Content uploaded by Flora Forouzesh
Author content
All content in this area was uploaded by Flora Forouzesh on Jul 04, 2019
Content may be subject to copyright.
Copyright © 2019, Avicenna Journal of Medical Biotechnology. All rights reserved. Vol. 11, No. 3, April-July 2019
Original Article
Effect of Sodium Butyrate on
LHX1
mRNA Expression as a Transcription Factor of HDAC8
in Human Colorectal Cancer Cell Lines
Mahsa Ghiaghi 1, Flora Forouzesh 1, and Hamzeh Rahimi 2
1. Department of Genetics, Faculty of Advanced Science and Technology, Tehran Medical Sciences, Islamic Azad
University, Tehran, Iran
2. Department of Molecular Medicine, Pasteur Institute of Iran, Tehran, Iran
Abstract
Background: LHX1 is an important transcription factor for the
HDAC8
gene. The aim
of this study was to investigate the effect of Sodium Butyrate (SB), as a histone dea-
cetylase inhibitor, on the expression of
LHX1
gene in colorectal cancer cell lines.
Methods: HT-29 and HCT-116 cell lines were treated with 6.25 to 200
mM
concentra-
tions of SB at 24, 48, and 72
hr
. The cytotoxicity effect on cell viability was evaluated
by MTT assay. The 50% Inhibiting Concentration (IC50) was determined graphically.
Quantitative real-time PCR was performed to investigate the
LHX1
mRNA expression
level.
Results: Our study revealed that SB inhibited the proliferation of these cell lines in a
concentration and time-dependent manner. The IC50 values for HT-29 cell line were
65, 18.6, and 9.2
mM
after 24, 48, and 72
hr
of treatment, respectively. The IC50 values
for HCT-116 cell line were 35.5, 9.6, and 10
mM
after 24, 48, and 72
hr
of treatment, re-
spectively. Furthermore, real-time PCR findings demonstrated that the
LHX1
mRNA
expression in treated HT-29 cell line significantly increased in comparison with un-
treated cells (p<0.05). However, in treated HCT-116 cell line, SB led to a significant de-
crease in the level of
LHX1
mRNA (p<0.05), as compared to untreated cells.
Conclusion: In this study, different effects of SB on
LHX1
mRNA expression level were
revealed in two distinct human colorectal cancer cell lines.
Keywords: Colorectal cancer, HCT-116 cells, Histone deacetylase inhibitors, Humans, Transcrip-
tion factors
Introduction
Colorectal cancer is one of the most common can-
cers in the world including 9% of all cancers 1. This
cancer is the second common cancer and the fourth
cause of death due to cancer globally 2. Dysregulation
in the epigenetic mechanisms, including histone acety-
lation, is one of the main factors contributing to the
colorectal cancer 3-5. Acetylation, a process in which
the chromatin structure and gene expression 6 are mod-
ified, is controlled by two types of enzymes, Histone
Acetylases (HAT) and Histone Deacetylases (HDACs)
7. The change in acetylation status in cancer cells such
as prostate 8, colon 9, and gastric 10 cancers has been
linked to the increased expression of certain HDAC in
indefinite patterns.
HDACs directly interact with transcription factors
and can regulate the expression of a large number of
genes 11. LHX1 (LIM Homeobox1) protein is one of
the transcription factors involved in the transcription of
HDAC8 gene 12. Moreover, it has different functions
including regulation of cell fate, cellular skeleton or-
ganization, and tumor formation 13-16. The LHX1 ex-
pression has been reported in human cancers such as
ovarian cancer, kidney carcinoma, leukemia cells, and
epithelial cells 17.
Histone Deacetylase Inhibitors (HDACi) can change
the balance between HAT and HDAC, and also lead to
the acetylation of histone and non-histone proteins that
induce transcription and related molecular effects18.
Some processes involved in the inhibition of HDAC
are apoptosis, necrosis, growth inhibition, and differen-
tiation 19-21. One of the HDACi is Sodium Butyrate
(SB) 22,23. The produced butyrate in the colon may in-
hibit the development of colon cancer and protect
against colon cancer 24,25. One of the functions of buty-
rate is its anti-inflammatory effect that plays a crucial
role in inhibiting the histone deacetylase 26. In addition,
SB influences the gene expression through binding to
the transcription factors. Epigenetic regulation orches-
* Corresponding authors:
Flora Forouzesh, Ph.D.,
Department of Genetics, Faculty
of Advanced Science and
Technology, Tehran Medical
Sciences, Islamic Azad University,
Tehran, Iran
Tel: +98 21 22006660-7
Fax: +98 21 22600714
E-mail: f8forouzesh@gmail.com
Received: 26 Sept 2018
Accepted: 24 Nov 2018
Avicenna J Med Biotech 2019; 11(3):
٢
The Effect of Sodium Butyrate on the
LHX1
mRNA Expression in Colorectal Cancer Cell Line
Avicenna Journal of Medical Biotechnology, Vol. 11, No. 3, April-July 2019
trates various physiological procedures, comprising
transcription, replication, and repair from developmen-
tal to differentiated stages and emerges with a pivotal
role in the process of tumorigenesis 27-29. The under-
standing of these mechanisms might contribute to the
optimization of prognostic and diagnostic systems, as
well as the generation of novel and targeted therapeutic
approaches. In the present study, the effect of SB on
LHX1 mRNA expression, as a transcription factor of
the HDAC8 gene, in HT-29 and HCT116 human colo-
rectal cell lines was investigated. It is expected that the
expression of LHX1 in treated cells would be de-
creased, in comparison with untreated cells. Our results
showed that in HCT-116 cells, the expression of LHX1
was decreased; however, in HT-29 cells this expression
level was increased, compared with untreated cells.
One of the explanations for this may be the different
tissue origin of these two cell lines given the fact that
HT-29 is adenocarcinoma and HCT-116 is carcinoma.
Furthermore, these cell lines represent a wide range of
cancer characteristics; HCT-116 has a wild-type p53
response while being deficient in mismatch repair,
whereas the HT-29 is p53 deficient and an unstable
cell line 30. Molecular mechanisms may affect the un-
derlying function in each cell line.
Materials and Methods
Cell culture
HT-29 and HCT116 human colorectal cell lines
were purchased from Pasteur Institute of Iran (Tehran,
Iran). HT-29 and HCT116 cells were cultured in RPMI
1640 and DMEM (Dulbecco’s Modified Eagle’s Me-
dium) (Gibco, Germany), respectively, which was sup-
plemented with 10% heat-inactivated fetal bovine se-
rum (FBS) (Gibco, Germany) and 1% penicillin-
streptomycin (100 IU/ml and 100 μg/ml, respectively)
(Dacell, Iran). Cells were incubated at 37°C under a
humidified atmosphere of 95% air and 5% CO2 (v/v).
Monolayer cells were harvested by 0.25% trypsin-
EDTA (Gibco, Germany).
SB treatment
Optimization of cell numbers in 96-well plates (Spl
life sciences, Korea) was performed for 24, 48, and 72
hr of incubation time. A total of 50×103 cells per well
(The optimized cell number) were seeded in 96-well
plates and incubated for 24 hr. SB was dissolved in
sterile water with a 1 molar concentration of stock so-
lution for in vitro studies, which was further diluted to
the working concentration (6.25 to 200 mM) in culture
media. All cell lines were then treated with SB at the
concentrations ranging from 6.25 to 200 mM for 24,
48, and 72 hr. Untreated cells (0 Mm) and cells treated
with dimethyl sulfoxide (DMSO) 20% were considered
as negative and positive controls, respectively.
Cytotoxicity assay
The cytotoxic effect of SB (Biobasic, Canada Inc.)
in HT-29 and HCT-116 colorectal cell lines was de-
termined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazo¬lium bromide (MTT) assay (Sigma,
USA) and was compared with the untreated cells (0
Mm) as a control group. Briefly, 100 μl of the MTT
stock solution (5 mg/ml in PBS) was added to each
well to attain a final concentration of 0.5 mg/ml in
RPMI-1640 without phenol red culture (Biosera,
France). After 4 hr of incubation, the supernatants were
aspirated; the formazan crystals in each well were dis-
solved in 50 μl DMSO and the absorbance was meas-
ured at 546 nm using an ELISA reader (Garni Medical
Eng. Co., Tehran, Iran). Each SB concentration was
assayed in separated wells and each experiment was
repeated at least 3 times. Cell viabilities were calcu-
lated using the following formula:
Cell viability rate (%)=(OD546 of treated cells/OD546 of
control cells)×100 %.
Afterwards, the half-maximal growth inhibitory
concentration (IC50) values were estimated from dose
response curves by applying linear regression analysis
via the JavaScript version of PolySolve (07.20.2013)
software.
RNA extraction and cDNA synthesis
A total of 3×106 HT-29 and HCT-116 human colo-
rectal cells were seeded in 6-well plates (Spl life
sciences, Korea) in 2 ml of RPMI-1640 and DMEM
medium supplemented with 2% FBS, respectively, and
were treated with different concentrations of SB (6.25
to 200 mM) for 24 and 48 hr. After the end of incuba-
tion time, total cellular RNA was extracted from the
cancer cells treated with SB and untreated cells using
RNX- Plus Solution (Sinaclon, Iran). The quality and
quantity of extracted RNA were measured with agarose
gel electrophoresis and a spectrophotometer (Eppen-
dorf, Germany). Complementary DNA (cDNA) was
synthesized with 2000 ng total RNA using a cDNA
synthesis kit (Yektatajhiz, Iran) according to the manu-
facturer's protocol.
Quantitative real-time PCR (qRT-PCR)
The qRT-PCR analysis was carried out for LHX1
gene using RQ-PCR SYBR Green I system Light Cyc-
ler 96 (Roche Diagnostics, Germany). The GAPDH
(Housekeeping gene) was used as an internal control.
Reactions were prepared in duplicate using 2X SYBR
Green Supermix (Pishgam, Iran) according to manu-
facturer’s instructions to a final volume of 20 µl. The
following conditions were used: 95°C for 15 min, fol-
lowed by 40 cycles of denaturation at 95°C for 15 s,
annealing, and extension at 60°C for 60s. Quality of
PCR products was evaluated by generating a melting
curve, which was also used to verify the absence of
PCR artifacts (Primer-dimers) or nonspecific PCR
products. Variations in relative gene expressions be-
tween treated cells and control group (Untreated cells)
cDNA samples were identified with Relative Expres-
sion Software Tool 9 (REST 9, Qiagen) using the
2-ΔΔCT method. The primers (10 pmol) are listed in table
1.
Ghiaghi M,
et al
Avicenna Journal of Medical Biotechnology, Vol. 11, No. 3, April-July 2019
Data analysis
Ct values were adjusted, taking into account primer
efficiencies for each gene when calculating 2-ΔΔCT val-
ues. Expression data for each target gene was also
normalized to the housekeeping gene (GAPDH) and
fold change calculations were made based on Schmitt-
gen and Livak’s method by using REST 9 and Li-
nRegPCR softwares. The level of statistical signific-
ance was set at p<0.05.
Results
The effect of SB on the cell viability of HT-29 and HCT-116
human colorectal cancer cell lines
To investigate the role of HDAC on the prolifera-
tion of colorectal cancer cells, HT-29, and HCT-116
human colorectal cell lines were treated with various
concentrations of SB (From 6.25 to 200 mM) for 24,
48, and 72 hr. Then, the cytotoxicity effect of SB on
cancer cells was investigated with MTT assay. The
viability of HT-29 and HCT-116 cells was further de-
creased by higher doses of SB (6.25 to 200 mM). Our
study revealed that SB could inhibit the proliferation of
HT-29 (Figure 1A) and HCT-116 (Figure 1B) cell lines
in a concentration and time-dependent manner.
The IC50 calculated for SB
The effective concentration of SB for the determina-
tion of the half-maximal inhibitory concentration (IC50)
value was obtained by regression analyses of concen-
tration-inhibition curves. The IC50 value for HT-29
human colorectal cell line was achieved as 65 mM for
the 24 hr of SB treatment, 18.6 mM for 48 hr of SB
treatment, and 9.2 mM for 72 hr of SB treatment (Fig-
ure 2). As well, the IC50 value for HCT-116 human
colorectal cell line was 35.5 mM for 24 hr of SB treat-
ment, 9.6 mM for 48 hr of SB treatment, and 10 mM
for 72 hr of SB treatment (Figure 3). The IC50 of SB in
HT-29 and HCT-116 human colorectal cancer cell
lines was significantly decreased in 24, 48, and 72 hr in
a time-dependent manner.
Quantitative real-time PCR
HT-29 cell line: The effect of SB was examined on
LHX1 mRNA expression in HT-29 human colorectal
cancer cell line in vitro by incubating the cells in 6.25,
12.5, 25, 50, and 100 mM concentrations of SB for 24
and 48 hr. The concentrations of 150 and 200 mM were
found to be toxic. After 24 hr of incubation with 6.25
to 100 mM concentrations of SB, LHX1 mRNA expres-
sion significantly increased in all concentrations, com-
pared with untreated cells as a control group (p<0.05)
(Figure 3A); however, in higher concentration of SB,
this fold change decreased in comparison with 6.25
mM concentration. This is probably owing to the very
low numbers of cells at higher concentrations of SB
treatment causing a denominator effect. The increased
SB concentrations in the treatment were found to result
in reduced cell numbers and enhanced cell death. After
48 hr of incubation, LHX1 mRNA expression was sig-
nificantly enhanced at concentrations of 6.25, 25, 50,
and 100 mM SB, compared with untreated cells as a
control group (p<0.05). Nonetheless, there was no sig-
nificant increase in the concentration of 12.5 mM
(p>0.05) (Figure 4).
HCT-116 cell line
Also, the effects of SB on LHX1 mRNA expression
in HCT-116 human colorectal cancer cell line were
investigated in vitro by incubating the cells in 6.25,
12.5, 25, 50, and 100 mM concentrations of SB for 24
and 48 hr. 24 hr after treatment with SB, LHX1 mRNA
expression significantly decreased at concentrations of
6.25, 12.5, 50, and 100 mM SB, compared with un-
treated cells as a control group (p<0.05). However,
there was no significant decrease at the concentration
of 25 mM (p>0.05) (Figure 5A). Likewise, 48 hr after
Table 1. Primer sequences used in quantitative polymerase chain reaction (qRT-PCR)
Name Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′) Accession number
GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC NM_001289745.2
LHX1 TCTCCAGGGAAGGCAAACT CGAAACACCGGAAGAAGTC NM_005568.4
Figure 1. Cell viability in cancer cells treated with sodium butyrate
(SB). A) HT-29 colorectal cell line was treated with 6.25 to 200 mM
concentrations of SB at 37°C for 24, 48, and 72 hr of incubation. B)
HCT-116 colorectal cell line was treated with 6.25 to 200 mM con-
centrations of SB at 37°C for 24, 48, and 72 hr of incubation. Cell
viabilities were evaluated using MTT assay and calculated as a ratio
of the control. Control (+): cells treated with dimethyl sulfoxide
(DMSO) 20% and untreated cells (0 mM) as negative control. All
experiments were performed in triplicate.
۴
The Effect of Sodium Butyrate on the
LHX1
mRNA Expression in Colorectal Cancer Cell Line
Avicenna Journal of Medical Biotechnology, Vol. 11, No. 3, April-July 2019
treatment with SB, LHX1 mRNA expression was sig-
nificantly down-regulated in all concentrations of 6.25
to 100 mM SB, compared with untreated cells as a con-
trol group (p<0.05) (Figure 5B).
Discussion
Acetylation is a chief part of the gene expression
regulation 31,32 and is controlled by the opposite func-
tion of the HAT and HDAC enzymes7. The dysregu-
lated expression of HDAC enzymes is often seen in
cancers 31,32. HDAC can regulate the expression of a
large number of genes by direct interaction with tran-
scription factors such as P53, E2f, Stat3, NF-KB, reti-
noblastoma protein, and TFIIE 11 affecting angiogene-
sis, cell cycle arrest, apoptosis, and the differentiation
of different cell types 33,34. LHX1 is one of the tran-
scription factors involved in the transcription of
HDAC8 gene 12. Despite the normal expression of
HDAC8 in healthy organs, its expression in tumor tis-
sues is up-regulated 35,36. The selective pharmacologi-
cal inhibition of HDACi represents a novel treatment
for cancer therapy 18,33,34,37,38. One of the HDACi is SB
22,23. In 2010, Ooi et al examined the effects of SB and
their analogs in HT-29 cancer cells and observed that
the 5 mmol/L concentration of SB resulted in decreased
proliferation, increased apoptosis, and the reduction of
HDAC activity 39. The findings of the presents study
are consistent with the above information. The cytotox-
icity of SB in HT-29 and HCT-116 human colorectal
Figure 2. Regression analyses to calculate the 50% inhibiting con-
centration (IC50) values for effect of sodium butyrate (SB) on HT-29
human colorectal cell line. The horizontal axis (x) represents the
concentration (mM) and the vertical axis (y) represents the percen-
tage of the cell viability. A) The IC50 value was 65 mM for 24 hr
after treatment, B) 18.6 mM for 48 hr after treatment, and C) 9.2 mM
for 72 hr after treatment.
Figure 3. Regression analyses to calculate the 50% inhibiting concen-
tration (IC50) values for effect of sodium butyrate (SB) in HCT-116
human colorectal cell line. The horizontal axis (x) represents the
concentration (mM) and the vertical axis (y) represents the percentage
of the cell viability. A) The IC50 value was 35.5 mM for 24 hr after
treatment, B) 9.6 mM for 48 hr after treatment, and C) 10 mM for 72
hr after treatment.
Ghiaghi M,
et al
Avicenna Journal of Medical Biotechnology, Vol. 11, No. 3, April-July 2019
cancer cell lines was examined by using MTT assay.
Our results revealed that SB could inhibit the prolifera-
tion of both HT-29 and HCT-116 cell lines in a con-
centration- and time-dependent manner. In HT-29 cell
line, the viability of cells decreased to 52, 52, and 50%
after 24, 48, and 72 hr of treatment, respectively. Be-
sides, in HCT-116 cell line, the cell viability was dimi-
nished to 68, 51 and 54% after 24, 48, and 72 hr of
treatment, respectively.
In the present study, for the first time, the effect of
SB on the LHX1 mRNA expression was investigated.
In 2009, Haberland et al examined the relationship
between HDAC8 and homeobox transcription factors
of LHX1 and Otx2 using PCR techniques in mice and
concluded that the inappropriate expression of these
transcription factors suppressed HDAC8 40. In 2011,
Dormoy et al reviewed the transcription factor of
LHX1 as a new oncogene in kidney cancer cells. They
showed LHX1 gene was re-expressed in kidney cancer
and it is expressed in large quantities in kidney cancer
cells, whereas in the normal kidney cells, it appears
with a low expression level. On the other hand, they
identified that the reduction of LHX1 expression can
lead to an increase in apoptosis and a decrease in cell
proliferation after 72 hr 41. In addition, Saha et al have
assessed the effects of an HDAC8 inhibitor on the tran-
scription factors of Otx2 and LHX1 in mice. Their re-
sults depicted that HDAC8 suppresses the inappro-
priate expression of Otx2 and LHX1 and these two
transcription factors are adjusted by HDAC8 42. Also,
according to the literature, it was found that butyrate is
able to stop cell cycle, differentiation, and apoptosis in
a number of cell lines by inhibiting HDAC 43-45. SB
affects the expression of genes by binding to the tran-
scription factors. In this study, the effect of SB on
LHX1 as a transcription factor of HDAC8 in colorectal
cancer cell lines was investigated. Existing documents
have shown the inappropriate expression of LHX1 in
cancers that leads to the increased transcription,
growth, and proliferation, as well as inhibition of can-
cer cell apoptosis 17,41. In the current study, it was ex-
pected that SB would act as a drug reducing the ex-
pression of LHX1. Our findings showed that treatments
with SB significantly decreased the expression of
LHX1 in HCT-116 cells in comparison with untreated
cells (p<0.05). However, to our surprise, the expression
of LHX1 significantly increased in HT-29 cell line,
compared with untreated cells. Our results are well in
line with that of Rocha et al that observed different
effects of SB, as HDACi, on the expression of Estro-
gen Receptor (ERα). They expected that SB would lead
to an increase in the ERα expression, while the oppo-
site was found and the ERα expression was reduced 46.
Figure 4. The effect of sodium butyrate (SB) on the LHX1 mRNA
expression in HT-29 cell line. A) Cells were cultured for 24 hr with
6.25 to 100 mM concentrations of SB at 37°C. B) Cells were cultured
for 48 hr with 6.25 to 100 mM concentrations of SB at 37°C. LHX1
mRNA expression was investigated using qRT-PCR. GAPDH was
used as the internal control. LHX1 mRNA expression increased in
treated cells compared to control (0 mM). * Indicates a significant
increase (p<0.05) vs. controls. All experiments were performed in
duplicate.
Figure 5. The Effect of sodium butyrate (SB) on LHX1 mRNA ex-
pression in HCT-116 cell line. A) Cells were cultured for 24 hr with
6.25 mM to 100 mM of SB at 37°C. B) Cells were cultured for 48 hr
with 6.25 mM 100 mM of SB at 37°C. LHX1 mRNA expression in-
vestigated using qRT-PCR. GAPDH was used as an internal control.
LHX1 mRNA expression decreased in treated cells compared to con-
trol (0 mM). * Indicates a significant reduction (p<0.05) vs. controls.
All experiments were performed in duplicate.
۶
The Effect of Sodium Butyrate on the
LHX1
mRNA Expression in Colorectal Cancer Cell Line
Avicenna Journal of Medical Biotechnology, Vol. 11, No. 3, April-July 2019
They suggested that treatment duration time and used
concentrations may be critical in these effects 46. Ac-
cording to our results, Wang et al showed that HDACi
could, via HDAC8/YY1, cause suppression of mutant
P53 in breast cancer. HDAC8 reacts with YY1 tran-
scription factor and adjusts the transcriptional activity.
They figured out that treatment with SAHA and SB
can inhibit the HDAC8 and YY1 association, enhance
the YY1 acetylation, and eventually suppress the YY1-
induced transcription of p53. They, also, determined
that the network of HDAC8 and YY1 prevents the pro-
liferation of breast cancer cells 47.
Conclusion
The current study indicated that SB had anticancer
activities and inhibits the growth of HT-29 and HCT-
116 human colorectal cancer cell lines. Moreover, the
results of this study showed that LHX1 mRNA expres-
sion level was significantly different between two hu-
man colorectal cancer cell lines (HT-29 and HCT-116)
due to SB treatment. In HT-29 human colorectal cell
line, the significant increase of LHX1 mRNA expres-
sion was observed after 24 and 48 hr of incubation
time. On the contrary, SB led to a significantly down-
regulated LHX1 expression level at 24 and 48 hr of
incubation time in HCT-116 human colorectal cell line.
Altogether, these results indicated that there is no simi-
lar effect of SB on these different cell lines. Worthy of
note, the histopathology origins of the used human
colorectal cell lines in this study are distinguished. HT-
29 is a cell line with adenocarcinoma origin derived
from colon ascendens and colon with Dukes’ C stage
(Involvement of lymph nodes) 48,49. HCT-116, on the
other hand, has a carcinoma tissue origin and is derived
from colon ascendens with Dukes’ D stage (Wide-
spread metastases) 50-52. Moreover, the molecular fea-
tures of these colon cancer cell lines are different53;
thus, their response to drugs is supposed to be distinct.
SB might be capable of both repressing and inducing
the expression of different genes. In this study, the ex-
pression of LHX1 gene was investigated in untreated
and treated colorectal cells and different effects of SB
on LHX1 mRNA expression were revealed in two dif-
ferent human colorectal cancer cell lines. Future stu-
dies are needed to evaluate the effect of SB on LHX1
mRNA expression in other human colorectal cancer
cell lines as well as other cancer cell lines.
Acknowledgement
This paper has been resulted from MSc thesis of
Mahsa Ghiaghi, student at Faculty of Advanced
Science and Technology, Tehran Medical Sciences,
Islamic Azad University, Tehran, Iran.
References
1. Haggar FA, Boushey RP. Colorectal cancer epidemiolo-
gy: incidence, mortality, survival, and risk factors. Clin
Colon Rect Surg 2009;22(4):191-197.
2. Rafiemanesh H, Mohammadian-Hafshejani A, Ghoncheh
M, Sepehri Z, Shamlou R, Salehiniya H, et al. Incidence
and mortality of colorectal cancer and relationships with
the human development index across the world. Asian
Pac J Cancer Prev 2016;17(5):2465-2473.
3. Esteller M. CpG island hypermethylation and tumor
suppressor genes: a booming present, a brighter future.
Oncogene 2002;21(35):5427-5440.
4. Johnstone RW. Histone-deacetylase inhibitors: novel
drugs for the treatment of cancer. Drug Discov 2002;1
(4):287-299.
5. Iizuka M, Smith MM. Functional consequences of his-
tone modifications. Curr Opin Genet Dev 2003;13(2):
154-160.
6. Clayton AL, Hazzalin CA, Mahadevan LC. Enhanced
histone acetylation and transcription: a dynamic perspec-
tive. Mol Cell 2006;23(3):289-296.
7. Bannister AJ, Kouzarides T. Regulation of chromatin by
histone modifications. Cell Res 2011;21(3):381-395.
8. Halkidou K, Gaughan L, Cook S, Leung HY, Neal DE,
Robson CN. Upregulation and nuclear recruitment of
HDAC1 in hormone refractory prostate cancer. Prostate
2004;59(2):177-189.
9. Wilson AJ, Byun DS, Popova N, Murray LB, L'Italien K,
Sowa Y, et al. Histone deacetylase 3 (HDAC3) and other
class I HDACs regulate colon cell maturation and p21
expression and are deregulated in human colon cancer. J
Biol Chem 2006;281(19):13548-13558.
10. Choi JH, Kwon HJ, Yoon BI, Kim JH, Han SU, Joo HJ,
et al. Expression profile of histone deacetylase 1 in gas-
tric cancer tissues. Jpn J Cancer Res 2001;92(12):1300-
1304.
11. Lin HY, Chen CS, Lin SP, Weng JR, Chen CS. Targeting
histone deacetylase in cancer therapy. Med Res Rev
2006;26(4):397-413.
12. Micelli C, Rastelli G. Histone deacetylases: structural
determinants of inhibitor selectivity. Drug Discov Today
2015;20(6):718-735.
13. Way JC, Chalfie M. mec-3, a homeobox-containing gene
that specifies differentiation of the touch receptor neu-
rons in C. elegans. Cell 1988;54(1):5-16.
14. Sánchez-García I, Rabbitts TH. The LIM domain: a new
structural motif found in zinc-finger-like proteins. Trends
Genet 1994;10(9):315-320.
15. Bridwell JL, Price JR, Parker GE, Schiller AM, Sloop
KW, Rhodes SJ. Role of the LIM domains in DNA rec-
ognition by the Lhx3 neuroendocrine transcription factor.
Gene 2001;277(1):239-250.
16. Yaden BC, Savage JJ, Hunter CS, Rhodes SJ. DNA rec-
ognition properties of the LHX3b LIM homeodomain
transcription factor. Mol Biol Rep 2005;32(1):1-6.
17. Bowen NJ, Walker LD, Matyunina LV, Logani S, Totten
KA, Benigno BB, et al. Gene expression profiling sup-
ports the hypothesis that human ovarian surface epithelia
are multipotent and capable of serving as ovarian cancer
initiating cells. BMC Med Genomics 2009;2:71.
Ghiaghi M,
et al
Avicenna Journal of Medical Biotechnology, Vol. 11, No. 3, April-July 2019
18. Bolden JE, Peart MJ, Johnstone RW. Anticancer activi-
ties of histone deacetylase inhibitors. Nat Rev Drug Dis-
cov 2006;5(9):769-784.
19. Lehrman G, Hogue IB, Palmer S, Jennings C, Spina CA,
Wiegand A, et al. Depletion of latent HIV-1 infection in
vivo: a proof-of-concept study. Lancet 2005;366(9485):
549-555.
20. Williams JA, Barreiro CJ, Nwakanma LU, Lange MS,
Kratz LE, Blue ME, et al. Valproic acid prevents brain
injury in a canine model of hypothermic circulatory ar-
rest: a promising new approach to neuroprotection during
cardiac surgery. Ann Thorac Surg 2006;81(6):2235-
2242.
21. Almeida AM, Murakami Y, Baker A, Maeda Y, Roberts
IA, Kinoshita T, et al. Targeted therapy for inherited GPI
deficiency. New Engl J Med 2007;356(16):1641-1647.
22. Hinnebusch BF, Meng S, Wu JT, Archer SY, Hodin RA.
The effects of short-chain fatty acids on human colon
cancer cell phenotype are associated with histone hyper-
acetylation. J Nutr 2002;132(5):1012-1017.
23. Emenaker NJ, Calaf GM, Cox D, Basson MD, Qureshi
N. Short-chain fatty acids inhibit invasive human colon
cancer by modulating uPA, TIMP-1, TIMP-2, mutant
p53, Bcl-2, Bax, p21 and PCNA protein expression in an
in vitro cell culture model. J Nutr 2001;131(11 Suppl):
3041S-3046S.
24. Butler LM, Webb Y, Agus DB, Higgins B, Tolentino
TR, Kutko MC, et al. Inhibition of transformed cell
growth and induction of cellular differentiation by py-
roxamide, an inhibitor of histone deacetylase. Clin Can-
cer Res 2001;7(4):962-970.
25. He LZ, Tolentino T, Grayson P, Zhong S, Warrell Jr RP,
Rifkind RA, et al. Histone deacetylase inhibitors induce
remission in transgenic models of therapy-resistant acute
promyelocytic leukemia. J Clin Invest 2001;108(9):1321-
1330.
26. Cummings JH, Macfarlane GT. The control and conse-
quences of bacterial fermentation in the human colon. J
Appl Microbiol 1991;70(6):443-459.
27. Van Engeland M, Derks S, Smits KM, Meijer GA, Her-
man JG. Colorectal cancer epigenetics: complex sim-
plicity. J Clin Oncol 2011;29(10):1382-1391.
28. Dawson MA, Kouzarides T. Cancer epigenetics: from
mechanism to therapy. Cell 2012;150(1):12-27.
29. You JS, Jones PA. Cancer genetics and epigenetics: two
sides of the same coin? Cancer cell 2012;22(1):9-20.
30. Danny CW, Waby JS, Chirakkal H, Staton CA, Corfe
BM. Butyrate suppresses expression of neuropilin I in
colorectal cell lines through inhibition of Sp1 transactiva-
tion. Mol Cancer 2010;9(1):276.
31. Cress WD, Seto E. Histone deacetylases, transcriptional
control, and cancer. J Cell Physiol 2000;184(1):1-6.
32. Timmermann S, Lehrmann H, Polesskaya A, Harel-
Bellan A. Histone acetylation and disease. Cell Mol Life
Sci 2001;58(5):728-736.
33. Hildmann C, Riester D, Schwienhorst A. Histone deace-
tylases—an important class of cellular regulators with a
variety of functions. Appl Microbiol Biotechnol 2007;75
(3):487-497.
34. Riester D, Hildmann C, Schwienhorst A. Histone deace-
tylase inhibitors—turning epigenic mechanisms of gene
regulation into tools of therapeutic intervention in malig-
nant and other diseases. Appl Microbiol Biotechnol
2007;75(3):499-514.
35. Song S, Wang Y, Xu P, Yang R, Ma Z, Liang S, et al.
The inhibition of histone deacetylase 8 suppresses proli-
feration and inhibits apoptosis in gastric adenocarcinoma.
Int J Oncol 2015;47(5):1819-1828.
36. Wang Y, Xu P, Yao J, Yang R, Shi Z, Zhu X, et al. RE-
TRACTED ARTICLE: MicroRNA-216b is down-
regulated in human gastric adenocarcinoma and inhibits
proliferation and cell cycle Progression by targeting on-
cogene HDAC8. Target Oncol 2016;11(2):197-207.
37. Minucci S, Pelicci PG. Histone deacetylase inhibitors
and the promise of epigenetic (and more) treatments for
cancer. Nat Rev Cancer 2006;6(1):38-51.
38. J Shuttleworth SJ, G Bailey SG, Townsend PA. Histone
deacetylase inhibitors: new promise in the treatment of
immune and inflammatory diseases. Curr Drug Targets
2010;11(11):1430-1438.
39. Ooi CC, Good NM, Williams DB, Lewanowitsch T,
Cosgrove LJ, Lockett TJ, et al. Efficacy of butyrate ana-
logues in HT‐29 cancer cells. Clin Exp Pharmacol Phy-
siol 2010;37(4):482-489.
40. Haberland M, Mokalled MH, Montgomery RL, Olson
EN. Epigenetic control of skull morphogenesis by his-
tone deacetylase 8. Genes Dev 2009;23(14):1625-1630.
41. Dormoy V, Beraud C, Lindner V, Thomas L, Coquard C,
Barthelmebs M, et al. LIM-class homeobox gene Lim1, a
novel oncogene in human renal cell carcinoma. Onco-
gene 2011;30(15):1753-1763.
42. Saha A, Pandian GN, Sato S, Taniguchi J, Hashiya K,
Bando T, et al. Synthesis and biological evaluation of a
targeted DNA-binding transcriptional activator with
HDAC8 inhibitory activity. Bioorg Med Chem 2013;21
(14):4201-4209.
43. Davie JR. Inhibition of histone deacetylase activity by
butyrate. J Nurt 2003;133(7 Suppl):2485S-2493S.
44. Danny CW Yu, Waby JS, Chirakkal H, Staton CA, Corfe
BM. Butyrate suppresses expression of neuropilin I in
colorectal cell lines through inhibition of Sp1 transactiva-
tion. Mol Cancer 2010;9(1):276.
45. Waby JS, Chirakkal H, Yu C, Griffiths GJ, Benson RS,
Bingle CD, et al. Sp1 acetylation is associated with loss
of DNA binding at promoters associated with cell cycle
arrest and cell death in a colon cell line. Mol Cancer
2010;9(1):275.
46. Rocha W, Sanchez R, Deschênes J, Auger A, Hebert E,
White JH, et al. Opposite effects of histone deacetylase
inhibitors on glucocorticoid and estrogen signaling in
human endometrial Ishikawa cells. Mol Pharmacol 2005;
68(6):1852-
47. Wang ZT, Chen ZJ, Jiang GM, Wu YM, Liu T, Yi YM,
et al. Histone deacetylase inhibitors suppress mutant p53
٨
The Effect of Sodium Butyrate on the
LHX1
mRNA Expression in Colorectal Cancer Cell Line
Avicenna Journal of Medical Biotechnology, Vol. 11, No. 3, April-July 2019
transcription via HDAC8/YY1 signals in triple negative
breast cancer cells. Cell Signal 2016;28(5):506-515.
48. Fogh J, (eds). Human Tumor Cell in Vitro. New York,
USA: Plenum Press; 1975. 550 p.
49. Cajot JF, Sordat I, Silvestre T, Sordat B. Differential
display cloning identifies motility-related protein
(MRP1/CD9) as highly expressed in primary compared
to metastatic human colon carcinoma cells. Cancer Res
1997;57(13): 2593-2597.
Brattain MG, Brattain DE, Fine WD, Khaled FM, Marks
ME, Kimball PM, et al. Initiation and characterization of
cultures of human colonic carcinoma with different
biological characteristics utilizing feeder layers of
confluent fibroblasts. Oncodev Biol Med 1981;2(5):355-
366.
50. Brattain MG, Fine WD, Khaled FM, Thompson J,
Brattain DE. Heterogeneity of malignant cells from a
human colonic carcinoma. Cancer Res 1981;41(5):1751-
1756.
51. Eshleman JR, Lang EZ, Bowerfind GK, Parsons R,
Vogelstein B, Willson JK, et al. Increased mutation rate
at the hprt locus accompanies microsatellite instability in
colon cancer. Oncogene 1995; 10(1):33-37.
52. Ahmed D, Eide PW, Eilertsen IA, Danielsen SA, Eknaes
M, Hektoen M, et al. Epigenetic and genetic features of
24 colon cancer cell lines. Oncogenesis 2013;2(9):e71.
