Available via license: CC BY 4.0
Content may be subject to copyright.
1
N-glycosylation of the voltage-gated sodium channel β2 subunit is required for efficient trafficking of
NaV1.5/β2 to the plasma membrane.
Eric Cortada1,2, Ramon Brugada1,2,3, and Marcel Verges1,2,3,*
1 Cardiovascular Genetics Group – Girona Biomedical Research Institute (IDIBGI); 2 Biomedical
Research Networking Center on Cardiovascular Diseases (CIBERCV); 3 Medical Sciences Dep. –
Univ. of Girona Medical School, C/ Doctor Castany, s/n – Edifici IDIBGI, 17190 Salt – Prov. Girona
– Spain
Running title: β2 glycosylation in NaV1.5/β2 trafficking
* Corresponding author: Marcel Vergés, mverges@gencardio.com; marcel.verges@udg.edu; Tel +34
872 987087 Ext. 62
Key words: sodium channel, N‐linked glycosylation, protein trafficking (Golgi), protein sorting,
protein targeting, voltage-gated sodium channel, SCN2B, NaV1.5, cardiac arrhythmia
Abstract
The voltage-gated sodium channel is
critical for cardiomyocyte function and consists
of a protein complex comprising a pore-forming
α subunit and two associated β subunits. It
previously has been shown that the associated β2
subunits promote cell surface expression of the α
subunit. The major α isoform in the adult human
heart is NaV1.5, and germline mutations in the
NaV1.5-encoding gene, sodium voltage-gated
channel alpha subunit 5 (SCN5A), often cause
inherited arrhythmias. Here, we investigated the
mechanisms that regulate β2 trafficking, and
how they may determine proper NaV1.5 cell
surface localization. Using heterologous
expression in polarized Madin-Darby canine
kidney (MDCK) cells, we show that β2 is N-
glycosylated in vivo and in vitro at residues 42,
66, and 74, becoming sialylated only at Asn-42.
We found that fully non-glycosylated β2 was
mostly retained in the endoplasmic reticulum,
indicating that N-linked glycosylation is required
for efficient β2 trafficking to the apical plasma
membrane. The non-glycosylated variant
reached the cell surface by bypassing the Golgi
compartment at a rate of only approximately
one-third of that of wild-type β2. YFP-tagged,
non-glycosylated β2 displayed mobility kinetics
in the plane of the membrane similar to that of
wild-type β2. However, it was defective in
promoting surface localization of NaV1.5.
Interestingly, β2 with a single intact
glycosylation site was as effective as the wild-
type in promoting NaV1.5 surface localization. In
conclusion, our results indicate that N-linked
glycosylation of β2 is required for surface
localization of NaV1.5, a property that is often
defective in inherited cardiac arrhythmias.
Introduction
Genetic alterations leading to
channelopathies are frequently found in the
voltage-gated sodium (NaV) channel (1). A well-
known ion channel disorder causing ventricular
fibrillation is Brugada syndrome (BrS). In this
regard, ~ 20 % of BrS cases are caused by
mutations in SCN5A, the gene encoding NaV1.5,
i.e., the pore-forming, α subunit, of the major
cardiac NaV channel (2). The NaV channel allows
http://www.jbc.org/cgi/doi/10.1074/jbc.RA119.007903The latest version is at
JBC Papers in Press. Published on September 11, 2019 as Manuscript RA119.007903
by guest on September 12, 2019http://www.jbc.org/Downloaded from
2
fast influx of sodium ions, thus generating the
rapid upward deflection of the action potential
(AP). Therefore, it plays a central role in
myocardial cell excitability. The abnormal
electrocardiogram observed in BrS is due to NaV
channel loss-of-function, often caused by
defective NaV1.5 trafficking and localization to
the cell surface (3).
NaV1.5 is localized at the sarcolemma,
i.e. the cardiomyocytes’ plasma membrane. The
differential localization of NaV channel pools at
sarcolemma subregions is important for
conduction velocity and cardiac impulse
propagation (4). Large evidence shows that
localization and function of the α subunit are
regulated by NaV channel auxiliary β subunits
and other associated proteins (5). Analysis of
NaV1.5 trafficking can be envisaged from at least
three standpoints; first, to address how NaV1.5 is
targeted to the plasma membrane; secondly, how
Nav1.5 is retained at certain surface domains or
subregions; and third, how NaV1.5 endocytosis
and turnover are regulated. In this work, we
mainly focused on the first two aspects,
addressing the contribution of one of the
associated β subunits. Five β subunits are known
in mammals: β1, β2, β3, β4, and β1B (the latter
is an alternative splice variant of β1) (6).
Interacting with NaV1.5 through their
extracellular region (7), or even with their
transmembrane domain (TMD) (8), β subunits
are thought to assist α for effective transport to
the plasma membrane (3). In fact, various
mutations in β subunits have been found
associated with BrS, thereby causing loss-of-
function of the NaV channel (9-12).
We focused here on β2, whose case is of
particular interest, since it is believed to
influence NaV1.5 localization in post-Golgi
compartments, just before, or during its targeting
to the cell surface (13,14). In fact, we previously
described the first BrS-associated mutation in
SCN2B, the gene encoding β2. Such mutation,
D211G (substitution of Asp for Gly), causes a 40
% decrease in sodium current density due to
reduced cell surface levels of NaV1.5 (10).
Moreover, we have shown that exogenously
expressed β2 is transported in a polarized
fashion, namely, to the apical domain in
polarized Madin-Darby canine kidney (MDCK)
cells. Both in MDCK cells and in
cardiomyocyte-derived HL-1 cells, surface
localization of NaV1.5 was promoted by wild-
type (WT) but not D211G β2 (15).
It is not known how β2 is targeted to the
cell surface and, more specifically, how it
preferentially reaches the apical surface in
MDCK cells. Indeed, it is subject of intense
study to understand how apical targeting signals
are recognized. Recognition can take place by
association of the protein’s TMD to lipid rafts. It
can also occur via N- or O-linked glycosylation
of the luminal domain and consequent
interaction with sugar-binding galectins. In
addition, Ras-related Rab GTPases, microtubule
motors and the actin cytoskeleton have been
implicated (16,17).
β2 is a type I transmembrane protein
with an extracellular, immunoglobulin-like loop,
likely performing a cell adhesion function (5), a
single TMD, and a short cytoplasmic tail (18).
The extracellular loop, maintained by an
intramolecular disulfide bond between Cys-50
and Cys-127 (7), has three potential N-
glycosylation sites, i.e. Asn-42, Asn-66 and Asn-
74 (19). Within this region, a third cysteine, Cys-
55, establishes a disulfide bond with the α
subunit (7). In addition, the short C-terminal
intracellular domain has two potential
phosphorylation sites, i.e. Ser-192 and Thr-204
(20); see UniProtKB - O60939.
Glycosylation, and more specifically
sialylation, appears important for regulating
channel biophysical properties. Thus, changes in
sodium current density at the plasma membrane
have been related with the sialic acid content of
β2 (19). For the β1 subunit, which interacts non-
covalently with α, it has been proposed that its
glycosylation level, including its sialylation, may
be differentially regulated in a tissue- and
developmental-specific manner. Hence, different
α/β1 subunit combinations would be
differentially sialylated in various tissues
throughout development, thereby contributing,
to a different degree, to NaV channel gating.
Such differences could even be linked to
pathological alterations (21). Despite this
evidence, to our knowledge, the contribution of
β2 glycosylation on its own trafficking, and
importantly, how such posttranslational
modification may influence trafficking of the α
subunit, have not been addressed in detail. Here,
we found that N-linked glycosylation of β2 is
required for its efficient trafficking to the plasma
membrane. Importantly, unglycosylated β2 was
by guest on September 12, 2019http://www.jbc.org/Downloaded from
3
defective in promoting surface localization of
NaV1.5.
Results
β2 is N-glycosylated and sialylated in vitro
and in vivo
We previously showed that exogenously
expressed β2 localizes almost exclusively at the
apical domain in polarized MDCK cells (15).
Here, we addressed how β2 is preferentially
targeted to this surface domain. Both N- and O-
linked glycosylation are common apical sorting
signals (16,17). The extracellular domain of β2
has three predicted N-glycosylation sites, i.e.
Asn-42, Asn-66 and Asn-74 (18), that follow the
Asn-X-Ser/Thr (NxS/T) motif, being x any
amino acid except Pro (22). We thus
systematically mutated these to Gln, which is
never glycosylated due to its different
conformation, and transiently expressed YFP-
tagged β2 in MDCK cells. Consequently, all
mutants showed increased electrophoretic
mobility, with N42Q displaying the highest
increase, followed by N74Q and N66Q, the
latter, with a minor, albeit measurable shift. This
variable mobility may be due to different
degrees of glycosylation on each site and/or
changes on glycoprotein size or charge due to
the sugar chain; the triple (fully) unglycosylated
mutant showed complete reduction in apparent
mass, no longer appearing as a smear, with
double mutants migrating in between (Figure
1A). To verify that β2 variants were indeed N-
glycosylated, cells were lysed and treated with
peptide:N-glycosidase F (PNGase F), which
cleaves off the bond between Asn and the first
N-acetylglucosamine (GlcNAc) moiety,
liberating the entire N-glycan (23). Upon
treatment, WT and mutants displayed identical
mobility to that of fully unglycosylated β2
(Figure 1B). To confirm that β2 glycosylation
takes place in vivo, cells were treated with
tunicamycin (TUN), or with benzyl-2-
acetamido-2-deoxy-α-D-galactopyranoside (Gal-
NAc-α-O-benzyl), to block N- or O-
glycosylation, respectively. As a result, β2 WT
became fully deglycosylated only with TUN,
remaining unaffected with Gal-NAc-α-O-benzyl
(Figure 1C). These data show that β2 is N-
glycosylated in vitro and in vivo, but does not
undergo O-glycosylation.
We next investigated the complexity of
β2 N-glycosylation with endoglycosidase H
(Endo H), which cleaves on high-mannose and
hybrid, but not complex glycans, typically
generated at late stages of Golgi glycosylation
(23). When cells were analyzed early (1 day)
after transfection, a faster-migrating band, also
visible in single and double mutants, suggested
the presence of immature β2-YFP still
unprocessed in the endoplasmic reticulum (ER).
Endo H treatment effectively increased the
mobility of this band, which then coincided with
unglycosylated β2, without affecting mature β2
(Figure 2A and Supplementary Figure S1A),
Thus, at that moment a considerable fraction of
β2 had not yet undergone processing by Golgi α-
mannosidase II (23).
To further assess N-glycans complexity,
cells were treated with broad-specificity
sialidase, i.e. neuraminidase (NA), which
cleaves terminal sialic acids from both N- and O-
glycans (23). In consequence, the slower-
migrating band displayed a noticeable increase
in mobility in β2 WT, N66Q and N74Q mutants,
but interestingly not in β2 N42Q. Similarly, no
effect was seen in double mutants including the
N42Q mutation, but it was clear in β2 N66Q /
N74Q (Figure 2B and Supplementary Figure
S1B). Because all variants with the N42Q
mutation were insensitive to NA, we conclude
that β2 is sialylated uniquely at Asn-42.
N-glycosylation is required for efficient cell
surface localization of β2
Since glycosylation is a well-known
mechanism for many proteins to efficiently
reach the plasma membrane (16), we tested by
protein biotinylation whether partially or fully
unglycosylated β2 properly localizes to the cell
surface. Uniquely the triple mutant displayed a
substantial defect, and band quantitation showed
that it reaches the surface at a rate of
approximately one-third in comparison with the
WT (Figure 3A and 3B). Moreover, the portion
of unglycosylated mutant at the surface was
around 8 % of total cellular β2 protein,
contrasting with 25-30 % by the WT and single
or double mutants. A comparable defect was
found in fully polarized cells. In these, the rate
by which unglycosylated β2 reached the apical
surface was also approximately one-third when
comparing with β2 WT or the partial mutants
(Figure 3C and 3D). To note, all variants of β2
by guest on September 12, 2019http://www.jbc.org/Downloaded from
4
remained nearly undetected at the basolateral
surface, or at least clearly de-enriched
comparing with lysates (Supplementary Figure
S2). To determine the magnitude of
glycosylation loss in trafficking deficiency of β2
overtime, we analyzed its surface levels along
various days from transfection. Indeed, the
defect was maintained throughout time.
Therefore, these data show that total lack of
glycosylation significantly prevents β2
localization to the surface (Figure 4). While a
single glycosylation site appeared sufficient for
proper surface localization of β2, TUN treatment
further confirmed that unglycosylated β2
virtually does not reach the plasma membrane in
vivo (Figure 3E and 3F).
We next determined in what subcellular
compartment trafficking of unglycosylated β2
becomes interrupted. To this end, cells were
immunostained for detection of various
subcellular markers of the endocytic and
exocytic pathways. These included the early
endosome (EE) marker EEA1, the late
endosomal lysobisphosphatidic acid (LBPA), the
lysosome-associated membrane protein LAMP2,
the cis-Golgi marker Golgi matrix protein of 130
kDa (GM130), and the trans-Golgi network
(TGN) marker TGN46. None of them
overlapped markedly with unglycosylated β2
(Supplementary Figure S3). However, an
apparent overlap found with the ER chaperone
calnexin indicates that a large portion of the
triple mutant is retained in the ER membranes.
Moreover, its pattern was highly comparable to
that of β2 WT in cells treated with TUN (Figure
5A). Indeed, the Manders’ coefficient was
around 0.7 in cells expressing unglycosylated β2
and in TUN-treated cells, in contrast with
negligible overlap in untreated cells expressing
β2 WT (Figure 5B). In the latter, β2 outlined the
cell end, also displaying an obvious dotted
pattern, which likely corresponds to β2 getting
positioned at the developing apical surface, i.e.
its final location in polarized cells (15). Because
of its preponderant surface localization, no
manifested overlap was observed between β2
WT and any of the markers tested
(Supplementary Figure S3). Altogether, these
data indicate that unglycosylated β2 becomes
retained in the ER.
Unglycosylated β2 can reach the cell surface
by bypassing the Golgi compartment
Even though unglycosylated β2 was
seen retained in the ER, a small fraction reached
the cell surface and, in polarized MDCK cells,
even properly localized to the apical surface. We
therefore tested whether blocking the ER-to-
Golgi pathway with brefeldin A (BFA) would
analogously prevent arrival of immature β2 to
the plasma membrane. Here, transfected cells
were treated o/n with BFA and both lysates and
pulldowns were then deglycosylated with Endo
H. As expected, mature, fully glycosylated β2
WT was not visible in cells treated with BFA,
confirming lack of processing by Golgi enzymes
(Figure 6A). Upon Endo H treatment, the faster-
migrating band (immature β2) increased its
mobility, coinciding with unglycosylated β2
(Figure 6A; see Figure 2A for comparison).
Remarkably, this immature form was the only
constituent of pulldowns from BFA-treated cells,
indicating that it can reach the plasma membrane
by bypassing Golgi glycosylation. Subsequently,
pulldowns were also treated with Endo H, which
again shifted a small fraction of immature β2 to
the position of (faster-moving) unglycosylated
β2 (Figure 6A).
Albeit to a lesser extent, β2 WT was still
detected in pulldowns of BFA-treated cells.
However, quantitation of western blots indicated
that, similarly to unglycosylated β2, the ratio by
which immature β2 can reach the cell surface in
BFA-treated cells is only approximately one-
third as compared with untreated cells (Figure
6B). Proper validation that the drug produced β2
accumulation in the ER was seen by its
considerable overlap with calnexin (Figure 6D),
whose pattern clearly differed from that of the
cis-Golgi marker GM130, which became more
tubulated and disperse in the presence of BFA
(see also Supplementary Figure S4A). Thus, a
large portion of β2 WT now appeared
accumulated in enlarged calnexin-positive
structures, often undistinguishable from buildup
of unglycosylated β2 (arrowheads in Figure 6D).
Moreover, in untreated cells expressing low
levels of unglycosylated β2, the mutated protein
largely overlapped with calnexin, further
confirming its retention in the ER
(Supplementary Figure S4B).
by guest on September 12, 2019http://www.jbc.org/Downloaded from
5
Dynamics of β2 in the plane of the membrane
is not influenced by N-glycosylation
The data above provide strong evidence
that N-glycosylation is required for β2 to reach
the plasma membrane. It is plausible to
contemplate that N-glycans ensure correct
folding and oligomerization of β2 to exit the ER
properly. Glycosylation may favor β2 clustering
at the TGN, which in turn may increase affinity
to lipid rafts, for subsequent inclusion into apical
transport carriers (24). Thus, we hypothesized
that β2 dynamics in the plane of the membrane
may be influenced by its glycosylation, which
could have important functional implications.
Movement of fluorescently tagged β2 was
monitored by fluorescence recovery after
photobleaching (FRAP). The mobile fraction
(MF), that is, the portion of molecules
undergoing diffusion, differed depending on the
cell’s location where the measurement was
taken. Hence, we chose three representative
regions for analysis, i.e. at the cell end, mostly
representing cell surface β2 (Figure 7A); within
the cytoplasm matrix, likely including the
dispersed ER network as well as clusters of β2
already at the surface (Figure 7B); and in
vesicular structures of unknown nature, which
may represent large perinuclear ER elements
with β2 in transit to the cell surface (Figure 7C).
At the cell end, approximately 60 % of β2 WT
molecules underwent diffusion 4-5 min after
bleaching. MF at the cell end was slightly
increased for unglycosylated β2, yet differences
were not significant (Figure 7A and
Supplementary Table S1). Similar data were
found for cytoplasmic β2 (Figure 7B). However,
when β2 found in large vesicles was bleached,
mean fluorescence never recovered above 10 %
of the total initial signal (Figure 7C). These
differences in the portion of freely diffusible
molecules suggest that the molecular
environment of β2 seemingly accumulated in
these large vesicles differed from that present in
the other areas analyzed.
The FRAP data also showed that the
mobility rate of WT and unglycosylated β2 is
comparable, with a slight tendency of the mutant
to move slower. Regardless of the location, half-
time of recovery (τ1/2, the time-point of half
fluorescence recovery) was approximately 1 min
in both β2 variants (Supplementary Table S1).
Consequently, a diffusion coefficient (D) of ≈
0.02 µm2/s was found in general, although β2 in
large vesicles moved even slower, i.e. at ≈ one
fourth of this speed (see Experimental
procedures).
Unglycosylated β2 is defective in promoting
surface localization of NaV1.5
The comparable mobility of both WT
and unglycosylated mutant β2 indicates that the
sugar moiety does not influence β2 dynamics
within the membrane bilayer. It is accepted that
β subunits function in concert with the α subunit
to promote channel trafficking to the plasma
membrane, and in some cases to modulate its
biophysical properties (5). In this regard, it has
been shown that the major function of β2 in vivo
is to chaperone α subunits to the plasma
membrane, both in the heart ventricle (25) and in
neurons (26). Therefore, we tested whether
unglycosylated β2 was defective in promoting
surface localization of NaV1.5. As expected (15),
a fraction of NaV1.5 colocalized with β2 and the
apical marker gp114 (Figure 8A). Even though
NaV1.5 distributed throughout the cell,
calculation of the corrected total cell
fluorescence (CTCF) along z-stacks showed its
maximum fluorescence peak nearly overlapping
to those of gp114 and β2, corresponding to the
apical plasma membrane (Figure 8C). In the
presence of unglycosylated β2, NaV1.5
distribution was more widespread, mostly
abounding at the nuclear level and right above
the nucleus (Figure 8B and 8D). Moreover, a
large portion of NaV1.5 colocalized with
accumulations of mutated β2 (arrowhead in
Figure 8B).
By biochemical means, a small portion
of NaV1.5 can be effectively detected at the cell
surface of MDCK cells in the presence of β2
(15). We thus biotinylated surface proteins to
detect in pulldowns NaV1.5, whose levels were
visibly reduced in cells expressing
unglycosylated β2 (Figure 8E and 8F), thus
supporting the data obtained by
immunofluorescence.
Since we could measure the presence of
NaV1.5 at the surface by biotinylation, we then
wished to determine the magnitude of this defect
over time. To this end, we first analyzed β2
function in promoting NaV1.5 arrival to the
surface early from transfection. We thus
performed this analysis in cells growing non-
polarized in wells. Here, we took advantage of
our approach to quantify relative fluorescence
by guest on September 12, 2019http://www.jbc.org/Downloaded from
6
levels, i.e., mean fluorescence intensity (MFI),
along a segment drawn from the cell end
perpendicularly into the cytoplasm; by means of
confocal microscopy, the cell end taken is a
close approximation of the plasma membrane
region (15). As expected, localization of NaV1.5
to the plasma membrane was not promoted by
unglycosylated β2 throughout time, and the bulk
of NaV1.5 label remained intracellular (Figure
9C and 9D), similarly as in cells not expressing
β2 (Figure 9E and 9F). In contrast, the MFI of
NaV1.5 was concentrated at the cell end in the
presence of β2 WT, also in parallel with Na/K-
ATPase, especially at day 1, displaying a more
widespread distribution at days 2 and 3 (Figure
9A and 9B); a general defect in promoting
surface localization of NaV1.5 at late time points
was also verified by cell surface biotinylation,
by which all β2 variants were ineffective,
including the WT (Supplementary Figure S5).
We have shown that a single intact
glycosylation site in β2 is sufficient for its
proper surface localization (see Figure 3 and
Figure 4). Now, we asked whether incomplete
glycosylation would affect β2 in promoting
surface localization of NaV1.5. Interestingly,
partial loss of glycosylation still allowed a
positive effect, namely, only fully
unglycosylated β2 is clearly defective in
promoting surface localization of NaV1.5. Thus,
we found that single β2 mutants maintain
effectiveness at day 1 from transfection (Figure
10), which we also verified by cell surface
biotinylation (Figure 11 G-H). By biochemical
means, we also observed a comparable behavior
in double mutants, appearing similarly effective
as the WT in promoting surface localization of
NaV1.5 (Figure 11 I-J). Moreover, single mutants
were also effective to promote apical localization
of NaV1.5 in cells growing polarized in
Transwells, (Figure 11 A-F; compare with
Figure 8 A-D).
In summary, glycosylation is required
for β2 to reach efficiently the plasma membrane
and is important for β2 to promote surface
localization of NaV1.5.
Discussion
In this work, we analyzed the
mechanisms regulating β2 trafficking, and how
this may be determinant for proper localization
at the cell surface of NaV1.5, the major cardiac
NaV channel. We show that β2 is N-glycosylated
in vivo and in vitro at residues 42, 66 and 74,
becoming sialylated only at Asn-42, and that
glycosylation is required for its efficient
trafficking to the plasma membrane. We found
that a comparatively small fraction of the fully
unglycosylated mutant can reach the cell surface
by bypassing the Golgi compartment, in fact, at
only one-third the rate of the WT. In addition, it
was defective in promoting surface localization
of NaV1.5. We therefore propose that N-linked
glycosylation of β2 is required for NaV1.5
trafficking to the surface.
NaV1.5 is often mislocalized in inherited
channelopathies triggering cardiac arrhythmias.
Defective trafficking is often responsible (27),
although proper organization of macromolecular
complexes is also important (28). In addition,
association with adaptor proteins should ensure
proper sorting, targeting, anchoring, and
stabilization of the channel complex to certain
plasma membrane subdomains (29). Such
proteins may include auxiliary β subunits. In this
regard, β2 association with the α subunit – at
least in neurons – is important for proper
targeting and subcellular localization of the α/β
complex (5,7).
By confocal microscopy and protein
biotinylation, we observed that unglycosylated
β2 was clearly defective in shifting the
localization of NaV1.5 from the ER to the cell
surface. In fact, a considerable portion of both
proteins appeared stuck in the ER; to avoid
excessive β2 levels due to overexpression, in
most of these experiments we used cells stably
expressing β2-YFP in moderate levels
transiently transfected to express NaV1.5-FLAG.
Virtually all exogenously expressed NaV1.5
actually remains intracellular in MDCK cells, a
large portion being in the ER. This fits with the
classic idea that the ER may serve as a reservoir
for cardiac (14) and neuronal NaV channels,
generating a pool potentially essential to regulate
export of the α/β2 complex to appropriate
surface locations (13). Yet, even in MDCK cells,
β2 can promote NaV1.5 localization to the apical
surface (15). The fully unglycosylated mutant
was however defective, and therefore lacked the
most relevant function described for the β2
subunit to date, at least within the context of the
NaV channel (5,25). Remarkably, a single
glycosylation site in β2 was sufficient to allow
its trafficking to the apical surface and to
promote surface localization of NaV1.5.
by guest on September 12, 2019http://www.jbc.org/Downloaded from
7
The implication of β subunits in
promoting trafficking of the α subunit to the
plasma membrane is a common statement seen
in the literature (5,30,31). For β2 in particular, it
has long been believed that covalent assembly of
α/β2 takes place right before their arrival to the
plasma membrane (13), or at least after the
subunits have left the Golgi apparatus (14). This
is consistent with data from Scn2b deletion in
mice, which causes, both in ventricular
myocytes (25) and in primary hippocampal
neuron cultures (26), approximately a 40 %
reduction of α subunits at the cell surface.
Interestingly, β2 must associate with the α
subunit for its targeting to nodes of Ranvier and
to the axon initial segment (7). A similar
scenario is seen for β4 (32). While it was
concluded that trafficking to the plasma
membrane of β1, but not β2, is altered by the α
subunit (14), association of β2 to α actually
determines β2 targeting to specialized neuron
domains (7).
Regarding proper subcellular
localization, this evidence may lead us to
question whether β acts on the α subunit, or vice-
versa. Our data seem consistent with the notion
that β2 plays an important role in ensuring
efficient surface localization of NaV1.5; this
process is seen only defective when β2 remains
mainly retained in the ER as a result of no
glycosylation. The data from the present work
thus challenge the view that β2 acts on NaV1.5 at
a later stage, such as at the cell surface, or in a
post-Golgi compartment, as we also proposed
previously (15). Indeed, the unglycosylated
mutant seemed to drag along a large portion of
NaV1.5 to intracellular compartments, likely in
the very ER. According to this observation, it is
plausible that the β2 mutant causes NaV1.5
retention early in the secretory pathway in an
attempt to chaperone it for proper folding on its
way to the cell surface.
A minor fraction of unglycosylated β2,
estimated to be no more than 10 %, was detected
at the cell surface, contrasting with 25-30 % of
the WT; this reduction to approximately one-
third of the rate by β2 WT was similarly seen at
the apical domain of polarized cells. By blocking
ER-to-Golgi transport with the fungal drug BFA,
we demonstrated that even immature β2 WT,
which is Endo H sensitive, could be detected at
the plasma membrane. Based on this result, the
most likely explanation by which a small
fraction of unglycosylated β2 is detected at the
cell surface is that it did so also by bypassing the
Golgi compartment. At least for NaV1.5, there is
evidence that the immature protein may follow
such Golgi-independent, secretory pathway. For
NaV1.5, the role of this alternative anterograde
pathway is not clear, although it was proposed to
be potentially useful for clearance of
accumulating proteins in the ER as a constitutive
response to relieve or prevent ER stress (33). In
fact, it has been shown that a fraction of NaV1.5
remains Endo H sensitive and associates with
Kir2.1, the α subunit of the inward rectifying
potassium channel, early in their biosynthetic
pathway (34). In this regard, it has been
hypothesized that NaV1.5 mutants described in
BrS patients that are retained in the ER may still
be delivered to the plasma membrane via an
unconventional pathway (35).
We found that YFP-tagged,
unglycosylated β2 displays similar kinetics of
mobility in the plane of the membrane as β2
WT. Thus, N-glycosylation does not influence
its lateral mobility as well as interactions with
proteins and lipids within and across the
membrane. Taking into account the relatively
low D of around 0.02 µm2/s, or even less, it
would be conceivable to consider that β2
diffuses inside lipid rafts, fitting with reported D
≤ 0.05 µm2/s (36). Yet, a considerably lower D
would also agree with the possibility that the
protein is tethered to cytoskeleton elements
underlying the membrane (37).
We previously showed that proper
localization of NaV1.5 to the cell surface is
defective in the presence of β2 D211G (15), a
missense mutation associated with BrS (10). In
MDCK cells, β2 localizes in a polarized fashion,
seen almost exclusively at the apical surface
(15). In the present work, we found that fully
unglycosylated β2 poorly reaches the apical
plasma membrane. This agrees with previous
data showing that N-glycans are required for
polarized distribution of many apical membrane
proteins in epithelia (24). As the WT, β2 D211G
effectively localizes to the apical surface of
MDCK cells, and similarly, to the plasma
membrane of atria-derived HL-1 cells (15).
Therefore, its defective action on NaV1.5 must
be different from what we observed here for the
fully unglycosylated mutant, and may be related
to a potential effect on posttranslational
modifications, such as phosphorylation of the
by guest on September 12, 2019http://www.jbc.org/Downloaded from
8
intracellular domain, as we suggested (15).
However, previous work in heterologous
systems actually showed that the cytoplasmic
domain of β subunits does not have much
influence on α/β interaction. Thus, a β1 chimera
bearing the intracellular domain of β2
overlapped strongly with NaV1.5, supposedly in
intracellular compartments (38), similarly as β1
does, but in contrast to β2 (14).
In summary, we found that β2 N-
glycosylation is required for its efficient
trafficking to the plasma membrane, although a
small fraction of fully unglycosylated β2 can
reach the cell surface by bypassing the Golgi
compartment. Importantly, this mutant was
defective in promoting surface localization of
NaV1.5. These findings add to a better
understanding of β2 function, which appears
primarily relevant for proper NaV1.5
localization, thereby influencing cell excitability
and electrical coupling in the heart, and in turn
contributing to an improved knowledge on how
arrhythmias develop.
Experimental procedures
Plasmid vectors, cDNA cloning, and site
directed mutagenesis
The vector containing SCN2B-yfp, to
express β2 with YFP fused to its C-terminus, has
been described (15). Following the
manufacturer’s instructions, the QuikChange
Lighting Site-Directed Mutagenesis Kit (Agilent
Technologies) was used to change Asn for Gln
at predicted N-glycosylation sites (22), thus
preventing potential N-glycosylation of the
expressed protein. Human SCN2B (designated in
the Consensus Coding Sequence database
(CCDS) with ID 8390.1), containing the desired
mutation, was used as a template.
Complementary primer pairs for PCR were
designed with the QuikChange® Primer Design
Program (Agilent) and synthetized by Metabion
International AG. Sequences were sense: 5'-
CCCTCAACGTCCTCCAGGGCTCTGACGCC
CG-3' and antisense: 5'-
CGGGCGTCAGAGCCCTGGAGGACGTTGA
GGG-3' (N42Q); sense: 5'-
CACAAACAGTTCTCCCTGCAGTGGACTT
ACCAGGAGTGC-3' and antisense: 5'-
GCACTCCTGGTAAGTCCACTGCAGGGAG
AACTGTTTGTG-3' (N66Q); sense: 5'-
ACTTACCAGGAGTGCAACCAGTGCTCTG
AGGAGATGTTC-3' and antisense: 5'-
GAACATCTCCTCAGAGCACTGGTTGCAC
TCCTGGTAAGT-3' (N74Q). (Mutated bases
are marked in bold and underlined.) All possible
combinations of mutant β2 were generated:
N42Q, N66Q, N74Q, N42Q / N66Q, N42Q /
N74Q, N66Q / N74Q, and N42Q / N66Q /
N74Q. The constructs were then verified by
sequencing.
The FLAG-tagged human SCN5A
cloned in pcDNA3.1 has been described; the tag
is located in the extracellular loop (right after
Pro154) between segments S1 and S2 of domain
I (39).
Cell culture and transient transfection
MDCK cells II and transfectant
derivatives were maintained in Minimum
Essential Medium with Earl’s salts (MEME). To
generate a fully polarized monolayer, cells were
grown on polycarbonate Transwell filters of 12
mm diameter and 0.4 μm of pore size for at least
3 days (Corning-Costar), as described (40); the
medium was supplemented with GlutaMAXTM
(Gibco). Transfections were performed
according to the manufacturer’s instructions.
Cells to be split for transfection had been grown
o/n until subconfluence. 400,000
cells/Transwell, 350,000 cells/22-mm well (12-
well plates), or 1.2x106 cells/35-mm well (6-well
plates), were seeded and immediately (co-
)transfected – in suspension – with vector(s) to
(co-)express NaV1.5, β2 and/or GFP, using
Lipofectamine® 2000, at 1 μl reagent/µg DNA,
in Gibco Opti-MEMTM I reduced-serum medium
(Invitrogen). 2 μg SCN2B-yfp vector were used
per transfection in Transwells and 22-mm wells,
and 4 μg in 35-mm wells; 6.5 μg SCN5A-FLAG
vector were transfected into β2 stable cells in
Transwells; and 2 µg of the latter plus 3 μg
SCN2B-yfp vector were transfected into cells in
35-mm wells. In cotransfections of NaV1.5 and
β2, the pEGFP-N1 vector (Clontech) was used
as a control for β2-YFP.
For experiments of Fluorescence
recovery after photobleaching (FRAP), 180,000
cells were seeded in ibidi® µ-slides (with 4 wells
Ph+ and a glass bottom) and transfected as
above with 1.5 µg SCN2B-yfp vector.
Generation of stable cell lines
Transfections were performed by
calcium phosphate coprecipitation, as described
by guest on September 12, 2019http://www.jbc.org/Downloaded from
9
(41), and single-cell clones then selected with
200 μg/ml G418 (Sigma). Positive clones for
WT and unglycosylated β2-YFP mutants were
identified visually using the appropriate filter
under a fluorescence microscope, and then
confirmed by anti-β2 western blot. Proper
distribution of surface markers (gp114, apical;
and p58, basolateral) and tight junctions (ZO-1)
was then verified by immunofluorescence,
ensuring normal cell polarity. The cell line
expressing NaV1.5-YFP has been described (15).
Pharmacological inhibition of glycosylation
To block N-linked protein glycosylation,
cells were treated with tunicamycin (TUN;
Sigma T7765). TUN inhibits the initial events in
glycosylation of Asn residues, resulting in the
synthesis of totally unglycosylated proteins.
TUN was first dissolved at 10 mg/ml in DMSO.
Cells were treated 2 h after transfection with 0.3
µg/ml TUN for 24 h in complete medium; in
untreated samples, an equivalent volume of
solvent was added (0.003 %).
To inhibit O-linked protein
glycosylation, cells were treated with benzyl-2-
acetamido-2-deoxy-α-D-galactopyranoside (Gal-
NAc-α-O-benzyl; Sigma B4894), a competitive
inhibitor of O-glycan chain extension (42). Gal-
NAc-α-O-benzyl was first dissolved at 100
mg/ml in DMSO. Cells were treated ~ 2 h after
transfection with 2 mM Gal-NAc-α-O-benzyl for
24 h in complete medium; in untreated samples,
the equivalent volume of solvent was added (0.6
%).
Treatment with brefeldin A (BFA)
To block transport from the ER to the
Golgi, cells were treated with the fungal drug
brefeldin A (BFA; Thermo Fisher Scientific 00-
4506-51). BFA reversibly inhibits a GTPase
activity necessary for coat formation on Golgi
membranes, which ultimately induces a
redistribution of Golgi components to the ER
(43). Cells were treated ~ 2 h after transfection
with 1.5 µg/ml BFA o/n in Opti-MEM (BFA
was purchased already dissolved at 3 mg/ml in
methanol); in untreated samples, an equivalent
volume of solvent was added (0.05 %).
In vitro deglycosylation
Deglycosylation was performed in
whole cell lysates. Reactions were stopped with
Laemmli buffer. To remove completely N-
glycans, we used peptide:N-glycosidase F
(PNGase F; NEB P0708), which cleaves off the
bond between Asn and the first N-
acetylglucosamine (GlcNAc) moiety, liberating
the entire N-glycan. The protocol by New
England Biolabs (NEB) was used. Briefly, 10 µg
protein were denatured for 10 min at 100ºC in 10
µl Glycoprotein Denaturing Buffer (0.5 % SDS
with 40 mM DTT). The reaction with 1 µl
PNGase F (500 units) was then performed in 20
µl total volume, including GlycoBuffer 2 (50
mM sodium phosphate at pH 7.5) and containing
1 % Nonidet P-40 (NP-40), by o/n incubation at
37°C. To discern between simple and complex
N-glycosylation, we used endoglycosidase H
(Endo H; NEB P0702), which cleaves N-glycans
between the two GlcNAc moieties in the core
region of the glycan chain on high-mannose and
hybrid, but not complex, glycans. Similarly, 7.5
µg protein were denatured for 10 min at 100ºC
in 10 µl Glycoprotein Denaturing Buffer. The
reaction with 1 µl Endo H (500 units) was then
performed in 20 µl total volume, including
GlycoBuffer 3 (50 mM sodium acetate at pH 6),
by o/n incubation at 37°C.
To cleave terminal sialic acids, from N-
and O-glycans, we used α2-3,6,8 neuraminidase
(NA; NEB P0720), which hydrolyzes α2-3, α2-
6, and α2-8-linked sialic acid residues from
glycoproteins and oligosaccharides. Here, 2 µl
NA (100 units) were added to 3.5 µg protein in
GlycoBuffer 1 (5 mM CaCl2 in 50 mM sodium
acetate at pH 5.5) and incubated o/n at 37°C. To
ensure proper visibility in gels with samples
from double mutants, twice the amount of
protein and enzyme were used in digestions with
Endo H and NA.
In experiments addressing the effect of
BFA, material obtained by surface protein
biotinylation (see below) was also digested with
Endo H. Here, o/n NeutrAvidin pulldowns were
resuspended in 20 µl Glycoprotein Denaturing
Buffer and denatured as above to release the
protein from beads. Beads were then spun down
and 10 µl of supernatant was deglycosylated in
GlycoBuffer 3 as above using 3-times as much
enzyme.
Antibodies
Some antibodies were provided by other
researchers, including the mouse monoclonal
antibodies to gp114 (a cell adhesion molecule)
by guest on September 12, 2019http://www.jbc.org/Downloaded from
10
and to p58 (the Na/K-ATPase β subunit) (44), as
well as the rat monoclonal antibody against ZO-l
(45). The following are commercially available
mouse monoclonal antibodies: to the early
endosome (EE) marker EEA1 and the Golgi
matrix protein of 130 kDa (GM130) (BD
Transduction Laboratories 610457 and 610822,
respectively); and to the Na/K-ATPase α1
subunit and the trans-Golgi network (TGN)
marker TGN46 (Abcam ab7671 and ab50595,
respectively). Commercial rabbit polyclonal
antibodies used were, from Alomone, ASC-013
to NaV1.5, and ASC-007 to anti-β2; from
Abcam, anti-GFP (ab290) and anti-calnexin
(ab75801); and from Sigma, anti-actin (A 2066).
Secondary antibodies HRP-conjugated
for western blot were from Jackson
ImmunoResearch (codes 111-035-003 and 115-
035-003), and Alexa Fluor®-labeled for
immunofluorescence from Molecular Probes-
Invitrogen (codes A11012 and A21050).
Sample preparation for western blot
Protein determination from cell lysates
and preparation of samples for SDS-PAGE were
done as previously (15,46), with the following
remarks in samples analyzing NaV1.5. These
were prepared in Laemmli buffer by heating at
70ºC for 10 min, and protein transferring to
PVDF membranes was done for 30 h in the
presence of 0.01 % SDS to optimize NaV1.5
solubilization and transfer.
Cell surface biotinylation
Surface protein biotinylation was done
with EZ-Link™ Sulfo-NHS-SS-Biotin (Pierce
21331), a water-soluble and membrane
impermeable reagent. The procedure followed
has been described previously in detail (15,46).
Unless otherwise specified, nine tenths of cell
lysate was subjected to o/n pulldown with
NeutrAvidin (Pierce 53150) and analyzed by
western blot along with the remaining 10 %
(referred to as lysate). Quantitation of blotted
protein bands in lysates and pulldowns was
performed as described (15) using the ImageJ
program.
Confocal immunofluorescence microscopy
and quantitative image analysis
MDCK cells were analyzed at
subconfluence on glass coverslips or grown
polarized in 12 mm Transwells. Cells were fixed
with paraformaldehyde and immunostained,
essentially as described (15,46).
High magnification images were taken
on a Nikon A1R confocal microscope at a
minimum pixel resolution of 1,024 x 1,024 using
the NIS-Elements AR software, as described
(47). Images were exported to TIFF format and
3D colocalization was done without image
preprocessing using Fiji, the ImageJ-based
package that includes the JACoP plugin for
colocalization analysis. Manders’ colocalization
coefficients were then calculated along apical-to-
basal z-stacks to estimate the fraction of β2
present in compartments positive for a given
subcellular marker, as described (15).
To measure cell fluorescence along z-
stacks (optical slice thickness of 0.5 μm),
confocal images were taken at 512 x 512 pixel
resolution. As previously (47), we calculated
along 3D reconstructions the corrected total cell
fluorescence (CTCF), which integrates
fluorescence intensity and area. In non-polarized
cells, to measure relative fluorescence levels
from the plasma membrane into the cytoplasm,
we calculated for each channel the mean
fluorescence intensity (MFI), which shows the
percentage of fluorescence intensity/pixel over
the pixel with maximum intensity, as described
(15).
Fluorescence recovery after photobleaching
(FRAP)
MDCK cells were transiently transfected
and grown subconfluent (2 days) on ibidi® glass
supports. Cells were placed in a live-cell
imaging chamber at 37ºC and 5 % CO2, and
imaged through a water-immersion objective
(Plan-Apo 60X, 1.2 NA) on a Nikon A1R
confocal microscope. Confocal images were
taken at 512 x 512 pixel resolution. An argon
laser with emission at 514 nm was used to image
the YFP fluorescence and a 405 nm diode laser
was used for photobleaching. The pinhole radius
was set to 3 Airy Units, except when imaging
perinuclear endoplasmic reticulum (ER)
structures, when the pinhole was set to 1 Airy
Unit. 3 regions-of-interest were drawn: a
bleached area, in which fluorescence recovery
was recorded along time; a background area,
outside obvious fluorescence labeling; and a
non-bleached (reference) area, in a different cell
displaying similar fluorescence intensity as the
by guest on September 12, 2019http://www.jbc.org/Downloaded from
11
bleached cell. Both bleached and reference areas
were circular regions with a nominal radius (rn)
of 2 μm, except when imaging perinuclear ER
structures, where rn was 1 μm.
Images were collected at a rate of 1
frame per second, as follows. First, 10 pre-
bleaching images were taken, and then bleaching
was done for 5 seconds at 100 % laser
transmission. Immediately, post-bleaching
images were captured until fluorescence
recovery reached a plateau. Similarly as
described (48), we used the NIS-Elements AR
software to measure average fluorescence
intensities and to correct for background and
acquisition photobleaching, taking into account
background and reference fluorescence values,
respectively.
Next, data were normalized as follows.
First, the lowest fluorescence value, obtained
from the first post-bleaching recording, was
subtracted from each time point value to set
bleach depth to zero. Then, all values were
divided by the value from the last pre-bleaching
(10th) frame, i.e. right before photobleaching.
From each curve, we then obtained three
parameters: [1] the mobile fraction (MF),
determined by averaging the fluorescence values
of the first 30 time-points throughout which the
curve reaches a plateau (30 seconds), and
expressing this value as a percentage of the
maximum fluorescence at pre-bleaching,
indicates the portion of molecules that can
undergo diffusion during the experiment; [2] the
half-time of recovery (τ1/2), i.e. the time-point in
which half of total fluorescence recovery has
occurred (this value inversely correlates to the
rate of diffusion, and therefore to the speed of
molecule movement in the area analyzed); and
[3] the diffusion coefficient (D), indicating rate
of diffusion, and calculated applying the
simplified Soumpasis equation (49):
D = 0.25 · (rn2 / τ1/2)
Statistics
All experiments were performed a
minimum of 3 times. Data are expressed as mean
± SD, as indicated in figure legends, and
displayed as curves or bar graphs superimposed
to scatter plots showing all the individual data
points. Statistical significance was calculated by
the two-tailed Student’s t-test, or by one-way
ANOVA with Tukey's honest significant
difference (HSD) post hoc test by using the R
software for statistical computing (50), when
differences among groups needed to be tested. P
values are also specified in figure legends.
Author contributions
E.C. carried out the experimental work, and contributed in designing the work and writing up
the manuscript. R.B. gave advice and provided financial support to carry out the project. M.V.
conceived the project, designed the work, supervised the experiments, and wrote the manuscript.
Acknowledgements
DNA constructs kindly donated by other researchers were those to express NaV1.5-FLAG
(Matteo Vatta and Jonathan Makielski), in addition to NaV1.5-YFP and β2-YFP (Thomas Zimmer).
Antibodies given by other scientists were those against gp114 and p58 (Kai Simons). Antibodies for
LBPA (Jean Gruenberg) and LAMP-2 (Enrique Rodriguez-Boulan) were also kind gifts. We
appreciate the service and advice from the technicians at the confocal microscopy facility of the Univ.
of Girona-Research Technical Services, and by Maria Buxó, from the IDIBGI Statistical Service. This
study was made possible by the financial support from “La Caixa” Foundation to R.B. E.C. is
recipient of a predoctoral fellowship (FI_B 00071) from the Agència de Gestió d'Ajuts Universitaris i
de Recerca (AGAUR) — Generalitat de Catalunya. We also thank the Spanish Instituto de Salud
Carlos III (ISCIII); the CIBERCV is an initiative of the ISCIII from the Spanish Ministerio de
Ciencia, Innovación y Universidades.
Conflict of interest
The authors declare that they have no conflicts of interest with the contents of this article.
by guest on September 12, 2019http://www.jbc.org/Downloaded from
12
References
1. Amin, A. S., Asghari-Roodsari, A., and Tan, H. L. (2010) Cardiac sodium channelopathies.
Pflugers Arch. 460, 223-237
2. Napolitano, C., and Priori, S. G. (2006) Brugada syndrome. Orphanet J. Rare Dis. 1, 35
3. Rook, M. B., Evers, M. M., Vos, M. A., and Bierhuizen, M. F. (2012) Biology of cardiac
sodium channel Nav1.5 expression. Cardiovasc. Res. 93, 12-23
4. Petitprez, S., Zmoos, A. F., Ogrodnik, J., Balse, E., Raad, N., El-Haou, S., Albesa, M.,
Bittihn, P., Luther, S., Lehnart, S. E., Hatem, S. N., Coulombe, A., and Abriel, H. (2011) SAP97 and
dystrophin macromolecular complexes determine two pools of cardiac sodium channels Nav1.5 in
cardiomyocytes. Circ. Res. 108, 294-304
5. O'Malley, H. A., and Isom, L. L. (2015) Sodium channel beta subunits: emerging targets in
channelopathies. Annu. Rev. Physiol. 77, 481-504
6. Brackenbury, W. J., and Isom, L. L. (2011) Na channel beta subunits: overachievers of the
ion channel family. Front. Pharmacol. 2, 53
7. Chen, C., Calhoun, J. D., Zhang, Y., Lopez-Santiago, L., Zhou, N., Davis, T. H., Salzer, J. L.,
and Isom, L. L. (2012) Identification of the cysteine residue responsible for disulfide linkage of Na+
channel alpha and beta2 subunits. J. Biol. Chem. 287, 39061-39069
8. Zhu, W., Voelker, T. L., Varga, Z., Schubert, A. R., Nerbonne, J. M., and Silva, J. R. (2017)
Mechanisms of noncovalent beta subunit regulation of NaV channel gating. J. Gen. Physiol. 149, 813-
831
9. Hu, D., Barajas-Martinez, H., Burashnikov, E., Springer, M., Wu, Y., Varro, A., Pfeiffer, R.,
Koopmann, T. T., Cordeiro, J. M., Guerchicoff, A., Pollevick, G. D., and Antzelevitch, C. (2009) A
mutation in the beta 3 subunit of the cardiac sodium channel associated with Brugada ECG
phenotype. Circ. Cardiovasc. Genet. 2, 270-278
10. Riuro, H., Beltran-Alvarez, P., Tarradas, A., Selga, E., Campuzano, O., Verges, M., Pagans,
S., Iglesias, A., Brugada, J., Brugada, P., Vazquez, F. M., Perez, G. J., Scornik, F. S., and Brugada, R.
(2013) A missense mutation in the sodium channel beta2 subunit reveals SCN2B as a new candidate
gene for Brugada syndrome. Hum. Mutat. 34, 961-966
11. Watanabe, H., Koopmann, T. T., Le Scouarnec, S., Yang, T., Ingram, C. R., Schott, J. J.,
Demolombe, S., Probst, V., Anselme, F., Escande, D., Wiesfeld, A. C., Pfeufer, A., Kaab, S.,
Wichmann, H. E., Hasdemir, C., Aizawa, Y., Wilde, A. A., Roden, D. M., and Bezzina, C. R. (2008)
Sodium channel beta1 subunit mutations associated with Brugada syndrome and cardiac conduction
disease in humans. J. Clin. Invest. 118, 2260-2268
12. Ishikawa, T., Takahashi, N., Ohno, S., Sakurada, H., Nakamura, K., On, Y. K., Park, J. E.,
Makiyama, T., Horie, M., Arimura, T., Makita, N., and Kimura, A. (2013) Novel SCN3B mutation
associated with brugada syndrome affects intracellular trafficking and function of Nav1.5. Circ. J. 77,
959-967
13. Schmidt, J. W., and Catterall, W. A. (1986) Biosynthesis and processing of the alpha subunit
of the voltage-sensitive sodium channel in rat brain neurons. Cell 46, 437-444
14. Zimmer, T., Biskup, C., Bollensdorff, C., and Benndorf, K. (2002) The beta1 subunit but not
the beta2 subunit colocalizes with the human heart Na+ channel (hH1) already within the endoplasmic
reticulum. The Journal of membrane biology 186, 13-21
15. Dulsat, G., Palomeras, S., Cortada, E., Riuro, H., Brugada, R., and Verges, M. (2017)
Trafficking and localisation to the plasma membrane of Nav1.5 promoted by the beta2 subunit is
defective due to a beta2 mutation associated with Brugada syndrome. Biol. Cell 109, 273-291
16. Stoops, E. H., and Caplan, M. J. (2014) Trafficking to the apical and basolateral membranes
in polarized epithelial cells. J. Am. Soc. Nephrol. 25, 1375-1386
17. Weisz, O. A., and Rodriguez-Boulan, E. (2009) Apical trafficking in epithelial cells: signals,
clusters and motors. J. Cell Sci. 122, 4253-4266
18. Isom, L. L., Ragsdale, D. S., De Jongh, K. S., Westenbroek, R. E., Reber, B. F., Scheuer, T.,
and Catterall, W. A. (1995) Structure and function of the beta 2 subunit of brain sodium channels, a
transmembrane glycoprotein with a CAM motif. Cell 83, 433-442
by guest on September 12, 2019http://www.jbc.org/Downloaded from
13
19. Johnson, D., and Bennett, E. S. (2006) Isoform-specific effects of the beta2 subunit on
voltage-gated sodium channel gating. J. Biol. Chem. 281, 25875-25881
20. The UniProt Consortium (2015) UniProt: a hub for protein information. Nucleic Acids Res.
43, D204-D212
21. Johnson, D., Montpetit, M. L., Stocker, P. J., and Bennett, E. S. (2004) The sialic acid
component of the beta1 subunit modulates voltage-gated sodium channel function. J. Biol. Chem. 279,
44303-44310
22. Hart, G. W. (1992) Glycosylation. Curr. Opin. Cell Biol. 4, 1017-1023
23. Freeze, H. H., and Kranz, C. (2010) Endoglycosidase and glycoamidase release of N-linked
glycans. Curr. Protoc. Mol. Biol. Chapter 17, Unit 17 13A
24. Vagin, O., Kraut, J. A., and Sachs, G. (2009) Role of N-glycosylation in trafficking of apical
membrane proteins in epithelia. Am. J. Physiol. Renal Physiol. 296, F459-F469
25. Bao, Y., Willis, B. C., Frasier, C. R., Lopez-Santiago, L. F., Lin, X., Ramos-Mondragon, R.,
Auerbach, D. S., Chen, C., Wang, Z., Anumonwo, J., Valdivia, H. H., Delmar, M., Jalife, J., and
Isom, L. L. (2016) Scn2b deletion in mice results in ventricular and atrial arrhythmias. Circ.
Arrhythm. Electrophysiol. 9
26. Chen, C., Bharucha, V., Chen, Y., Westenbroek, R. E., Brown, A., Malhotra, J. D., Jones, D.,
Avery, C., Gillespie, P. J., 3rd, Kazen-Gillespie, K. A., Kazarinova-Noyes, K., Shrager, P., Saunders,
T. L., Macdonald, R. L., Ransom, B. R., Scheuer, T., Catterall, W. A., and Isom, L. L. (2002)
Reduced sodium channel density, altered voltage dependence of inactivation, and increased
susceptibility to seizures in mice lacking sodium channel beta 2-subunits. Proc. Natl. Acad. Sci. USA
99, 17072-17077
27. Remme, C. A. (2013) Cardiac sodium channelopathy associated with SCN5A mutations:
electrophysiological, molecular and genetic aspects. The Journal of physiology 591, 4099-4116
28. Balse, E., and Eichel, C. (2018) The cardiac sodium channel and its protein partners. Handb.
Exp. Pharmacol. 246, 73-99
29. Shy, D., Gillet, L., and Abriel, H. (2013) Cardiac sodium channel Nav1.5 distribution in
myocytes via interacting proteins: the multiple pool model. Biochim. Biophys. Acta 1833, 886-894
30. Veerman, C. C., Wilde, A. A., and Lodder, E. M. (2015) The cardiac sodium channel gene
SCN5A and its gene product NaV1.5: Role in physiology and pathophysiology. Gene 573, 177-187
31. Hull, J. M., and Isom, L. L. (2018) Voltage-gated sodium channel beta subunits: The power
outside the pore in brain development and disease. Neuropharmacology 132, 43-57
32. Buffington, S. A., and Rasband, M. N. (2013) Na+ channel-dependent recruitment of
Navbeta4 to axon initial segments and nodes of Ranvier. J. Neurosci. 33, 6191-6202
33. Mercier, A., Clement, R., Harnois, T., Bourmeyster, N., Bois, P., and Chatelier, A. (2015)
Nav1.5 channels can reach the plasma membrane through distinct N-glycosylation states. Biochim.
Biophys. Acta 1850, 1215-1223
34. Ponce-Balbuena, D., Guerrero-Serna, G., Valdivia, C. R., Caballero, R., Diez-Guerra, F. J.,
Jimenez-Vazquez, E. N., Ramirez, R. J., Monteiro da Rocha, A., Herron, T. J., Campbell, K. F.,
Willis, B. C., Alvarado, F. J., Zarzoso, M., Kaur, K., Perez-Hernandez, M., Matamoros, M., Valdivia,
H. H., Delpon, E., and Jalife, J. (2018) Cardiac Kir2.1 and NaV1.5 channels traffic together to the
sarcolemma to control excitability. Circ. Res. 122, 1501-1516
35. Perez-Hernandez, M., Matamoros, M., Alfayate, S., Nieto-Marin, P., Utrilla, R. G.,
Tinaquero, D., de Andres, R., Crespo, T., Ponce-Balbuena, D., Willis, B. C., Jimenez-Vazquez, E. N.,
Guerrero-Serna, G., da Rocha, A. M., Campbell, K., Herron, T. J., Diez-Guerra, F. J., Tamargo, J.,
Jalife, J., Caballero, R., and Delpon, E. (2018) Brugada syndrome trafficking-defective Nav1.5
channels can trap cardiac Kir2.1/2.2 channels. JCI insight 3, pii: 96291
36. Pralle, A., Keller, P., Florin, E. L., Simons, K., and Horber, J. K. (2000) Sphingolipid-
cholesterol rafts diffuse as small entities in the plasma membrane of mammalian cells. J. Cell Biol.
148, 997-1008
37. Peran, M., Hicks, B. W., Peterson, N. L., Hooper, H., and Salas, R. (2001) Lateral mobility
and anchoring of recombinant GABAA receptors depend on subunit composition. Cell Motil.
Cytoskeleton 50, 89-100
by guest on September 12, 2019http://www.jbc.org/Downloaded from
14
38. Zimmer, T., and Benndorf, K. (2007) The intracellular domain of the beta 2 subunit
modulates the gating of cardiac Nav1.5 channels. Biophys. J. 92, 3885-3892
39. Valdivia, C. R., Medeiros-Domingo, A., Ye, B., Shen, W. K., Algiers, T. J., Ackerman, M. J.,
and Makielski, J. C. (2010) Loss-of-function mutation of the SCN3B-encoded sodium channel
{beta}3 subunit associated with a case of idiopathic ventricular fibrillation. Cardiovasc. Res. 86, 392-
400
40. Verges, M., Sebastian, I., and Mostov, K. E. (2007) Phosphoinositide 3-kinase regulates the
role of retromer in transcytosis of the polymeric immunoglobulin receptor. Exp. Cell Res. 313, 707-
718
41. Breitfeld, P. P., Casanova, J. E., Harris, J. M., Simister, N. E., and Mostov, K. E. (1989)
Expression and analysis of the polymeric immunoglobulin receptor in Madin-Darby canine kidney
cells using retroviral vectors. Methods Cell Biol. 32, 329-337
42. Huet, G., Hennebicq-Reig, S., de Bolos, C., Ulloa, F., Lesuffleur, T., Barbat, A., Carriere, V.,
Kim, I., Real, F. X., Delannoy, P., and Zweibaum, A. (1998) GalNAc-alpha-O-benzyl inhibits
NeuAcalpha2-3 glycosylation and blocks the intracellular transport of apical glycoproteins and mucus
in differentiated HT-29 cells. J. Cell Biol. 141, 1311-1322
43. Lippincott-Schwartz, J., and Liu, W. (2006) Insights into COPI coat assembly and function in
living cells. Trends Cell Biol. 16, e1-e4
44. Fullekrug, J., Shevchenko, A., Shevchenko, A., and Simons, K. (2006) Identification of
glycosylated marker proteins of epithelial polarity in MDCK cells by homology driven proteomics.
BMC Biochem. 7, 8
45. Stevenson, B. R., Siliciano, J. D., Mooseker, M. S., and Goodenough, D. A. (1986)
Identification of ZO-1: a high molecular weight polypeptide associated with the tight junction (zonula
occludens) in a variety of epithelia. J. Cell Biol. 103, 755-766
46. Cuartero, Y., Mellado, M., Capell, A., Alvarez-Dolado, M., and Verges, M. (2012) Retromer
regulates postendocytic sorting of beta-secretase in polarized Madin-Darby canine kidney cells.
Traffic 13, 1393-1410
47. Mellado, M., Cuartero, Y., Brugada, R., and Verges, M. (2014) Subcellular localization of
retromer in postendocytic pathways of polarized Madin-Darby canine kidney cells. Biol. Cell 106,
377–393
48. Phair, R. D., Gorski, S. A., and Misteli, T. (2004) Measurement of dynamic protein binding to
chromatin in vivo, using photobleaching microscopy. Methods Enzymol. 375, 393-414
49. Kang, M., Day, C. A., Kenworthy, A. K., and DiBenedetto, E. (2012) Simplified equation to
extract diffusion coefficients from confocal FRAP data. Traffic 13, 1589-1600
50. Dessau, R. B., and Pipper, C. B. (2008) [''R"--project for statistical computing]. Ugeskrift for
laeger 170, 328-330
Abbreviations
BrS, Brugada Syndrome; CTCF, corrected total cell fluorescence; D, diffusion coefficient;
DAPI, 4',6-diamidino-2-phenylindole; EE, early endosome; Endo H, endoglycosidase H; ER,
endoplasmic reticulum; FRAP, fluorescence recovery after photobleaching; GalNAc-O-bn, benzyl-2-
acetamido-2-deoxy-α-D-galactopyranoside; GlcNAc, N-acetylglucosamine; GM130, Golgi matrix
protein of 130 kDa; τ1/2, half-time of recovery; HSD, honest significant difference; LBPA,
lysobisphosphatidic acid; LAMP, lysosomal-associated membrane protein; MDCK, Madin-Darby
canine kidney; MF, mobile fraction; MFI, mean fluorescence intensity; NA, α2-3,6,8 neuraminidase;
NaV, voltage-gated sodium; rn, nominal radius; PNGase F, peptide:N-glycosidase F; TGN, trans-Golgi
network; TMD, transmembrane domain; TUN, tunicamycin; WT, wild-type.
by guest on September 12, 2019http://www.jbc.org/Downloaded from
15
Figures
Figure 1. β2 is N-glycosylated at positions Asn-42, Asn-66 and Asn-74.
MDCK cells were transiently transfected with the SCN2B-yfp vector to express WT, partially,
or fully unglycosylated β2, or left untransfected (utf). (A, B) Cells were grown for 2 days in wells.
Representative western blots are shown with the same amount of protein lysate loaded into each lane.
(A) All glycosylation-defective mutants display increased electrophoretic mobility, with N42Q as the
single mutant with the greatest change, and triple (fully) unglycosylated β2 showing complete shift.
(B) Denatured protein from cell lysates was treated o/n at 37°C with PNGase F to cleave off all N-
glycans. (C) Cells were treated with TUN, or with GalNAc-O-bn, to block N- or O-glycosylation,
respectively, and grown for 1 day in wells; β2 WT remains unglycosylated only with TUN. DMSO:
indicates cells with the equivalent volume of solvent added, and "-", untreated cells. Blots for Na/K-
ATPase or actin are included as loading controls. Molecular weight markers are in kilodaltons (kDa).
by guest on September 12, 2019http://www.jbc.org/Downloaded from
16
Figure 2. β2 undergoes complex N-glycosylation and is sialylated at Asn-42.
MDCK cells were transiently transfected with the SCN2B-yfp vector to express WT, partially,
or fully unglycosylated β2, and grown for 1 day in wells. Representative western blots are shown with
the same amount of protein lysate loaded into each lane. Note that immature (unprocessed) β2 is
clearly discernible from the slow-migrating mature form (compare with Figure 1). (A) Denatured
protein from cell lysates was treated o/n at 37°C with Endo H to cleave off immature N-glycans
(faster-migrating band) in β2. (B) Lysates were treated o/n at 37°C with NA to cleave off all terminal
sialic acids. The upper band displays a slight increase in mobility in WT and single and double
mutants not including the N42Q mutation (red fonts). Blots for actin are included as loading controls.
Molecular weight markers are in kilodaltons (kDa). The division line in B separates different blots
(taken from the same exposure) conveniently put together for clear display.
by guest on September 12, 2019http://www.jbc.org/Downloaded from
17
Figure 3. N-glycosylation is required for efficient cell surface localization of β2.
MDCK cells were transiently transfected with the SCN2B-yfp vector to express WT, partially,
or fully unglycosylated β2. (A, B) Cells were grown for 2 days in wells, or (C, D) polarized in
Transwells, and surface biotinylated at 4ºC. (A, C) Representative western blots and (B, D) band
quantitation show that levels of fully unglycosylated β2 were reduced in comparison with the WT and
partially glycosylated mutants in biotin-NeutrAvidin pulldowns, both in subconfluent and in polarized
cells. One-way ANOVA with Tukey’s HSD post hoc test highlighted these differences (B: *P <
0.001; D: *P < 0.05). (A, C) Values underneath blots show the percentage of each β2 variant at the
surface over total cellular β2 protein. (E, F) Cells were treated with TUN to block N-glycosylation,
grown for 1 day in wells, and surface biotinylated at 4ºC (UT, untreated cells). (E) Representative
western blots and (F) band quantitation show absence of unglycosylated β2 in pulldowns (two-tailed
Student’s t-test shows significant differences; *P = 0.009). The same amount of protein was used to
process each lysate (≈ 130 μg), and the corresponding portion (nine tenths) was subjected to overnight
pulldown. Na/K-ATPase (B, E) or gp114 (C) were blotted as surface markers to correct for
quantitations in pulldowns. All data are mean ± SD (n ≥ 3). Molecular weight markers are in
by guest on September 12, 2019http://www.jbc.org/Downloaded from
19
Figure 4. Defect over time in β2 surface localization due to lack of N-glycosylation.
MDCK cells were transiently transfected with the SCN2B-yfp vector to express WT, partially,
or fully unglycosylated β2. Cells were grown in wells for the indicated number of days and surface
biotinylated at 4ºC. (A) Representative western blots and (B-E) band quantitation show that levels of
fully unglycosylated β2 were reduced in comparison with the WT and partially glycosylated mutants
in biotin-NeutrAvidin pulldowns (Membrane). One-way ANOVA with Tukey’s HSD post hoc test
highlighted these differences, with a few exceptions (B: all P < 0.05, except 42 vs. UNG: P = 0.054;
C: all P < 0.05 except 42 vs. UNG: P = 0.052, and 74 vs. UNG: P = 0.189; D: P < 0.002; and E: P <
0.005). The same amount of protein was used to process each lysate (≈ 130 μg), and the
corresponding portion (nine tenths) was subjected to overnight pulldown. Na/K-ATPase was blotted
as surface marker to correct for quantitations in pulldowns. Data are mean ± SD (n ≥ 3). Molecular
weight markers are in kilodaltons (kDa).
by guest on September 12, 2019http://www.jbc.org/Downloaded from
20
Figure 5. Unglycosylated β2 is retained in the endoplasmic reticulum (ER).
MDCK cells were transiently transfected with the SCN2B-yfp vector to express WT or fully
unglycosylated β2 (ung), and grown for 1 day in wells. Cells were treated with TUN 2 h after
transfection, or left untreated (-), fixed, and immunostained with a rabbit polyclonal antibody against
calnexin (red). (A) Representative XY sections show that unglycosylated β2 (green) is intracellular
and overlaps with calnexin, as does the WT in TUN-treated cells. This contrasts with the localization
of β2 WT at the cell end in untreated cells, also displaying a scattered pattern. To focus more
accurately where β2 is found in each condition, sections were taken right above the nucleus (WT -) or
at the nuclear level (for the rest). Nuclear staining by DAPI is in blue. Scale bar is 10 μm. (B) Line
chart showing Manders’ coefficients calculated along the z-axis and indicating the fraction of β2
overlapping to compartments labeled with calnexin. The high overlap in TUN-treated cells and in
those expressing unglycosylated β2 contrasts with negligible overlap in untreated cells expressing β2
WT. One-way ANOVA with Tukey’s HSD post hoc test revealed differences among means (*P <
0.0005). Data are mean ± SD (n ≥ 3).
by guest on September 12, 2019http://www.jbc.org/Downloaded from
21
Figure 6. Brefeldin A (BFA) prevents complex glycosylation of β2, a fraction of which can reach
the cell surface.
MDCK cells were transiently transfected with the SCN2B-yfp vector to express WT or fully
unglycosylated β2 (ung), then treated 2 h later with BFA (+), or left untreated (-), and grown o/n in
wells. (A, C) Cells were surface biotinylated at 4ºC. The same amount of protein was used to process
each lysate (≈ 100 μg) and the corresponding portion (nine tenths) subjected to overnight pulldown.
Denatured protein from cell lysates and pulldowns was treated o/n at 37°C with Endo H to cleave off
immature N-glycans, or left untreated (-). Representative western blots show that the (lower) faster-
migrating band of β2 WT is the only one visible in cells treated with BFA and increases its mobility
with the Endo-H treatment; this band coincides with unglycosylated β2 (C; compare with Figure 2A).
Note that Endo-H digestion in pulldowns is only partial, either due to saturation of the enzyme or to
suboptimal conditions for enzyme action. Blots for Na/K-ATPase are included as loading controls.
Molecular weight markers are in kilodaltons (kDa). (B) Band quantitation shows reduced levels of
immature β2 in biotin-NeutrAvidin pulldowns (Membrane) of BFA-treated cells. Two-tailed
Student’s t-test shows significant difference (*P < 0.05). Data are mean ± SD (n ≥ 3). (D) Cells were
by guest on September 12, 2019http://www.jbc.org/Downloaded from
22
fixed and immunostained with a rabbit polyclonal antibody against calnexin (red) and a mouse
monoclonal to GM130 (blue). Representative XY sections show that, in BFA-treated cells, β2 WT
displays an intracellular accumulation comparable to mutated β2 (green), grossly overlapping with
calnexin in enlarged structures (arrowheads). This contrasts with its apparent localization in the
plasma membrane in untreated cells, displaying also a scattered pattern that does not overlap with
calnexin (sections were taken at the cell level where β2 is mainly found in each case). Nuclear
staining by DAPI is in gray. Scale bar is 10 μm.
by guest on September 12, 2019http://www.jbc.org/Downloaded from
23
Figure 7. Dynamics of β2 is not influenced by N-glycosylation.
MDCK cells were transiently transfected with the SCN2B-yfp vector to express WT or fully
unglycosylated (ung) β2, and grown for 2 days on glass supports. Mobility of β2-YFP on three
different cellular locations was monitored by FRAP with a confocal microscope. Line charts of
fluorescence intensity (mean ± SD) of ≥ 3 representative experiments show comparable mobile
fraction between β2 WT (blue line) and mutant (red line) at the three regions analyzed, i.e., (A) the
cell end, (B) the cytoplasm matrix, and (C) in large vesicular structures. For each, images on the right
show a representative cell pre-bleached, right after bleaching, and after fluorescence recovery
(arrowheads mark the bleached area); see the complete FRAP data in Supplementary Table S1. Scale
bar is 10 μm.
by guest on September 12, 2019http://www.jbc.org/Downloaded from
24
Figure 8. Surface localization of NaV1.5 is reduced with unglycosylated β2.
(A, B) MDCK cells stably expressing WT or fully unglycosylated (ung) β2-YFP were
transiently transfected with the vector SCN5A-FLAG and grown polarized in Transwells. Cells were
fixed and immunostained with a rabbit polyclonal antibody against NaV1.5 (red), and with a mouse
monoclonal antibody to gp114 (cyan). Images were obtained by confocal microscopy. In merged
images, the YFP-emitted fluorescence is in green and DAPI is in blue. Representative XY sections
taken at the apical (A), or nuclear (B) levels (sections taken at the cell level where NaV1.5 is mainly
found in each case), and corresponding z-axis reconstruction (reciprocal XZ and XY sections marked
by a yellow dashed line), show improved apical localization of NaV1.5 with β2 WT (A), which
remains mostly intracellular in the presence of unglycosylated β2 (B); note the intracellular NaV1.5
accumulation with mutated β2 (arrowhead). Scale bars are 10 μm. (C, D) Line charts displaying the
corrected total cell fluorescence (CTCF, mean percentage ± SD) along an apical-to-basal z-stack
(section 1: most apical; 0.5 μm optical slice thickness) show the NaV1.5 curve peak close to those of
apical gp114 and β2 WT (C). In contrast, NaV1.5 is displaced toward the nuclear section with mutated
β2, which overlays with DAPI (D), included as reference for the nuclear level (≥ 6 cells were
analyzed per condition). (E) MDCK cells stably expressing NaV1.5-YFP were transiently
by guest on September 12, 2019http://www.jbc.org/Downloaded from
25
cotransfected with the SCN2B-yfp vector to express β2, WT or fully unglycosylated (ung), plus
additional SCN5A-FLAG vector to ensure extensive NaV1.5 overexpression, and grown o/n in wells;
the pEGFP-N1 vector was used as a control. Cells were surface biotinylated at 4ºC. The same amount
of protein was used to process each lysate (≈ 600 μg), 97 % of which was subjected to overnight
NeutrAvidin pulldown. Representative western blots and (F) band quantitation show reduced levels of
NaV1.5 in biotin-NeutrAvidin pulldowns (Membrane) in the presence of unglycosylated β2, or
without β2 (GFP), when comparing with the WT. One-way ANOVA with Tukey’s HSD post hoc test
showed significant differences (*P < 0.002). The percentage of NaV1.5 at the cell surface over total
cellular NaV1.5 protein varied from 1.42 ± 0.98 in the WT to 0.73 ± 0.50 % with unglycosylated β2.
Data are mean ± SD (n ≥ 6). Na/K-ATPase was blotted as surface marker to correct for quantitations
in pulldowns. Molecular weight markers are in kilodaltons (kDa). For clear display, the blot in E
shows lysates and pulldowns separated by division lines, which indicate different exposure between
lysates and pulldowns but equal exposure within each group.
by guest on September 12, 2019http://www.jbc.org/Downloaded from
26
Figure 9. Defect over time of unglycosylated β2 in promoting surface localization of NaV1.5.
MDCK cells stably expressing WT (A) or fully unglycosylated (ung) β2-YFP (C), or
untransfected (parental) cells (E), were transiently transfected with the vector SCN5A-FLAG and
grown in wells for the indicated number of days. Cells were fixed and immunostained with a rabbit
polyclonal antibody against NaV1.5 (red), and with a mouse monoclonal antibody to Na/K-ATPase
(blue). Images were obtained by confocal microscopy. In merged images, the YFP-emitted
fluorescence is in green and DAPI is in gray. (A, C, E) Representative XY sections (sections taken at
the cell level where NaV1.5 is mainly found in each case) show a general diffuse NaV1.5 pattern,
intracellular and often perinuclear, except for a noticeable overlap with Na/K-ATPase, particularly at
day 1, in the presence of β2 WT. Scale bars are 10 μm. Confocal images were analyzed by calculating
the mean fluorescence intensity (MFI) along linear segments of 30 pixels in length (d, distance; 0.1
μm/pixel) drawn from the cell end perpendicularly into the cytoplasm. (B, D, F) Line charts show
MFIs with the first 5 pixels of the segments, equivalent to the plasma membrane region (cell end),
marked with a square bracket. The highest MFI levels are at the cell end for Na/K-ATPase and for β2
WT, which progressively decrease intracellularly. The profile for NaV1.5 increases at the cell end only
in the presence of β2 WT and especially at day 1 (B), but remains comparatively low within this
region with unglycosylated β2 (D) or in the absence of β2 (F). Data are mean ± SD (number of cells
analyzed ≥ 3; 4 segments / cell).
by guest on September 12, 2019http://www.jbc.org/Downloaded from
27
Figure 10. Single β2 glycosylation mutants can promote surface localization of NaV1.5 – analysis
over time.
MDCK cells stably expressing the indicated single mutants for β2-YFP glycosylation were
transiently transfected with the vector SCN5A-FLAG and grown in wells for the specified number of
days. Cells were fixed and immunostained with a rabbit polyclonal antibody against NaV1.5 (red), and
with a mouse monoclonal antibody to Na/K-ATPase (blue). Images were obtained by confocal
microscopy. In merged images, the YFP-emitted fluorescence is in green and DAPI is in gray. (A, C,
E) Representative XY sections (taken at the level where NaV1.5 is mainly found in each case) show
some areas of overlap of NaV1.5 with Na/K-ATPase at the cell end, particularly at day 1, in the
presence of any of the mutants, while remaining mostly disperse throughout the cells in later time
points. Scale bars are 10 μm. Confocal images were analyzed by calculating the MFI along linear
segments of 30 pixels in length (d, distance; 0.1 μm/pixel) drawn from the cell end perpendicularly
into the cytoplasm. (B, D, F) Line charts show MFIs with the first 5 pixels of the segments, equivalent
to the plasma membrane region (cell end), marked with a square bracket. The highest MFI levels are
at the cell end for Na/K-ATPase and for the different β2 single mutants, all progressively decreasing
intracellularly. The profile for NaV1.5 increases at the cell end at day 1 in all cases, remaining
comparatively low within this region at later time points. Data are mean ± SD (number of cells
analyzed ≥ 3, 4 segments / cell).
by guest on September 12, 2019http://www.jbc.org/Downloaded from
29
Figure 11. Single and double glycosylation mutants of β2 can promote surface localization of
NaV1.5. MDCK cells (A, C, E) stably expressing the indicated single mutants for β2-YFP
glycosylation were transiently transfected with the vector SCN5A-FLAG and grown polarized in
Transwells. Cells were fixed and immunostained with a rabbit polyclonal antibody against NaV1.5
(red), and with a mouse monoclonal antibody to gp114 (cyan). Images were obtained by confocal
microscopy. In merged images, the YFP-emitted fluorescence is in green and DAPI is in gray.
Representative XY sections taken at the apical level (section level chosen to assess presence of
NaV1.5 at the apical surface), and corresponding z-axis reconstruction (reciprocal XZ and XY sections
marked by a yellow dashed line), show noticeable apical localization of NaV1.5 with the different β2
variants. Scale bars are 10 μm. (B, D, F) Line charts displaying the CTCF (mean percentage ± SD)
along an apical-to-basal z-stack (section 1: most apical; 0.5 μm optical slice thickness) show the
NaV1.5 curve peak in close proximity to those of apical gp114 and any of the β2 mutants. DAPI is
included as reference for the nuclear level (≥ 6 cells were analyzed per condition). (G, I) MDCK cells
stably expressing NaV1.5-YFP were transiently cotransfected with the SCN2B-yfp vector to express
β2-YFP, WT, or any of the indicated single (G) or double (I) mutant, plus additional SCN5A-FLAG
vector to ensure extensive NaV1.5 overexpression, and grown o/n in wells. Cells were surface
biotinylated at 4ºC. The same amount of protein was used to process each lysate (≈ 600 μg), 97 % of
which was subjected to overnight NeutrAvidin pulldown. (G, I) Representative western blots and (H,
J) band quantitation show comparable levels of NaV1.5 in biotin-NeutrAvidin pulldowns (Membrane)
in the presence of any mutant variant of β2 as with the WT. One-way ANOVA revealed no
differences among means. Data are mean ± SD (n ≥ 3). Na/K-ATPase was blotted as surface marker
to correct for quantitations in pulldowns. Molecular weight markers are in kilodaltons (kDa). For clear
display, the blots in G and I show lysates and pulldowns separated by division lines, which indicate
different exposure between each.
by guest on September 12, 2019http://www.jbc.org/Downloaded from
Eric Cortada Sr., Ramon Brugada and Marcel Verges
2 to the plasma membrane.β1.5/
V
efficient trafficking of Na 2 subunit is required forβ-glycosylation of the voltage-gated sodium channel N
published online September 11, 2019J. Biol. Chem.
10.1074/jbc.RA119.007903Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted• When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on September 12, 2019http://www.jbc.org/Downloaded from
