Content uploaded by Gamal M. Fahmy
Author content
All content in this area was uploaded by Gamal M. Fahmy on Sep 19, 2019
Content may be subject to copyright.
Content uploaded by Gamal M. Fahmy
Author content
All content in this area was uploaded by Gamal M. Fahmy on Sep 19, 2019
Content may be subject to copyright.
Content uploaded by Eihab Taha
Author content
All content in this area was uploaded by Eihab Taha on Jul 31, 2019
Content may be subject to copyright.
Egypt. J. Exp. Biol. (Bot.), 15(2): 197 – 203 (2019) © The Egyptian Society of Experimental Biology
DOI: 10.5455/egyjebb.20190620115158 AARU Impact Factor: 0.6
ISSN: 1687-7497 Online ISSN: 2090 - 0503 https://www.ejmanager.com/my/ejeb
R E S E A R C H A R T I C L E
Elhamy M El-Assiuty
Eihab M Taha
Zeinab M Fahmy
Gamal M Fahmy
Histological and molecular detections of Peronospora variabilis
Gäum oospores in seeds of Quinoa (Chenopodium quinoa L.)
ABSTRACT:
The oospores of Perosnospora variabilis Gäum, the
causal agent of downy mildew of quinoa
(Chenopodium quinoa L.), were detected
histologically in the perianth, pericarp, testa,
perisperm, and the cotyledons of the embryo of
quinoa seed. The histological detections of oospores
were confirmed by the polymerase chain reaction
(PCR) using the DNA extracted from the perianth and
all the seed parts. The occurrence percentage of
oospores in examined seed samples was high in the
perianth (90%) followed by the seed coat (87%)
whereas, the lowest percentages were found in the
embryo (3%) and the perisperm (2%).
KEY WORDS:
Chenopodiaceae, Downy mildew, Sexual
stage, PCR.
CORRESPONDENCE:
Eihab Mohamed Taha
* Plant Pathology Research Institute,
Agricultural Research Centre, Giza,
Egypt.
** Department of Biology, Faculty of Science,
Hafr Al Batin University, Kingdom of
Saudi Arabia.
E-mail: eihab111@gmail.com
Elhamy M El-Assiutya
Zeinab M Fahmya
Gamal M Fahmyb
a Plant Pathology Research Institute,
Agricultural Research Centre, Giza,
Egypt
b Department of Botany and Microbiology,
Faculty of Science, University of Cairo,
Giza 12613, Egypt
ARTICLE CODE: 18.02.19
INTRODUCTION:
Quinoa (Chenopodium quinoa Willd.), an
ancient food and feed stuff of the Andean
Region of South America, has been recently
introduced as a winter crop to Egypt. The crop
is endangered by downy mildew (DM) caused
by Peronospora variabilis Gäum (formerly P.
farinosa f. sp. chenopodii Byford). In 2014,
the disease was discovered and recorded in
Egypt on some accessions of quinoa (El-
Assiuty et al., 2014). Downy mildew causes
yield losses as reported at 33 - 58% in
resistant cultivars and up to 99% in some of
the highly susceptible cultivars (Danielsen et
al., 1999). The seeds were reported as the
main source of dissemination and
transmission of quinoa downy mildew
(Danielsen et al., 2004; Kitz, 2008). There are
many other reports that documented the role
of seed-borne oospores in downy mildew
transmission (Ojiambo et al., 2015; Cohen et
al., 2017; Salgado-Salazar et al., 2018;
Thangavel et al., 2018). Oospores of P.
variabilis transmitted through infected quinoa
seed were reported to be presented under the
seed (fruit) pericarp (Danielsen et al., 2004).
Inaba et al. (1983) observed oospores in seed
wash-offs from commercial spinach seed. The
detection of P. effusa in different parts of
spinach seeds as the calyx tube, funiculus,
integument, and nucellus has been observed
(Leach and Borthwick, 1934). Plant pathogens
can be detected in different parts of the crop
seeds (Landa et al., 2007; Carroll et al., 2017;
Gilardi et al., 2018).
PCR-based assay was applied in many
articles to detect small amounts of pathogen
DNA. Testen et al. (2014) confirmed the
presence of P. variabilis oospores in quinoa
seeds by species-specific primers (PV6).
Oospores were recovered from 16% of the
spinach seed lots, but the presence of P.
effusa DNA was detected in 95% of seed lots
by PCR or qPCR assays (Kunjeti et al., 2016).
The occurrence of P. cubensis in cucurbits
seeds via microscopy was confirmed by
species-specific PCR assays (Cohen et al.,
2014).
Egypt. J. Exp. Biol. (Bot.), 15(2): 197 – 203 (2019)
ISSN: 1687-7497 Online ISSN: 2090 - 0503 https://www.ejmanager.com/my/ejeb
198
In this research, we conducted
histological examinations and species-specific
PCR-based assay to identify exactly the
accurate location(s) of oospores in the
different tissues of the infected quinoa seed
for manage the Downy mildew disease.
MATERIAL AND METHODS:
Detection of oospores in the quinoa seed
and perianth:
The seeds of quinoa variety, c.v. Misr1,
supplied by the Agriculture Research Centre,
Egypt, were used in the present study. The
dry seeds and the perianths were surface
sterilized by immersion in 1.5% sodium
hypochlorite for five minutes, washed in
sterilized distilled water (SDW), and blotted
dry with sterile tissue paper. The surface
sterilized seeds were soaked in warm SDW
for 60 minutes. Each individual seed was
dissected to separate the different
components (perianth, seed coat (pericarp +
testa), and embryo) by the aid of sharp fine
scalpel and forceps (Fig. 1: A1-A6).
Subsequently, each separated seed
component was surface sterilized (1.5%
sodium hypochlorite for three minutes),
washed with excessive SDW and transferred
to 1.5 ml tube, as well as stored at 4ºC until
use. To avoid cross-contamination, great care
was taken during the seed processing by
using new sterilized pairs of gloves, scalpels,
and forceps (Zimmer et al., 1992; Licen and
Kreft, 2007).
1. Anatomical detections:
A) Examination of the oospores adhered to
or present on the pericarp:
The seed washing method was used for
oospore detection in quinoa seeds according
to Inaba et al. (1983) and Testen et al.
(2014). Five grams (≈1200 to 1400 seeds ) of
seed-free perianth were stirred in 50 ml SDW
for 30 minutes. Thereafter, a sterile
cheesecloth was used to filter the seed wash
suspension. Then, the water suspensions
were centrifuged for 5 min. at 4000 rpm and
the resulting pellets were examined
microscopically (Olympus CH) to detect the
presence of oospores.
B) Examination of the oospores in cleared
whole mounts seeds:
A hundred of the separated tissues
and/or whole seeds were soaked in 25 ml of 1
M KOH for 30 min. at 90∘C to hydrolyse the
perisperm contents and to loosen and soften
the seed coat and the perianths (Danielsen et
al., 2004). The tissues were then rinsed in
water and acidified with dilute HCl (Phillips
and Hayman, 1970), stained with lactophenol-
trypan blue (10 ml lactic acid, 10 ml glycerol,
10 g phenol, 10 mg trypan blue dissolved in
10 ml SDW according to Keogh et al. (1980)
and Koch and Slusarenko (1990). Then, the
tissues were washed in chloral hydrate to
remove the excess stain, mounted in the
same solution on clean glass slides, and
gently pressed. The KOH-treated tissues were
systematically viewed and photographed
under a compound microscope (Olympus CH)
for the detection of P. variabilis oospores.
C) Examination of the seed cross sections:
The whole seeds (without perianths)
were fixed in formalin aceto-alcohol at 6°C for
6 hours (Clark, 1981) and stored in 70%
ethanol. Then, the fixed seeds were
dehydrated in a graded ethanol series
following the standard method of Stasolla and
Yeung (2015), embedded in paraffin wax
(Paraplast), and sectioned in transverse
directions at 5 µm using a rotary microtome.
The obtained Paraplast ribbons were mounted
on microscope slides, dried on a slide warmer
and stained with safranin and fast green (Ma
et al., 1993) or with lactophenol-trypan blue
(Koch and Slusarenko, 1990) with some
modifications. The Paraplast was removed
from the slides with xylene followed by a
descending graded series of ethanol (from
absolute ethanol to 50% in water), then the
slides were brought into water, and finally
stained with lactophenol-trypan blue as
described above.
D) Quantitative estimates of oospores in
the perianth and different tissues of the
seed:
These estimates were made by
recording the presence or absence of
oospore(s) in different tissues (perianth, seed
coat (pericarp + testa), embryo, and
perisperm) of each individual KOH-cleared
seed. The values were calculated as the
occurrence of oospores detected in perianth
and each seed tissue as percentage of the
total number of examined seeds.
2. Molecular detection:
To confirm the occurrence of oospores
in perianth, perianth-free seed and different
seed parts (pericarp, and embryo), PCR with
PV6 primers was assayed. The genomic DNA
was extracted from the perianth, seed and
seed components using the Thermo Gene JET
Genomic DNA Purification kit (Thermo Fisher
Scientific, Waltham, USA) according to the
ma nufacturer’s protoc ol. Tou chdo wn PCR
amplification of partial internal transduction
spacer (ITS) region of rDNA was developed to
detect P. variabilis in quinoa using species-
specific primers PV6F
(GTTGCTGGTTGTGAAGGCTG) and PV6R
(ATGCTACGCAACCGAAGTCA) as described
by Testen et al. (2014). The PCR was carried
out in 25-μl re acti ons consi sting of 12 .5 μl
DreamTaq Green PCR Master Mix (2X)
(Thermo Fisher Scientific, Waltham, USA), 0.2
μM of ea ch primer, and 3 μ l of template DNA.
Amplifications were performed in an Applied
Biosystems 2720 Thermal Cycler programmed
El-Assiuty et al., Histological and molecular detections of Peronospora variabilis Gäum oospores in seeds of Quinoa
ISSN: 1687-7497 Online ISSN: 2090 - 0503 https://www.ejmanager.com/my/ejeb
199
for initial denaturation at 94°C for 2 min.
followed by 32 cycles of a touchdown PCR
(Korbie and Mattick, 2008) with denaturation
at 95°C for 30 s, annealing from 66 to 56°C
for 45 s, and elongation at 72°C for 90 s; with
a final elongation step of 72°C for 5 min.
Amplification products were separated by
electrophoresis on a 1.5% agarose gel in Tris-
Borate-EDTA buffer (TBE) containing ethidium
bromide and visualized under UV light. The
amplified PCR products at the expected size
were purified and sequenced at Macrogen
(Seoul, South Korea). The identification of the
obtained sequences was confirmed by
comparison with the National Centre for
Biotechnology Information (NCBI; http://www.
ncbi.nlm.nih.gov/) database.
RESULTS:
The light microscopic examinations of
the suspensions of water-soaked quinoa
seeds (without perianths), the whole mounts
seeds, as well as the transverse sections of
the seeds are shown in figure 1 (B-I). The
oospores were typically globose (Fig. 1 B, C,
D, E, F, & I) or ovoid (Fig. 1 G, H) and each
one was surrounded by smooth outer thick
wall. The inclusions of the oospores were
transparent (Fig. 1 E), slightly granular (Fig. 1
C, D, & I) or densely pigmented (Fig. 1 B, F,
G, & H). The diameter of the globose
oospores ranged from 14 to 22 µm, while the
ovoid ones sized 14.2 - 19.2 µm in width and
16.6 - 22.2 µm in length.
Egypt. J. Exp. Biol. (Bot.), 15(2): 197 – 203 (2019)
ISSN: 1687-7497 Online ISSN: 2090 - 0503 https://www.ejmanager.com/my/ejeb
200
Fig. 1. (A1) The quinoa seed enclosed by perianth; (A2) Quinoa seed without perianth; (A3) An isolated perianth of
quinoa seed consisting of five tepals; (A4) The pericarp and the testa removed from the seed by means of scalpel
and very fine point forceps; (A5) The isolated curved embryo of quinoa seed; (A6) The embryo consists of
hypocotyl-radicle axis (the left part) and two fine cotyledons (the right part); (B) Oospore (arrow) in a whole mount
of a perianth segment stained with trypan blue; (C) Unstained oospore (arrow) from a suspension of water-soaked
seeds; (D) Oospore (arrow), in a whole mount of the pericarp tissue stained with trypan blue; (E) Transverse
section of seed showing an oospore (arrow) in the pericarp stained with safranin and fast green; (F) Transverse
section of the seed showing an oospore (arrow) in the tissue of the seed testa stained with safranin and fast
green; (G) Transverse section of the seed showing an oospore (arrow) inside the tissues of one cotyledon stained
with trypan blue; (H) Magnified view of the oospore shown in (G); (I) One oospore (arrow) inside the perisperm
tissue of the seed stained with trypan blue. Abbreviations: Pr = pericarp; Ts = testa; Co = cotyledon.
Quinoa seed contains peripheral, curved
embryo (Fig. 1 A5, A6) surrounding a
perisperm (Fig. 1I) and both were covered by
the seed coat (testa) and the two layered
pericarp (Fig. 1E&F) as recorded by Prego et
al. (1998). Fig. 1 (E) shows the large and
papillose cells of the outer layer of the
pericarp. Oospores are seen in mesophyll
under the epidermal cells of the whole
mounted perianth (Fig. 1B). Examination of
the suspension of the water-soaked quinoa
seeds (perianth-free) revealed that the
detected oospores (Fig. 1 B) were possibly
adhered to the surface of the pericarp and
that soaking of the seeds in water resulted in
their removal. The oospores were embedded
among the papillose cells of the pericarp (Fig.
1 D&E). Moreover, in the two-layered tissue of
the testa, the oospores were only found
among the cells of the outer layer (Fig. 1 F).
Oospores were scarcely observed in the
perisperm (the storage tissue of large cells
rich in starch grains) as in figure 1 (I). Also,
few oospores were observed within the
palisade tissues of the cotyledons as shown
in figure 1 (G&H). Neither hyphae nor sexual
structures (antheridia and oogonia) were
detected in the perianth or any of the seed
tissues (Fig. 1).
Comparisons of the perianth and the
different seed tissues regarding the presence
of oospores (Fig. 2) revealed that the
percentage occurrences of oospores were
high in the perianth (90% of the examined
seeds), followed by the seed coat (87%),
while the lowest percentages of oospores
were detected in the embryo (3%) and the
perisperm (2%).
Fig. 2. Occurrence percentages of oospores in the perianth and different tissues of quinoa seeds. Total
examined number was100 seeds.
PCR with PV6F and PV6R gave
amplification products of the expected size (278 bp) with DNA of all seed parts (perianth,
seed coat, and embryo) as seen in figure 3.
El-Assiuty et al., Histological and molecular detections of Peronospora variabilis Gäum oospores in seeds of Quinoa
ISSN: 1687-7497 Online ISSN: 2090 - 0503 https://www.ejmanager.com/my/ejeb
201
The sequences of the amplified PCR products
were completely homologous (more than
99.5% identical) to corresponding sequences
of P. variabilis (MF511726, MF511727,
EF614959, KF269611, and KF269612) in the
NCBI-BLAST.
Fig. 3. PCR detection of Peronospora variabilis in quinoa seed tissues with specific primer PV6F & PV6R.
Product size is approx. 278 bp. M = 100bp DNA ladder; lane1, perianth; lane2, pericarp; lane3,
embryo; lane 4, perianth-free seed.
DISCUSSION:
The results obtained throughout the
current study complement the findings of
previous investigators who reported that
quinoa seeds are the main source of
dissemination and transmission of downy
mildew (Danielsen et al., 2004; Kitz, 2008).
Danielsen et al. (2004) detected oospores in
the pericarp in 15% of quinoa seed lots, and
in the suspension of the water-soaked seeds.
Likewise, Alandia et al. (1979) detected
oospores in the seed wash of quinoa. Testen
et al. (2014) using the light microscope, was
able to detect oospores of P. variabilis in
wash of tested quinoa seed lots. The current
study showed that oospores were easily
released from the seeds by the seed-washing
method. Moreover, we could prove by the light
microscopic examination that oospores of P.
variabilis were present in perianth and in
different seed tissues (pericarp, testa,
embryo, and perisperm). Oospores of many
plant parasitic oomycetes were reported to be
present in different seed tissues of a variety
of crop plants other than quinoa as stated by
Singh and Mathur (2004). PCR assays
detected the pathogen in the perianth, seed
coat (pericarp + testa), and embryo. The
sequencing analysis confirmed that all seed
component samples that yielded 278 bp
amplicon were P. variabilis. Although Testen
et al. (2014) confirmed the presence of P.
variabilis oospores in quinoa seeds by
species-specific primers (PV6), and by
microscopic examination of the seed washes,
they did not locate them in the different seed
tissues that were examined. In the PCR assay
used by Kitz (2008) to study the growth and
development of DM pathogen through
different quinoa tissues, the ITSP primers
were able to amplify bands at 688 bp from
infected leaf, stem, and petiole tissues. Since
the PCR-based molecular method, which we
applied in the present investigation, was
efficient for detection of the fungal structures
(oospores) of P. variabilis in different tissues
and in the perianth of quinoa seeds examined,
the use of the P. variabilis-specific primer in
identifying seed lots for further rapid seed
certification is highly recommended. In
addition, we measured diameters of the
detected oospores within different parts of
quinoa seed. Average dimensions ranged
between 14 and 22.2 µm. Yet, measurements
of oospores made by Danielsen and Ames
(2004) were wider (39 - 50 µm). We
hypothesize that the differences in resting
spore dimensions may be regarded to the
host, environmental conditions, pathogen
races, age of spores, etc. This can be
supported by findings of Choi et al. (2008)
who reported that the diameters of oospores
of P. variabilis in Chenopodium album ranged
from 22.4 to 32.5 µm. Likewise, Lai et al.
(2004) recorded differences in oospore
dimensions of soybean DM.
It is worth mentioning that some
conclusions from this study can be drawn.
The most important one of these is the role of
fallen oospore-bearing perianths (thin
membranous outer parts of the flowers, which
enclose the mature quinoa seeds). The
perianth that consists of 5 tepals as described
by Burrieza et al. (2014) and shown in figure1
(A), easily splits at harvest to release the
Egypt. J. Exp. Biol. (Bot.), 15(2): 197 – 203 (2019)
ISSN: 1687-7497 Online ISSN: 2090 - 0503 https://www.ejmanager.com/my/ejeb
202
seed, acting as a dispersal agent of oospore
in soil. The perianth may play a role in
persistence of oospores in soil to the next
season. Accordingly, it could be hypothesized
that P. variabilis might be able to invade
quinoa plants through developing roots. This
can be supported by the fact that persistence
of oospores of some DM pathogens of other
crops in soil such as Peronosclerospora
sorghi, the cause of sorghum DM, can
substantially attack plants through developing
roots (Pratt and Janke, 1978). Systemic
infection, however, needs to be clearly
defined because the principles and methods
of control differ considerably in relation to the
dynamics of the disease.
Eventually, as oospores of P. varaibilis
play the initial role in quinoa DM, we may
state that a plenty of studies must be
implemented on oospores in the future to
manage the disease. For instance, adequate
extension of seed treatment methods,
improved methods for detection of seed-borne
DM, mechanism(s) of oospore production,
effect of host (collateral) on spore production,
tests for oospore viability, oospore longevity
in seed and soil and germination of oospores.
ACKNOWLEDGEMENT:
We express our sincere thanks to the
laboratory of Professor Dr. Youssef Fawzy
Ahmed, Department of Reproduction and
Artificial Insemination at the National
Research Centre, Giza, Egypt, for offering
help in paraffin embedding, sectioning and
staining of the seed.
REFERENCES:
Alandia S, Otazu V, Salas B. 1979. Enfermedades.
In: “ Quinua y kanihua. Cul tivos Andinos.
(Tapia M, Gandarillas MH, Alandia S et al.
(Eds.)”. Bogotá, Colom bi a, p p. 137-148.
Burrieza HP, López-Fenadez MP, Maldonado S. 2014.
Analogous reserve distribution and tissue
characteristics on quinoa and grass seeds
suggest convergent evolution. Front. Plant Sci.,
5: 546. doi: 10.3389/fpls.2014.00546.
Carroll CL, Carter CA, Goodhue RE, Lawell CY,
Subbarao KV. 2017. A review of control
options and externalities for verticillium wilts.
Phytopathology, 108(2): 160-171.
Choi YJ, Denchev CM, Shin HD. 2008. Morphological
and molecular analyses support the existence of
host-specific Peronospora species infecting
Chenopodium. Mycopathologia, 165(3): 155-164.
Clark G. 198 1. General meth ods. In: “Staining
procedures used by the biological stain
commission. (Clark G. ed)”. 4th edn. Williams
& Wilkins, Baltimore, London, pp. 1-26.
Cohen Y, Ben Naim Y, Falach L, Rubin AE. 2017.
Epidemiology of basil downy mildew.
Phytopathology, 107(10): 1149-1160.
Cohen Y, Rubin AE, Galperin M, Ploch S, Runge F,
Thines M. 2014. Seed transmission of
Pseudoperonospora cubensis. PLoS One,
9(10): e109766.
Danielsen S, Ames T. 2004. Mildew (Peronospora
farinosa) of quinua (Chenopodium quinoa) in
the Andean region: Practical manual for the
study of the disease and pathogen.
International Potato Center, Lima, Peru
Danielsen S, Jacobsen SE, Echegaray J, Ames T.
1999. Impact of downy mildew on the yield of
quinoa. In: “n: Scientist and farmer: partners
in the 21. Century, (Danielsen S, Jacobsen
SE, Echegaray J, Ames T. Eds)”. CIP program
report 1999-2000, No. 2001, p. 397-401.
Danielsen S, Mercado VH, Ames T, Munk L. 2004.
Seed transmission of downy mildew
(Peronospora farinosa f. sp. chenopodii) in
quinoa and effect of relative humidity on seedling
infection. Seed Sci. Technol., 32(1): 91-98.
El-Assiuty EM, Bekheet FM, Fahmy ZM. 2014. First
record of downy mildew of quinoa in Egypt.
Egypt. J. Agric. Res., 92(3): 871-872
Gilardi G, Gullino ML, Garibaldi A. 2018. Emerging
foliar and soil‐borne pathogens of leafy
vegetable crops: a possible threat to Europe.
EPPO Bull., 48(1): 116-127.
Inaba T, Takahashi K, Morinaka T. 1983. Seed
transmission of spinach downy mildew. Plant
Dis., 67: 1139-1141
Keogh R, Deverall BJ, McLeod S. 1980. Comparison
of histological and physiological responses to
Phakopsora pachyrhizi in resistant and
susceptible soybean. T. Brit. Mycol. Soc.,
74(2): 329-333.
Kitz L. 2008. Evaluation of downy mildew
(Peronospora farinosa f. sp. Chenopodii)
resistance among quinoa genotypes and
investigation of P. farinosa growth using
scanning electron microscopy. Dissertation,
Brighan Young University.
Koch E, Slusarenko A. 1990. Arabidopsis is
susceptible to infection by a downy mildew
fungus. Plant Cell, 2: 437-445
Korbie DJ, Mattick JS. 2008. Touchdown PCR for
increased specificity and sensitivity in PCR
amplification. Nat. Protoc., 3(9): 1452-1456.
Kunjeti SG, Anchieta A, Subbarao KV, Koike ST,
Klosterman SJ. 2016. Plasmolysis and vital
staining reveal viable oospores of
Peronospora effusa in spinach seed lots. Plant
Dis., 100(1): 59-65.
Lai PS, Lien TJ, Chen RS, Tsay JG. 2004. The
occurrence of downy mildew of vegetable
soybean and its detection by PCR. Plant Prot.
Bull., 46(2): 155-162.
Landa BB, Montes-Borrego M, Muñoz-Ledesma
FJ, Jiménez-Díaz RM. 2007.Phylogenetic
analysis of downy mildew pathogens of opium
poppy and PCR-based in planta and seed
detection of Peronospora arborescens.
Phytopathology, 97(11): 1380-1390.
El-Assiuty et al., Histological and molecular detections of Peronospora variabilis Gäum oospores in seeds of Quinoa
ISSN: 1687-7497 Online ISSN: 2090 - 0503 https://www.ejmanager.com/my/ejeb
203
Leach LD, Borthwick HA. 1934. Distribution of downy
mildew mycelium in Spinach fruits.
Phytopathology, 24:1021-1025.
Licen M, Kreft I. 2007. Buckwheat (Fagopyrum
esculentum) allergenic seed proteins are
restricted to the embryo and not found in the
endosperm. Proc. 10th Int. Symp. Buckwheat,
Yangling, China, pp. 510-514.
Ma Y, Sawhney VK, Steeves TA. 1993. Staining
paraffin-embedded plant material in safranin
and fast green without prior removal of
paraffin. Can. J. Bot., 71(7): 996-999.
Ojiambo PS, Gent DH, Quesada-Ocampo LM,
Hausbeck MK, and Holmes GJ. 2015.
Epidemiology and population biology of
Pseudoperonospora cubensis: A model
system for management of downy mildews.
Annu. Rev. Phytopathol., 53: 223-246.
Phillips JM, Hayman DS. 1970. Improved procedures
for clearing roots and staining parasitic and
vesicular-arbuscular mycorrhizal fungi for
rapid assessment of infection. T. Brit. Mycol.
Soc., 55: 158-161.
Pratt RG, Janke GD. 1978. Oospores of Sclerospora
sorghi in soils of south Texas and their
relationships to the incidence of downy mildew
in grain sorghum. Phytopathology, 68(11):
1600-1605.
Prego I, Maldonado S, Otegui M. 1998. Seed
structure and localization of reserves in
Chenopodium quinoa. Ann. Bot., 82(4): 481-
488.
Salgado-Salazar C, Shishkoff N, Daughtrey M L,
Palmer C, Crouch J A. 2018. Downy mildew: a
serious disease threat to rose health
worldwide. Plant Dis., 102(10): 1873-1882.
Singh D, Mathur SB. 2004. Histopathology of seed-
borne infections. CRC Press LLC. USA, pp.
296.
Stasolla C, Yeung E. 2015. Paraffin and polyester
waxes. In: “Plant Microt ec hniques and
Protocols. (Yeung EC, Stasolla C, Summer
MJ, Huang BQ. ed)”. Springer, Swit zerland,
pp. 45-66.
Testen AL, del Mar Jiménez-Gasco M, Ochoa JB,
Backman PA. 2014. Molecular detection of
Peronospora variabilis in quinoa seed and
phylogeny of the quinoa downy mildew
pathogen in South America and the United
States. Phytopathology, 104(4): 379-386.
Thangavel T, Jones S, Scott J, Livermore M, and
Wilson CR. 2018. Detection of two
Peronospora spp., responsible for downy
mildew in opium poppy seed. Plant
Dis.,102(11): 2277-2284.
Zimmer RC, McKeen WE, Campbell CG. 1992.
Location of oospores in buckwheat seed and
probable roles of oospores and conidia of
Peronospora ducometi in the disease cycle on
buckwheat. J. Phytopathol., 135(3): 217-223.
.
Perosnospora variabilis
PCR
