Access to this full-text is provided by Frontiers.
Content available from Frontiers in Physiology
This content is subject to copyright.
fphys-10-01068 August 19, 2019 Time: 17:5 # 1
ORIGINAL RESEARCH
published: 20 August 2019
doi: 10.3389/fphys.2019.01068
Edited by:
Bin Tang,
Hangzhou Normal University, China
Reviewed by:
Alvin Kah-Wei Hee,
Universiti Putra Malaysia, Malaysia
Tomas Erban,
Crop Research Institute (CRI),
Czechia
Zhaorigetu Hubhachen,
Oklahoma State University,
United States
*Correspondence:
Hong-Bo Jiang
jhb8342@swu.edu.cn
Specialty section:
This article was submitted to
Invertebrate Physiology,
a section of the journal
Frontiers in Physiology
Received: 01 May 2019
Accepted: 05 August 2019
Published: 20 August 2019
Citation:
Tang G-H, Xiong Y, Liu Y,
Song Z-H, Yang Y, Shen G-M,
Wang J-J and Jiang H-B (2019) The
Transcription Factor MafB Regulates
the Susceptibility of Bactrocera
dorsalis to Abamectin via GSTz2.
Front. Physiol. 10:1068.
doi: 10.3389/fphys.2019.01068
The Transcription Factor MafB
Regulates the Susceptibility of
Bactrocera dorsalis to Abamectin via
GSTz2
Guang-Hui Tang1,2,3, Ying Xiong1,2,3 , Yi Liu1,2,3, Zhong-Hao Song1,2,3, Yang Yang1,2,3,
Guang-Mao Shen1,2,3 , Jin-Jun Wang1,2,3 and Hong-Bo Jiang1,2,3*
1Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University,
Chongqing, China, 2State Cultivation Base of Crop Stress Biology for Southern Mountainous Land, Southwest University,
Chongqing, China, 3International Joint Laboratory of China-Belgium on Sustainable Crop Pest Control, Academy
of Agricultural Sciences, Southwest University, Chongqing, China
Pesticide resistance is a serious problem that poses a major challenge to pest
control. One of the most potent resistance mechanisms is the overexpression of
genes coding for detoxification enzymes. The expression of detoxification genes is
regulated by a series of transcription factors. Previous studies have revealed that the
increased expression of detoxification genes contributes to the insecticide tolerance of
Bactrocera dorsalis. Our objective was thus to identify the transcription factors involved
in this process. Temporal expression profiles showed that the transcription factor MafB
and detoxification genes were expressed highly in the fat body. Further analysis showed
that the expression of MafB,GSTz2, and CYP473A3 was induced by abamectin.
Disruption of the MafB transcription factor through RNA interference decreased the
transcript levels of GSTz2 and CYP473A3 and increased the susceptibility to abamectin
significantly. Direct silencing of the expression of GSTz2 also increased susceptibility
to abamectin, while CYP473A3 did not. In conclusion, these results suggest that the
expression of GSTz2 and CYP473A3 was regulated by the transcription factor MafB,
and the up-regulation of GSTz2 via MafB decreased the susceptibility of B. dorsalis
to abamectin.
Keywords: oriental fruit fly, transcription factor, MafB,GST, abamectin
INTRODUCTION
The oriental fruit fly Bactrocera dorsalis (Hendel) is globally distributed and constitutes one of the
most damaging and economically important agricultural pests. In the field control of B. dorsalis,
the application of insecticides has led to high levels of insecticide resistance in China as well as
Hawaii of United States, which has resulted in severe ecological problems as well as significant
economic losses (Hsu et al., 2004;Chou et al., 2010;Jin et al., 2014). Abamectin, a macrocyclic
lactones compound, originated from the soil microorganism involving Streptomyces avermitilis,
has been commonly used for the control of fruit flies (Jin et al., 2011). It belongs to the family
of avermectins (Putter et al., 1981), targeting the glutamate-gated chloride channels (GluCls) and
histamine-gated chloride channels (HisCls) (Zheng et al., 2002;McCavera et al., 2007). However,
Frontiers in Physiology | www.frontiersin.org 1August 2019 | Volume 10 | Article 1068
fphys-10-01068 August 19, 2019 Time: 17:5 # 2
Tang et al. MafB Involved in Abamectin Detoxification in Bactrocera dorsalis
resistance selection analysis of a laboratory-reared strain
indicated that B. dorsalis could develop high resistance
to abamectin after 36 generations. Furthermore, resistance
monitoring showed that field populations of B. dorsalis in
China have developed resistance to abamectin (Jin et al., 2011).
Therefore, investigating the underlying molecular mechanisms
of insecticide resistance is an important prerequisite for the
development of resistance management strategies.
Great progress has been made over the last two decades
in understanding the molecular mechanisms of insecticide
resistance. It has been well reported that decreased target
site sensitivity, enhanced metabolic detoxification, and reduced
cuticle penetration are the major contributors to resistance
(Vontas et al., 2011;Liu, 2015;Vargas et al., 2015). Metabolic
resistance refers to the enhanced detoxification and metabolism
of insecticides in insects through increasing the expression or
activity of detoxification enzymes. Notably, the overexpression
of cytochrome P450 monooxygenases (P450s), carboxylesterases
(CarEs), and glutathione S-transferases (GSTs) constitutes the
most common metabolic resistance mechanism (Wilson, 2001).
RNA interference (RNAi) technology can effectively detect the
importance of these continuously overexpressed detoxification
genes in insect resistance. Interference of the overexpressed
genes (CYP6FD2 and CYP6FF1) of Locusta migratoria has led
to an increase in deltamethrin toxicity (Guo et al., 2016). In
Tetranychus cinnabarinus, P450 genes, such as CYP389B1 and
CYP392A26, were overexpressed in a fenpropathrin-resistant
strain (Shi et al., 2015). The transcription levels of GSTs (GSTe2,
GSTe4, and GSTe9) and CarEs (CarE2,CarE4, and CarE6) in
malathion-resistant strains of B. dorsalis were increased, and the
silencing of these genes by RNAi could increase the susceptibility
to malathion (Wang et al., 2015, 2016;Lu et al., 2016).
To further clarify the regulatory mechanisms of specific
genes, the transcription system of xenobiotic detoxification
in Drosophila was assessed (Misra et al., 2011). Under stress
exposure conditions, Keap1 releases CncC [a basic leucine
zipper (bZIP) protein], which translocates to the nucleus, and a
heterodimer formed by CncC and sMaf (belonging to the bZIP
family) binds upstream of the stress-response genes (XRE) to
regulate the expression of antioxidant genes (Nioi et al., 2003;
Baird and Dinkova-Kostova, 2011;Misra et al., 2011;Hirotsu
et al., 2012). It has been reported that the Cncc–Maf heterodimer
is involved in the transcriptional regulation of detoxifying
metabolic enzymes. In Drosophila melanogaster,CYP6a2 and
CYP6a8 were down-regulated following the knockdown of
CncC, which resulted in a decreased DDT tolerance in DDT-
resistant strains (Misra et al., 2013). Expression of GSTd1
in D. melanogaster was also reduced after the silencing of
CncC and led to the high mortality of paraquat poisoning
(Sykiotis and Bohmann, 2008). In Aphis gossypii, CncC regulates
Cyp6AD2 to alter gossypol tolerance in a gossypol-resistant strain
(Peng et al., 2016).
Oriental fruit flies are polyphagous pests that reduce the yield
and quality of fruit, often cause spoilage. The long-term intensive
use of pesticides has led to resistance to various insecticides in
the species (Brown and Payne, 1988). It was previously indicated
that the overexpression of detoxification enzymes constitutes a
primary mechanism of resistance in B. dorsalis. In this study,
we focused on the function of the transcription factor MafB
and its downstream genes, which are involved in the abamectin
tolerance of B. dorsalis.
MATERIALS AND METHODS
Test Insects
Larvae of the flies were originally collected from the infested
oranges in Hainan province, China, in 2008. For this study, 60
generations of the flies have been reared. The insects were reared
with an artificial diet according to a previously described protocol
(Wang et al., 2013). The laboratory strain of the flies was cultured
in a growth chamber at 27.5 ±0.5◦C, 75 ±5% relative humidity,
and a photoperiod of 14:10 h (light:dark).
Molecular Cloning
The reference sequence of the MafB cDNA was acquired
from NCBI (GenBank accession number, XM_011207424).
Primers amplifying the complete open-reading frame (ORF) were
designed (Table 1) using Primer Premier 5.0 (Premier Biosoft
International, Palo Alto, CA, United States). PrimeSTAR high-
fidelity DNA polymerase (Takara, Dalian, China) was used for
PCR amplification. The purified PCR product was subcloned into
the pGEM-T Easy Vector (Promega, Beijing, China), and the
construct was transformed into Trans5αchemically competent
cells. Positive clones were sent for sequencing (TransGen Biotech,
Beijing, China).
Quantitative Reverse Transcript PCR
RNA was extracted from different tissues, including the
Malpighian tubules, fat body, and midgut. TRIzol reagent (Life
Technologies, Carlsbad, CA, United States) was used for the
RNA isolation with a genome DNA elimination by DNase I
(Promega, Madison, WI, United States). The extracted RNA
was purified using phenol/chloroform method and dissolved
in the RNase-free water. The concentration and the purity
were assessed by Nanodrop 1000 (GE Healthcare Bio-sciences,
Uppsala, Sweden). The cDNA synthesis was conducted by the
PrimeScript 1st Strand cDNA Synthesis Kit (Takara, Dalian,
China) according to the manufacturers’ instructions. For each
TABLE 1 | Primers for MafB used in the study.
Experiment Primer names Sequences (50–30)
Full-length MafB-F ATGAGAATGGAAGACCCAAACC
MafB-R GCAAGTTGGCGTCAGAGA
RT-qPCR MafB-qF GAAATCTACACGCACGGACC
MafB-qR AGGATCTGAACGCATGGAGT
dsRNA synthesis MafB-dsF TAATACGACTCACTATAGGGAATGGAAG
TACTTGTGCCCAAA
MafB-dsR TAATACGACTCACTATAGGGGCTATATTG
TCTGGAGCAGGT
MafB, transcription factor. The underlined letters represent the T7 promoter
sequences for efficient in vitro transcription in dsRNA synthesis.
Frontiers in Physiology | www.frontiersin.org 2August 2019 | Volume 10 | Article 1068
fphys-10-01068 August 19, 2019 Time: 17:5 # 3
Tang et al. MafB Involved in Abamectin Detoxification in Bactrocera dorsalis
sample, 1 µg of total RNA was used to synthesize cDNA. A serial
dilution (fivefold) of the cDNA was employed to determine the
amplification efficiency of each primer pair for the target gene.
Quantitative Reverse Transcript PCR (RT-qPCR) was performed
in 10 µL reaction volumes consisting of 5 µL qPCR Master Mix
(Promega, Madison, WI, United States), 0.5 µL each of cDNA
and reverse primers (5 µM), and 3.5 µL nuclease-free water. The
RT-qPCR reactions were conducted with the following program:
initial incubation of 95◦C for 2 min, followed by 40 cycles of
95◦C for 15 s and 60◦C for 30 s. RPS and α-tubulin served
as the internal reference genes for normalization of the relative
expression levels (Shen et al., 2010). The RT-qPCR was conducted
with two technical and four biological replications. The relative
expression data were analyzed using Qbase. The expression of
MafB and detoxification enzymes in three different tissues of
B. dorsalis was log2 transformed. A heat map was generated
by HemI. RNAi and abamectin treatment data are presented as
the mean ±standard error (SE). All the data were subject to
independent t-test by utilizing SPSS 20.0 (SPSS Inc., Chicago,
IL, United States).
Phylogenetic Analysis and Identification
MafB protein sequences of dipteran species were obtained from
the NCBI web server1and aligned with the MafB sequences
generated in the present study using Clustal (Larkin et al.,
2007) and JalView 2.9 (Waterhouse et al., 2009). To infer the
evolutionary relationships, the neighbor-joining method was
used to construct a phylogenetic tree in MEGA5.05 (Tamura
et al., 2011) with 1000 bootstrap replicates. The molecular weight
1http://www.ncbi.nlm.nih.gov
and isoelectric point of MafB were predicted using the online
software tool2.
RNAi
A fragment of MafB was amplified by PCR using primers
(Table 1) containing the T7 promoter as the template for double-
stranded (ds) RNA synthesis. The dsRNA was synthesized using
the TranscriptAid T7 High Yield Transcription Kit (Thermo
Scientific, Wilmington, DE, United States). About 1.5 µg of
dsRNA was injected into the abdomen between the first and
second abdominal segments with a Nanoject II Auto-Nanoliter
Injector (Drummond Scientific, Broomall, PA, United States).
Equivalent injection quantities of the ds green fluorescent
protein (dsGFP) served as the control. The RNAi efficiency was
determined using randomly collected adults at 24 and 48 h post-
injection. At least 60 4-day-old adult flies were used for each
treatment and control group. Mortality was less than or equal to
5% after dsRNA injection for each treated and control group.
Abamectin Bioassay
Abamectin (95% purity) was purchased from Bangnong
Chemical Company (Guangzhou, China). The bioassay was
performed following the knockdown of MafB,CYP437A3,
and GSTz2. A 0.5-µL of abamectin [concentration = LC40
(105 µg/mL)] was applied to the pronotum of test insects using
a PB-600-1 repeating dispenser (Hamilton Company, Reno, NV,
United States). For the dsRNA-injected flies, the bioassay was
conducted at 24 h after the injection. At least 60 injected flies
were used for the bioassays for each treatment. Mortality of the
flies was scored after 24 h of exposure to abamectin. Chi-square
2http://web.expasy.org/protparam/
FIGURE 1 | Sequence and phylogenetic tree of MafB.(A) Phylogenetic tree of MafBs. Amino acid sequences of B. dorsalis MafB and dipteran MafB were aligned to
forming phylogenetic tree to assess their relationships. MafB of B. dorsalis was indicated by the red rectangle. (B) The amino acid sequence structure of MafB. The
basic leucine and zipper (bZIP) domain are indicated by blue background and red color. DNA-binding site and dimer interface domain are indicated by yellow and
purple core color, respectively.
Frontiers in Physiology | www.frontiersin.org 3August 2019 | Volume 10 | Article 1068
fphys-10-01068 August 19, 2019 Time: 17:5 # 4
Tang et al. MafB Involved in Abamectin Detoxification in Bactrocera dorsalis
FIGURE 2 | The transcriptional expression profiles of MafB and detoxification enzymes in three different tissues of B. dorsalis. MT, Malpighian tubules; MG, midgut;
FB, fat body. The expression of MafB and detoxification enzymes of B. dorsalis was log2 transformed. Different colors represent the degree of expression, red and
blue indicate upregulation and downregulation, respectively.
(χ2)-test was used to determine the significant difference of the
mortality between dsRNA treated and control group by utilizing
SPSS 20.0 (SPSS Inc., Chicago, IL, United States). Data are
presented as the mean ±SE.
RESULTS
MafB Sequence Analysis
The ORF of MafB was screened out from the transcriptome
data of B. dorsalis and confirmed by PCR. The sequence of
MafB is accessible in GenBank (XM_011207424). The complete
ORF of MafB contains 1323 nucleotides and encodes 440 amino
acids. The predicted molecular weight of the MafB protein is
48.71 kD, and the isoelectric point is 6.97. The phylogenetic
tree of dipteran MafB protein sequences shows that the MafB
proteins are relatively conserved and that the MafB of B. dorsalis
is close to the MafB of B. latifrons and B. oleae from Tephritidae
(Figure 1). The MafB protein includes one conserved domain
(Basic Leucine zipper domain). There is a dimerization domain
and a DNA-binding site (DBD) (Figure 1). Thirteen residues
consist of DNA-binding sites and 19 are composed of a dimer
interface that can form a dimer and bind upstream of the target
gene to initiate transcription.
Tissue-Specific Expression Profiling
The expression patterns of the transcription factor (MafB) as well
as the detoxification enzymes in the three major tissues (midgut,
fat body, and Malpighian tubules) associated with insecticide
metabolism were analyzed by RT-qPCR (Figure 2). The highest
expression of MafB was detected in the fat body, followed by
the midgut and then the Malpighian tubules. Based on this
characteristic, GSTe6,GSTz2,CYP437A3,CYP4AC4, and aE6,
which were highly expressed in the fat body, were screened out.
These filtered genes were then used in the following experiments.
Abamectin-Induced Expression
The relative expressions of MafB and the filtered detoxifying
genes in the 4-day-old adult flies under abamectin treatment at
Frontiers in Physiology | www.frontiersin.org 4August 2019 | Volume 10 | Article 1068
fphys-10-01068 August 19, 2019 Time: 17:5 # 5
Tang et al. MafB Involved in Abamectin Detoxification in Bactrocera dorsalis
FIGURE 3 | The transcriptional expression profiles of MafB and GSTe6,
GSTz2,CYP4AC4,CYP437A3, and aE6 of B. dorsalis in the fat body by
abamectin treatment. The data shown are mean ±SE (n= 3). Relative
expression was calculated based on the value of acetone. Asterisks (∗and ∗∗)
above the error bars present statistical differences determined by the
independent samples t-test with P<0.05 and P<0.01, respectively.
three different time points (12, 24, and 36 h) were analyzed by RT-
qPCR (Figure 3). The relative expression of MafB in the fat body
after treatment was significantly higher than in the control at 12 h
(P<0.05), indicating the rapid response of MafB to abamectin
stimulation. The relative expressions of CYP437A3 and GSTz2 in
the fat body after 36 h of treatment were significantly increased
(P<0.05). However, the expression of CYP4AC4,aE6, and
GSTe6 did not change significantly at any time point following
abamectin treatment. CYP437A3 and GSTz2 were thus selected
for the subsequent interference experiments.
RNAi of MafB and Abamectin
Susceptibility Test
To examine whether MafB controls the expression of detoxifying
genes (including CYP437A3 and GSTz2) and affects the
susceptibility of abamectin, RNAi of MafB was conducted.
The suppression efficiency of MafB compared to the GFP-
injected control was quantified by RT-qPCR (Figure 4A). The
transcriptional level of MafB was significantly reduced (88.4%
suppressed) than in the control after 24 h (P<0.05). RNAi of
MafB also led to the reduced expression of two detoxification
genes (CYP437A3 and GSTz2). The abamectin bioassays showed
that RNAi of MafB presented a significantly higher mortality
rate (Figure 4B). Under abamectin exposure, the mortalities at
24 h were 37 and 51% in the flies injected with dsGFP and
dsMafB, respectively.
RNAi of GSTz2 and CYP437A3 and
Abamectin Susceptibility Test
RNA interference of CYP437A3 and GSTz2 was conducted in
B. dorsalis using the same method described above. The mRNA
levels of CYP437A3 and GSTz2 were significantly reduced after
24 h (P<0.05) (Figure 5A). The abamectin bioassay suggested
that the RNAi of GSTz2 was associated with a higher mortality
rate (Figure 5B). However, the RNAi of CYP437A3 had no effect
on mortality. Under exposure to abamectin, the mortalities at
24 h were 47 and 61% in the flies injected with dsGFP and
dsGSTz2, respectively.
DISCUSSION
The principal objective of this study was to confirm whether MafB
functions in the regulation of detoxification genes in B. dorsalis.
Although small Maf works as a ligand protein of CncC, it
plays an indispensable role in the heterodimer that regulates the
detoxification of metabolic enzymes. Without Maf, the regulatory
pathway of CncC is invalid. When CncC and Maf were both
expressed in Tribolium castaneum, luciferase activity was higher
than under the expression of CncC alone in the regulation of
CYP6BQ12,CYP6BQ6,CYP6BQ7, and CYP6BQ9 (Kalsi and Palli,
2015). In T. cinnabarinus, luciferase activity was also higher in
the presence of both CncC and Maf than in the presence of CncC
alone in the regulation of CYP389B1 and CYP392A28 (Shi et al.,
2017). In addition, the bZIP nuclear transcription factor family
is composed of small Maf (MafG, MafK, and MafF) and large
Maf (c-Maf and MafB) proteins that repress as well as activate
the transcription of many genes. Notably, large Maf (MafB) and
CncC proteins belong to the bZIP family. Large Maf (MafB)
proteins are similar to CncC proteins and possess a transcription
activity region, binding to antioxidant response elements (AREs)
to activate or repress ARE-mediated transcription (Katsuoka
and Yamamoto, 2016). It has been documented that large
Maf proteins regulate the gene expression of ARE-mediated
detoxifying enzymes (Saravanakumar and Jaiswal, 2002). The
functional analysis of MafB is thus particularly important in
oriental fruit fly.
In order to explore the functions of MafB, the expression of
MafB was analyzed. Compared with the midgut and Malpighian
tubules, the MafB gene was highly expressed in the fat body
and exhibited tissue specificity. The fat body is one of the
most important tissues for detoxification metabolism. Numerous
P450s express in the fat body, midgut, and Malpighian tubules.
Signaling of the CYP4p2 and CYP4s3 genes has been exclusively
detected in the fat body via a hybridization technique (Chung
et al., 2009). The fat body plays a significant role in metabolic
functioning, including in the storage and delivery of energy to
satisfy energy demands in insects (Arrese and Soulages, 2010).
The high expression in the fat body implies that MafB was
involved in detoxification metabolism. Based on the transcripts,
CYP4AC4,CYP437A3,aE6,GSTe6, and GSTz2 were highly
expressed in the fat body, which suggests a regulatory relationship
between MafB and these genes.
Abamectin treatment experiments were then conducted
to further explore these regulatory relationships. MafB was
significantly expressed at 12 h in the fat body following
abamectin treatment, and the downstream target genes (GSTz2
and CYP437A3) were elevated at 36 h, which indicates that MafB
responds to abamectin more rapidly and that MafB is likely
to regulate downstream genes. However, the mRNA levels of
GSTe6,aE6, and CYP4AC4 were not significantly increased at
any time following abamectin treatment. RNAi experiments were
Frontiers in Physiology | www.frontiersin.org 5August 2019 | Volume 10 | Article 1068
fphys-10-01068 August 19, 2019 Time: 17:5 # 6
Tang et al. MafB Involved in Abamectin Detoxification in Bactrocera dorsalis
FIGURE 4 | Susceptibility of B. dorsalis to abamectin after MafB knockdown by RNAi. (A) Relative expression levels of MafB after B. dorsalis adults were injected
with dsMafB compared to dsGFP, a double-stranded green fluorescent protein RNA. (B) Mortality rate for the dsMafB- and dsGFP-injected flies after abamectin
treatment. Asterisks (∗and ∗∗) above the error bars present statistical differences determined by the independent samples t-test with P<0.05 and P<0.01,
respectively.
FIGURE 5 | Susceptibility of B. dorsalis to abamectin after GSTz2 and CYP437A3 knockdown by RNAi. (A) Relative expression levels of GSTz2 and CYP437A3 after
B. dorsalis adults were injected with dsGSTz2 and dsCYP437A3, respectively, compared to dsGFP, a double-stranded green fluorescent protein RNA. (B) Mortality
rate for the dsGSTz2 and dsCYP437A3 and dsGFP-injected flies after abamectin treatment. Asterisks (∗and ∗∗) above the error bars present statistical differences
determined by the independent samples t-test with P<0.05 and P<0.01, respectively.
performed to further evaluate the relationship between MafB and
downstream genes (GSTz2 and CYP437A3).
RNA interference was used to disrupt the expression
of MafB.MafB knockdown resulted in increased abamectin
susceptibility and the down-regulation of CYP437A3 and
GSTz2. In a previous experiment, the transcription levels
of detoxification genes were suppressed by Maf disruption,
including CYP6M2,GSTD1,GSTD3,jheh1,jheh2, and Gnmt,
leading to increased susceptibility to DDT, permethrin, and
deltamethrin in Anopheles gambiae (Ingham et al., 2017).
Furthermore, Maf-S transcription factors were found to control
the expression of P450 genes associated with deltamethrin
resistance in T. castaneum (Kalsi and Palli, 2015), imidacloprid
resistance in Leptinotarsa decemlineata (Kalsi and Palli, 2017),
and fenpropathrin resistance in T. cinnabarinus (Shi et al., 2017).
The studies indicated that the silencing of Maf results in the
down-regulated expression of detoxifying enzyme genes, which
further influences metabolism. In this paper, we found that the
mRNA levels of GSTz2 and CYP437A3 were also significantly
decreased following MafB knockdown. We also demonstrated
that the silencing of GSTz2 results in increased susceptibility
to abamectin. GSTs are an important group of detoxification
enzymes and can be divided into six classes, including epsilon,
delta, zeta, theta, omega, and sigma (Ding et al., 2003). GST
activity was increased in the fat body and hemolymph under
exposure to abamectin in Colorado potato beetle (Tomilova et al.,
2016). In pollen beetle Meligethes aeneus, cytochromes P450
and GST made a contribution to deltamethrin exposure (Erban
et al., 2017). However, silencing of CYP437A3 did not alter the
susceptibility of B. dorsalis to abamectin in the current study,
Frontiers in Physiology | www.frontiersin.org 6August 2019 | Volume 10 | Article 1068
fphys-10-01068 August 19, 2019 Time: 17:5 # 7
Tang et al. MafB Involved in Abamectin Detoxification in Bactrocera dorsalis
indicating that it is a downstream gene of MafB and may not
contribute decisively to abamectin susceptibility.
CONCLUSION
In conclusion, the results indicated that the expression of GSTz2
was regulated by the transcription factor MafB, which resulted
in the susceptibility change of B. dorsalis to abamectin. This
study improves our understanding of the regulatory relationship
between MafB and detoxification enzymes and also confirms
that GSTz2 is an important downstream gene that is involved in
abamectin tolerance.
DATA AVAILABILITY
All datasets for this study are included in the manuscript and/or
the supplementary files.
AUTHOR CONTRIBUTIONS
H-BJ and J-JW designed the research and provided the
materials and reagents. G-HT, YX, YL, and YY performed
all of the experiments. Z-HS and G-HT reared the
test insects and collected the data in bioassay. G-HT,
YX, G-MS, and H-BJ analyzed the data. G-HT wrote
the original draft. H-BJ, J-JW and G-MS edited and
modified the manuscript.
FUNDING
This work was financially supported by the National Natural
Science Foundation of China (31572016 and 31772233),
the Fok Ying Tung Education Foundation (161029), the
Chongqing Young Talents Support Program, the Chongqing
Excellent Talents Support Program in University, the
Fundamental Research Funds for the Central Universities
(XDJK2017A011), and the earmarked fund for Modern
Agro-industry (Citrus) Technology Research System (CARS-
27) of China.
ACKNOWLEDGMENTS
We thank LetPub (http://www.letpub.com) for its linguistic
assistance during the preparation of this manuscript.
REFERENCES
Arrese, E. L., and Soulages, J. L. (2010). Insect fat body: energy, metabolism,
and regulation. Annu. Rev. Entomol. 55, 207–225. doi: 10.1146/annurev-ento-
112408-085356
Baird, L., and Dinkova-Kostova, A. T. (2011). The cytoprotective role of the
keap1–Nrf2 pathway. Arch. Toxicol. 85, 241–272. doi: 10.1007/s00204-011-
0674-5
Brown, T. M., and Payne, G. T. (1988). Experimental selection for insecticide
resistance. J. Econom. Entomol. 81, 49–56. doi: 10.1093/jee/81.1.49
Chou, M. Y., Haymer, D. S., Feng, H. T., Mau, R. F. L., and Hsu, J. C.
(2010). Potential for insecticide resistance in populations of Bactrocera dorsalis
in hawaii: spinosad susceptibility and molecular characterization of a gene
associated with organophosphate resistance. Entomologia Exp. Et Applicata.
134, 296–303. doi: 10.1111/j.1570-7458.2009.00962.x
Chung, H., Sztal, T., Pasricha, S., Sridhar, M., Batterham, P., and Daborn, P. J.
(2009). Characterization of Drosophila Melanogaster cytochrome P450 genes.
Proc. Nat. Acad. Sci. U. S. A. 106, 5731–5736. doi: 10.1073/pnas.081214
1106
Ding, Y., Ortelli, F., Rossiter, L. C., Hemingway, J., and Ranson, H. (2003).
The Anopheles gambiae glutathione transferase supergene family: annotation,
phylogeny and expression profiles. BMC Genom. 4:35. doi: 10.1186/1471-2164-
4-35
Erban, T., Harant, K., Chalupnikova, J., Kocourek, F., and Stara, J. (2017).
Beyond the survival and death of the deltamethrin-threatened pollen
beetle Meligethes aeneus: an in-depth proteomic study employing a
transcriptome database. J. Proteom. 150, 281–289. doi: 10.1016/j.jprot.2016.
09.016
Guo, Y., Wu, H., Zhang, X., Ma, E., Guo, Y., Zhu, K. Y., et al. (2016). RNA
interference of cytochrome P450 CYP6F subfamily genes affects susceptibility
to different insecticides in Locusta migratoria.Pest Manag. Sci. 72, 2154–2165.
doi: 10.1002/ps.4248
Hirotsu, Y., Katsuoka, F., Funayama, R., Nagashima, T., Nishida, Y., Nakayama,
K., et al. (2012). Nrf2-MafG heterodimers contribute globally to antioxidant
and metabolic networks. Nucleic Acids Res. 40, 10228–10239. doi: 10.1093/nar/
gks827
Hsu, J. C., Feng, H. T., and Wu, W. J. (2004). Resistance and synergistic effects of
insecticides in Bactrocera dorsalis (Diptera:Tephritidae) in taiwan. J. Econom.
Entomol. 97, 1682–1688. doi: 10.1603/0022-0493- 97.5.1682
Ingham, V. A., Pignatelli, P., Moore, J. D., Wagstaff, S., and Ranson, H. (2017). The
transcription factor Maf-S regulates metabolic resistance to insecticides in the
malaria vector Anopheles gambiae.BMC Genom. 18:669. doi: 10.1186/s12864-
017-4086- 7
Jin, T., Liang, G. W., Zeng, L., and Lu, Y. Y. (2014). Detoxification enzymes
activities in different Bactrocera dorsalis (Hendel) populations and their
relationship with the resistant levels. J. Environ. Entomol. 36, 58–67.
Jin, T., Zeng, L., Lin, Y., Lu, Y., and Liang, G. (2011). Insecticide resistance of
the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera:Tephritidae), in
mainland China. Pest Manag. Sci. 67, 370–376. doi: 10.1002/ps.2076
Kalsi, M., and Palli, S. R. (2015). Transcription factors, CncC and Maf, regulate
expression of CYP6BQ genes responsible for deltamethrin resistance in
Tribolium castaneum.Insect Biochem. Mole. Biol. 65, 47–56. doi: 10.1016/j.
ibmb.2015.08.002
Kalsi, M., and Palli, S. R. (2017). Transcription factor cap n collar C regulates
multiple cytochrome P450 genes conferring adaptation to potato plant
allelochemicals and resistance to imidacloprid in Leptinotarsa decemlineata
(Say). Insect Biochem. Mole. Biol. 83, 1–12. doi: 10.1016/j.ibmb.2017.02.002
Katsuoka, F., and Yamamoto, M. (2016). Small Maf proteins (MafF, MafG, MafK):
history, structure and function. Gene 586, 197–205. doi: 10.1016/j.gene.2016.
03.058
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A.,
McWilliam, H., et al. (2007). Clustal W and clustal X version 2.0. Bioinformatics
23, 2947–2948. doi: 10.1093/bioinformatics/btm404
Liu, N. (2015). Insecticide resistance in mosquitoes: impact, mechanisms, and
research directions. Annu. Rev. Entomol. 60:537. doi: 10.1146/annurev-ento-
010814-020828
Lu, X. P., Wang, L. L., Huang, Y., Dou, W., Chen, C. T., and Wei, D. (2016).
The epsilon glutathione s-transferases contribute to the malathion resistance
in the oriental fruit fly, bactrocera dorsalis (hendel). Comp. Biochem. Physiol. C
Toxicol. Pharmacol. 180, 40–48. doi: 10.1016/j.cbpc.2015.11.001
McCavera, S., Walsh, T. K., and Wolstenholme, A. J. (2007). Nematode ligand-
gated chloride channels: an appraisal of their involvement in macrocyclic
Frontiers in Physiology | www.frontiersin.org 7August 2019 | Volume 10 | Article 1068
fphys-10-01068 August 19, 2019 Time: 17:5 # 8
Tang et al. MafB Involved in Abamectin Detoxification in Bactrocera dorsalis
lactone resistance and prospects for developing molecular markers. Parasitology
134, 1111–1121. doi: 10.1017/s0031182007000042
Misra, J. R., Geanette, L., and Thummel, C. S. (2013). Constitutive activation of
the Nrf2/Keap1 pathway in insecticide-resistant strains of Drosophila.Insect
Biochem. Mole. Biol. 43, 1116–1124. doi: 10.1016/j.ibmb.2013.09.005
Misra, J. R., Horner, M. A., Geanette, L., and Thummel, C. S. (2011).
Transcriptional regulation of xenobiotic detoxification in Drosophila.Genes
Dev. 25, 1796–1806. doi: 10.1101/gad.17280911
Nioi, P., McMahon, M., Itoh, K., Yamamoto, M., and Hayes, J. D. (2003).
Identification of a novel Nrf2-regulated antioxidant response element (ARE)
in the mouse NAD(P) H: quinone oxidoreductase 1 gene: reassessment of the
ARE consensus sequence. Biochem. J. 374, 337–348. doi: 10.1042/bj20030754
Peng, T., Pan, Y., Gao, X., Xi, J., Zhang, L., Yang, C., et al. (2016). Cytochrome
P450 CYP6DA2 regulated by cap ’n’collar isoform C (CncC) is associated with
gossypol tolerance in Aphis gossypii Glover. Insect Mole. Biol. 25, 450–459.
doi: 10.1111/imb.12230
Putter, I., Connell, J. G. M., Preiser, F. A., Haidri, A. A., Ristich, S. S., and Dybas,
R. A. (1981). Avermectins: novelinsecticides, acaricides, and nematicides from
soil microorganism. Cell. Mole. Life Sci. 37, 963–964. doi: 10.1007/bf01971780
Saravanakumar, D., and Jaiswal, A. K. (2002). c-Maf negatively regulates ARE-
mediated detoxifying enzyme genes expression and anti-oxidant induction.
Oncogene 21, 5301–5312. doi: 10.1038/sj.onc.1205642
Shen, G. M., Jiang, H. B., Wang, X. N., and Wang, J. J. (2010). Evaluation of
endogenous references for gene expression profiling in different tissues of the
oriental fruit fly Bactrocera dorsalis (Diptera:Tephritidae). BMC Mole. Biol.
11:76. doi: 10.1186/1471-2199- 11-76
Shi, L., Wang, M., Zhang, Y., Shen, G., Di, H., Wang, Y., et al. (2017). The
expression of P450 genes mediating fenpropathrin resistance is regulated by
CncC and Maf in Tetranychus cinnabarinus (Boisduval). Comp. Biochem.
Physiol. C Toxicol. Pharmacol. 198, 28–36. doi: 10.1016/j.cbpc.2017.05.002
Shi, L., Xu, Z. F., Shen, G. M., Song, C. G., Wang, Y., Peng, J. F., et al. (2015).
Expression characteristics of two novel cytochrome P450 genes involved in
fenpropathrin resistance in Tetranychus cinnabarinus (Boisduval). Pesticide
Biochemistry and Physiology. 119, 33–41. doi: 10.1016/j.pestbp.2015.02.009
Sykiotis, G. P., and Bohmann, D. (2008). Keap1/Nrf2 Signaling regulates oxidative
stress tolerance and lifespan in Drosophila.Dev. Cell. 14, 76–85. doi: 10.1016/j.
devcel.2007.12.002
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011).
MEGA5: molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mole. Biol. Evol. 28,
2731–2739. doi: 10.1093/molbev/msr121
Tomilova, O. G., Kryukov, V. Y., Duisembekov, B. A., Yaroslavtseva, O. N., Tyurin,
M. V., Kryukova, N. A., et al. (2016). Immune-physiological aspects of synergy
between avermectins and the entomopathogenic fungus metarhizium robertsii
in colorado potato beetle larvae. J. Invertebrate Pathol. 140, 8–15. doi: 10.1016/
j.jip.2016.08.008
Vargas, R. I., Piñero, J. C., and Leblanc, L. (2015). An overview of pest
species of Bactrocera Fruit Flies (Diptera:Tephritidae) and the integration
of biopesticides with other biological approaches for their management with
a focus on the pacific region. Insects 6, 297–318. doi: 10.3390/insects60
20297
Vontas, J., Hernandez-Crespo, P., Margaritopoulos, J. T., Ortego, F., Feng, H. T.,
Mathiopoulos, K. D., et al. (2011). Insecticide resistance in tephritid flies. Pestic.
Biochem. Physiol. 100, 199–205. doi: 10.1016/j.pestbp.2011.04.004
Wang, J. J., Wei, D., Dou, W., Hu, F., Liu, W. F., and Wang, J. J. (2013). Toxicities
and synergistic effects of several insecticides against the oriental fruit fly
(Diptera:Tephritidae). J. Econom. Entomol. 106, 970–978. doi:10.1603/e c12434
Wang, L. L., Huang, Y., Lu, X. P., Jiang, X. Z., Smagghe, G., Feng, Z. J., et al.
(2015). Overexpression of two-esterase genes mediates metabolic resistance to
malathion in the oriental fruit fly, Bactrocera dorsalis (Hendel). Insect Mole.
Biol. 24, 467–479. doi: 10.1111/imb.12173
Wang, L. L., Lu, X. P., Meng, L. W., Huang, Y., Wei, D., Jiang, H. B., et al.
(2016). Functional characterization of an α-esterase gene involving malathion
detoxification in Bactrocera dorsalis (Hendel). Pestic. Biochem. Physiol. 130,
44–51. doi: 10.1016/j.pestbp.2015.12.001
Waterhouse, A. M., Procter, J. B., Martin, D. M. A., Clamp, M., and Barton, G. J.
(2009). Jalview Version 2-a multiple sequence alignment editor and analysis
workbench. Bioinformatics 25, 1189–1191. doi: 10.1093/bioinformatics/btp033
Wilson, T. G. (2001). Resistance of drosophila to toxins. Annu. Rev. Entomol.
46:545.
Zheng, Y., Hirschberg, B., Yuan, J., Wang, A. P., Schmatz, D. M., and Cully, D. F.
(2002). Identification of two novel Drosophila melanogaster histamine-gated
chloride channel subunits expressed in the eye. J. Biol. Chem. 277, 2000–2005.
doi: 10.1074/jbc.m107635200
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
Copyright © 2019 Tang, Xiong, Liu, Song, Yang, Shen, Wang and Jiang. This is an
open-access article distributed under the terms of the Creative Commons Attribution
License (CC BY). The use, distribution or reproduction in other forums is permitted,
provided the original author(s) and the copyright owner(s) are credited and that the
original publication in this journal is cited, in accordance with accepted academic
practice. No use, distribution or reproduction is permitted which does not comply
with these terms.
Frontiers in Physiology | www.frontiersin.org 8August 2019 | Volume 10 | Article 1068
Available via license: CC BY
Content may be subject to copyright.
