![Amplification of DNA from the samples using esxB (CFP-10) primers [Lane M-100 bp ladder, L1-Positive control (M. tuberculosis), L2-L9-Blood samples].](https://www.researchgate.net/publication/333822122/figure/fig1/AS:770764752027649@1560776045485/Amplification-of-DNA-from-the-samples-using-esxB-CFP-10-primers-Lane-M-100-bp-ladder_Q320.jpg)
Available via license: CC BY 4.0
Content may be subject to copyright.
Open Journal of Veterinary Medicine, 2019,9, 55-65
http://www.scirp.org/journal/ojvm
ISSN Online: 2165-3364
ISSN Print: 2165-3356
DOI:
10.4236/ojvm.2019.95005 May 31, 2019 55 Open Journal of Veterinary Medicine
Diagnosis of Bovine Tuberculosis by
Comparative Intradermal Tuberculin Test,
Interferon Gamma Assay and esxB (CFP-10)
PCR in Blood and Lymph Node Aspirates
Derhasar Brahma1, Deepti Narang1*, Mudit Chandra1, Gursimran Filia2, Amarjit Singh3,
Sikh Tejinder Singh4
1Department of Veterinary Microbiology, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences
University, Ludhiana, Punjab, India
2Animal Disease Research Centre, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences University,
Ludhiana, Punjab, India
3Department of Veterinary Pathology, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences
University, Ludhiana, Punjab, India
4Directorate Livestock Farm, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences University,
Ludhiana, Punjab, India
Abstract
Bovine tuberculosis (TB) is a chronic debilitating disease of huge economic
importance due to loss in production, morbidity and mortality, and has a po-
tential zoonotic threat. TB is endemic in India and has a worldwide preva-
lence, therefore, needing early
diagnostic technique for the eradication of TB
globally. Currently, compared to the eradication programme
of TB in
Medical sector, Veterinary sector is lagging behind though TB is one of the
major zoonotic diseases prevalent in dairy animals and w
ildlife in India. With
the “End TB” strategy by WHO in human, parallel measures for early diagno-
sis and culling has to be followed in case of animals for an overall successful
eradication programme. The objective of this study is diagnosis of TB in cat-
tle and buffaloes by using the cell-mediated immune response tests,
i.e.
Comparative Intradermal Tuberculin Test (CITT) and Interferon gamma
(IFN-
γ
) assay, and Polymerase Chain Reaction (PCR) targeting
esxB
gene
(CFP-10 protein) and to compare their diagnostic
capabilities. This study was
carried out in 202 dairy cattle and buffaloes from an organized dairy farm,
where almost all of the animals appeared clinically healthy. We found that,
the combined use of both CITT and IFN-
γ
assay lead to more accurate diag-
nosis of TB, although IFN-
γ
assay was more specific than CITT. However,
esxB
PCR showed almost similar sensitivity to IFN-
γ
assay and may be used
as a fast alternative method for the diagnosis of bovine TB from blood samples.
How to cite this paper:
Brahma, D., Na-
rang
, D., Chandra, M., Filia, G., Singh, A
.
and
Singh, S.T. (2019)
Diagnosis of Bovine
Tuberculosis by Comparative Intradermal
Tuberculin Test, Interferon Gamma Assay
and
esxB
(CFP-
10) PCR in Blood and
Lymph
Node Aspirates.
Open Journal of
Veterinary Medicine
,
9
, 55-65.
https://doi.org/10.4236/ojvm.2019.95005
Received:
April 2, 2019
Accepted:
May 28, 2019
Published:
May 31, 2019
Copyright © 201
9 by author(s) and
Scientific
Research Publishing Inc.
This work is licensed under the Creative
Commons Attribution International
License (CC BY
4.0).
http://creativecommons.org/licenses/by/4.0/
Open Access
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 56 Open Journal of Veterinary Medicine
Keywords
Bovine TB, CITT, IFN-
γ
,
esxB
PCR
1. Introduction
TB caused by
Mycobacterium tuberculosis
complex (MTC) comprising of
M.
bovis
,
M. caprae
and
M. tuberculosis
; is a major infectious and chronic wasting
disease, having a zoonotic potential and a worldwide distribution [1]. TB in
milch animals is mainly caused by
M. bovis
[2]. Since 2015, the World Health
Organization (WHO) has adopted a new strategy for TB prevention, care and
control—The End TB Strategy—with its targets to end the Global TB epidemic
by reduction in the incidence rate and death rate of the disease by 90% and 95%
respectively in 20 years (2015-2035) compared with level to 2015 by means of
improved diagnostics, prevention and control measures [3].
Diagnosis of TB in the early stage is very important for effective prevention
and control of the disease. Conventional diagnostic methods like culture and
microscopy, though considered as gold standard, is time consuming and re-
quires more than 3 weeks for the visible growth of MTC colony [4], besides,
symptoms of TB mostly appears in late or advanced phage of the disease. There-
fore, ante-mortem tests of cellular immune response (Tuberculin test and
Interferon gamma Assay) and molecular diagnosis is required for the early di-
agnosis of the disease [2] [5]. Serological test like indirect ELISA can also be used
complementarily for screening of anti-TB antibody in a herd [6].
Molecular diagnosis of TB using
esxB
(CFP-10) PCR targeting
esxB
gene
present in the RD1 region of the pathogenic Mycobacterial species, is a fast di-
agnostic tool having higher sensitivity and specificity [7]. Therefore, the present
study was aimed at comparative diagnosis of bovine TB in cattle and buffaloes
using cell-mediated immune response tests viz. CITT and IFN-
γ
assay; and mo-
lecular diagnosis using
esxB
gene PCR targeting CFP-10 protein.
2. Materials and Methods
2.1. Selection of Animals and Collection of Blood and Lymph Node
Aspirate Samples
A total of 202 female milch animals (42 HF-cross cows and 160 Murrah and Nili
Ravi buffaloes) from 2 years and above were selected randomly from an orga-
nized dairy farm in Ludhiana, Punjab. CITT was performed on all the animals
and then blood samples were collected for IFN-
γ
assay and
esxB
PCR. Lymph
node aspirates (n = 15) from the TB reactor animals (positive by either of the
two tests viz. CITT or IFN-
γ
assay) were also collected.
In fact, the sampling size was done irrespective of any criteria of selection and
the reason for choosing only female animals for this study was because of the
availability of females in large numbers and taking into consideration that female
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 57 Open Journal of Veterinary Medicine
animals are more important in transmission of the causative organism through milk.
2.2. Time and Place of Work
The present study was carried out during the year 2015-2016, at Department of
Microbiology, COVS, GADVASU, Ludhiana, Punjab, India.
2.3. Variables
In this study, the variables to be tested/compared are CITT and IFN-
γ
assay for
cell-mediated immune response and
esxB
PCR for molecular diagnosis of TB in
cattle and buffaloes.
2.4. Comparative Intradermal Tuberculin Test (CITT)
The selected animals were subjected to CITT, as per OIE [2]. Bovine tuberculin
PPD from culture of
M. bovis
(strain AN5, 3000 IU) and avian tuberculin PPD
from culture of
M. avium
subspecies
avium
(strain D4ER, 2500 IU), obtained
from Prionics (Netherlands), were used for CITT. Two 2 × 2 square inch areas
were shaved at the middle third of left side of neck approximately 12 - 15 cm
apart. The zero hour skin thickness was measured with the help of a vernier ca-
liper. The bovine and the avian tuberculin PPD (0.1 ml each) were injected in-
tra-dermally; the bovine PPD being injected in the caudal shaved area. The cor-
rection of the injection was confirmed by palpation of a small pea-like swelling
at the site. Inflammatory responses were recorded 72 hours post injection. The
observations were made on the basis of hot, pain and swelling at the site of injec-
tion. Animals were considered positive if the increase in skin thickness at the
bovine site of injection was more than 4 mm greater than the reaction shown at
the site of the avian injection. The reaction was recorded as negative, if no or ≤1
mm difference in the increase in skinfold thickness was observed. Difference
between 1 - 4 mm was considered as doubtful.
2.5. Bovine Interferon Gamma (IFN-γ) Assay
This test was performed using
M. bovis
Gamma Interferon Assay Kit for Cattle
(BOVIGAM, Prionics, Switzerland). BOVIGAM is a rapid
in-vitro
blood based
assay of cell-mediated immune response to
M. bovis
purified protein derivative
(PPD). A minimum volume of 5 ml of blood from jugular veins of each animal
was collected in commercially available sterile 10 ml heparinized tubes. Three
1.5 ml aliquots of heparinized blood from each animal were dispensed into wells
of 24-well tissue culture plate, to which 100 µl each of PBS as nil antigen control
(pH-7.2), avian and bovine PPD (Prionics, Netherlands) were added aseptically
into the wells containing heparinized blood. The antigens were mixed tho-
roughly into the aliquoted blood and then incubated in a humidified atmosphere
for 16 - 24 hours at 37˚C. The plasma was then collected and assayed for IFN-
γ
production in duplicate. Optical densities were measured on an ELISA plate
reader (Multiskan, MTX Lab Systems, Inc., USA) at 450 nm filter with a 620 nm
reference filter. Animal was considered positive when mean OD of bovine PPD
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 58 Open Journal of Veterinary Medicine
minus mean OD of avian PPD and mean OD of bovine PPD minus mean OD of
nil antigen was ≥0.1. Animal was considered negative when mean OD of bovine
PPD minus mean OD of avian PPD and mean OD of bovine PPD minus mean
OD of nil antigen was <0.1.
2.6. DNA Extraction
Initially, buffy coat was obtained from 1 ml of whole blood samples by centrifu-
gation at 10,000 rpm for 10 min. The buffy coat and lymph node aspirates were
subjected to DNA extraction using QIAamp DNA blood mini kit (Qiagen).
DNA was stored in −20˚C till further use.
2.7. esxB (CFP-10) PCR
PCR targeting
esxB
gene (Rv3875) present on RD1 region of MTC encoding
CFP-10 protein was done for confirmation of TB. The sequences of
esxB
primer
pair were: Forward 5’ATGGCAGAGATGAAGACCGATGCCGCT3’ and Re-
verse-5’TCAGAAGCCCATTTGCGAGGACAGCGCC3’ with an expected band
size of 302 bp [7]. PCR conditions were performed as per Brahma
et al
. [8].
Briefly, a ready to use GoTaq® Green Master Mix, 2X (Promega) was used. A
reaction volume of 25 µl was made containing 12.5 µl of GoTaq® Green Master
mix, 1 µl of forward primer (10 pmol/μl), 1 µl of reverse primer (10 pmol/μl), 2.5
µl of nuclease free water and 8 µl of DNA template. Along with sample DNA, a
known positive control DNA from
M. tuberculosis
culture (IMTECH, Chandi-
garh) was also amplified. Thermal cycling was performed in research thermal
cycler (Eppendorf, Germany) with initial denaturation of 10 min at 95˚C for 1
cycle, denaturation, annealing and extension at 95˚C, 63˚C and 72˚C respective-
ly for 45 sec for 40 cycles and final extension at 72˚C for 10 min for 1 cycle. PCR
products were run by 1.5% agarose gel electrophoresis and visualized in
gel-documentation system (Alpha Innotech, San Leandro, CA). The sensitivity
of
esxB
(CFP-10) primers were assessed in ten-fold serial dilution of the known
concentration (8 ng/μl) of the standard genomic DNA of
M. tuberculosis
and
specificity of
esxB
primers were tested against other non-tuberculous mycobac-
terial species [
M. avium
,
M. kansasii, M. fortuitum
and
M. smegmatis
(Microbi-
ologics)] and non-mycobacterial species (
B. abortus
,
P. multocida
and
E
.
coli
).
2.8. Statistical Analysis
The proportions of the animals that were positive by either CITT or IFN-
γ
assay
were calculated. Kappa test was applied to compare the degree of agreement be-
tween the two tests at 95% level of significance.
3. Results
3.1. CITT and IFN-γ Assay
In this study, out of total 202 animals screened for TB, 40 animals (19.80%) were
found to be positive by CITT (18 cattle and 22 buffaloes). Out of these only 30
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 59 Open Journal of Veterinary Medicine
animals (13 cattle and 17 buffaloes) showed an exclusively positive reaction to
CITT by showing an increase in the thickness > 4 mm and a negative response to
IFN-
γ
.
The numbers of animals positive by IFN-
γ
assay were 17 (7 cattle and 10 buf-
faloes), out of which only 7 animals (2 cattle and 5 buffaloes) showed an exclu-
sively positive reaction to IFN-
γ
and a negative response to CITT. However, out
of all animals, only 10 showed a positive response to both CITT and IFN-
γ
assay.
Based on the results of CITT and IFN-
γ
assay, the animals were divided into
four groups, as given in Table 1. Group 4 was considered as the control group
for further comparison of various observations. Considering the results of TB
positive animals by either one or both the tests, the incidence of TB recorded in
cattle (47.62%) was almost three times more than that of buffaloes (16.88%).
3.2. esxB (CFP-10) Gene PCR
The detection limit of the
esxB
(CFP-10) PCR was upto 8 pg/μl of pure culture
M. tuberculosis
DNA. None of the organisms other than
M. tuberculosis
showed
amplification which clearly indicates the specificity of
esxB
gene only for the
pathogenic Mycobacterial species viz.
M. tuberculosis
and
M. bovis
.
Overall, 13 (6.44%) out of 202 animals were found to be positive for TB by
esxB
(CFP-10) gene PCR. (Figure 1) in blood samples, where 10 of 13 were pos-
itive by both CITT and IFN-
γ
assay in common and the rest 3 of 13 were IFN-
γ
positive but CITT negative. In contrast,
esxB
PCR from the lymph node aspi-
rates of 15 animals revealed only 1 animal to be positive for TB.
3.3. Statistical Analysis
The proportions of the animals that were positive by either CITT or IFN-
γ
assay
are given in Table 2. At 95% level of significance, kappa value between CITT and
IFN-
γ
assay was 0.264, indicating a fair degree of agreement between the two tests.
Figure 1. Amplification of DNA from the samples using
esxB
(CFP-10) primers
[Lane M-100 bp ladder, L1-Positive control (
M. tuberculosis
), L2-L9-Blood samples].
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 60 Open Journal of Veterinary Medicine
Table 1. Grouping of cattle and buffaloes based on the results of CITT and IFN-
γ
Assay.
Group No.
Criteria
Number of
Cattle (%)
Number of
Buffaloes (%)
Total no. of
cattle and
buffaloes (%)
Group 1
Animals tested positive for TB by
both the tests
i.e.
CITT and IFN-
γ
Assay
5 (11.90%) 5 (3.13%) 10 (4.95%)
Group 2
Animals tested positive for TB by
CITT but tested negative by IFN
-
γ
Assay
13 (30.95%) 17 (10.63%) 30 (14.85%)
Group 3
Animals tested negative for TB by
CITT but tested positive by IFN
-
γ
Assay
2 (4.76%) 5 (3.13%) 7 (3.47%)
Group 4
Animals tested negative by both
CITT and IFN
-
γ
Assay 22 (52.38%) 133 (83.13%) 155 (76.73%)
Total
TB
positive
Animals
Number of animals tested TB
positive with one or both the tests
20 (47.62%) 27 (16.88%) 47 (23.27%)
Table 2. Proportions of animals positive or negative by CITT and INF-
γ
Assay.
Intra-dermal
Test Result
No. of Animals
with IFN-
γ
+ve
No. of Animals
with IFN-
γ
−ve
Total No.
of Animals
CITT +ve
10 30 40
CITT −ve
7 155 162
Total
17 185 202
4. Discussions
In this study, the incidence of TB recorded in cattle (47.62%) either by one or
both the tests were almost three times more than that of buffaloes (16.88%).
Probably the cattle which were mostly HF-cross may be more susceptible to the
disease due to production and environmental stress, compared to the local indi-
genous buffaloes, similar findings have also been reported by Das
et al
. [9] After
all, the overall prevalence rate of TB in the farm was 23.27%, which is higher
than the overall prevalence rate of TB in the state (Punjab)
i.e.
5.38% [10].
However, based on a random-effects meta-regression model analysis, Srinivasan
et al
. [11], revealed a pooled prevalence estimate of 7.3% indicating that there
may be an estimated 21.8 million infected cattle in India.
Numerous studies have been carried out in the last decades to evaluate sensi-
tivity and specificity of the intradermal test and IFN-
γ
assay in cattle under dif-
ferent epidemiological situations using different antigens [12] [13] [14]. Since
both the tests measure the cell-mediated T-cell response, there is to be expected
a considerable overlap (~80%) between the animals that respond to these tests
[15]. In our study, no significant difference has been observed between the sen-
sitivity and specificity of CITT and IFN-
γ
assay, similar to the findings by Ame-
ni
et al
. [16]. However, the sensitivity of the IFN-
γ
assay was less than the CITT
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 61 Open Journal of Veterinary Medicine
whereas specificity of IFN-
γ
assay was greater than the CITT in our study. The
IFN-
γ
assay has a sensitivity of 84% that is comparable to, but lower than, the
observed sensitivity of the CITT (90%), whereas, the specificity of the IFN-
γ
as-
say (97%) is lower than that of the CITT (99.9%) [15]. When used in parallel
with
i.e.
at the same time as the tuberculin test, the combined tests give a sensi-
tivity of over 90% - 95% [5] [15] [17] [18], which is also supported by the find-
ings in our study as well as Ahir
et al
. [19]
The probable reason of our findings, that is, 30 CITT positive animals testing
negative for IFN-
γ
assay may be due to co-infection of the animals with an en-
vironmental mycobacterium or anergic situation of infected animals, as recorded
by other workers [13] [20]. In contrast, 7 CITT negative animals which were
tested positive by IFN-
γ
assay suggested that these animals might be in the early
stage of the disease that couldn’t be determined by CITT, as the same has been
recorded by Gormley
et al
. [5], Strain
et al
. [21] Good
et al
. [15] also reported
subpopulations of
M. bovis
-infected cattle which give a positive reaction to the
IFN-
γ
assay and not to the tuberculin test and vice versa. However, animals
which tested positive for IFN-
γ
assay and negative for intra-dermal tuberculin
test were subsequently converted to tuberculin positive and posed an increased
risk to the other cattle [20].
At 95% level of significance, kappa value between CITT and IFN-
γ
assay was
0.264, indicating a fair degree of agreement between the two tests. So both the
tests, when used simultaneously increase the accuracy of detection of TB positive
dairy animals, similar to the findings by Gormley
et al
. [5], Ahir
et al
. [19]
The sensitivity (detection limit) of the
esxB
(CFP-10) PCR was up to 8 pg/μl of
pure culture
M. tuberculosis
DNA [8]. There are reports of PCR from blood and
tissue samples of cattle, using JB21 and JB22 primers specific for
M. bovis
, de-
tecting as low as 10 fg/ul of purified
M. bovis
DNA [22] [23].
Several PCR systems have been developed for the detection of TB viz. PCR
amplification of
esxA
and
esxB
genes targeting ESAT-6 and CFP-10 proteins re-
spectively, present in pathogenic Mycobacterial species, can be used for confir-
mation of
M. tuberculosis
as well as
M. bovis
[7] [24]. Although the presence of
ESAT-6 and CFP-10 has also been detected in other mycobacterial species and
further studies of their extent of amino acid sequence similarities are required
[25]. Besides,
M. tuberculosis
, as well as
M. bovis
, can also be detected by PCR
targeting IS6110 insertion sequence [2] [26].
M. bovis
in cattle lymph nodes
were detected by PCR using TB1 and TB2 primers targeting gene that codes for
MPB70 protein [27].
In our study, the 3 PCR positive animals that were IFN-
γ
positive but CITT
negative may be in their early stage of TB infection. Besides, the probability that
most of the TB reactor animals positive by CITT and IFN-
γ
assay failed to be
detected by PCR may be due to low concentration of DNA (even less than 8
pg/µl) in clinical samples which remained undetected by PCR, besides
M. bovis
DNA may not be present in the clinical samples as the animal may not be in the
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 62 Open Journal of Veterinary Medicine
stage of bacteriaemia. Therefore, information on
M. bovis
or
M. tuberculosis
bactaeriaemia and time of dissemination in blood stream need to be further ex-
plored for proper sampling time. However, compared to lymph node aspirate
PCR which detected only 1 TB positive out of 15 animals, blood PCR had better
sensitivity as the later detected TB positive in more numbers (13 out of 47) of
either CITT and IFN-
γ
positive animals.
After all, there were certain limitations in this study, as no test is 100% sensi-
tive and 100% specific [28] and no single test can diagnose bovine TB at all stag-
es of infection [29] [30]. CITT has many limitations including difficulties in ad-
ministration and interpretation of results, need for a second step visit, low de-
gree of standardization and imperfect test accuracy [13]. The sensitivity of the
test is affected by the potency and dose of tuberculin administered, desensitiza-
tion, deliberate interference, post-partum immune-suppression and observer
variation. Specificity is influenced by sensitisation as a result of exposure to
M.
avium
,
M. avium paratuberculosis
and other environmental mycobacteria [31].
Because intradermal tuberculin testing elevates the production of IFN-
γ
by
lymphocytes of cattle that have had prior exposure to
M. bovis
antigens [32],
there is the potential for multiple injections of tuberculin to increase the produc-
tion of IFN-
γ
, resulting in higher optical density (OD) values of the IFN-
γ
assay
and thus, for animals subsequently being classified falsely as positive [33]. Be-
sides, TB is a chronic granulomatous disease, therefore, diagnosis of TB from
blood samples may be done especially during the stage of bacteriaemia. After all,
the difficulty in lymph node aspirate sampling from cattle and buffaloes were an
inevitable drawback in this study. So, the accurate sense of the lymph node aspi-
rate PCR cannot be ascertained from the present study as the numbers of sam-
ples are insufficient to make a correct judgement.
5. Conclusion
From this study, we can conclude that diagnosis of bovine TB can be done in
early stage in live animals with cell-mediated immune response based tests
(CITT and IFN-
γ
assay) and blood PCR especially during the stage of bacte-
riaemia. Combined use of both CITT and IFN-
γ
assay lead to more accurate
screening of TB, though IFN-
γ
assay was more specific than CITT. However,
esxB
(CFP-10) PCR can also be used as a fast and easy alternative method for the
laboratory diagnosis of bovine TB. Early diagnosis of TB can lead to quick se-
gregation of infected animals, restrict transmission and help in eradication of
bovine TB from the country. In fact, equal importance must be given for eradi-
cation of TB from the dairy animals to make the WHO’s “End TB strategy” a
100% success.
Acknowledgements
The authors are grateful to DBT (Department of Biotechnology) Govern-
ment of India for providing funds for the present work through a Project
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 63 Open Journal of Veterinary Medicine
(BT/PR5776/MED/30/928/2012).
Ethical Approval
This study was approved by Animal Ethics Committee of Guru Angad Dev Ve-
terinary and Animal Sciences University (GADVASU), Ludhiana, Punjab.
Conflicts of Interest
The authors declare no conflicts of interest regarding the publication of this pa-
per.
References
[1] OIE (World Organisation for Animal Health) (2018) Chapter 8.11. Infection with
Mycobacterium tuberculosis
Complex. Terrestrial Animal Health Code.
[2] OIE (2009) Chapter 2.4.6: Bovine Tuberculosis. Terrestrial Manual. World Organi-
zation for Animal Health, Paris.
[3] World Health Organization (2018) Global Tuberculosis Report.
[4] Pfyffer, G.E. and Wittwer, F. (2012) Incubation Time of Mycobacterial Cultures:
How Long Is Long Enough to Issue a Final Negative Report to the Clinician?
Jour-
nal of Clinical Microbiology
, 50, 4188-4189. https://doi.org/10.1128/JCM.02283-12
[5] Gormley, E., Doyle, M.B., Fitzsimons, T., McGill, K. and Collins, J.D. (2006) Diag-
nosis of
Mycobacterium bovis
Infection in Cattle by Use of the Gamma-Interferon
(Bovigam1) Assay.
Veterinary Microbiology
, 112, 171-179.
https://doi.org/10.1016/j.vetmic.2005.11.029
[6] OIE (2012) Chapter 2.4.7. Bovine Tuberculosis. Manual of Diagnostic Tests and
Vaccines for Terrestrial Animals. Seventh Edition, Paris.
[7] Dikshit, M., Sharma, R.J., Adsool, A.D. and Chaphalkar, S.R. (2012) ESAT-6 and
CFP-10 Proteins of
Mycobacterium tuberculosis
in Making Diagnostic Tool for TB.
Journal of Biotechnology Letters
, 3, 28-30.
[8] Brahma, D., Narang, D., Chandra, M., Gupta, K., Singh, A. and Kaur, G. (2017) Di-
agnosis of Mycobacterial Infections (Tuberculosis and Paratuberculosis) in Tissue
Samples Using Molecular (In-House Multiplex PCR, PCR and TaqMan Real-Time
PCR), Histopathology and Immunohistochemical Techniques.
Tropical Biomedi-
cine
, 34, 1-17.
[9] Das, R., Dandapat, P., Chakrabarty, A., Nanda, P.K., Bandyopadhyay, S. and Ban-
dyopadhyay, S. (2018) A Cross-Sectional Study on Prevalence of Bovine Tuberculo-
sis in Indian and Crossbred Cattle in Gangetic Delta Region of West Bengal, India.
International Journal of One Health
, 4, 1-7. https://doi.org/10.14202/IJOH.2018.1-7
[10] Sharma, S., Patil, P.K., Kumar, H., Mahajan, V., Filia, G., Verma, S. and Sandhu,
K.S. (2011) Bovine Tuberculosis in Intensive Dairy Operations of Punjab: Longitu-
dinal Comparative Study on Prevalence and the Associated Risk Factors.
Indian
Journal of Comparative Microbiology
,
Immunology and Infectious Diseases
, 32,
41-44.
[11] Srinivasan, S., Easterling, L., Rimal, B., Niu, X.M., Conlan, A.J.K., Dudas, P. and
Kapur, V. (2018) Prevalence of Bovine Tuberculosis in India: A Systematic Review
and Meta-Analysis.
Transboundary and Emerging Diseases
, 65, 1627-1640.
https://doi.org/10.1111/tbed.12915
[12] Buddle, B.M., Ryan, T.J., Pollock, J.M., Andersen, P. and de Lisle, G.W. (2001) Use
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 64 Open Journal of Veterinary Medicine
of ESAT-6 in the Interferon-g Test for Diagnosis of Bovine Tuberculosis Following
Skin Testing.
Veterinary Microbiology
, 80, 37-46.
https://doi.org/10.1016/S0378-1135(00)00375-8
[13] De La Rua-Domenech, R., Goodchild, A.T., Vordermeier, H.M., Hewinson, R.G.,
Christiansen, K.H. and Clifton-Hadley, R.S. (2006) Ante Mortem Diagnosis of Tu-
berculosis in Cattle: A Review of the Tuberculin Tests, Gamma-Interferon Assay
and Other Ancillary Diagnostic Techniques.
Research in Veterinary Science
, 81,
190-210. https://doi.org/10.1016/j.rvsc.2005.11.005
[14] Aagaard, C., Govaerts, M., Meikle, V., Gutiérrez-Pabello, J.A., McNair, J., Andersen,
P., SuárezGüemes, F., Pollock, J., Espitia, C. and Cataldi, A. (2010) Detection of Bo-
vine Tuberculosis in Herds with Different Disease Prevalence and Influence of Pa-
ratuberculosis Infection on PPDB and ESAT-6/CFP10 Specificity.
Preventive Vete-
rinary Medicine
, 96, 161-169. https://doi.org/10.1016/j.prevetmed.2010.06.007
[15] Good, M., Duignan, A., Maher, P. and O’Keeffe, J. (2010) Veterinary Handbook for
Herd Management in the Bovine TB Eradication Programme.
[16] Ameni, G., Miorner, H., Roger, F. and Tibbo, M. (2000) Comparison between
Comparative Tuberculin and Gamma-Interferon Tests for the Diagnosis of Bovine
Tuberculosis in Ethiopia.
Tropical Animal Health and Production
, 32, 267-276.
https://doi.org/10.1023/A:1005271421976
[17] Wood, P.R., Corner, L.A., Rothel, J.S., Baldock, C., Jones, S.L., Cousins, D.B.,
McCormick, B.S., Rancis, B.R., Creeper, J. and Tweddle, N.E. (1991) Field Compar-
ison of the Interferon-Gamma Assay and the Intra-Dermal Tuberculin Test for the
Diagnosis of Bovine Tuberculosis.
Australian Veterinary Journal
, 68, 286-290.
https://doi.org/10.1111/j.1751-0813.1991.tb03254.x
[18] Liebana, E., Girvin, R.M., Welsh, M., Neill, S.D. and Pollock, J.M. (1999) Genera-
tion of CD8 (+) T-Cell Responses to
Mycobacterium bovis
and Mycobacterial An-
tigen in Experimental Bovine Tuberculosis.
Infection and Immunity
, 67, 1034-1044.
[19] Ahir, P., Filia, G., Mahajan, V., Leishangthem, G.D., Rai, T.S. and Singh, A. (2016)
Diagnosis of Bovine Tuberculosis in Lactating Cattle and Buffaloes by Comparative
Intradermal Tuberculin Test and Bovine Gamma-Interferon Immunoassay.
Journal
of Animal Research
, 6, 1069-1072. https://doi.org/10.5958/2277-940X.2016.00157.1
[20] Gormley, E., Doyle, M.B., McGill, K., Costello, E., Good, M. and Collins, J.D. (2004)
The Effect of the Tuberculin Test and the Consequences of a Delay in Blood Culture
on the Sensitivity of a Gamma-Interferon Assay for the Detection of
Mycobacte-
rium bovis
Infection in Cattle.
Veterinary Immunology and Immunopathology
,
102, 413-420. https://doi.org/10.1016/j.vetimm.2004.08.002
[21] Strain, S.A.J., McNair, J. and McDowell, S.W.J. (2011) Bovine Tuberculosis. A Re-
view of Diagnostic Tests for
M
.
bovis
Infection in Cattle. Bacteriology Branch, Ve-
terinary Sciences Division, AgriFood and Biosciences Institute, Belfast, Northern
Ireland, UK.
[22] Rodriguez, J.G., Mejia, G.A., Portillo, P.D., Patarroyo, M.E. and Murillo, L.A. (1995)
Species-Specific Identification of
Mycobacterium bovis
by PCR.
Microbiology
, 141,
2131-2138. https://doi.org/10.1099/13500872-141-9-2131
[23] Zali, M.H.S., Farajnia, F., Yahyapour, H., Moslemzadeh, T. and Hashempour, A.
(2014) Detection of
Mycobacterium bovis
in Cattle Suspected to Tuberculosis by
PCR Method in Urmia-Iran.
Bulletin of Environment
,
Pharmacology and Life
Sciences
, 3, 152-157.
[24] Pinxteren, L.A.H.V., Ravn, P., Agger, E.M., Pollock, J. and Andersen, P. (2000) Di-
agnosis of Tuberculosis Based on the Two Specific Antigens ESAT-6 and CFP-10.
D. Brahma et al.
DOI:
10.4236/ojvm.2019.95005 65 Open Journal of Veterinary Medicine
Clinical and Diagnostic Laboratory Immunology
, 7, 155-160.
https://doi.org/10.1128/CDLI.7.2.155-160.2000
[25] Van Pittius, N.C.G., Warren, R.M. and van Helden, P.D. (2002) Letter to the Editor.
ESAT-6 and CFP-10: What Is the Diagnosis?
Infection and Immunity
, 70,
6509-6511. https://doi.org/10.1128/IAI.70.11.6509-6511.2002
[26] Bassessar, V., Shrivastav, A.B., Swamy, M., Jadhav, K. and Rajput, N. (2014) Poly-
merase Chain Reaction Based Detection of
Mycobacterium tuberculosis
IS6110 in
Cattle Faeces.
Indian Journal of Veterinary Pathology
, 38, 10-13.
https://doi.org/10.5958/0973-970X.2014.01126.2
[27] Helmy, N.M., Abdel-Moghney, A.R.F. and Atia, M.A.M. (2015) Evaluation of Dif-
ferent PCR-Based Techniques in Diagnosis of Bovine Tuberculosis in Infected Cat-
tle Lymph Nodes.
American Journal of Microbiology and Biotechnology
, 2, 75-81.
[28] Pucken, V.B., Knubben-Schweizer, G., Dopfer, D., Groll, A., Hafner-Marx, A.,
HoÈrmansdorfer, S., Sauter-Louis, C, Straubinger, R.K., Zimmermann, P. and
Hartnack, S. (2017) Evaluating Diagnostic Tests for Bovine Tuberculosis in the
Southern Part of Germany: A Latent Class Analysis.
PLoS ONE
, 12, e0179847.
https://doi.org/10.1371/journal.pone.0179847
[29] Marassi, C.D., Medeiros, L., Figueiredo, E., Fonseca, L.S., Duarte, R., Paschoalin, V.,
Oelemann, W.R.M. and Lilenbaum, W. (2013) A Multidisciplinary Approach to
Diagnose Naturally Occurring Bovine Tuberculosis in Brazil.
Pesquisa Veterinária
Brasileira
, 33, 15-20. https://doi.org/10.1590/S0100-736X2013000100004
[30] Bezos, J., Alvarez, J., Romero, B., De Juan, L. and Dominguez, L. (2014) Bovine Tu-
berculosis: Historical Perspective.
Research in Veterinary Science
, 97, S3-S4.
https://doi.org/10.1016/j.rvsc.2014.09.003
[31] Monaghan, M.L., Doherty, M.L., Collins, J.D., Kazda, J.F. and Quinn, P.J. (1994)
The Tuberculin Test.
Veterinary Microbiology
, 40, 111-124.
https://doi.org/10.1016/0378-1135(94)90050-7
[32] Whipple, D.L., Palmer, M.V., Slaughter, R.E. and Jones, S.L. (2001) Comparison of
Purified Protein Derivatives and Effect of Skin Testing on Results of a Commercial
Gamma Interferon Assay for Diagnosis of Tuberculosis in Cattle.
Journal of Vete-
rinary Diagnostic Investigation
, 13, 117-122.
https://doi.org/10.1177/104063870101300204
[33] Rangen, S.A., Surujballi, O.P., Lutze-Wallace, C. and Lees, V.W. (2009) Is the
Gamma Interferon Assay in Cattle Influenced by Multiple Tuberculin Injections?
Canadian Veterinary Journal
, 50, 270-274.
