Access to this full-text is provided by Springer Nature.
Content available from Stem Cell Research & Therapy
This content is subject to copyright. Terms and conditions apply.
R E S E A R C H Open Access
PBX homeobox 1 enhances hair follicle
mesenchymal stem cell proliferation and
reprogramming through activation of the
AKT/glycogen synthase kinase signaling
pathway and suppression of apoptosis
Yixu Jiang
1
, Feilin Liu
2
, Fei Zou
3
, Yingyao Zhang
4
, Bo Wang
4
, Yuying Zhang
4
, Aobo Lian
4
, Xing Han
4
, Zinan Liu
4
,
Xiaomei Liu
4
, Minghua Jin
4
, Dianliang Wang
5
, Gang Li
6
and Jinyu Liu
1,4*
Abstract
Background: PBX homeobox 1 (PBX1) is involved in the maintenance of the pluripotency of human embryonic
and hematopoietic stem cells; however, the effects of PBX1 in the self-renewal and reprogramming of hair follicle
mesenchymal stem cells (HF-MSCs) are unclear. The AKT/glycogen synthase kinase (GSK) 3βpathway regulates cell
metabolism, proliferation, apoptosis, and reprogramming, and p16 and p21, which act downstream of this pathway,
regulate cell proliferation, cell cycle, and apoptosis induced by reprogramming. Here, we aimed to elucidate the
roles of PBX1 in regulating the proliferation and reprogramming of HF-MSCs.
Methods: A lentiviral vector designed to carry the PBX1 sequence or PBX1 short hairpin RNA sequence was used to
overexpress or knock down PBX1. The roles of PBX1 in proliferation and apoptosis were investigated by flow
cytometry. Real-time polymerase chain reaction was performed to evaluate pluripotent gene expression. Dual-luciferase
reporter assays were performed to examine the transcriptional activity of the NANOG promoter. Western blotting was
performed to identify the molecules downstream of PBX1 involved in proliferation and reprogramming. Caspase3
activity was detected to assess HF-MSC reprogramming. The phosphatidylinositol 3-kinase/AKT inhibitor LY294002 was
used to inhibit the phosphorylation and activity of AKT.
Results: Overexpression of PBX1 in HF-MSCs increased the phosphorylation of AKT and nuclear translocation of β-catenin,
resulting in the progression of the cell cycle from G
0
/G
1
to S phase. Moreover, transfection with a combination of five
transcription factors (SOMKP) in HF-MSCs enhanced the formation of alkaline phosphatase-stained colonies compared with
that in HF-MSCs transfected with a combination of four transcription factors (SOMK). PBX1 upregulated Nanog transcription
by activating the promoter and promoted the expression of endogenous SOX2 and OCT4. Furthermore, PBX1 expression
activated the AKT/glycogen synthase kinase (GSK) 3βpathway and reduced apoptosis during the early stages of
reprogramming. Inhibition of phospho-AKT or knockdown of PBX1 promoted mitochondrion-mediated apoptosis and
reduced reprogramming efficiency.
(Continued on next page)
© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
* Correspondence: jy_liu@jlu.edu.cn
1
The Key Laboratory of Pathobiology, Ministry of Education, Department of
Pathology, College of Basic Medical Sciences, Jilin University, 126 Xinmin
Avenue, Changchun 130021, China
4
Department of Toxicology, School of Public Health, Jilin University, 1163
Xinmin Avenue, Changchun 130021, China
Full list of author information is available at the end of the article
Jiang et al. Stem Cell Research & Therapy (2019) 10:268
https://doi.org/10.1186/s13287-019-1382-y
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
(Continued from previous page)
Conclusions: PBX1 enhanced HF-MSC proliferation, and HF-MSCs induced pluripotent stem cells (iPSC) generation by
activating the AKT/GSK3βsignaling pathway. During the reprogramming of HF-MSCs into HF-iPSCs, PBX1 activated the
NANOG promoter, upregulated NANOG, and inhibited mitochondrion-mediated apoptosis via the AKT/GSK3βpathway
during the early stages of reprogramming.
Keywords: Hair follicle mesenchymal stem cells, PBX homeobox 1, NANOG, AKT, Glycogen synthase kinase 3β, Apoptosis
Background
Increasing evidence has shown that transcription fac-
tors (TFs) orchestrate a complicated gene expression
network and synergistically interact in a temporal and
spatial manner to maintain stem cell self-renewal,
multipotency, and reprogramming of somatic cells into
pluripotent stem cells (PSCs). Cells recapture the devel-
opmental potency by the introduction of specific TFs,
reprogramming proteins, chemical compounds, micro-
RNAs, and antibodies, indicating great potential for
biomedical research and regenerative medicine [1–5].
In general, the generation of inducible PSCs (iPSCs) by
transduction with SRY-box 2 (SOX2), octamer-binding
transcription factor 4 (OCT4), c-MYC,andKruppel-like
factor 4 (KLF4)(SOMK)isahighlyreproduciblebutin-
efficient process and maybe one of the main hurdles for
the therapeutic application of iPSCs. In recent years,
many researchers have focused on the identification of
important players that can enhance or inhibit the
reprogramming process, such as ZIC3,NAC1,and
PHLDA3 [6–8].
PBX homeobox 1 (PBX1) is a homeodomain TF that
forms hetero-oligomeric complexes with HOX and
transcription activator-like effector proteins to regulate
numerous embryonic processes, including morphologic
patterning, organogenesis, and hematopoiesis [9–11].
PBX1 is a three-amino acid loop extension homeodomain
TF that dimerizes with other homeodomain proteins via a
PBC domain to form nuclear complexes, which can
enhance protein binding to DNA [12]. Research from
Wang’s group has shown that there is a feedback inter-
action loop between PBX1 and NANOG [13]. Moreover,
PBX1 binding to the NANOG promoter individually or in
combination with OCT4 and KLF4 activate NANOG
transcription and subsequently support the self-renewal
capability of human embryonic stem cells (hESCs) [14].
As a serine-threonine kinase, AKT regulates many
downstream signaling pathways that control cell metabol-
ism, proliferation, apoptosis, and reprogramming [15–17].
AKT phosphorylation upregulates cyclin D1 by inhibiting
the expression of p16 and p21, which shift hair follicle
(HF) mesenchymal stem cells (MSCs) at the G
1
phase to
the S phase [18]. Acting downstream of AKT/GSK3β
signaling, p16 and p21 inhibit cyclin-dependent kinases
dynamically and regulate proliferation by arresting cell
cycle at G
1
/S phase. AKT activation can upregulate
glucose transporters and metabolic enzymes involved in
glycolysis, thereby enhancing the generation of iPSCs from
human somatic cells [19,20]. In the primate iPSC pluripo-
tency network, the AKT pathway significantly upregulates
T-box 3, a known transcriptional repressor that interacts
with the pluripotency factors NANOG and OCT4 to pro-
mote the maintenance of pluripotency [21,22]. Moreover,
the AKT/GSK3βpathway is involved in β-catenin phos-
phorylation and regulates β-catenin to affect ubiquitin-
mediated protein degradation. Accumulation of β-catenin
by inhibition of GSK3βactivity promotes the translocation
of β-catenin into the nucleus [23]. Nuclear β-catenin then
interacts with TFs and co-activators to promote Wnt
target gene expression [24]. Simultaneously, nuclear β-ca-
tenin protects against apoptosis by deletion of p53 and
p21, thereby increasing reprogramming efficiency [25].
Hair follicles are an easily accessible rich source of
autologous stem cells, exhibiting tremendous advantages
over other cell sources in various clinical applications.
Indeed, the use of hair follicle mesenchymal stem cells (HF-
MSCs) as a cell source for skin wound healing, hair follicle
regeneration, nerve repair, cardiovascular tissue engi-
neering, and gene therapy has shown remarkable success
[26–29]. In a previous study, we successfully use transgenic
HF-MSCs overexpressing the release-controlled insulin
gene to reverse hyperglycemia and decrease mortality rates
in streptozotocin-induced diabetic mice [30]. However, the
limited differentiation potential of HF-MSCs restricts their
potential applications. Therefore, we reprogrammed HF-
MSCs to generate iPSCs that were indistinguishable from
hESCs in terms of colony morphology and expression of
specific hESC surface markers by lentiviral transduction
with SOMK, and these HF-iPSCs could be used as alterna-
tive cellular tools for inducing hepatocytes in vitro [31,32].
Maintenance of HF-MSCs self-renewal ability and enhance-
ment of iPSC generation are essential for the applications
in stem cell-based regenerative medicine.
In this study, we aimed to further elucidate the
applications of HF-MSCs by investigating the roles of
PBX1 in regulating the proliferation and reprogram-
ming of human HF-MSCs. Our results provided
important insights into the mechanisms mediating the
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 2 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
maintenance of HF-MSC self-renewal ability and
pluripotency.
Methods
Establishment of HF-MSCs
After the approval of the study protocol by the Ethics
Committee of Basic College of Medicine, Jilin University,
HF-MSC isolation was performed as described previously
[30]. Briefly, HFs were rinsed three times in phosphate-buff-
ered saline (PBS) containing 100 IU/mL penicillin and 100
IU/mL streptomycin (Hyclone, Australia), seeded into 24-
well plates (Corning, MA, USA) at one hair follicle per well,
and cultured in Dulbecco’s modified Eagle’smedium
(DMEM)/Ham’s F-12 medium (Life Technologies, USA)
containing 10% fetal bovine serum (FBS; Hyclone, USA) and
4 ng/mL basic fibroblast growth factor (bFGF; Invitrogen,
USA) at 37 °C in an incubator with an atmosphere contain-
ing 5% CO
2
. When HF-MSCs proliferated to 80% con-
fluence, they were subcultured. HF-MSCs were used for
experiments at passages 3–8.
Immunofluorescence staining and flow cytometry
For immunofluorescence staining, HF-MSCs or HF-iPSCs
were fixed with 4% paraformaldehyde for 15 min at room
temperature, blocked with 1% bovine serum albumin
(Roche Diagnostics, France), and incubated with primary
antibodies against CD90, CD105, CD31 (Bioscience, CA,
USA),CD44(R&DSystems,UK),CD73(LifeTechnologies,
USA), stage-specific embryonic antigen (SSEA) 3, SSEA4
(Developmental Studies Hybridoma Bank, USA), TRA-1-
60, TRA-1-81 (Chemicon, USA), NANOG (R&D Systems),
and OCT4 (Santa Cruz Biotechnology, Santa Cruz, CA,
USA) at 4 °C overnight. The next day, Alexa Fluor 488-con-
jugated goat anti-mouse/rabbit antibodies were used to de-
tect the primary antibodies (Cell Signaling Technology,
Danvers, MA, USA). HF-MSCs were then counterstained
with DAPI (Life Technologies, USA) and imaged using
fluorescence microscopy (Olympus, Japan). For flow cytom-
etry, HF-MSCs were collected by centrifugation, fixed with
paraformaldehyde, blocked with bovine serum albumin,
and incubated with primary and secondary antibodies as
described above. HF-MSCs were then subjected to flow
cytometry (FACS Calibur flow cytometer; BD Biosciences,
San Jose, CA, USA) and analyzed using FlowJo software.
Analysis of the multipotency of HF-MSCs
For adipogenic differentiation assays [30], HF-MSCs were
cultured in adipogenic differentiation medium consisting
of high-glucose DMEM (Life Technologies) containing
10% FBS (Hyclone), 1 mM dexamethasone, 0.5 mM isobu-
tylmethylxanthine, 10 mM insulin, and 200 mM indo-
methacin (Sigma-Aldrich, MO, USA). Two weeks after
adipogenic induction, Oil red O (Sigma-Aldrich) staining
was performed to inspect intracellular lipid droplets.
For osteogenic differentiation assays, HF-MSCs were
cultured in high-glucose DMEM containing 10% FBS, 0.1
mM dexamethasone, 50 mM ascorbate-2-phosphate, and
10 nM β-glycerophosphate (Sigma-Aldrich) for 4 weeks.
At the end of culture, Alizarin red S (Sigma-Aldrich)
staining was performed to inspect the formation of
calcium nodules.
Cell proliferation assay
A Cell Counting Kit-8 (CCK-8; Dojindo, Japan) was
used to detect the proliferation of HF-MSCs. Briefly,
2×10
3
cells were seeded in 96-well plates in triplicate
and cultured in DMEM/F-12 medium supplemented
with 4 ng/mL bFGF and 10% FBS. After 24, 48, 72, and
96 h, CCK-8 reagent was added to each well, and plates
were incubated for an additional 2 h. At the end of in-
cubation, the absorbance of the supernatant from each
well was measured using a microplate reader (Synergy
H1; Biotek, USA) at 450 nm. The results were plotted
as the means ± standard deviations from three separate
experiments.
Cell cycle assay
HF-MSCs were transduced with lentiviruses encoding
PBX1,PBX1 short hairpin RNA (shRNA), or empty vec-
tor. After cells proliferated to 80% confluence, they were
collected (1 × 10
6
) by trypsin digestion and centrifugation,
washed with cold PBS, and fixed with 70% ice-cold etha-
nol for 1 h at 4 °C. Finally, the cells were washed with PBS
three times and incubated in 500 μL propidium iodide so-
lution containing RNase (BD, USA) for 15 min at room
temperature. After incubation, HF-MSCs were washed
with PBS and subjected to flow cytometry. ModFitLT was
used to estimate G
0
/G
1
/S/G
2
/M phases of the cell cycle.
The cell proliferation index (PI) was calculated as follows:
PI = (S + G
2
/M)/(G
0
/G
1
+S+G
2
/M) × 100%.
Lentiviral vector construction and HF-iPSC generation
The lentiviral vector pLV-CMV-CDNA-IRES-EGFP en-
coding PBX1 was obtained from Youbio (China), and the
vector pLV-EF1α-CDNA-IRES-EGFP encoding one of the
four transcription factors (OCT4,SOX2,c-MYC,orKLF4)
was obtained from the Xiaolei Group (Shanghai Institute
of Biochemistry and Cell Biology, Chinese Academy of
Sciences, Shanghai, China). PBX1 and NANOG shRNA se-
quences were cloned into the lentiviral vector GV115
(GNEN, China). The sequences targeted by shRNA were
as follows: PBX1 (GATCCTGCGTTCCCGATTT) and
NANOG (TAAACTACTCCATGAACAT). For the prep-
aration of the lentivirus, 10 μg lentiviral vector was
cotransfected with 7.5 μg pMD2.G and 2.5 μgpsPAX2
(Addgene) into human embryonic kidney 293T cells (ob-
tained from the Xiaolei Group) in T75 flasks using
Lipofectamine 3000 transfection reagent (Invitrogen).
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 3 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
After the measurement of each lentiviral titers, HF-MSCs
were transduced with a cocktail of lentivirus carrying
SOX2,OCT4,c-MYC,andKLF4 (SOMK) or SOX2,OCT4,
c-MYC,KLF4,andPBX1 (SOMKP). Forty-eight hours
post-transduction, 5 × 10
4
cells HF-MSCs were plated in a
60-mm dishes (Nest, China). The next day, the medium
was aspirated and replaced with hESC culture medium
(80% DMEM/F-12 supplemented with 20% knockout
serum replacement, 1% nonessential amino acids, 1 mM L-
glutamine, 4 ng/mL human bFGF, and 0.1 mM β-mercap-
toethanol (Invitrogen). HF-MSCs transduced with SOMK,
SOMKP, or SOMK-PBX1 shRNA were cultured in hESC
culture medium for 32 days, and colonies showing alkaline
phosphatase staining were designated as HF-iPSCs.
Teratoma formation and karyotype assays
HF-iPSCs were subcutaneously injected into non-obese dia-
betic/severe combined immune-deficient (NOD/SCID)
mice (HFK, China) at 5 × 10
6
HF-iPSCs/mouse. Teratomas
developed in NOD/SCID mice at 8 weeks after HF-iPSC in-
jection. Teratomas were then harvested and processed for
hematoxylin-eosin (H&E) staining and karyotyping. For
H&E staining, teratomas were fixed in 10% formalin, em-
bedded in paraffin, sectioned at 5 μm thickness, stained
withH&E,andimagedusingmicroscopy (Olympus).
Karyotyping was performed at the Department of Genetics,
College of Basic Medical Sciences, Jilin University, using
standard protocols for high-resolution G-banding.
Dual luciferase reporter assay
HF-MSCs transduced with lentiviruses encoding a cocktail
of transcription factors (SOMK, SOMKP, or SOMK-PBX1
shRNA) were seeded in 6-well plates and cultured in the
hESC culture medium. Twenty-four hours later, 500 ng
pNanog-Luc plasmid (Plasmid 25900; Addgene) and 50 ng
pRL-TK plasmid (Youbio) were cotransfected into HF-
MSCs in triplicate using Lipofectamine 3000. At 24 h after
transfection, HF-MSCs were lysed, and dual firefly/Renilla
luciferase reporter assays were performed (Beyotime,
China) according to the manufacturer’s instructions using
a microplate reader (Synergy H1; Biotek). Relative lucifer-
ase units were calculated as the ratio of firefly to Renilla
luciferases after normalization to the control group
(SOMK).
Apoptosis assays
Apoptosis analysis was performed using an Annexin V-
APC/7-AAD Apoptosis Detection Kit (Sungene, China)
according to the manufacturer’s instructions. Briefly, 1 ×
10
5
HF-MSCs transduced with lentiviruses encoding a
cocktail of TFs were suspended in 100 μL binding buffer
containing 5 μL Annexin V-APC and incubated for 10
min in the dark at room temperature. After incubation,
5μL 7-AAD was added, and HF-MSCs were incubated
for an additional 5 min at room temperature. Cells were
then subjected to flow cytometry (BD Biosciences).
Caspase 3 activity detection
To evaluate the activity of caspase 3, HF-MSCs were col-
lected on days 7 and 21 after transduction with lentivi-
ruses encoding a cocktail of TFs and then washed with
PBS. Next, 5 × 10
5
HF-MSCs were lysed with 60 μL lysis
buffer and centrifuged. Forty microliters of HF-MSCs
lysate was then added to 50 μL reaction buffer, and
10 μL Ac-DEVD-pNA (Beyotime) was added to the mix-
ture. Lysates were incubated at 37 °C for 2 h. The colori-
metric reaction was measured at 405 nm in a microtiter
plate reader.
Quantitative polymerase chain reaction and western
blotting
Total RNA was extracted from HF-iPSCs and hESCs-X01
(obtained from the Xiaolei Group) using TRIzol reagent
(Invitrogen), reverse transcribed into cDNA, and subse-
quently used as a template PCR (TransGen Biotech,
China). qPCR was performed with a kit (Roche, CH), ac-
cording to the manufacturer’s instructions, using a 7300
Real-Time PCR System (ABI, USA). Data were analyzed
by the comparative threshold cycle (Ct) method, and the
relative expression was calculated as 2
−ΔCt
,withglyceral-
dehyde 3-phosphate dehydrogenase (GAPDH)asan
endogenous control. The primers used for qPCR are listed
in Table 1.
For western blotting, 1.5 × 10
6
cells were lysed in 250 μL
RIPA (Beyotime Biotechnology, China) supplemented with
1% protease inhibitor cocktail (CoWin Biosciences, China)
and 1% phosphatase inhibitor cocktail (CoWin Biosciences,
China) on ice for 20 min and centrifuged at 15,000gfor 20
min at 4 °C. The extraction of nucleoprotein was performed
with a kit (Beyotime Biotechnology), according to the
manufacturer’s instructions. Forty micrograms of protein
was separated using precast gels (Biofuraw, China) and
electrotransferred to polyvinylidene fluoride membranes
(Millipore, The Netherlands). The membranes were incu-
bated with primary antibodies targeting PBX1, AKT, phos-
pho-AKT (Ser473), GSK-3β, phospho-GSK-3β(Ser9), β-
catenin, p21, caspase-3, poly (ADP ribose) polymerase 1
(PARP1), cyclin D1 (Cell Signaling Technology; 1:1000 dilu-
tion), p53 (Santa Cruz Biotechnology; 1:1000 dilution), p16,
NANOG (ProteinTech, USA; 1:2000 dilution), BAX, BCL2
(Abcam, UK; 1:1000 dilution), HISTONE, and GAPDH
(ProteinTech; 1:4000 dilution). The membranes were
incubated with enhanced chemiluminescence reagent
(TransGen Biotech), and proteins were visualized using a
Tanon 5200 instrument (Tanon, China). The grayscale
intensities of the results were analyzed using Tanon Gis
analytical software.
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 4 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Statistical analysis
Results are presented as means ± standard deviations. All
data are from at least three independent experiments.
Comparisons between the two groups were performed
with independent sample ttests, and differences among
multiple groups were compared with one-way analysis of
variance. Differences with Pvalues of less than 0.05 were
considered statistically significant.
Results
HF-MSCs displayed surface marker of MSCs and exhibited
adipogenic and chondrogenic differentiation potential
Ten days after the initiation of HF culture, fibroblast-
like cells migrated outwards from HFs (Fig. 1a).
Immunofluorescence staining combined with flow
cytometry assays showed that fibroblast-like cells dis-
played surface markers of MSCs (positive for CD73,
CD44, CD90, and CD105 and negative for CD31
(Fig. 1d, e). Under osteogenic culture conditions, the
cells changed morphology from that of fibroblast-like
to that of osteoblast-like cells and showed high levels of
alkaline phosphatase activity (Fig. 1b). Under adipo-
genicdifferentiationcultureconditions,thecells
showed lipid droplet formation in the cytoplasm by Oil
red O staining (Fig. 1c). Hair follicle-derived fibroblast-
like cells exhibited surface markers of mesenchymal
stem cells and display trilineage differentiation poten-
tials toward osteoblasts and adipocytes. Accordingly,
these cells were designated as HF-MSCs.
PBX1 promoted HF-MSC proliferation through activation
of the AKT/GSK3βsignaling pathway
To explore the effects of PBX1 on HF-MSC proliferation,
HF-MSCs were transduced with a lentiviral vector encod-
ing PBX1 (HF-MSCs
PBX1
) or empty vector (HF-MSCs
EGFP
;
Fig. 2a). Exogenous expression of PBX1 was confirmed by
western blotting (Fig. 2f). CCK-8 assays showed that
overexpression of PBX1 significantly increased the rate of
HF-MSC proliferation at 72 and 96 h after cell seeding
(P< 0.05, 72 h; P< 0.05, 96 h; Fig. 2b). Cell cycle analyses
showed that overexpression of PBX1 induced the entry of
HF-MSCs from G
0
/G
1
to S and G
2
/M phases (Fig. 2c, d),
with significantly higher PIs (P<0.01; Fig. 2e). Consistent
with cell proliferation and cell cycle assays, western blot-
ting showed that PBX1 increased the levels of phospho-
AKT (P< 0.05), phospho-GSK3β(P< 0.01), and cyclin D1
(P< 0.05) and promoted β-catenin translocation from the
cytoplasm to the nucleus (P< 0.001). Moreover, PBX1
expression decreased p16 (P< 0.01) and p21 (P<0.01)
expression (Fig. 2f, g).
To explore the mechanism through which PBX1
enhanced HF-MSC proliferation, endogenous PBX1 was
knocked down by transduction with a lentiviral vector en-
coding PBX1 shRNA (HF-MSCs
shRNA
) or scrambled
shRNA vector as a control (HF-MSCs
scrambled
). The cell
growth rates at 48 h (P< 0.01), 72 h (P<0.01), and 96h
(P< 0.05) were significantly decreased in HF-MSCs
shRNA
compared with those in HF-MSCs
scrambled
(Fig. 3a).
Moreover, PBX1 knockdown significantly reduced the per-
centage of HF-MSCs in the S phase from 12.53% ± 0.782%
to 7.39% ± 1.01% (P< 0.05) and the PIs from 20.34 ± 0.99 to
12.50 ± 1.05 (P< 0.05; Fig. 3b–d). Western blotting showed
that PBX1 knockdown resulted in significant decreases in
the levels of phospho-AKT, phospho-GSK3β, cyclin D1,
and nuclear β-catenin, but increased the expression of the
cyclin kinase inhibitor p21 (Fig. 3e, f).
To confirm that the role of PBX1 in enhancing HF-MSC
proliferation involved the activation of the AKT/GSK3βsig-
naling pathway, HF-MSCs
PBX1
were treated with 10 μM
LY294002 for 24 h [18]. Flow cytometry assays showed that
LY294002 treatment significantly reduced the percentage of
HF-MSCs in the S phase and decreased the PI from
29.77 ± 1.850 to 9.913 ± 1.602 (P< 0.005; Fig. 3g–i).
Western blotting showed that LY294002 treatment dramat-
ically decreased the levels of cyclin D1 (P< 0.001), phos-
pho-AKT (P< 0.001), and phospho-GSK3β(P< 0.001), but
increased the levels of p16 by 1.6-fold (P<0.01)andp21 by
2.5-fold (P< 0.01; Fig. 3j, k). However, LY294002 treatment
Table 1 Primers for qPCR
Gene Forward primers (5′to 3′) Revers primers(5′to 3′)
PBX1 GAGACGGAATTTCAACAAGCA GTTTGATACCTGGGAGACTG
Endo-OCT4 GGGAGGAGCTAGGGAAAGAAAACCT GAACTTCACCTTCCCTCCAACCAGT
Endo-SOX2 TTAGAGCTAGTCTCCAAGCGACGA CCACAGAGATGGTTCGCCAG
NANOG ATGGAGGGTGGAGTATGGTTGG AGGCTGAGGCAGGAGAATGG
CRIPTO TACCTGGCCTTCAGAGATGACA CCAGCATTTACACAGGGAACAC
FOXD3 AAGCCCAAGAACAGCCTAGTGA GGGTCCAGGGTCCAGTAGTTG
LIN28 CAGGTGCTACAACTGTGGAGG GCACCCTATTCCCACTTTCTCC
FGF4 CTACAACGCCTACGAGTCCTACA GTTGCACCAGAAAAGTCAGAGTTG
ESG1 ATATCCCGCCGTGGGTGAAAGTTC ACTCAGCCATGGACTGGAGCATCC
GAPDH CCATGTTCGTCATGGGTGTGA CATGGACTGTGGTCATGAGT
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 5 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
did not cause any significant changes in PBX1 expression,
suggesting that PBX1 increased the HF-MSC proliferation
through activation of the AKT/GSK3βsignaling pathway.
PBX1 enhanced HF-iPSC generation and upregulated
pluripotent gene expression
AKT activation enhances the reprogramming of somatic
cells into iPSCs [20–22], and our study showed that over-
expression of PBX1 activated the AKT/GSK3βsignaling
pathway, suggesting a role for PBX1 in reprogramming of
HF-MSCs into HF-iPSCs. Indeed, the qPCR analysis
showed that endogenous PBX1 levels increased with time
during HF-iPSC reprogramming induced by SOMK trans-
duction (Fig. 4b); PBX1 expression in these cells was sig-
nificantly higher than that in HF-MSCs (P<0.001) but
lower than that in hESCs (Fig. 4a). In addition, compared
with HF-MSCs, HF-iPSCs generated by SOMKP trans-
duction (HF-iPSCs
SOMKP
) exhibited high expression of
endogenous FGF4,FOXD3,NANOG,CRIPTO,LIN28,
ESG1, endo-OCT4, and endo-SOX2 (P<0.05, P<0.001).
Additionally, the expression levels of endo-OCT4,
NANOG,LIN28,ESG1, and endo-SOX2 were significantly
higher than those in hESCs-X01 (P< 0.05, P<0.001;
Fig. 4d). As expected, HF-iPSCs
SOMKP
formed typical
ESC-like clones, expressing the ESC-related markers
SSEA-1, SSEA-4, TRA-1-60, and TRA-1-81, as demon-
strated by immunofluorescence staining (Fig. 4c, e). These
cells also developed teratomas consisting of ectoderm
(squamous epithelium), mesoderm (smooth muscle tis-
sues), and endoderm (gland-like structures) when injected
into NOD-SCID mice (Fig. 4f). Moreover, HF-iPSCs
SOMKP
exhibited a normal male chromosome type (46XY), similar
to HF-MSCs, and no chromosomal aberrations were
found (Fig. 4g). Interestingly, compared with SOMK trans-
duction, SOMKP transduction significantly increased both
HF-iPSC colony formations, from 50.67 ± 3.84 to 79 ± 8.02
(P<0.05; Fig.5a, b), and increased the expression levels of
the endogenous OCT4,LIN28,SOX2,andNANOG genes
Fig. 1 Isolation and characterization of human hair follicle mesenchymal stem cells (HF-MSCs). aHF-MSCs, resembling typical fibroblast-like cells,
spread out from the hair follicle (bar, 200 μm). The multipotent differentiation potential of HF-MSCs was determined. bAfter 4 weeks of induction,
calcium nodules were demonstrated by Alizarin red staining (bar, 100 μm). cAfter 3 weeks of induction, the number of intracellular lipid droplets
was detected by Oil red O staining (bar, 200 μm). d,eImmunofluorescence and flow cytometric analysis of cell surface markers on HF-MSCs
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 6 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
(P<0.05, P<0.01; Fig. 5e). In contrast, knockdown of
PBX1 with PBX1 shRNA significantly decreased SOMK-
induced HF-iPSC colony formation, from 52 ± 5.5 to 28 ±
4.5 (P< 0.05; Fig. 5d, e).
NANOG is a core TF involved in the maintenance of
thepluripotentstateinhESCsandreprogrammingof
somatic cells into iPSCs. Thus, we next evaluated the
expression of the NANOG by qPCR. The results
showed that NANOG expression in HF-iPSCs induced
by either SOMK or SOMKP transduction increased
over time from day 14 to day 28. SOMKP transduction
significantly increased NANOG expression on days 14
(P< 0.05), 21 (P<0.001), and 28 (P< 0.05) compared
with SOMK transduction. However, knockdown of
PBX1 with Pbx1 shRNA significantly decreased
NANOG expression during reprogramming (P< 0.01,
P< 0.001; Fig. 5f). Dual-luciferase assays showed that
compared with SOMK, SOMKP transduction signi-
ficantly increased NANOG promoter activities by
1.74-, 1.46-, and 1.25-foldduringreprogrammingof
HF-MSCs into HF-iPSCs on days 7 (P<0.01), 14
(P< 0.01), and 21 (P< 0.05), whereas knockdown of
PBX1 significantly decreased NANOG promoter
activities on days 7 (P< 0.001), 14 (P< 0.001), 21
(P< 0.01), and 28 (P<0.05; Fig. 5g). These findings
suggested a role for PBX1 in the activation of the
pluripotency-related gene NANOG during iPSC
reprogramming.
Fig. 2 Expression of PBX1 in transduced HF-MSCs increased proliferation capacity. aThe cell morphologies of PBX1-transduced HF-MSCs (bar,
100 μm). bCell proliferation curve of HF-MSCs
EGFP
and HF-MSCs
PBX1
.cEffects of PBX1 in the cell cycle distribution in HF-MSCs. dPercentages of
cells in the G
1
, S, and G
2
phases of the cell cycle and PIs (e) of HF-MSCs
EGFP
and HF-MSCs
PBX1
.f,gWestern blot analysis the levels of phospho-
AKT, phospho-GSK3β, cyclin D1, p16, p21, and β-catenin proteins in HF-MSCs
EGFP
and HF-MSCs
PBX1
. GAPDH and HISTONE were used as
endogenous controls for equal loading. The value for HF-MSCs
EGFP
in the control group transduced by lentiviral vector was set as 1.
*P< 0.05; **P< 0.01
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 7 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
PBX1 enhanced HF-iPSC generation through activation of
the AKT/GSK-3βsignaling pathway
To dissect the mechanisms through which PBX1 enhanced
HF-iPSC generation, the relationship between PBX1 and
the AKT/GSK3βsignaling pathway was explored during
HF-iPSC reprogramming. Western blotting showed that
compared with SOMK, SOMKP transduction significantly
increased the phosphorylation of AKT and GSK3β,pro-
moted the nuclear translocation of β-catenin, and downreg-
ulated the p53 and p21 expression during reprogramming
on days 7 and 21 (Fig. 6a–e). Inhibition of endogenous
PBX1 expression decreased thephosphorylationofAKT
and GSK3β, but upregulated the p53 and p21 expression
and decreased the nuclear translocation of β-catenin.
Immunofluorescence staining showed that PBX1 promoted
the accumulation of β-catenin in the cytoplasm and nu-
cleus. In contrast, knockdown of PBX1 inhibited the accu-
mulation of β-catenin in the cytoplasm and nucleus but
promoted the accumulation of p53 in the cytoplasm and
nucleus. Surprisingly, we found that NANOG expression
was positively correlated with PBX1 expression during
reprogramming on day 21 and that knockdown of NANOG
with NANOG shRNA did not cause any significant changes
in PBX1, phospho-AKT, or phospho-GSK3βlevels.
Fig. 3 Knockdown of PBX1 in HF-MSCs suppressed proliferation and inhibited the AKT/GSK3βpathway. aCell proliferation curves for HF-
MSCs
scrambled
and HF-MSCs
shRNA
.b,cPercentages of cells in the G
1
, S, and G
2
phases of the cell cycle and PIs (d) for the HF-MSCs
scrambled
and HF-
MSCs
shRNA
.e,fWestern blot analysis of the levels of phospho-AKT, phospho-GSK3β, cyclin D1, p16, p21, and β-catenin proteins in HF-
MSCs
scrambled
and HF-MSCs
shRNA
.g,hPercentages of cells in the G
1
, S, and G
2
phases of the cell cycle and PIs (i) for HF-MSCs
PBX1
cultured with
DMSO and LY294002. j,kWestern blot analysis of the levels of phospho-AKT, phospho-GSK3β, cyclin D1, p16, p21, and β-catenin proteins in HF-
MSCs
PBX1
cultured with DMSO and LY294002. *P< 0.05; **P< 0.01; ***P< 0.001
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 8 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
However, a significant decrease in β-catenin nuclear trans-
location was observed (P< 0.01; Fig. 6d, e).
In order to determine whether PBX1 enhanced HF-iPSC
generation via activation of the AKT/GSK3βpathway, the
AKT signaling pathway was blocked using the PI3K/AKT
inhibitor LY294002 during HF-iPSC reprogramming
induced by SOMKP. As expected, LY294002 treatment
significantly decreased the numbers of HF-iPSC colony
from 73 ± 2.64 to 36 ± 4.583 (P<0.01; Fig. 7a, b). Western
blotting showed that LY294002 treatment not only reduced
phospho-AKT levels but also decreased NANOG and
phopsho-GSK3βlevels and blocked β-catenin nuclear
translocation. In contrast, LY294002 treatment significantly
increased the expression of p53 and p21 during reprogram-
ming on days 7 and 21 (Fig. 7c–e). These results suggested
that the AKT/GSK3βpathway acted downstream of PBX1
to regulate NANOG expression and cell reprogramming.
PBX1 reduced apoptosis during HF-iPSC reprogramming
Apoptosis is a key resistance mechanism in somatic cell
reprogramming [33,34]. Therefore, the role of PBX1 in
the regulation of apoptosis during HF-iPSC reprogram-
ming was explored. Flow cytometry showed that
compared with SOMK, SOMKP transduction significantly
reduced the percentage of AnnexinV
+
/7-AAD
−
cells from
19.97% ± 0.6% to 14.73% ± 0.61% during reprogramming
on day 7 (P< 0.01); however, no significant differences
were detected on day 21 (Fig. 8a–c). Additionally, SOMKP
transduction did not significantly alter the percentages of
AnnexinV
+
/7-AAD
+
cells during reprogramming on days
7 and 21. To confirm the role of PBX1 in reducing HF-
MSC apoptosis during HF-iPSC reprogramming, PBX1
was knocked down with PBX1 shRNA. Flow cytometry
showed that PBX1 knockdown increased the percentage
of AnnexinV
+
/7-AAD
−
cells from 19.97% ± 0.6% to
Fig. 4 Characterization of PBX1-induced pluripotent stem cells from HF-MSCs. aTranscript levels of endogenous PBX1 in HF-MSCs, HF-iPSCs, and
hESCs-X01 were determined by qPCR. The value in HF-MSCs as the control group was set as 1.0. bAfter transduction with SOMK, HF-MSCs were
harvested on days 0, 7, 14, and 21, and the expression of endogenous PBX1 was assessed by qPCR. Data are shown as fold induction compared
with that at day 0. cThe cell morphologies of transduced HF-MSCs were changed by reprogramming at 0 and 34 days after SOMKP transduction
(bar, 500 μm). dExpression of endogenous pluripotency genes in hESCs and HF-iPSCs
SOMKP
relative to that in parental somatic cell populations, as
determined by qPCR. Data are shown as fold induction compared with that in hESCs-X01. eHF-iPSCs
SOMKP
expressed TRA-1-60, TRA-1-81, SSEA-3,
SSEA-4, OCT4, and NANOG, as shown by immunostaining (bar, 200 μm). fH&E staining of teratomas obtained from HF-iPSCs
SOMKP
injected into
NOD-SCID mice revealed gland-like structures (endoderm), smooth muscle (mesoderm), and squamous epithelium (ectoderm; bar, 100 μm). g
Karyotype analysis. HF-MSCs at passage 6 (left) and HF-iPSCs
SOMKP
at passage 12 (right) showed a normal 46XY karyotype. *P< 0.05;
**P< 0.01; ***P< 0.001
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 9 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
24.73% ± 0.77% (P< 0.01) during reprogramming on day 7
and from 18.37% ± 0.84% to 25.67% ± 1.386% (P<0.05)
during reprogramming on day 21 (Fig. 9a, b). There were
no significant differences in the SOMK group with regard
to the percentage of AnnexinV
+
/7-AAD
+
cells (Fig. 9c).
Unexpectedly, the knockdown of NANOG did not cause
any significant changes in the percentages of AnnexinV
+
/
7-AAD
−
and AnnexinV
+
/7-AAD
+
cells during reprogram-
ming on day 21. Western blotting showed that compared
with SOMK, SOMKP transduction significantly upregu-
lated BCL2 expression, downregulated caspase3 and
cleaved PARP1 expression, and decreased caspase3 activ-
ity during reprogramming on days 7 (Fig. 8d, e). In con-
trast, the knockdown of PBX1 downregulated BCL2
expression; upregulated BAX, caspase3, and cleaved
PARP1 expression; and increased caspase 3 activity during
reprogramming on days 7 and 21 (Fig. 9d, e). Similar to
apoptosis assays, the knockdown of Nanog did not cause
any significant changes in BCL2, BAX, caspase3, and
cleaved PARP1 expression or in caspase 3 activity in HF-
MSCs transduced with SOMKP during reprogramming
on day 21 (Fig. 9f). Overall, these results demonstrated
that overexpression of PBX1 significantly inhibited HF-
MSC apoptosis during the early stages of reprogramming
and that inhibition of endogenous PBX1 expression
promoted apoptosis during reprogramming.
PBX1 reduced apoptosis by activation of the AKT/GSK3β
signaling pathway during HF-iPSC reprogramming
In order to explore whether PBX1 inhibited HF-MSC
apoptosis during HF-iPSC reprogramming through the
AKT/GSK3βpathway, HF-MSCs were treated with the
Fig. 5 PBX1 enhanced HF-iPSC generation and activated the NANOG promoter. a,bQuantification of the number of alkaline phosphatase-
positive colonies 32 days after lentivirus vector-mediated transduction with SOMKP and SOMK vectors into HF-MSCs. cExpression of endogenous
pluripotency genes in HF-iPSCs
SOMK
and HF-iPSCs
SOMKP
was assessed by qPCR. The value in iPSCs
SOMK
as the control group was set as 1.0. d,e
Quantification of the number of alkaline phosphatase-positive colonies 32 days after lentivirus vector-mediated transduction by SOMK with
scrambled shRNA and SOMK with shRNA against PBX1.fTransduced HF-MSCs were harvested on days 7, 14, 21, and 28 to assess the expression
of endogenous NANOG by qPCR. Data are shown as fold induction compared with the SOMK control on day 7. gDual-luciferase reporter gene
assays were used to assess the activation of the NANOG promoter in transduced HF-MSCs on days 7, 14, 21, and 28. The value in SOMK-
transduced HF-MSCs as the control group was set as 1.0. *P< 0.05; **P< 0.01; ***P< 0.001
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 10 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
specific PI3K/AKT inhibitor LY294002 during HF-iPSC
reprogramming induced by SOMKP. Flow cytometry re-
vealed that compared with SOMK, LY294002 treatment
increased the percentages of both AnnexinV
+
/7-AAD
−
cells during reprogramming on day 7 (P< 0.05) and on
day 21 (P< 0.001). Additionally, treatment with this in-
hibitor increased the percentages of AnnexinV
+
/7-AAD
+
cells during reprogramming on day 7 (P< 0.05) and day
21 (P< 0.01; Fig. 10a–c). These findings suggested that
LY294002 suppress apoptotic protection granted by
PBX1 exogenous expression. Moreover, LY294002 treat-
ment significantly increased the caspase3 activity by
1.36-fold (P < 0.01) during reprogramming on day 7 and
by 1.4-fold (P< 0.05) on day 21 (Fig. 10g). Consistent
with flow cytometry assays, western blotting showed that
LY294002 treatment significantly increased the expres-
sion of the apoptosis-related proteins BAX, caspase3,
and cleaved PARP1 during reprogramming on days 7
(Fig. 10e) and 21 (Fig. 10f). These results revealed that
the inhibitory activity of the AKT/GSK3βpathway
accounted for the effects of overexpression of PBX1 on
the protection of HF-MSCs against apoptosis.
Discussion
HF-MSCs and HF-iPSCs reprogrammed from HF-MSCs
offer autologous stem cell sources for tissue repair and
regeneration, without induction of immune responses or
concerns regarding the ethics of allogeneic implantation.
Fig. 6 PBX1 activated the ATK/GSK3βsignaling pathway in induced pluripotent stem cells. a,bTransduced HF-MSCs were harvested on day 7 to
assess the levels of phospho-AKT, phospho-GSK3β, p16, p21, and β-catenin. GAPDH and HISTONE were used as loading controls. The value in
SOMK-transduced HF-MSCs as the control group was set as 1.0. cImmunofluorescence analysis of β-catenin and p53 expression and localization
in transduced HF-MSCs (bar, 100 μm). d,eTransduced HF-MSCs were harvested on day 21 to assess the levels of phospho-AKT, phospho-GSK3β,
p16, p21, NANOG, and β-catenin. GAPDH and HISTONE were used as endogenous controls for equal loading. The value in SOMK-transduced HF-
MSCs as the control group was set as 1.0. *P< 0.05; **P< 0.01; ***P< 0.001
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 11 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Cell senescence caused by long-term culture significantly
reduced the therapeutic potential of stem cells. More-
over, low reprogramming efficiency is a major challenge
for the clinical application of HF-iPSCs, thus necessitat-
ing the development of novel strategies to enhance HF-
MSC proliferation and HF-iPSC generation. TFs are key
intrinsic regulators involved in the maintenance of the
pluripotent state of stem cells and reprogramming of
somatic cells into iPSCs, orchestrating the interaction
networks in a temporal and spatial manner to regulate
stem cell proliferation and differentiation. In this study,
we found that PBX1 promoted cell proliferation and re-
programming in HF-MSCs. Our findings demonstrated
that PBX1 enhanced cell cycle progression from G
0
/G
1
to S phase, upregulated cyclin D1, increased AKT and
GSK3βphosphorylation, and decreased p16 and p21 ex-
pression. Additionally, activation of the AKT/GSK3β
pathway induced by ectopic expression of PBX1 in HF-
MSCs increased the translocation of β-catenin from the
cytoplasm to the nucleus. We also showed that low ex-
pression of PBX1 inhibited cell proliferation and that the
inhibitory activity of the AKT/GSK3βpathway abolished
the effects of PBX1 overexpression. Collectively, our
findings demonstrated, for the first time, that PBX1 en-
hanced HF-MSC proliferation through activation of the
AKT/GSK signaling pathway.
As a potential TF involved in maintaining pluripotency,
PBX1 was actively expressed in hESCs and HF-iPSCs. Our
results indicated that PBX1 expression was increased
throughout the reprogramming process. Moreover, HF-
iPSCs induced by SOMKP developed teratomas, which
contained ectoderm, mesoderm, and endoderm, in im-
mune-incompetent mice, suggesting that ectopic expres-
sion of PBX1 did not affect the totipotency and
proliferation capacities of the cells. Compared with SOMK,
SOMKP transduction significantly increased HF-iPSC col-
ony formation and upregulated pluripotent gene expres-
sion. Additionally, the expression of pluripotency-related
genes in SOMKP-transduced HF-iPSCs was significantly
higher than that in hESCs-X0. Equivalence to ES cell lines
is unlikely to be a sufficient indicator of an iPS cell line’s
utility for a specific application, but it indicates the remark-
able contribution of PBX1 to iPSCs reprogramming and
maintenance of cell pluripotency. Further analysis revealed
that during the early stages of reprogramming, PBX1 over-
expression decreased the percentage of cells in early apop-
tosis by activating the AKT/GSK3βpathway and reducing
the expression of apoptosis-related proteins. During the late
stages of reprogramming, PBX1 greatly upregulated
NANOG by activating the NANOG promoter, consistent
with previous studies in hESCs [14]. Furthermore, PBX1
upregulated NANOG not only by activating the promoter
but also by increasing the phosphorylation of AKT. Add-
itionally, the inhibition of PBX1 expression and the AKT/
GSK3βpathway increased the percentage of cells in early
apoptosis during reprogramming and significantly de-
creased the generation of iPSCs. Taken together, these
Fig. 7 Inhibition of the AKT/GSK3βsignaling pathway activated by
the overexpression of PBX1 reduced the generation of iPSCs. a,b
Quantification of the number of alkaline phosphatase-positive
colonies 32 days after lentivirus vector-mediated transduction by
SOMKP with DMSO and LY294002. cSOMKP transduced HF-MSCs
cultured with LY294002 were harvested on days 7 (d) and 21 (e)to
assess the levels of phospho-AKT, phospho-GSK3β, p16, p21,
NANOG, and β-catenin. GAPDH and histone were used as
endogenous controls for equal loading. The value in SOMKP-
transduced HF-MSCs cultured with DMSO as the control group was
set as 1.0. *P< 0.05; **P< 0.01; ***P< 0.001
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 12 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
results suggested that PBX1 not only enhanced the gener-
ation of HF-iPSCs without blocking the induced pluripo-
tency but was also essential for reprogramming.
In our previous study, AKT signaling was found to be es-
sential for maintaining HF-MSC proliferation by upregulat-
ing cyclin D1 and downregulating p16 and p21 [18].
During reprogramming, activators of AKT also improve re-
programming efficiency. Studies of hiPSCs have demon-
strated that increased phosphorylation of AKT and GSK3β
induced by the inhibition of PHLDA3 expression enhances
somatic cell reprogramming [8]. Similarly, by adding a
small molecule activator of PDK1 to activate the down-
stream AKT, reprogramming efficiency is further enhanced
[20]. This may occur through direct phosphorylation of
GSK3βand subsequent phosphorylation of β-catenin by
GSK3β. Moreover, phosphorylation of GSK3βat serine 9
promotes cell survival by inhibiting apoptosis [35,36].
Additionally, our study suggested that β-catenin transloca-
tion caused by the activation of the AKT/GSK3βpathway
in the presence of ectopic PBX1 expression may promote
reprogramming efficiency. During reprogramming, β-ca-
tenin acts via interactions with telomerase reverse tran-
scriptase/Brahma-related gene-1 and altered the structure
of nucleosomes, thereby facilitating the binding of TFs and
proteins to DNA [37,38]. Additionally, we found that the
knockdown of PBX1 or inhibition of AKT/GSK3βpro-
moted the mitochondrion-mediated apoptotic cascade. In
previous studies, p53 was found to block reprogramming in
numerous cell lines. Inhibition of p53 expression or the ex-
pression of its target gene p21 improves reprogramming ef-
ficiency by decreasing the number of suboptimal cells via
p53-dependent apoptosis [39,40]. Our data suggested that
p53 was downregulated by the AKT/GSK3βpathway.
Western blot analysis showed that p53 mediated apoptosis
by downregulation of the anti-apoptotic protein BCL2 and
increased the expression of BAX. Moreover, the knock-
down of PBX1 or inhibition of the AKT/GSK3βpathway
regulated the activation of the p53 pathway, possibly indu-
cing the translocation of stabilized p53 to the mitochondria,
where p53 can directly interact with anti-apoptotic BCL2
and BAX [41]. BCL2 is localized in the outer wall of the
mitochondria and acts to maintain membrane integrity and
inhibit the release of cytochrome C. BAX is expressed in
the cytosol but can translocate to the mitochondria and
promote the release of cytochrome C [35]. Additionally, the
translocation of cytochrome C promotes the cleavage of
pro-caspase3 to caspase3, further accelerating the cleavage
of PARP1, which is involved in DNA repair and chromatin
Fig. 8 PBX1 reduced apoptosis during the early stage of reprogramming. aApoptosis of transduced HF-MSCs on reprogramming day 7. b
Quantitative analysis of the proportion of early apoptotic cells (APC Annexin V
+
and 7-AAD
−
). cQuantitative analysis of the proportion of late
apoptotic cells (APC Annexin V
+
and 7-AAD
+
). d,eWestern blotting was used to detect the expression of apoptosis-related proteins (BCL-2, BAX,
Caspase3, and PARP1) in transduced HF-MSCs on reprogramming day 7. fCaspase3 activity in transduced HF-MSCs on reprogramming day 7 is
shown as the fold change compared with the control. The value in SOMK-transduced HF-MSCs as the control group was set as 1.0. *P< 0.05;
**P< 0.01; ***P< 0.001
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 13 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
remodeling. During the final step of apoptosis, PARP1 acts
as a marker of apoptosis after cleavage by caspases [42]. Re-
cent studies have indicated that increased PARP1 expres-
sion is detected throughout the reprogramming process
and is involved in the efficient generation of iPSCs via
PARP1-mediated epigenetic modulation and activation of
pluripotency-related genes during reprogramming [43].
The coordination between PARP1 and TET2 promotes his-
tone modifications; regulates the expression of SOX2,
OCT4, and NANOG; and modulates chromatin structure
during the reprogramming process [43,44]. In our study,
PBX1 knockdown or AKT/GSK3βinhibition reduced
PARP1expressionandmayhaveresultedinlowrepro-
gramming efficiency.
Dual-luciferase assays showed that PBX1 activated
NANOG promoter activity. These findings were confirmed
by qPCR, which demonstrated that PBX1 upregulated
NANOG expression during the reprogramming process.
NANOG plays a central role in maintaining the pluripotent
state of stem cells and in the reprogramming of somatic
cells into iPSCs. Both transforming growth factor β/activin
and bFGF signaling pathways promote hiPSC and hESC
pluripotency by sustainably maintaining the NANOG ex-
pression. In cooperation with OCT4, SOX2, and regulatory
feedback loops, NANOG maintains the self-renewal and
pluripotency of hiPSCs and hESCs [45–47]. Our results
suggested that SOMKP induced iPSCs with a more active
transcriptional network. Moreover, PBX1 has been reported
to enhance the expression of pluripotency-related genes in
hESCs [14]. Consistent with this report, we found that
SOMKP transduction significantly regulated ESG1,LIN28,
NANOG, endogenous SOX2,andOCT4 expression during
iPSCreprogramming.NANOG,OCT4,andSOX2regulate
their own promoters and other diverse pluripotency-related
genes to form an extensive regulatory circuitry to maintain
the pluripotency of hESCs and hiPSCs [48]. Additionally,
pluripotency-related genes are downregulated during the
differentiation of hiPSCs and hESCs in vitro [49]. Similarly,
PBX1 was found to be expressed in undifferentiated hESCs
and downregulated in differentiated cells [14]. As an up-
stream regulator of NANOG, overexpression of PBX1 en-
hances and maintains the high expression of pluripotency-
related genes, probably potentially providing a significant
route for maintenance of the pluripotency of HF-iPSCs in
vitro. In the cell regulatory network, PBX1 prebound to the
promoters of its target genes and subsequently interacted
with other TFs to cooperatively activate the transcription of
target genes [11,50]. Similar to KLF4, OCT4, and SOX2,
PBX1 could penetrate silent chromatin and bind to regula-
tory regions to increase DNA access for other proteins and
active reprogramming at times when the overall chromatin
structure still prevents access of other TFs [51,52].
Fig. 9 Knockdown of PBX1 promoted apoptosis during reprogramming. aApoptosis in transduced HF-MSCs during reprogramming on day 21. b
Quantitative analysis of the proportion of early apoptotic cells (APC Annexin V
+
and 7-AAD
−
). cQuantitative analysis of the proportion of late
apoptotic cells (APC Annexin V
+
and 7-AAD
+
). d,eWestern blotting analysis of the expression levels of apoptosis-related proteins (BCL-2, BAX,
caspase3, and PARP1) in transduced HF-MSCs during reprogramming on day 21. fCaspase3 activity in transduced HF-MSCs during
reprogramming on day 21, shown as the fold change compared with the control. The value for SOMK-transduced HF-MSCs as the control group
was set as 1.0. *P< 0.05; **P< 0.01; ***P< 0.001
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 14 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
However, we discovered that NANOG expression was
also regulated by the AKT/GSK3βpathway. Recent
studies have revealed that activation of the Wnt/β-ca-
tenin pathway by inhibition of GSK3βresults in β-ca-
tenin accumulation, which can help to maintain the
self-renewal capacity of MSCs and hESCs by increasing
NANOG expression [53]. Therefore, we concluded that
PBX1 upregulated the NANOG expression to activate
the NANOG promoter and increase the phosphory-
lation of AKT.
Conclusions
In this study, we identified PBX1 as an important TF in
enhancing HF-MSC proliferation and reprogramming,
potentially by increasing AKT phosphorylation and β-
catenin nuclear translocation. In HF-MSC reprogram-
ming, PBX1 activated the NANOG promoter and
upregulated NANOG expression. Moreover, PBX1 acti-
vated the AKT/GSK3βsignaling pathway, inhibited
mitochondrion-mediated apoptosis during the early
stage of reprogramming, and upregulated endogenous
SOX2 and OCT4 expression during the later stage of
reprogramming. These results established a strategy for
a large-scale acquisition of HF-MSCs and efficient ge-
neration of HF-iPSCs, which may have applications in
regenerative medicine.
Abbreviations
HF: Hair follicle; MSC: Mesenchymal stem cell;; HF-MSCs: Human hair follicle
mesenchymal stem cells; iPSCs: Induced pluripotent stem cells; HF-
iPSCs: Human hair follicle mesenchymal stem cell-derived induced
Fig. 10 Overexpression of PBX1 inhibited the AKT/GSK3βsignaling pathway to promote apoptosis during reprogramming. aApoptosis in SOMK-
transduced HF-MSCs and SOMKP-transduced HF-MSCs cultured with LY294002 during reprogramming on days 7 and 21. bQuantitative analysis of the
proportion of early apoptotic cells (APC Annexin V+ and 7-AAD-). cQuantitative analysis of the proportion of late apoptotic cells (APC Annexin V+ and
7-AAD
+
). dWestern blotting analysis of the expression of apoptosis-related proteins (BCL-2, BAX, caspase3, and PARP1) in transduced HF-MSCs during
reprogramming on days 7 (e) and 21 (f). gCaspase3 activity in transduced HF-MSCs during reprogramming on day 21, shown as the fold change
compared with the control. The value for SOKM-transduced HF-MSCs as the control group was set as 1.0. *P<0.05;**P< 0.01; ***P<0.001
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 15 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
pluripotent stem cells; ESCs: Embryonic stem cells; HF-MSCs
EGFP
: HF-MSCs
transfected with vector lentivirus; HF-MSCs
PBX1
: HF-MSCs transfected with
lentivirus encoding PBX1; HF-MSCs
shRNA
: HF-MSCs transfected with lentivirus
encoding PBX1 short hairpin RNA; HF-MSCs
scrambled
: HF-MSCs transfected
with scrambled lentivirus; OCT4: Octamer-binding transcription factor 4;
KLF4: Kruppel-like factor 4; SOX2: SRY-box 2; SOKM: SOX2-OCT4-KLF4-cMYC;
SOKMP: SOX2-OCT4-KLF4-cMYC-PBX1; PBS: Phosphate-buffered saline;
SSEA: Stage-specific embryonic antigen; qPCR: Quantitative polymerase chain
reaction; bFGF: Basic fibroblast growth factor; CDK: Cyclin-dependent kinase;
PI: Proliferation index; TFs: Transcription factors; APC: Allophycocyanin;
DMEM: Dulbecco’s modified Eagle’s medium; 7AAD: 7-Amino actinomycin;
DMSO: Dimethyl sulfoxide; FBS: Fetal bovine serum; PARP: Poly (ADP ribose)
polymerase 1; shRNA: Short hairpin RNA; H&E: Hematoxylin and eosin
Acknowledgements
We would like to thank Xiao Lei at the Shanghai Academy of Sciences for
the material assistance.
Authors’contributions
The study was designed by JL. YJ carried out most of the experiments,
performed the statistical analysis, and drafted the manuscript. FL, FZ, YZ, BW,
YZ, AL, XH, and ZL carried out some of the experiments. XL and MJ helped
with the statistical analysis. DW and GL helped with the editing of the paper.
All authors have read and approved the final manuscript.
Funding
The Jilin Province Science and Technology Development Plan
(20190304044YY), the Innovative Special Industry Fund Project in Jilin
province (2018C049-2), the Open Research Project of the State Key
Laboratory of Industrial Control Technology, the China Natural National
Science Foundation (81573067), and the Joint Construction Project between
Jilin province and provincial colleges (SXGJQY2017-12).
Availability of data and materials
All data generated or analyzed during this study are included in this
published article.
Ethics approval and consent to participate
All experiments were approved by the Jilin University Hospital, Jilin
University Ethics Committee (No. 2011037). HF-MSCs were collected from do-
nors with written informed consent in accordance with the guidelines of the
ethics committee of the Jilin University Hospital.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Author details
1
The Key Laboratory of Pathobiology, Ministry of Education, Department of
Pathology, College of Basic Medical Sciences, Jilin University, 126 Xinmin
Avenue, Changchun 130021, China.
2
Department of Ophthalmology, The
Second Hospital of Jilin University, Changchun 130021, China.
3
Department
of Pediatrics, The First Hospital of Jilin University, Changchun 130021, China.
4
Department of Toxicology, School of Public Health, Jilin University, 1163
Xinmin Avenue, Changchun 130021, China.
5
Stem Cell and Tissue
Engineering Research Laboratory, PLA Rocket Force Characteristic Medical
Center, Beijing 100088, China.
6
Department of Orthopaedics & Traumatology,
Li Ka Shing Institute of Health Sciences, Chinese University of Hong Kong,
Prince of Wales Hospital, Hong Kong 999077, China.
Received: 23 April 2019 Revised: 8 August 2019
Accepted: 12 August 2019
References
1. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from
mouse embryonic and adult fibroblast cultures by defined factors. Cell.
2006;126(4):663–76.
2. Cao S, et al. Chromatin accessibility dynamics during chemical induction of
pluripotency. Cell Stem Cell. 2018;22(4):529–542.e5.
3. Eguchi T, Kuboki T. Cellular reprogramming using defined factors and
microRNAs. Stem Cells Int. 2016;2016:7530942.
4. Kim D, et al. Generation of human induced pluripotent stem cells by direct
delivery of reprogramming proteins. Cell Stem Cell. 2009;4(6):472–6.
5. Blanchard JW, et al. Replacing reprogramming factors with antibodies selected
from combinatorial antibody libraries. Nat Biotechnol. 2017;35(10):960–8.
6. Faiola F, et al. NAC1 regulates somatic cell reprogramming by controlling
Zeb1 and E-cadherin expression. Stem Cell Rep. 2017;9(3):913–26.
7. Declercq J, et al. Zic3 enhances the generation of mouse induced
pluripotent stem cells. Stem Cells Dev. 2013;22(14):2017–25.
8. Qiao M, et al. PHLDA3 impedes somatic cell reprogramming by activating
Akt-GSK3beta pathway. Sci Rep. 2017;7(1):2832.
9. Selleri L, et al. Requirement for Pbx1 in skeletal patterning and
programming chondrocyte proliferation and differentiation. Development.
2001;128(18):3543–57.
10. Hanley O, et al. Parallel Pbx-dependent pathways govern the coalescence
and fate of motor columns. Neuron. 2016;91(5):1005–20.
11. Maves L, et al. Pbx homeodomain proteins direct Myod activity to promote
fast-muscle differentiation. Development. 2007;134(18):3371–82.
12. Berthelsen J, et al. The subcellular localization of PBX1 and EXD proteins
depends on nuclear import and export signals and is modulated by
association with PREP1 and HTH. Genes Dev. 1999;13(8):946–53.
13. Li C, Wang J. Quantifying cell fate decisions for differentiation and
reprogramming of a human stem cell network: landscape and biological
paths. PLoS Comput Biol. 2013;9(8):e1003165.
14. Chan KK, et al. KLF4 and PBX1 directly regulate NANOG expression in
human embryonic stem cells. Stem Cells. 2009;27(9):2114–25.
15. Sarbassov DD, et al. Phosphorylation and regulation of Akt/PKB by the
rictor-mTOR complex. Science. 2005;307(5712):1098–101.
16. Manning BD, Cantley LC. AKT/PKB signaling: navigating downstream. Cell.
2007;129(7):1261–74.
17. Tang Y, et al. Differential effects of Akt isoforms on somatic cell
reprogramming. J Cell Sci. 2014;127(Pt 18):3998–4008.
18. Bai T, et al. Epidermal growth factor induces proliferation of hair follicle-
derived mesenchymal stem cells through epidermal growth factor receptor-
mediated activation of ERK and AKT signaling pathways associated with
upregulation of cyclin D1 and downregulation of p16. Stem Cells Dev. 2017;
26(2):113–22.
19. DeBerardinis RJ, et al. The biology of cancer: metabolic reprogramming
fuels cell growth and proliferation. Cell Metab. 2008;7(1):11–20.
20. Zhu S, et al. Reprogramming of human primary somatic cells by OCT4 and
chemical compounds. Cell Stem Cell. 2010;7(6):651–5.
21. Lee DF, et al. Combining competition assays with genetic complementation
strategies to dissect mouse embryonic stem cell self-renewal and
pluripotency. Nat Protoc. 2012;7(4):729–48.
22. Ke M, et al. Leukemia inhibitory factor regulates marmoset induced
pluripotent stem cell proliferation via a PI3K/Akt-dependent Tbx3 activation
pathway. Int J Mol Med. 2018;42(1):131–40.
23. Sato N, et al. Maintenance of pluripotency in human and mouse embryonic
stem cells through activation of Wnt signaling by a pharmacological GSK-3-
specific inhibitor. Nat Med. 2004;10(1):55–63.
24. Ding VM, et al. FGF-2 modulates Wnt signaling in undifferentiated hESC and
iPS cells through activated PI3-K/GSK3beta signaling. J Cell Physiol. 2010;
225(2):417–28.
25. Lluis F, et al. The Wnt/beta-catenin signaling pathway tips the balance
between apoptosis and reprograming of cell fusion hybrids. Stem Cells.
2010;28(11):1940–9.
26. Liu JY, et al. Derivation of functional smooth muscle cells from multipotent human
hair follicle mesenchymal stem cells. Tissue Eng Part A. 2010;16(8):2553–64.
27. Yashiro M, et al. From hair to heart: nestin-expressing hair-follicle-associated
pluripotent (HAP) stem cells differentiate to beating cardiac muscle cells.
Cell Cycle. 2015;14(14):2362–6.
28. Liu Z, et al. Transdifferentiation of human hair follicle mesenchymal stem
cells into red blood cells by OCT4. Stem Cells Int. 2015;2015:389628.
29. Amoh Y, et al. Multipotent nestin-positive, keratin-negative hair-follicle bulge
stem cells can form neurons. Proc Natl Acad Sci U S A. 2005;102(15):5530–4.
30. Wu C, et al. Engineered hair follicle mesenchymal stem cells overexpressing
controlled-release insulin reverse hyperglycemia in mice with type I
diabetes. Cell Transplant. 2015;24(5):891–907.
31. Wang Y, et al. Induced pluripotent stem cells from human hair follicle
mesenchymal stem cells. Stem Cell Rev. 2013;9(4):451–60.
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 16 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
32. Shi X, et al. Differentiation of hepatocytes from induced pluripotent stem
cells derived from human hair follicle mesenchymal stem cells. Cell Tissue
Res. 2016;366(1):89–99.
33. Esteban MA, Pei D. Vitamin C improves the quality of somatic cell
reprogramming. Nat Genet. 2012;44(4):366–7.
34. Jiang Y, et al. Phosphatidic acid improves reprogramming to pluripotency
by reducing apoptosis. Stem Cells Dev. 2016;25(1):43–54.
35. Si H, et al. Overexpression of adrenomedullin protects mesenchymal stem
cells against hypoxia and serum deprivationinduced apoptosis via the Akt/
GSK3beta and Bcl2 signaling pathways. Int J Mol Med. 2018;41(6):3342–52.
36. Ying Y, et al. GLP1 protects cardiomyocytes from palmitate-induced apoptosis
via Akt/GSK3b/b-catenin pathway. J Mol Endocrinol. 2015;55(3):245–62.
37. Randazzo FM, et al. brg1: a putative murine homologue of the Drosophila
brahma gene, a homeotic gene regulator. Dev Biol. 1994;161(1):229–42.
38. Shi Y, et al. A combined chemical and genetic approach for the generation
of induced pluripotent stem cells. Cell Stem Cell. 2008;2(6):525–8.
39. Kawamura T, et al. Linking the p53 tumour suppressor pathway to somatic
cell reprogramming. Nature. 2009;460(7259):1140–4.
40. Marion RM, et al. A p53-mediated DNA damage response limits
reprogramming to ensure iPS cell genomic integrity. Nature. 2009;
460(7259):1149–53.
41. Chipuk JE, et al. Direct activation of Bax by p53 mediates mitochondrial
membrane permeabilization and apoptosis. Science. 2004;303(5660):1010–4.
42. Krishnakumar R, Kraus WL. The PARP side of the nucleus: molecular actions,
physiological outcomes, and clinical targets. Mol Cell. 2010;39(1):8–24.
43. Jiang BH, et al. CHD1L regulated PARP1-driven pluripotency and chromatin
remodeling during the early-stage cell reprogramming. Stem Cells. 2015;
33(10):2961–72.
44. Doege CA, et al. Early-stage epigenetic modification during somatic cell
reprogramming by Parp1 and Tet2. Nature. 2012;488(7413):652–5.
45. Orkin SH. Chipping away at the embryonic stem cell network. Cell. 2005;
122(6):828–30.
46. Kim J, et al. An extended transcriptional network for pluripotency of
embryonic stem cells. Cell. 2008;132(6):1049–61.
47. Jiang J, Ng HH. TGFbeta and SMADs talk to NANOG in human embryonic
stem cells. Cell Stem Cell. 2008;3(2):127–8.
48. Boyer LA, et al. Core transcriptional regulatory circuitry in human embryonic
stem cells. Cell. 2005;122(6):947–56.
49. Hyslop L, et al. Downregulation of NANOG induces differentiation of human
embryonic stem cells to extraembryonic lineages. Stem Cells. 2005;23(8):1035–43.
50. Magnani L, et al. PBX1 genomic pioneer function drives ERalpha signaling
underlying progression in breast cancer. PLoS Genet. 2011;7(11):e1002368.
51. Iwafuchi-Doi M, Zaret KS. Pioneer transcription factors in cell
reprogramming. Genes Dev. 2014;28(24):2679–92.
52. Grebbin BM, Schulte D. PBX1 as pioneer factor: a case still open. Front Cell
Dev Biol. 2017;5:9.
53. Yu SJ, et al. Beta-catenin accumulation is associated with increased
expression of Nanog protein and predicts maintenance of MSC self-renewal.
Cell Transplant. 2017;26(2):365–77.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Jiang et al. Stem Cell Research & Therapy (2019) 10:268 Page 17 of 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com
Available via license: CC BY 4.0
Content may be subject to copyright.
