problematicus, we propose the creation of a new genus of Xenodontini to accommodate the species
in the tribe.
Arcanumophis new genus
urn:lsid:zoobank.org:act:93B8A481-E912-4D83-B862-5339F836058D
Type species. Erythrolamprus problematicus (Myers, 1986), by monotypy.
Etymology. From Latin arcanum, meaning mystery and Greek ophis, meaning serpent.
Definition and diagnosis. Arcanumophis gen. nov. differs from all other Xenodontini by the presence of a
crease on the rostral scale, here interpreted as an autapomorphic condition. Molecular data support A. problematicus
as an independent lineage, sister taxon to all other species of Xenodontini (see Discussion).
Distribution. the type species is strictly known from two locations in the Cordillera de Carabaya, Department
of Puno, Peru, in the upper drainages of the Tambopata and Inambari rivers, at elevations of 1520–1960 m a.s.l.
Arcanumophis problematicus new combination
(Figs. 2–4)
Holotype. adult male, total length 275mm, tail length 51mm, tail 18% of total length, FMNH 64733 collected
between 22 November–20 December of 1950 by Hilda Hempl Heller at 1520 m, near San Juan del Oro, about 30
km ENE of the town of Sandia, Province of Sandia, Department of Puno, on the west bank of the Río Tambopata
(approximated coordinates 14.21667°S, 69.16667°W).
Referred specimen. adult female, total length 210mm, tail length 40mm, tail 19% of total length, CORBIDI
18731 collected near the abandoned mine of Santo Domingo at 1960 m a.s.l. (13.83202°S, 69.63705°W; GPS co-
ordinates, WGS84), Province of Carabaya, Department of Puno on 8 June 2016 by A. Catenazzi, A. Ttito and J. C.
Jahuanchi.
Description of CORBIDI 18731 (Fig. 4). Small, slender snake with a slender head and no distinct neck, head
narrowing at snout; pupil rounded, eyes’ diameter almost as long as eye-nostril distance; rostral crescent shaped
and twice as wide as high, visible from above, wider in the center, with a horizontal crease at lower 2/3 of the ros-
tral scale, extending all the way across, curving with the shape of the scale; loreal present, as long as wide; eight
supralabials, 2nd contacting loreal; 3rd–5th contacting eye; eight infralabials, 1st–4th contacting anterior genial, 4th–5th
contacting posterior genial; two internasals, roughly trapezoidal, wider posteriorly and narrowing toward the ros-
tral; frontal roughly pentagonal, twice as long as wide and twice as long as prefrontals; supraocular kidney shaped,
slightly shorter than frontal, narrowing anteriorly; parietals paired, slightly longer than frontal and one-and-a-half
times as long as wide; nasal twice as long as high, contacting 1st and 2nd supralabial; one preocular two-and-a-half
times as high as long, longer dorsally and shortening toward supralabials; two postoculars, upper postocular dis-
NEW GENUS OF ANDEAN SNAKE Zootaxa 4671 (1) © 2019 Magnolia Press · 133
tinctly larger than lower; temporals 1+2; anterior temporal large, two-and-a-half times as long as high, in contact
with 6th and 7th supralabials; two upper posterior temporals three times as long as lower posterior temporal; four
genials; anterior pair twice as long as wide; posterior pair three time as long as wide; dorsal scales smooth, 19/17/17;
ventrals 137, anal plate divided; subcaudals 39 pairs. For details on hemipenial morphology, see Myers (1986).
FIGURE 2. Full body of Arcanumophis problematicus CORBIDI 18731 showing dorsal and ventral coloration patterns (pre-
served specimen). Photographs by A. Catenazzi.
FIGURE 3. Coloration in life of Arcanumophis problematicus (CORBIDI 18731) from Santo Domingo, Department of Puno,
Peru. Photographs by A. Catenazzi.
Coloration patterns (Figs. 2–4): Dorsal color dark brown, fading to a dark olive on flanks; head sides exhibit-
ing two yellowish-white stripes running from rostral through lower margin of eye and ending at mouth corner; two
small and cream white circular nape blotches separated from parietal tips by one dorsal scale; a cream, elongated
SMAGA ET AL.
134 · Zootaxa 4671 (1) © 2019 Magnolia Press
blotch, three times as long as high, present on each side of neck; supralabials 1–3 dark, turning pale at 4–5, and
retuning dark at 6–8; infralabials pale with slight black blotching; two paravertebral cream white stripes originating
slightly dorsally and posteriorly to cream neck blotch; paravertebral stripes mostly restricted to 6th dorsal row, de-
scending to 4th dorsal row near the tail; venter cream white, ventral surface of head slightly darker than body venter.
In life, the head and flanks exuded bright yellow stripes (Fig. 3), which faded to white after preservation (Fig. 2).
The nuchal spots, which were a less bright yellow than the stripes, retained similar coloration after preservative,
with only a slight loss of yellow.
FIGURE 4. Head of Arcanumophis problematicus (CORBIDI 18731), showing horizontal crease on rostrum. Photographs by
A. Catenazzi.
Discussion
Our phylogenetic analysis of the concatenated 12S and 16S sequences of 31 terminals agrees in most aspects with
those conducted by Zaher et al. (2009) and Grazziotin et al. (2012) for the Xenodontini clade. The only differences
refer to the position of Xenodon severus and X. werneri that are retrieved nested within Lygophis in our analysis, but
with low support values, whereas Grazziotin et al. (2012) found X. severus and X. werneri nested in Xenodon with
high support, resulting in a monophyletic Lygophis. Our analysis used only mitochondrial markers, due to the lack
of additional markers for many Xenodontini terminals, while previous studies used nuclear markers as well, which
can lead to differences in position of lower-rank taxa (Grechko 2013). Relationships among Erythrolamprus also
differ slightly between our analysis and the phylogenies of Zaher et al. (2009) and Grazziotin et al. (2012). How-
ever, we recovered high support values (97%) for a monophyletic Erythrolamprus (excluding A. problematicus).
Furthermore, we obtained a relatively low bootstrap support (71%) for the clade Xenodontini when compared to
those obtained by Zaher et al. (2009) and Grazziotin et al. (2012). Despite the lower number of terminals and gene
sequences, our analysis recovered A. problematicus as the sister taxon to all other Xenodontini with unequivocal
support (100%).
The presence of apical disks on the hemipenis justifies the allocation of Arcanumophis problematicus in the
Xenodontini (Jenner & Dowling 1985, Zaher 1999, Zaher et al. 2009, Grazziotin et al. 2012). Regarding other re-
lated lineages, Zaher et al. (2009) erected two new tribes that are sister-groups to Xenodontini—Psomophiini, which
is characterized by a bicapitate hemipenis, and Conophiini, characterized by a non-capitate hemipenis. Although it
is possible that A. problematicus lies outside the Xenodontini, the differences mentioned above render it unlikely.
Therefore, currently it seems more appropriate to allocate the new genus in the Xenodontini.
Morphologically, the snake is unique. The crease on the rostral scale could reflect semi-fossorial habits (e.g.
revolving substrate in the leaf litter), but as mentioned by Myers (1986), the snake shows no other morphological
traits commonly found in fossorial snakes. Our new specimen was found in the soil below layers of mosses, further
supporting the idea that this snake is ground dwelling, but other anatomical characteristics of the snake (skull mor-
phology and large eyes), do not support a semi-fossorial hypothesis.
NEW GENUS OF ANDEAN SNAKE Zootaxa 4671 (1) © 2019 Magnolia Press · 135
A comprehensive analysis of new molecular sequences and morphological characters may bring new informa-
tion regarding the relationships among the Xenodontini genera. Very few, if any, publications have investigated such
differences based on representative sampling, most likely because of the high amount of variance, even within some
genera.
The phylogeny of Xenodontinae snakes has undergone several changes since researchers started using mo-
lecular data (Curcio et al. 2009; Zaher et al. 2009, 2018; Grazziotin et al. 2012). These changes have included syn-
onymizations, resurrections, and new allocations of genera. Erythrolampus is a diverse genus and may be split into
multiple genera as sampling efforts increase, and as more molecular data become available. The lack of a defining
morphological synapomorphy for Erythrolampus renders comparisons with other genera difficult, but we believe
that our decision to create a new genus to allocate A. problematicus within the Xenodontini based on genetic data
and a morphological autapomorphy (i.e., rostral crease) improves the classification of Xenodontini snakes to better
reflect their radiation.
FIGURE 5. Autapomorphy of Arcanumophis illustrated by comparing heads of (A) A. problematicus (CORBIDI 18731) and
of selected species of Erythrolamprus: (B) E. breviceps; (C) E. janaleeae; (D) E. reginae; (E) E. taeniurus; (F) E. thyphlus.
Photographs by A. Catenazzi (A, E) and P. Venegas (B, C, D, F).
SMAGA ET AL.
136 · Zootaxa 4671 (1) © 2019 Magnolia Press
FIGURE 6. Phylogenetic tree of concatenated partial sequences of two mitochondrial genes (12S and 16S rRNA) of Arcanu-
mophis problematicus and sampled species of Xenodontini.
Acknowledgments
Field work was supported by grants from the Eppley Foundation. We thank A. Resetar (FMNH) for access to mu-
seum collections and loan of tissues. A permit to carry on this research has been issued by the Peruvian Ministry of
Agriculture (permit #292-2014-MINAGRI-DGFFS-DGEFFS).
References
Alfaro, M.E., Karns, D.R., Voris, H.K., Brock, C.D. & Stuart, B.L. (2007) Phylogeny, evolutionary history, and biogeography of
Oriental-Australian rear-fanged water snakes (Colubroidea:Homalopsidae) inferred from mitochondrial and nuclear DNA
sequences. Molecular Phylogenetics and Evolution, 46 (2008), 576–593.
https://doi.org/10.1016/j.ympev.2007.10.024
Curcio, F.F., Piacentini, V. & Fernandes, D.S. (2009) On the status of the snake genera Erythrolamprus Boie, Liophis Wagler
and Lygophis Fitzinger (Serpentes, Xenodontinae). Zootaxa, 2173, 66–68.
https://doi.org/10.11646/zootaxa.2173.1.7
Dixon, J.R. (1980) The Neotropical colubrid snake genus Liophis. The generic concept. Contributions in Biology and Geology,
Milwaukee Public Museum, 31, 1–40.
Grechko, V.V. (2013) The problems of molecular phylogenetics with the example of squamate reptiles; mitochondrial DNA
markers. Molecular Biology, 47 (1), 61-82.
https://doi.org/10.1134/S0026893313010056
NEW GENUS OF ANDEAN SNAKE Zootaxa 4671 (1) © 2019 Magnolia Press · 137
Grazziotin, F.G., Zaher, H., Murphy, R.W., Scrocchi, G., Benavides, M.A., Zhang, Y.P. & Bonatto, S.L. (2012) Molecular phy-
logeny of the New World Dipsadidae (Serpentes: Colubroidea): a reappraisal. Cladistics, 1 (2012), 1–23.
https://doi.org/10.1111/j.1096-0031.2012.00393.x
Jenner, J.V. & Dowling, H.G. (1985) Taxonomy of American Xenodontine snakes: the tribe Pseudoboini. Herpetologica, 41 (2),
161–172.
Katoh, K. & Standley, D. (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and
usability. Molecular Biology and Evolution, 30, 772–780.
https://doi.org/10.1093/molbev/mst010
Myers, C.W. (1986) An enigmatic new snake from the Peruvian Andes, with notes on the Xenodontini (Colubridae:Xenodon-
tinae). American Museum Novitates, 2853, 1–12.
Stamatakis, A. (2014) RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformat-
ics, 30 (9), 1312–1313.
https://doi.org/10.1093/bioinformatics/btu033
Vidal, N., Kindl, S.G., Wong, A., & Hedges, S.B. (1999) Phylogenetic relationships of Xenodontine snakes inferred from 12S
and 16S ribosomal RNA sequences. Molecular Phylogenetics and Evolution, 14 (3), 389-402.
https://doi:10.1006/mpev.1999.0717
Zaher, H. (1999) Hemipenial morphology of the South American Xenodontine snakes, with a proposal for a monophyletic Xen-
odontinae and a reappraisal of Colubroid hemipenes. Bulletin of the American Museum of Natural History, 240, 1–168.
Zaher, H., Grazziotin, F.G., Cadle, J.E., Murphy, R.W., Moura-Leite, J.C.de & Bonatto, S.L. (2009) Molecular phylogeny of
advanced snakes (Serpentes, Caenophidia) with an emphasis on South American Xenodontines: a revised classification and
descriptions of new taxa. Papéis Avulsos de Zoologia, 49, 115–153.
https://doi.org/10.1590/S0031-10492009001100001
Zaher, H., Yánez-Muñoz, M.H., Rodrigues, M.T., Graboski, R., Machado, F.A., Altamirano-Benavides, M., Bonatto, S.L. &
Grazziotin, F.G. (2018) Origin and hidden diversity within the poorly known Galápagos snake radiation (Serpentes: Dip-
sadidae). Systematics and biodiversity, 16 (7), 614–642.
https://doi.org/10.1080/14772000.2018.1478910
APPENDIX 1. Material examined
Clelia clelia: Madre de dios: Pakitza, MVZ 197163.
Drepanoides anomalus: Madre de dios: Pakitza, MVZ 197146.
Drymoluber dichrous: Madre de dios: Provincia Manu, Los Amigos Conservation Concession, MUSM 24362.
Arcanumophis problematicus: Peru: Puno, CORBIDI 18731.
Erythrolamprus reginae: Madre de dios: Provincia Manu, Los Amigos Conservation Concession, MUSM 24339.
Erythrolamprus taeniogaster: Madre de dios: Provincia Manu, Los Amigos Conservation Concession, MUSM 24363,
34368.
Erythrolamprus taeniurus: CusCo: Provincia Paucartambo, Kosñipata, CORBIDI –HE 11896, 19169.
Helicops angulatus: Madre de dios: Provincia Manu, Los Amigos Conservation Concession, MUSM 24113, 24139, 24340,
24358.
Oxyrhopus marcapatae: CusCo: Provincia Paucartambo, Kosñipata, MUSM 30251–52.
Oxyrhopus melanogenys: Madre de dios: Pakitza, MVZ 197150.
Pseudoboa coronata: Madre de dios: Pakitza, MVZ 1974148.
Pseudoeryx plicatilis: Madre de dios: Provincia Manu, Los Amigos Conservation Concession, MUSM 24359.
Siphlophis compressus: Madre de dios: Provincia Manu, Los Amigos Conservation Concession, MUSM 24338; Pakitza, MVZ
197145.
Tachymenis peruviana: MUSM 28014, KU 139426–27.
Taeniophallus brevirostris: Madre de dios: Provincia Manu, Los Amigos Conservation Concession, MUSM 25860.
Taeniophallus occipitalis: Madre de dios: Provincia Manu, Los Amigos Conservation Concession, MUSM 25859.
Xenopholis scalaris: Madre de dios: Provincia Manu, Los Amigos Conservation Concession, MUSM 24162, 24350.
SMAGA ET AL.
138 · Zootaxa 4671 (1) © 2019 Magnolia Press
APPENDIX 2. Species and GenBank accession numbers for sampled snake species
Terminal 12S 16S
Arcanumophis problematicus MH513952 MH532901
Pseudalsophis elegans AF158401 AF158470
Erythrolamprus aesculapii GQ457795 GQ457736
Erythrolamprus mimus GU018157 GU018175
Pseudalsophis dorsalis AF158456 AF158525
Erythrolamprus almadensis JQ598808 JQ598871
Lygophis anomalus JQ598817 JQ598879
Erythrolamprus atraventer JQ598809 JQ598872
Erythrolamprus breviceps AF158464 AF158533
Erythrolamprus ceii JQ598810 JQ598873
Erythrolamprus cursor JX905310 JX905314
Lygophis elegantissimus GQ457808 GQ457748
Erythrolamprus epinephalus GU018158 GU018176
Erythrolamprus flavifrenatus JQ598818 JQ598880
Erythrolamprus jaegeri GQ457809 GQ457749
Erythrolamprus juliae AF158464 AF158514
Lygophis meridionalis GQ457810 GQ457750
Erythrolamprus miliaris JQ598811 JQ598874
Erythrolamprus poecilogyrus JQ598812 JQ598875
Erythrolamprus reginae JQ598813 JQ598876
Erythrolamprus typhlus GQ457811 GQ457751
Xenodon dorbignyi GQ457812 GQ457752
Xenodon histricus GQ457813 GQ457753
Xenodon matogrossensis JQ598850 JQ598910
Xenodon nattereri JQ598851 JQ598912
Lystrophis pulcher JQ598852 JQ598913
Xenodon semicinctus GU018156 GU018173
Xenodon guentheri JQ598849 JQ598909
Xenodon neuwiedii GQ457841 GQ457779
Xenodon severus JQ598853 JQ598914
Xenodon werneri AF158468 AF158538
