Content uploaded by Angelica Crottini
Author content
All content in this area was uploaded by Angelica Crottini on Aug 15, 2018
Content may be subject to copyright.
178
W C et al.
Available at http://www.salamandra-journal.com
© 2018 Deutsche Gesellscha für Herpetologie und Terrarienkunde e.V. (DGHT), Mannheim, Germany
SALAMANDRA 54(3) 178–200 15 August 2018 ISSN 0036–3375
e herpetofauna (Amphibia, Crocodylia, Squamata, Testudines)
of the Isalo Massif, Southwest Madagascar:
combining morphological, molecular and museum data
W C, G M. R,, F A, G A, P E B,
F M, V M, J E R, D R,
M V A C
1) CIBIO, Research Centre in Biodiversity and Genetic Resources, InBIO, Universidade do Porto, Campus Agrário de Vairão,
Rua Padre Armando Quintas, No 7, 4485-661 Vairão, Portugal
2) Institute of Zoology, Zoological Society of London, Regent’s Park, NW1 4RY London, UK
3) Centre for Ecology, Evolution and Environmental Changes (CE3C), Faculdade de Ciências da Universidade de Lisboa,
Bloco C2, Campo Grande, 1749-016 Lisboa, Portugal
4) Museo Regionale di Scienze Naturali, Via G. Giolitti, 36, 10123 Torino, Italy
5) Dipartimento di Biologia, Università degli Studi di Napoli Federico II, Via Cinthia, 80126 Napoli, Italy
6) Acquario di Genova, Area Porto Antico, Ponte Spinola, 16128 Genova, Italy
7) Museum für Naturkunde, Leibniz-Institut für Evolutions- und Biodiversitätsforschung an der Humboldt-Universität zu Berlin,
Invalidenstr. 43, 10115 Berlin, Germany
8) Parc Botanique et Zoologique de Tsimabazaza, BP 4096, Antananarivo 101, Madagascar
9) Technische Universität Braunschweig, Zoological Institute, Mendelssohnstr. 4, 38106 Braunschweig, Germany
Corresponding author: W C, e-mail: walter.cocca85@gmail.com
Manuscript received: 28 November 2017
Accepted: 19 March 2018 by J K
Abstract. is study summarizes the data of multiple surveys carried out at the Isalo Massif (southwestern Madagascar),
both within and outside the National Park limits between and , providing an updated list of the amphibians and
non-avian reptiles present within the area. We used an integrative taxonomic approach, combining morphological and mo-
lecular data sets to identify collected samples as either described species, or as undescribed candidate species. We here report
on one new amphibian candidate species (Mantidactylus sp. a. multiplicatus Ca “Isalo”), and two new amphibian distri-
bution records (Mantella sp. a. expectata “South”, Scaphiophryne sp. a. calcarata Ca) compared to the former inventories
of the area. Additionally, we provide molecular reference sequences for of the amphibian taxa and for of the rep-
tile taxa known to occur in the area, combining all available sources. With this study, we validate Isalo as an important centre
of biodiversity and micro-endemism within Madagascar, with four described endemic amphibian (Gephyromantis azzurrae,
Mantella expectata, Mantidactylus nora lottae, and Scaphiophryne gottlebei) and one reptile species (Tra chy le pi s na nc yc out u-
ae). Of the taxa here listed for Isalo, seven amphibians and six reptiles are new candidate species, and among them at least
one amphibian (Mantidactylus sp. a. multi plicatus Ca “Isalo”) and three reptiles (Lygodactylus sp. a. tuberosus Ca “Is-
alo”, Paroedura sp. a. bastardi Ca “Isalo” and P. sp. a. bastardi Ca “Ilakaka”) are currently known only from Isalo. e
unique biodiversity of the Isalo Massif was likely favoured by the conuence of dierent biomes in the area and/or its role
as a refugium during palaeoclimatic oscillations. Our study highlights the crucial importance of applying molecular taxo-
nomic identication in updating the species lists even of previously well surveyed areas, and of maintaining and increasing
museum voucher collections as a permanent and accessible testimony of the biodiversity inventory.
Key words. Dry forest, museum specimens, species survey, integrative taxonomy, candidate species, S rRNA, COI.
Introduction
Madagascar is one of the most important hotspots of bio-
diversity worldwide (M et al. , G B-
, K et al. , V et al. , A-
et al. ). e island is characterized by an incredibly
high faunal endemism rate, ranging from in birds to
in native amphibians (G V , P et
al. ), and with about non-marine squamate species
only found in Madagascar (G V , J
179
e herpetofauna of the Isalo Massif, Madagascar
et al. ). Madagascar is characterized by a strong cli-
matic heterogeneity and it is roughly divided from north
to south into a humid east and an arid west (V et al.
, B et al. ). Five broad bioclimatic zones are
currently recognized: the eastern humid rainforest belt, the
sub-humid highlands, the western dry deciduous forests,
the southwestern sub-arid spiny forests, and the montane
grasslands and shrublands (S , G et
al. , G V , V et al. ). e
climate in the western part of the island is overall hot and
dry, with a cooler-drier and a warmer-wetter season that
each last – months (G B ). is
climate supports a diversity of sclerophyllous deciduous
forests, open woodland and savannas that change in com-
position from northern subhumid areas to southern spiny
bushland (G B ). Diversity pat-
terns of the herpetofauna largely reect this subdivision,
with bioclimatic boundaries coinciding with major areas
of biotic turnover (B et al. , ). Dry decidu-
ous forest in Madagascar has been experiencing a dramatic
decrease in the last decades and, since the s, has been
reduced by almost of its original extent (W et al.
). Knowledge is limited on the fauna and ora of this
biome, and even less is known about their biology and eco-
logical interactions.
While the richness of amphibians peaks in the eastern
and northern rainforest areas (e.g., more than amphi-
bian species are known to occur in Ranomafana National
Park, in Betampona Strict Nature Reserve, and at least
in Marojejy National Park; V et al. , R et
al. , G W ), the reptiles also ex-
hibit high species richness in western and southwestern
Madagascar (R , B et al. ).
In contrast, the patterns of local endemism appear to be
distinctly higher, for both amphibians and reptiles, in the
north (D’C et al. , B et al. ).
An analysis of the herpetofaunal diversity of the dry
forests of western Madagascar (R ) has
conrmed this bioregion as an important centre for spe-
cies diversity and local endemism. At least of the is-
land’s named herpetofauna occurs in this region, with are-
as of higher habitat heterogeneity reaching distinctly high-
er species richness values (R , B
et al. , G et al. , B et al. ). For
example, in the Tsingy de Bemaraha Massif, species of
amphibians and of reptiles have been recorded, and of
these, ve amphibians and reptile species are considered
local endemics (B et al. ).
One other important area known to be highly heteroge-
neous in terms of available habitats and hosting many local
endemic species is the Isalo Massif (M et al. ).
Part of this area is included in the Parc National de l’Isalo,
established in its current borders in (G
B ). In this study we update the previously
published inventory of the amphibians of this area (M-
et al. ), and report on the known reptiles (Squa-
mata, Testudines and Crocodylia) inhabiting this area,
complementing the former, unpublished inventory on the
herpetofauna of Isalo by H (). We used an inte-
grative taxonomic approach, combining the external mor-
phology of specimens, photographs in life, and DNA se-
quences to assign collected/observed amphi bians and rep-
tiles to either described species or undescribed candidate
species. To allow these data to be as informative as possible
for a better management of the area’s unique biodiversity,
we also provide a list of the available voucher specimens
hosted in the herpetological collection of the Museo Re-
gionale di Scienze Naturali di Torino (Italy). e term ‘rep-
tiles’ is used in this study as referring to non-avian reptiles
only, i.e., in this case vertebrates in the orders Squa mata,
Testudines and Crocodylia.
Material and methods
Study site
e Isalo Massif is situated in the southwestern corner of
the Province of Fianarantsoa (Fianarantsoa Faritany) and
hosts the Parc National de l’Isalo, one of the largest pro-
tected areas of Madagascar (, ha). Elevation ranges
between and m, with narrow canyons of up to
m deep, most of which occur in the eastern and northwest-
ern sectors of the area. is area is characterized by the
presence of sandstone outcrops and rocks with a mosaic
of three main habitat types: savannas, open valleys, and
narrow canyons (M A ). Savan-
nas are expansive prairies that are repeatedly exposed to
re during the dry seasons, with isolated trees and forested
spots. Humidity is low and temperature uctuations be-
tween night and day are high. In this kind of habitat, riv-
ers and pools are usually temporary, fed by seasonal rains,
and dry for most of the year. e open valleys are usually
vegetated by gallery forests that vary in dimension. Here
the aquatic habitats consist of permanent or semi-perma-
nent torrents with both cascades and pools being present.
e montane, rocky part of the massif is intersected by
canyons of dierent dimensions and depths in which wa-
ter is present to a variable extent. In these humid canyons,
vegetation is absent or limited to few isolated trees due to
the scarcity of light. e climate is dry tropical, with
of precipitation occurring between November and March
and with mean temperatures varying between °C in June
and °C in February (M et al. ).
Survey methods
Multiple surveys were carried out in Isalo, both within and
outside the National Park limits, between and
(Fig. , Supplementary Table S). Most of our sampling
took place during the rainy season, when the activity of
most species is at its highest. Sampling was conducted op-
portunistically during both day and night, using headlamps
and hand-held torchlights, in a quest to explore all availa-
ble habitats along transects or trails and by visiting seasonal
streams and temporary ponds. Our search for amphibians
180
W C et al.
also included locating vocalising males. Locality data were
recorded using a GPS receiver (Supplementary Table S).
Most animals were photographed with analogical and/
or digital cameras to document their coloration in life and
subsequently released at the place of capture. For molecu-
lar analyses, toe clips of adult amphibians, n tips of tad-
poles, and tissue samples of reptiles were usually collected
and stored in ethanol. If individuals were suspected
of possibly belonging to new and undescribed taxa, a lim-
ited number of specimens were collected as vouchers. ey
were anaesthetized by immersion in (amphibians), or in-
jection with (reptiles) MS, followed by euthanasia with
an overdose of MS. ey were then xed in forma-
lin or ethanol and later transferred to – etha-
nol for long-term storage. e lists of tissue samples and
voucher specimens analysed for this study are provided in
Supplementary Tables S–S.
Species identication in the eld was carried out mostly
using the descriptions provided by G V (),
and additional photographic records from scientic publi-
cations. e nal inventory of amphibian and reptile spe-
cies of the Isalo Massif is given as a compilation of the work
carried out by our team and complemented by records re-
trieved from other publications for species not found by us
(G V , H , P et al. ,
C et al. , M et al. ).
Toponyms used in this study are those more consistent-
ly used in the literature (Supplementary Table S). In most
cases, anyhow, they correspond to informal local names.
Molecular species identication
Total genomic DNA was extracted from tissue samples us-
ing proteinase K digestion ( mg/ml concentration) fol-
lowed by a standard high-salt extraction method (B-
et al. ). A fragment of ca. bp of the ’ ter-
minus of the mitochondrial S rRNA gene (hereaer re-
ferred to as S), proven to be suitable for amphibian iden-
tication (V et al. a), was amplied for sam-
ples, while a fragment of around bp of the standard
barcoding region of the cytochrome oxidase I gene (COI;
N et al. ) was amplied for reptile samples. For
three amphibian samples, it was not possible to amplify the
S fragment, and in these instances other mitochondri-
al gene fragments were used, i.e., S ’ terminus, or cyto-
chrome b (Cytb). e molecular taxonomic identication
using the COI fragment was not possible for some reptile
species due to missing reference sequences. In these in-
stances, other mitochondrial gene fragments (S, ND,
ND, ND, Cytb) were used for identication (see Supple-
mentary Table S and S for details and GenBank acces-
Figure 1. Maps of the study area with all sampling localities for both amphibians and reptiles. Andravaka not included because GPS
data were not available and this site could therefore not be georeferenced unambiguously.
181
e herpetofauna of the Isalo Massif, Madagascar
sion numbers of newly determined sequences [KX–
KX, MH–MH], and Supplementary
Table S for primers and cycling protocols). All fragments
were sequenced using an ABI XL automated sequenc-
er at Macrogen Inc. Chromatograms were checked and se-
quences were manually edited where necessary, using the
sequence alignment editor of BioEdit (V...; H ).
To assess taxon identity, sequences of each morpholog-
ically identied taxon were compared among each other
and each sequence was compared using the Basic Local
Alignment Search Tool (BLAST, http://blast.ncbi.nlm.nih.
gov/Blast.cgi, A et al. ) with all homologous
sequences available in GenBank http://www.ncbi.nlm.nih.
gov/GenBank/), using the nucleotide blast (nblast) option
with default parameters. Average genetic distances within
and between species were calculated by uncorrected pair-
wise genetic distance estimations (uncorrected p-distance)
using MEGA (K et al. ; Supplementary Table
S and S).
Some specimens could not be assigned to any described
or identied candidate species (V et al. , P
et al. , N et al. ). For these taxa, we applied
the terms and abbreviations, conrmed candidate spe-
cies (CCS), unconrmed candidate species (UCS), or deep
conspecic lineage (DCL) as dened by V et al.
(). Our denominations of already identied candidate
species follow P et al. () for amphibians and N
et al. () for reptiles, although we decided to comple-
ment these working names with information on the mor-
phologically closest described species by prexing the spe-
cies epithet with “sp. a.” and a descriptor of the locality
from where the taxon is known (this toponym was added
in cases of species known only from Isalo) or of a charac-
teristic trait of the candidate species.
Candidate species of amphibians were identied based
on a threshold of minimum divergence for the S
gene fragment (see also V et al. b, F et
al. , V et al. ). Candidate species of reptiles
were identied following the dierent thresholds proposed
for the dierent groups by N et al. (). e sequenc-
es of the other gene fragments were used to rene species
identication within a known species group and there was
no need to apply a minimum threshold.
In this study, we also provide updated distribution-
al range information within the Isalo Massif for amphi-
bians based on locality records from museum specimens,
molecular data, GenBank, and literature (mostly G
V , M et al. ; Supplementary Table
S). For reptiles, the distribution of each species includes
locality records from museum specimens, molecular data,
GenBank, and literature (mostly G V ,
H ; Supplementary Table S).
Museum specimens
Most of the specimens collected during our multiple sur-
veys in Isalo have been deposited in the herpetological col-
lections of the Museo Regionale di Scienze Naturali (Turin,
Italy) and the Parc Botanique et Zoologique de Tsimbazaza
(Antananarivo, Madagascar). We refer to these specimens
using their collection numbers preceded by acronyms
MRSN and PBZT, respectively. In addition to these, we
provide taxonomic information on some additional speci-
mens hosted in various collections. For these records, we
use their catalogue numbers preceded by their institution
acronyms (SMF, Senckenberg Museum Frankfurt, Germa-
ny; UADBA, Université d’Antananarivo, Mention Zoolo-
gie et Biodiversité Animale, Antananarivo, Madagascar;
ZMA, Zoölogisch Museum Amsterdam, e Netherlands
(collections currently in the process of being integrated
in the Naturalis Biodiversity Center of Leiden); UMMZ,
Museum of Zoology at the University of Michigan; ZSM,
Zoologische Staats samm lung München, Germany). Field
number acronyms are FAZC (Franco Andreone Zoologi-
cal Collection) and ACZCV (Angelica Crottini Zoological
Collection Voucher). In instances where specimens have
already been deposited in institutional collections, but are
not yet catalogued, they are given as FAZC/MRSN (for
specimens in Turin) and FAZC/PBZT (for specimens in
Antananarivo), respectively.
Specimens hosted in the MRSN collection (Supplemen-
tary Table S and S) were visually inspected and their tax-
onomic identication was reassessed based on the results
obtained in this study. A careful morphological inspection
and verication of diagnostic traits was performed when
molecular data were insucient to conrm species iden-
tity.
Results
In total, amphibian and reptile species were record-
ed in Isalo by combining all available data sources, and we
here provide DNA sequences for almost all of these spe-
cies. Like M et al. (), we failed to detect in
the eld Scaphiophryne menabensis that, at the moment,
remains known from the area by a single voucher speci-
men (UMMZ , University of Michigan, Museum of
Zoology: V et al. , G et al. ).
Among the amphibians, taxa () belong to the
family Mantellidae while six () are Microhylidae.
Hyperoli dae and Ptychadenidae are present with only one
species each. We conrm the presence of (out of the )
amphibian species listed by M et al. () and
provide evidence for the occurrence of one new candidate
species (Mantidactylus sp. a. multiplicatus Ca “Isalo”).
We also report two new amphibian distribution records
(Mantella sp. a. expectata “South” and Scaphiophryne sp.
a. calcarata Ca) compared to the previous inventories
of the area. Four of the amphi bian species and one can-
didate species seem to be Isalo endemics: Gephyro mantis
azzurrae, Mantella expectata, Scaphiophryne gottlebei,
Mantidactylus noralottae and M.sp. a. multiplicatus Ca
“Isalo”. In this study, Gephyromantis corvus is tentatively
not considered microendemic to Isalo, because there is a
182
W C et al.
record of this species from the Makay Massif (R-
G ), even though this record is in
need of conrmation and might turn out to represent a dif-
ferent species of the subgenus Phylacomantis. Finally, we
report new locality records for ten amphibian taxa with-
in the Isalo Massif: Scaphiophryne sp. a. calcarata Ca,
Dysco phus insularis, Boophis occidentalis, Laliostoma labro-
sum, Blommersia sp. a. wittei Ca “Isalo”, Gephyromantis
corvus, G.azzurrae, Mantidactylus sp. a. ulcerosus Ca
“Isalo”, M. noralottae, and M. sp. a. cowani Ca “small”
(see Supplementary Table S).
Our molecular and morphological analyses of speci-
men MRSN A (part of the type series of G. azzurrae
M A ) suggest this specimen was
wrongly assigned to G. azzurrae and we here propose to re-
fer it to G. corvus (Fig. , Supplementary Table S and S).
is specimen was not analysed genetically by M
A () when describing G. azzurrae and was
erroneously assigned to this species.
e reptile species of Isalo belong to of the fami-
lies known from the island (Supplementary Table S and
S). Most abundant are Gekkonidae and Lamprophiidae,
which are represented by and species, respectively (or
and of the total). Isalo represents an expansion of
the known range for six taxa (Crocodylus niloticus, Paroe-
dura sp. a. bastardi Ca “Marofandilia/Miandrivazo”,
Trachylepis gravenhorstii lineage b, O. saxicola, Lycodr-
yas guentheri, and L. sp. Ca “Andohahela”). A total of six
species are probably undescribed (Lygodactylus sp. a. pic-
tus Ca “Isalo”, L. sp. a. tuberosus Ca “Isalo”, Paroedura
sp. a. bastardi Ca “Marofandilia/Miandrivazo”, P. sp a.
bastardi Ca “Isalo”, P. sp. a. bastardi Ca “Ilakaka”, and
L. sp. a. pseudo granuli ceps Ca “Andohahela”); of these,
three taxa are known only from here and might be micro-
endemic to this massif (Lygodactylus sp. a. tuberosus Ca
“Isalo”, Paro edura sp. a. bastardi Ca “Isalo”, and P. sp.
a. bastardi Ca “Ilakaka”). Note that Lygodactylus sp. a.
pictus Ca “Isalo” is excluded from this list, because in this
study we report this taxon also from the nearby Zombitse-
Vohibasia National Park (details follow). Beside these, the
only other reptile species endemic to Isalo is Trachylepis
nancy coutuae.
To c om p l em e n t t h e w or k o f M et al. (), we
here report on the distribution, habitat preferences, and in-
traspecic genetic variability of the new amphibian candi-
date species Mantidactylus sp. a. multiplicatus Ca “Is-
alo” and the newly recorded Scaphiophryne sp. a. calcara-
ta Ca and Mantella sp. a. expectata “South”, and subse-
quently provide an annotated species list of the Isalo reptiles.
Species accounts
Amphibians
Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca
“Isalo” (UCS)
Fig. A
Locality records: Andohasahenina (MRSN A), Andriamane-
ro (MRSN A, MRSN A, ACZCV –), Namazaha
Valley (also referred to as Namaza) (MRSN A, MRSN A,
MRSN A, MRSN A), Piscine Naturelle.
is undescribed species represents a new record for
Madagascar and could represent a new example of micro-
endemism in Isalo. is lineage is phylo genetically close to
M.multiplicatus, M. sp. a. betsilea nus Ca “Tolagnaro”,
M. sp. a. betsileanus Ca “Andohahela”, and the sym-
patric M. noralottae. Note that a formal resurrection of
M.multiplicatus B, is still needed, but this
species name was already used by P et al. () an-
ticipating an upcoming taxonomic revision. e genetic
distance between M. sp. a. multiplicatus Ca “Isalo” and
all the other species of the aforementioned group is ca.
(S). is UCS represents the third Brygoomantis from
Isalo, with the other two being M. noralottae and M.sp.
Figure 2. Two new amphibian records from the Isalo region: A) An adult male of Mantidactylus sp. a. multiplicatus Ca65 “Isalo”
(FAZC 14351) in dorsolateral view from Piscine Naturelle, Petit Nazareth (30 November 2009, not collected); B) adult Scaphiophryne
sp. a. calcarata Ca02 (MRSN A6895) in dorsolateral view from Ranohira (22 January 2011).
183
e herpetofauna of the Isalo Massif, Madagascar
Figure 3. Diversity of Mantella species and corresponding morphotypes found in the Isalo Massif: A) Individual of M. expectata
from Sakavato with typical coloration (MRSN A5204); B) individual of M. expectata from Malaso with darker limbs; C) individual of
M.expectata from Antambonoa with a contrasting reddish lower back. is is a rather common coloration in M. expectata populations
from the northern section of the Isalo National Park (C et al. 2008) (B–C photos not reliably referable to certain vouchers,
but conrmed by molecular means as M. expectata following C et al. 2008); D–E) individuals from Sakavato represent-
ing the M.sp. a. expectata ”South” mitochondrial lineage (already known from Tranomaro and Tsingy de Bemaraha) (D: MRSN
A5222; E:MRSN A5230), note the typical M. expectata coloration of MRSN A5222 and the intermediate (M. expectata/M. betsileo)
chromatic traits of MRSN A5230; F) individual of M. betsileo from Andriamanero with a typical M. betsileo colour pattern (photo
not reliably referable to a certain voucher but conrmed by molecular means as M. betsileo); G–H) individuals of M. betsileo from
Sakavato (G:FAZC 12825) and Karofoty (H: photo not reliably referable to a certain voucher but conrmed by molecular means as
M. betsileo following G et al. (in prep.)) exhibiting dierent levels of intermediate (M. expectata and M. betsileo) chromatic
traits; I)ventral side of M. betsileo (FAZC 12825 as in G); and J) ventral side of M. expectata (MRSN A5204 as in A) exhibiting no
distinctive dierences in the ventral colour pattern.
a. ulcerosus Ca “Isalo”. New surveys followed up with
molecular taxonomic identication of the samples will be
needed to dene its extent of occurrence in Isalo due to
its supercial morphological similarity with M. noralottae.
Scaphiophryne sp. a. calcarata Ca (CCS)
Fig. B
Locality record: Ranohira (MRSN A).
e name S. calcarata (M, ) has not yet been
unequivocally assigned to any population of Scaphio-
phryne, and three deeply divergent mitochondrial lineag-
es exist in Madagascar: S. sp. a. calcarata Ca (or S.sp.
a. calcarata B; known from Tolagnaro and Berenty), S. sp.
a. calcarata Ca (or S. sp. a. calcarata A; known from
Kirindy and Menabe) (terminology follows V et
al. [] and P et al. [], respectively), and S. sp.
a. calcarata Ankarafantsika (P et al. ). S. sp. a.
calcarata Ca was previously reported as S. calcarata by
M et al. (), and we here also report the occur-
rence of S. sp. a. calcarata Ca (S p-distance between
populations from Kirindy and Isalo ca. ), revealing Is-
alo as a contact zone between these two taxa. e molecu-
lar divergence between S. sp. Ca and S. sp. Ca (ca. ;
S) is supported by bioacustic data (calls from Kirindy
and Berenty are highly divergent, G V []),
but no calls are known from Ankarafantsika or Isalo. e
population from Ankarafantsika shows a genetic dis-
184
W C et al.
tance (S) to populations of both Kirindy and Isalo and
ca. from populations from Berenty and Tolagnaro.
Mantella sp. a. expectata “South” (DCL)
Figs D–E
Locality record: Sakavato (MRSN A, MRSN A).
is lineage was already known from Tranomaro (in the
southeast) and Bemaraha in the west (R
et al. ). e S sequences of these two individuals
(EF–EF) were already published (C
et al. ) and released in GenBank as M. cf. expectata/
betsileo. Interestingly, individual MRSN A was une-
quivocally identied as M. expectata (see Fig. D) due to its
coloration, whereas MRSN A exhibits chromatic traits
that are intermediate between M. expectata and M. betsileo
(see Fig. E). ese samples have a genetic distance (S) of
ca to both M. betsileo and M. expectata, whose interspe-
cic genetic distance is only about . (see Supplemen-
tary Table S for more details). In general, Mantella spe-
cies are genetically poorly dierentiated from each other
(S et al. ), and the taxonomy of Mantella sp.
a. expectata “South” remains dicult, although prelimi-
nary phylogeographic analyses suggest it might deserve to
be treated as an independent taxon (unpublished data). It
is likely that a more robust study of the validity of this line-
age will be possible only when more samples are available.
Reptiles
PELOMEDUSIDAE
Pelomedusa subrufa (L, )
Fig. A
Locality records: Ambatovaky (MRSN R), Zahavola (MRSN
R), Isalo (no precise locality).
is species is the most common freshwater turtle in
Madagascar and widely distributed from the Sahamala-
za Peninsula in the northwest (P et al. ) to all
of the southwest. Pelomedusa subrufa is generally found
in stagnant water bodies and temporary ponds. In Isalo,
it was found in Ambatovaky and Zahavola in slow-ow-
ing streams, and it was previously reported from here by
H ().
CROCODYLIDAE
Crocodylus niloticus L,
Fig. B
Locality records: Ranohira (FAZC /PBZT-uncatalogued).
e species was found in the Ianakandrarezo River (vis-
ual record by PEB and GMR) and the Hazofotsy River in
Ranohira. Subfossil remains of C. niloticus are known from
Ampoza (G J ). is site is close
to the Analavelona Massif, which is located at a short dis-
tance (around km) west of Isalo. However, with the re-
cent recognition of the genus Voa y B, the iden-
tication of these remains requires reassessment (B
, G J ). e two records from
the Ranohira area represent the rst reliable report of the
Nile crocodile from the Isalo Massif. Although occasion-
ally hunted by local people, the species seems to be so se-
cretive in the area that there is no information about the
behaviour and ecology of the Isalo populations.
CHAMAELEONIDAE
Brookesia brygooi R N,
Fig. A
Locality records: Namazaha Valley (MRSN R), Isalo (no pre-
cise locality).
Figure 4. Gephyromantis azzurrae (M A, 2007), paratype MRSN A5313 (A, lateral view in life; B, dorsal and ventral
views in preservative), here genetically and morphologically reassigned to G. corvus.
185
e herpetofauna of the Isalo Massif, Madagascar
Brookesia brygooi belongs to the Brookesia decaryi group,
which includes aridity-adapted species that live within the
dry-deciduous forests on the western slope of the central
high plateau of the island (T et al. ). It inhab-
its the leaf litter stratum during the day and is found resting
on low vegetation during the night. It can be quite dicult
to observe in Isalo, although there is a record of one event
in which several individuals were sampled in one single
night (S. N, pers. comm.) is population is ge-
netically similar to the populations of B. brygooi at Kirindy
with which it shares a distinctive lineage when compared
to B. brygooi from Ankarafantsika (C et al. ).
Furcifer major (B, )
Fig. B
Locality records: Andranomena (MRSN R), Malaso, Rano-
hira (MRSN R), Zahavola (MRSN R–R), Isalo (no
precise locality).
is taxon was formerly considered a large-sized subspe-
cies of Furcifer lateralis (B , K B
) inhabiting the arid southwestern region of Mada-
gascar. A recent taxonomic revision of the carpet cha-
meleons elevated this taxon to species rank (F et
al. ), which therefore also applies to specimens from
Isalo. H () reported this taxon as F. lateralis.
e samples analysed in this study are genetically simi-
lar to each other (Supplementary Table S) whereas they
have a genetic distance at the COI fragment of ca. – to
F.viridis, – to F. lateralis, and ca. – to sympatric
F.oustaleti and F. verrucous.
Furcifer oustaleti (M, )
Fig. C
Locality records: Analalava Forest, Bereketa (MRSN R),
Namazaha Valley.
A recent phylogeographic analysis revealed the presence of
two distinctive lineages within this species, but refrained
from formally describing a new species based on the still-
limited evidence available (F R ).
e populations from Isalo belong to F. oustaleti Clade D
sensu F R () and are genetically
uniform for the marker analysed (Supplementary Table
S).
Furcifer verrucosus (C, )
Fig. D
Locality records: Piscine Naturelle, Sakavato (MRSN R,
MRSN R).
Slightly smaller, F. verrucosus can be easily mistaken for
F. oustaleti that also widely overlaps its distribution range.
Furcifer verrucosus is quite common in disturbed areas al-
though it can be found in a wide array of habitats at sites be-
low m a.s.l. (R R ).
A recent phylogeographic analysis revealed the presence of
a western and an eastern lineage (F R
). e Isalo population belongs to F. verrucosus Clade
B sensu F R (), and the analysed
samples from Isalo exhibit a genetic variability of .
(COI; Supplementary Table S) between each other.
GEKKONIDAE
Blaesodactylus sakalava (G, )
Locality record: Isalo (no precise locality).
In Isalo, this species is currently known from a record
made by H () and a photographic record avail-
able online (ickriver, Pete Read: http://www.ickriver.
com/photos/@No//). No molecular
data from Isalo are available for this species.
Figure 5. Chelonian and a crocodilian species found in the Isalo Massif: A) Pelomedusa subrufa (MRSN R3737) from Zahavola in life;
B) Crocodylus niloticus preserved specimen (FAZC 14784, PBZT-uncatalogued) from Hazofotsy River (Ranohira).
186
W C et al.
Figure 6. Photos in life of lizard species recorded in the Isalo Massif: A) Brookesia brygooi (ACZC 2569) from the Namazaha Val-
ley; B) Furcifer major (FAZC 14640) from Zahavola; C) Furcifer oustaleti from the Analalava Forest (photo not reliably referable
to a certain sample or voucher); D) F. v e rr u co s us from circuit Piscine Naturelle (photo not reliably referable to a certain sample or
voucher); E) Hemidactylus mercatorius (ACZC 1945) from the Namazaha Valley; F) Lyg od ac ty lu s sp. a. tuberosus Ca02 (MRSN
R3746) from Malaso; G) Paroedura picta from Zahavola (photo not reliably referable to a certain sample or voucher); H) P. sp.
a. bastardi Ca01 (FAZC 14631) from Zahavola; I) P. sp. a. bastardi Ca03 from Ilakaka (photo not reliably referable to a certain
sample or voucher); J) P. vahiny (MRSN R3748) from Malaso; K) Phelsuma hielscheri from Piscine Naturelle (tissue sample not
collected); L) P. m u t a b i l i s from the Namazaha Valley (tissue sample not collected); M) P. s t a n d i n g i from Isalo (no precise locality,
tissue sample not collected); N) Zonosaurus laticaudatus (MRSN R3213) from the Canyon des Makis; O) Z. madagascariensis from
Andranonombilahy (tissue sample not collected); P) Z. karsteni from Analamangabe (tissue sample not collected); Q) Chalarodon
madagascariensis from Ilakaka (tissue sample not collected); R) Oplurus cyclurus from Malaso (photo not reliably referable to a
certain sample or voucher); S) O. quadrimaculatus from Zahavola (tissue sample not collected); T) O. saxicola (photo not reliably
referable to a certain sample or voucher) from Sakavato; U) Tra chy le pi s e leg an s from the Namazaha Valley (tissue sample not
collected); V) T. gr av en h or st ii from the Namazaha Valley (tissue sample not collected); W) T. na nc yc ou tu a e from the Namazaha
Valley (tissue sample not collected).
187
e herpetofauna of the Isalo Massif, Madagascar
Geckolepis typica G,
Locality records: Analalava Forest (UMMZ –), Be-
reketa (UMMZ –), Sahanafa (UMMZ ), Isalo
(no precise locality).
e only specimens of this taxon from Isalo are those in
the collection of the Museum of Zoology at the Univer-
sity of Michigan, but another record stems from H
(). As for Isalo, neither molecular data nor informa-
tion on its habitat are available.
Hemidactylus mercatorius G,
Fig. E
Locality records: Analalava Forest (MRSN R–R), Mala-
so (FAZC /PBZT-uncatalogued), Namazaha Valley, Rano-
hira – Motel d’Isalo, Zahavola.
Hemidactylus mercatorius is one of the few non-endemic
squamate species of Madagascar, being present and wide-
ly distributed in eastern Africa and on many islands of
the Indian Ocean. Samples from Isalo belong to the most
common haplotype, occurring both in the Sambirano and
northeast, and in the southern central east, southeast, and
south (V et al. ). e analysed populations ex-
hibit an average genetic variation of . (COI; Supple-
mentary Table S) between each other.
Lygodactylus sp. a. pictus Ca “Isalo” (UCS)
Locality record: Analalava Forest (ZMA ).
is genus still contains several undescribed species (P
et al. , , M et al. ). Isalo lineage was
previous reported by P et al. () and refers to a
specimen deposited in the collection of the Naturalis Bio-
diversity Center, Leiden (e Netherlands), collected in the
Analalava Forest. It is morphologically similar to L.pictus
although genetically it has at least genetic distance to
all other species of Lygodact ylus for which S sequences
are currently available. For comparison, we sequenced the
S and COI fragment (S: MH–MH, COI:
MH–MH) of a recently collected specimen
of Ly god ac tyl us sp. a. pictus Ca “Isalo” from the Forêt de
Vohibasia (Zombitse-Vohibasia National Park) and the S
fragment proved to be identical to the S sequence of
this taxon collected in the Analalava Forest (P et al.
; AY). is lineage is therefore currently known
at least from Isalo and Zombitse-Vohibasia.
Lygodactylus sp. a. tuberosus Ca “Isalo” (UCS)
Fig. F
Locality records: Malaso (MRSN R, MRSN R).
is candidate species is identied here for the rst time.
e analysed specimens were found in open grassland
near canyon entrances and rocky microhabitat in Malaso.
Morphologically, this taxon is quite similar to L. tubero-
sus. e genetic distance between L. tuberosus from Ifaty
(MH) and this UCS from Isalo is ca. at the ana-
lysed COI fragment. e genetic distance in S between
this UCS and the syntopic Lygodactylus sp. a. pictus Ca
“Isalo” is ca. , and ca. to L. tuberosus from Toliara
and Belalanda (e.g., AY, LN).
Paroedura picta (P, )
Fig. G
Locality records: Andriamanero, Zahavola.
is ground-dwelling species is typically found in the dry
forests or on sandy substrate in spiny scrub vegetation of
southern Madagascar (G V ). Within
Isalo, it is commonly encountered in open savannah areas.
e samples here analysed have a genetic distance of
(S) to P. picta from Kirindy (AF) and only to
P. picta from the Toliara region (GU). In the COI
fragment analysed, the samples of P. picta from Isalo have
ca. – genetic distance to other P. picta from the pet
trade or from Isalo (KR and JQ, respective-
ly), and ca. distance to another P. picta from the pet
trade (KM), therefore suggesting the existence of a
complex of cryptic species.
Paroedura sp. a. bastardi Ca “Marofandilia/Miandriva-
zo” (UCS)
Fig. H; Fig. A
Locality records: Zahavola (MRSN R, MRSN R), Nama-
zaha Valley (MRSN R), Isalo (no precise locality, MRSN
R).
is UCS belongs to the P. bastardi species complex, which
contains several undescribed species (J et al. ,
A et al. , G et al. ). It was found within
the canyon in a shaded area close to the stream where hu-
midity was high due to the presence of a small cave and a
waterfall. It was already known from Marofandilia and Mi-
andrivazo, and the S genetic distance of the Isalo popula-
tion to these other populations is – (GU, Maro-
fandilia and GU, Miandrivazo; A et al. ).
Paroedura sp. a. bastardi Ca “Isalo” (UCS)
Locality records: Malaso, Zahavola (FAZC /PBZT-uncata-
logued).
is UCS also belongs to the P. bastardi species complex.
In , individuals belonging to this taxon were found on
188
W C et al.
rocky surfaces in open areas in close proximity to the Mu-
seum of the Isalo National Park, next to the Zahavola can-
yons (where also Paroedura sp. a. bastardi Ca “Maro-
fandilia/Miandrivazo” occurs). Other individuals were
observed in open grassland near canyon entrances and in
rocky microhabitats. ese two sympatric lineages (Paro-
edura sp. a. bastardi Ca “Marofandilia/Miandrivazo”
and Paroedura sp. a. bastardi Ca “Isalo”) are geneti-
cally highly dierentiated, with values of uncorrected p-
distance at the analysed COI and S gene fragment of ca.
(Supplementary Table S) and , respectively. e
analysed samples from Isalo are divergent (COI) from
P.bastardi from Toliara (JQ, N et al. ).
Paroedura sp. a. bastardi Ca “Ilakaka” (UCS)
Fig. I; Fig. B
Locality records: Ilakaka, Kazofoty (MRSN R), Isalo (no pre-
cise locality, MRSN R, MRSN R–R).
is is another UCS of the P. bastardi species complex that
is present in Isalo. is taxon was already known from pre-
vious work (A et al. ), and the genetic distance of
this taxon to co-occurring species of the P. bastardi com-
plex is (COI, Supplementary Table S), (S) to
P.sp. a. bastardi Ca “Marofandilia/Miandrivazo”, and
(COI, Supplementary Table S) and (S) to P. sp.
a. bastardi Ca “Isalo”, respectively. e genetic distance
between dierent samples of this species is ca. at the
analysed S fragment (GU, A et al. ).
Paroedura vahiny N R,
Fig. J
Locality records: Andohasahenina (MRSN R), Malaso
(MRSN R), Isalo (no precise locality).
is poorly known species is characterized by having an
overall smooth appearance, determined by the presence of
small and scattered tubercles and numerous small scales
on both body and head. In his report, H () list-
ed P. androyensis for Isalo National Park, but this record
almost certainly refers to P. vahiny, described few years af-
ter. In contrast to the holotype of P. vahiny that was found
on a plant stem in the forest, this taxon was found on the
ground in Isalo. It exhibits a genetic distance, at the COI
fragment, of ca. – to all the other syntopic species of
Paroedura (Supplementary Table S), but the lack of a COI
reference for P. vahiny from the type locality prevents us
from assigning these samples on a molecular basis. Simi-
larly, for the S gene fragment, samples of this taxon are
– similar to almost all other Paroedura species. We
here refer to this taxon as P. vahiny pending conrmation
by means of a molecular comparison with samples from
the type locality.
Phelsuma hielscheri R, O S,
Fig. K
Locality records: Ranohira, close to Isalo Ranch (N et al.
), Petit Nazareth Valley, Piscine Naturelle, Zahavola (MRSN
R), Isalo (no precise locality, ZSM /).
Phelsuma hielscheri is a regionally endemic species of
southwestern Madagascar that belongs to the P. d u b i a
group (R et al. ). is species is so far known only
from a few localities such as Kirindy, Morondava and Isalo.
Phelsuma hielscheri is quite dicult to observe in Isalo. In-
dividuals were spotted during the daytime, active on Pan-
danus sp. leaves. Only one specimen was collected in Za-
havola from which no DNA sequences could be obtained.
Phelsuma mutabilis (G, )
Fig. L
Locality record: Namazaha Valley.
Phelsuma mutabilis is distributed along the southern and
western Madagascar coasts up to Ankarafantsika in the
northwest (C et al. ). is species in known
to inhabit both natural and anthropogenic areas and is
adapted to live in dierent environments such as trees and
bushes, but also on walls of buildings or fences. In Isalo, a
representative of this species was observed in the Nama-
zaha Valley where it was basking on a tree trunk (A. C-
, pers. obs.). P. mutabilis exhibits an intraspecic ge-
netic distance of . across Madagascar (S, C
et al. ). e analysed sample from Isalo conrms this
intraspecic variability by showing a genetic distance rang-
ing from to (S) to other populations (Toliara, Ejeda,
Antsalova: R et al. ; Beroroha, Makay: S et
al. ).
Phelsuma standingi M H,
Fig. M
Locality records: Ranohira, Isalo (no precise locality).
Phelsuma standingi is a large species of day gecko with un-
resolved phylogenetic relationships (R et al. ,
), occurring only in the arid spiny forest of southwest-
ern Madagascar. Like P. hielscheri, P.standingi is quite rarely
seen in Isalo and our surveys did not yield any new obser-
vations. e only DNA sequence available for this species
from Isalo refers to a published record (S, DQ), of
which the locality is given as “South of Isalo” (S et al.
). erefore, it might actually refer to the Zombitse-
Vohibasia National Park, where we have observed the spe-
cies as well, rather than to the Isalo Massif itself. On the
other hand, B K () reported on a visu-
al record of this species in Ranohira.
189
e herpetofauna of the Isalo Massif, Madagascar
GERRHOSAURIDAE
Tracheloptychus madagascariensis P,
Locality record: Isalo (no precise locality).
is taxon was reported from Isalo by B (). No
molecular data from Isalo are available for this species.
Zonosaurus laticaudatus (G, )
Fig. N
Locality records: Canyon des Makis (MRSN R), Isalo (no pre-
cise locality, FAZC /MRSN R-uncatalogued).
In Isalo, this species was observed in forested habitat in-
side large canyons. e analysed samples suggest a close
relationship to Z. laticaudatus from Tsingy de Bemaraha
( for COI, JQ; for the S fragment, KC;
N et al. , R et al. ).
Zonosaurus madagascariensis (G, )
Fig. O
Locality records: Andranonombilahy, Canyon des Makis (MRSN
R).
In contrast to Z. laticaudatus, this species is mostly dis-
tributed in eastern Madagascar, although there are areas
in the northwest where these two species co-occur. In Is-
alo, the observed individuals were found in forested habi-
tat inside or at the entrance of large canyons. e samples
analysed show a genetic distance of ca. – to Z. mada-
gascariensis from Tsingy de Bemaraha (JQ) and
Mahasoa (JQ), and to specimens from Maro-
jejy (JQ) (COI). At the S fragment, Z. madagas-
cariensis from Isalo is only divergent from the clos-
est sister species, Z. haraldmeieri from the Forêt d’Ambre
(KC). More in-depth analyses will be needed to as-
sess whether Z. haraldmeieri is a chromatic variant of
Z.madagascariensis or represents a true sister species of re-
cent divergence (R et al. , R
et al. , B et al. ).
Zonosaurus ornatus (G, )
Locality record: Isalo (no precise locality).
Not encountered during our surveys, but reported from Is-
alo by G V (), where it was observed in
open grasslands. is visual record is in need of conrma-
tion, as no photographic or physical voucher is available,
and we cannot exclude this record was mistaken, e.g., by
confusion with an unusually colored Z. karsteni. No mo-
lecular data from Isalo specimens are available.
Zonosaurus karsteni (G, )
Fig. P
Locality records: Analamangabe, Ranohira Bas (FAZC /
PBZT-uncatalogued), Isalo (no precise locality).
is species is currently known from fragmented and geo-
graphically distant populations in the dry forests of west-
ern Madagascar (G V ). It has been re-
ported before in Isalo by H (). e populations
of this species analysed so far (Andranomanintsy, Bema-
raha, Kirindy, Lambokely, Mikea, and Petriky) show a
low phylo geographic substructure (R et al.
). Zonosaurus karsteni from Isalo conrms this pat-
tern in that the samples had a genetic distance at both the
S and ND fragment of only to Z. karsteni from To-
liara and Mikea-Ankindranoka.
OPLURIDAE
Chalarodon madagascariensis P,
Fig. Q
Locality records: Analalava Forest (UADBA ), Antambonoa
(MRSN R–R), Canyon des Makis (MRSN R), Ilaka-
ka, Vohimaro (FAZC /PBZT-uncatalogued), Isalo (no pre-
cise locality, MRSN R–R).
is species was encountered in Vohimaro aer it was al-
ready reported from this area (H ) and Anala-
lava (M et al. ). Samples from Isalo are
genetically more similar to the population of C. mada-
gascariensis at Tsingy de Bemaraha (in the central west)
than to the geographically closer populations at Toliara
(M et al. ).
Oplurus cyclurus (M, )
Fig. R
Locality records: Analalava Forest (ZSM /-/),
Andohasahenina (MRSN R), Andranomena (MRSN R),
Antambonoa (MRSN R), Malaso (MRSN R).
Oplurus cyclurus is a largely arboreal and rupicolous igua-
na that can be easily identied by its tail bearing enlarged
spines (G V ). In Isalo, specically in the
Analalava Forest, two mitochondrial lineages with a genet-
ic distance of up to at the S occur (M
et al. ). Our samples of O. cyclurus from Malaso are
genetically uniform for both S and COI (Supplementary
Table S) and equally divergent (; S) from the samples
of both clades present in the Analalava forest.
Oplurus grandidieri M,
Locality record: Antoha (MRSN R).
190
W C et al.
Only one specimen of Oplurus grandidieri was collect-
ed in Isalo. It exhibits a genetic distance of to a sam-
ple of O. grandidieri from Zazafotsy (S; EU;
M et al. ) and of from two samples
from the pet trade (COI, KM – A et al.
; AB, O K ). Oplurus
grandidieri has a low genetic divergence compared to
O. erinensis (S, c-mos uncorrected p-distances = .
and , respectively; M et al. ), and ac-
cording to our data, the COI distance is compared to a
specimen of O. erenensis from Toliara; JQ, N
et al. ).
Oplurus quadrimaculatus D,
Fig. S
Locality records: Andohasahenina (MRSN R), Andranom-
ena (MRSN R–R, MRSN R), Malaso (FAZC /
MRSN R-uncatalogued), Zahavola, Isalo (no precise locality,
MRSN R–R).
is species lives throughout the arid areas of southwest-
ern Madagascar, but can also be found in the drier parts of
the central highlands up to m a.s.l. (Ibity Massif) and
near the rainforest in the Tolagnaro area (G V
). In Isalo, it was collected in Malaso, but, in contrast
to O. cyclurus, which is more arboreal, this relatively com-
mon species was found on large rocks and boulders. is
taxon was previously recorded by H (). Oplu-
rus quadrimaculatus is known to comprise two well-sup-
ported clades, one representing the highland populations
(Antoetra, Ambositra, and Andringitra) and the other one
the southern populations (Toliara, Tolagnaro, Andohahe-
la, and Tranoroa) (M et al. ). e pop-
ulation at Isalo belongs to the southern lineage, and one
sample exhibits a distance (S) to this southern line-
age. At the COI fragment, O. quadrimaculatus from Isalo
shows a genetic distance of to samples from Andohahe-
la (JQ).
Oplurus saxicola G,
Fig. T
Locality record: Sakavato (MRSN R–R).
is rock-dwelling species inhabits the south of Madagas-
car (G V ). In Isalo, it has been found only
in Sakavato, and this represents the rst observation in this
area. Like O. quadrimaculatus, O. saxicola appears to com-
prise two divergent lineages: one in the southeast (Esomo-
ny, from where a new species of Chalarodon has recent-
ly been described; M et al. ), and one in the
southwest (M et al. ). e sample from
Isalo belongs to this last clade from the southwest, from
which it diers by (S), while it exhibits (S) di-
vergence from the sample from Esomony.
SCINCIDAE
Grandidierina rubrocaudata (G, )
Locality record: Isalo (no precise locality).
is taxon was reported for Isalo by B (). No
molecular data are available for this species from Isalo.
Trachylepis elegans (P, )
Fig. U
Locality records: Andohaosy (MRSN R), Andranombilahy
(MRSN R), Andranomena (MRSN R), Malaso, Nama-
zaha Valley, Ranohira – Motel d’Isalo, Vallee du Petit Nazareth
(MRSN R), Zahavola (MRSN R), Isalo (no precise local-
ity, MRSN R).
In Isalo, individuals were found in open grasslands and out-
side canyons, where they are oen seen basking on rocky
surfaces. A recent preliminary analysis of the genetic vari-
ability of this species across its distribution identied four
genetic lineages (V et al. ). e analysed samples
from Isalo are genetically homogeneous (., Supple-
mentary Table S) and belong to the most widespread line-
age of T. elegans, the lineage A sensu V et al. ().
Trachylepis gravenhorstii (D B, )
Fig. V
Locality records: Sambalahy (Andriamanero), Malaso (FAZC
/MRSN R-uncatalogued), Namazaha Valley (MRSN R),
Ranohira, Zahavola (MRSN R).
Trachylepis gravenhorstii can be found both in the ground
and on tree trunks (G V ), but not inside
canyons. In Isalo, we identied two dierent lineages, a
and b (sensu V et al. ), with a genetic distance
at the analysed COI fragment of between each other. As
far as we know, lineage a was found only in the village of
Ranohira, whereas lineage b occurred in at least two lo-
calities within the Massif (Malaso and Zahavola). Molec-
ular taxonomic identication of the individuals collected
in the Namazaha Valley was not possible. e presence of
T.gravenhorstii lineage b in Isalo represents a new distri-
butional record for this lineage.
Tra ch yl epi s nan cy co ut uae (N R, )
Fig. W
Locality records: Andranomena (MRSN R), Bemenara
(MRSN R), Bevato, Malaso (FAZC /PBZT-uncata-
logued), Namazaha Valley, Zahavola (MRSN R).
is skink species is endemic to Isalo, inhabiting rocky
substrates including large boulders and cli faces. Trachy-
191
e herpetofauna of the Isalo Massif, Madagascar
lepis nancycoutuae was found in the southeastern sections
of the Isalo NP and in the centre of the massif. is is a
very secretive species, which seems to be quite abundant
in this region, although it is dicult to collect. A phylo-
genetic analysis of the genus Trachyle pis has recently been
published and revealed that T. nancycoutuae probably is
the sister species of an undescribed species inhabiting the
area of Ambalavao and Andringitra (T. sp. a. vato; L
et al. ).
LAMPROPHIIDAE
Dromicodryas bernieri (D, B D, )
Fig. A
Locality records: Andranomangara, Andranomena (MRSN
R), Lola (MRSN R), Malaso, Ranohira (MRSN R),
Zahavola (MRSN R).
In Malaso, this snake species was encountered during the
day on rocks close to a shallow canyon, while in Ranohira,
it was found along a secondary road. e analysed samples
from Isalo are genetically similar to each other (. Sup-
plementary Table S) and to the individuals from Ifaty (,
JQ, N et al. ).
Ithycyphus oursi D,
Fig. B
Locality records: Canyon des Makis (MRSN R), Anjofo,
Namazaha Valley.
In Isalo, this species has been spotted in the Canyon des
Makis, Anjofo, and in the Namazaha Valley where one
adult individual was observed predating on an adult
Furcifer ousta leti (C et al. ). Irrespective of
their morphological dierences, I. oursi and I. miniatus
are genetically poorly dierentiated (ca. , COI). e two
analysed samples from Isalo are identical to each other in
COI, but have a ca. genetic divergence from a sample
from Ranobe (JQ; N et al. ).
Madagascarophis meridionalis (D, )
Fig. C
Locality records: Andranomena (MRSN R), Canyon des Rats
(MRSN R), Malaso (FAZC /PBZT-uncatalogued, FAZC
/PBZT-uncatalogued), Namazaha Valley (MRSN R,
MRSN R), Ranohira: Motel d’Isalo, Reine de l’Isalo (MRSN
R), Tsitorina (FAZC /MRSN R-uncatalogued), Vallée
du Petit Nazareth (MRSN R), Zahavola (MRSN R), Isalo
(no precise locality).
In Isalo, we found two distinct genetic lineages of this spe-
cies with ca. of genetic divergence at the analysed COI
gene fragment. e sample from the Canyon des Rats be-
longs to a lineage also present in Ifaty, Ihosy and Ranomafa-
na (N et al. , R et al. ), whereas samples
from Malaso, Ranohira and Zahavola belong to a lineage
found also in Tsimanampetsotsa (N et al. ). Both
lineages are present in the Namazaha Valley. H
() recorded this taxon as M. colubrinus.
Mimophis mahfalensis (G, )
Fig. D
Locality records: Andranomena (MRSN R), Bemenara
(MRSN R, MRSN R), Bereketa (MRSN R), Malaso,
Ranohira, Zahavola.
Mimophis mahfalensis and the recently described M. oc-
cultus R, M, L, Y, W, J, F-
, N, S, B R,
are the only Malagasy snakes that belong to the mostly
African subfamily Psammophiinae (R et al. ). In
Isalo, M. mahfalensis can be found in dry forest, thornbush
savannah, and anthropogenic habitats. e analysed sam-
ples from Isalo are identical to each other in the markers
studied (Supplementary Table S) and more similar to the
individuals from Ibity (, COI) than to those from Toliara
(, COI). Using specimens from Isalo, R et al. ()
provided data on the internal anatomy of M. mahfalensis
to demonstrate the presence of toxin-secreting glands, sup-
porting the notion to classify the Psammophiinae as a sub-
family of the Lamprophiidae (P et al. ).
Leioheterodon madagascariensis D B,
Locality record: Bereketa, Isalo (no precise locality).
In Isalo, this species is currently known only from a report
by H () and from Bereketa (G V
), but no molecular data are available.
Leioheterodon modestus (G, )
Fig. E
Locality records: Analalava Forest (FAZC /MRSN R-un-
catalogued), Andozoky (MRSN R), Canyon des rats (MRSN
R), Lola (MRSN R), Namazaha Valley, Ranohira (FAZC
/PBZT-uncatalogued), Ranohira – Motel d’Isalo, Isalo (no
precise locality).
is is a common species in Isalo and individuals were
seen in open savannas, gallery forest, and in canyons. In
Isalo, individuals of L. modestus have been recorded to pre-
date upon the microendemic frog Scaphiophryne gottlebei
(R et al. ).
Specimen FAZC , collected close to the Analalava
Forest, was identied by molecular means (COI) as Leio-
heterodon geayi M, . We compared a COI se-
quence of this specimen with sympatric and allopatric pop-
192
W C et al.
ulations of L. modestus (ACZC , FAZC , FAZC
from Isalo; FAZC from Zazafotsy, MH;
FAZC from Pont Bevilany, MH) and found
that the COI sequence of specimen FAZC had an av-
erage genetic distance of to the otherwise similar COI
sequences of the other analysed samples of L. modestus.
We therefore amplied the S fragment of this specimen
and of FAZC from Isalo and those sequences were
identical ( genetic distance), suggesting a possible am-
plication of a nuclear COI pseudogene in the case of speci-
men FAZC . However, these S sequences had a –
genetic similarity to Leioheterodon madagascariensis
(AY from N et al. ). Morphologically, these
six specimens (four from Isalo and two from elsewhere, de-
tails provided above) are identical to each other and they
all correspond phenotypically to L. modestus. We therefore
think that there might be a case of mislabelling the S se-
quence AY (N et al. ) and suggest that this
sequence actually refers to L. modestus.
Liophidium vaillanti (M, )
Fig. F
Locality record: Zahavola (MRSN R).
is species was rarely observed in Isalo. e known indi-
vidual from Zahavola has a coloration that is quite dierent
from those from other localities (compare pictures of L.sp.
a. vaillanti “South” – which corresponds to this record
– on page and of L. vaillanti on page in G
V ). However, analysed samples of this species
exhibit limited genetic dierentiation [– to L. vaillanti
from Kirindy (DQ, EU; Cytb) and Tsiman-
ampetsotsa (GQ; Cytb); to L. vaillanti from Tsi-
manampetsotsa (GQ; S)]. M et al. ()
observed that this species is at least partly ophiophagous.
Lycodryas guentheri (B, )
Fig. G
Locality records: Zahavola (MRSN R), Isalo (no precise lo-
cality).
We have only one record of this species from Zahavola,
where the individual was found in a shrub outside the can-
yon. As for L. carleti, no sequences were previously avail-
able, but with ventral scales (all other Lycodryas species
have more), scales at midbody, subcaudals and su-
pralabial scales, our inspection of specimen MRSN R
suggests this record being referable to this taxon (V
et al. , N et al ). A record of L. gaimardi ex-
ists from the Isalo area (H ), but neither mor-
phological nor precise locality information are available, so
it could represent another record for L.guen theri. Geneti-
Figure 7. Photos of snake species in life recorded in the Isalo Massif: A) Dromicodryas bernieri from Malaso (tissue sample not
collected); B) Ithycyphus oursi (ACZC 1932) from Namazaha Valley; C) Madagascarophis meridionalis (FAZC 14638) from Malaso
(sample not sequenced); D) Mimophis mahfalensis (FAZC 14677) from Malaso; E) Leioheterodon modestus from the Namazaha Valley
(tissue sample not collected); F) Liophidium vaillanti (MRSN R3210) from Zahavola; G) Lycodryas guentheri (MRSN R3739) from
Zahavola; H) Lycodryas sp. a. pseudogranuliceps Ca01 “Andohahela” (MRSN R3216) from Antoha; I) amnosophis lateralis (ACZC
1928) from the Namazaha Valley; J) Acrantophis dumerili from Ilakaka (tissue sample not collected); K) Sanzinia volontany from the
Namazaha Valley (tissue sample not collected); L) Madatyphlops arenarius (FAZC 14696) from near Ilakaka (sample not sequenced).
193
e herpetofauna of the Isalo Massif, Madagascar
cally, this taxon seems to be closely related to L. macula-
tus from the Comoros (ZSM /) and Mayotte (ZSM
/ and ZSM /) from which it has between
and genetic distance at the analysed S gene, respec-
tively, and at the COI fragment.
Lycodryas sp. a. pseudogranuliceps Ca “Andohahela”
(CCS)
Fig. H
Locality record: Antoha (MRSN R).
is undescribed species of Lyco dr yas is already known
from Andohahela in southeastern Madagascar (N et
al. ). Considering similar geographical patterns in Lio-
phidium vaillanti and Mantella sp. a. expectata “South”,
this anity of Isalo to Andohahela in southeastern Mada-
gascar is interesting to note. In Isalo, this species was found
on a small shrub at night. It seems to be closely related to
L.granuli ceps and L. pseudogranuliceps. e genetic distance
between the specimen from Isalo and Andohahela is and
at the analysed S and COI gene fragments, respective-
ly. Our sample has (S) and (COI) divergences from
L. pseudogranuliceps from Befandriana-Avaratra in north-
ern Madagascar (ZSM /, N et al. , ).
Pseudoxyrhopus quinquelineatus (G, )
Locality record: Isalo (no precise locality).
is species is currently known from Isalo only by the
record published by H (). No molecular data
from Isalo are available.
amnosophis lateralis (D, B D, )
Fig. I
Locality records: Andriamanero (FAZC /MRSN R-uncata-
logued), Namazaha Valley.
e individuals found in the Namazaha Valley and Andria-
manero were active on trails during the day. e analysed
samples from Isalo are quite similar to each other (.,
Supplementary Table S) and genetically similar (; COI)
to the individuals from Ranomafana as published by N
et al. ().
SANZINIIDAE
Acrantophis dumerili J,
Fig. J
Locality records: Andohasahenina, Ilakaka, Namazaha Valley, Is-
alo (no precise locality).
is species was reported from Isalo by H ().
We observed it in Andohasahenina and Ilakaka, but no
samples were collected. is species was recently (October
) found in Namazaha Valley (L. B, pers. comm.),
inactive on the ground during the day. Two species are cur-
rently known in this genus, but molecular analyses revealed
a third lineage in the south and southeast of Madagascar
(O- W et al. ). e only data for this
species from Isalo available to us are those of a published
record (S, EU; O- W et al. ).
Sanzinia volontany V G,
Fig. K
Locality records: Canyon de Zahavola, Namazaha Valley, Isalo
(no precise locality).
is taxon was formerly considered a subspecies of
S.mada gascariensis (O- W et al. ),
but has recently been elevated to species level (R
et al. ). As per its new denition, this species is re-
stricted to the west of Madagascar where it has a patchy
distribution mostly limited to habitats with trees and large
shrubs. In Isalo, this species was found in both primary
and secondary forests. In , one young individual was
observed resting for several days inside the Canyon of Za-
havola, where it was probably hunting. None of the new-
ly collected samples from Isalo could be successfully se-
quenced; we therefore here refer to a published record (S,
EU – O- W et al. ).
TYPHLOPIDAE
Madatyphlops arenarius (G, )
Fig. L
Locality records: Ilakaka (FAZC /MRSN R-uncatalogued),
Ranohira (MRSN R–R).
Madatyphlops arenarius is a worm-like blind snake known
from the west and south of Madagascar. It inhabits sandy
substrates and can be encountered under stones and, rare-
ly, active on the ground at night. In Isalo, this species is
rarely found, and only a few records are currently avail-
able (three specimens have been collected). One specimen
was found crossing a dirt road at night. Unfortunately, it
was not possible to amplify DNA fragments from these re-
cently collected specimens. e only genetic data available
for this species from Isalo are those of a published record
(COI, JQ; N et al. , ). is sample has
genetic distance to a sample of Madatyphlops arenarius
from Ifaty (KT; N et al. ). In fact, a recent
publication indicated that M. arenarius might be a com-
plex of at least four dierent taxa and a systematic revision
of this group is therefore needed to assign this name to one
or more populations (N et al. ).
194
W C et al.
Discussion
In this study, we generated reference sequences for almost
all amphibians and reptiles known from Isalo. ese in-
clude ) S sequences of of the amphibian taxa pre-
viously listed by M et al. (), and ) S se-
quences of one new taxon (Mantidactylus sp. a. multi-
plicatus Ca “Isalo”) and two new species distribution
records (Mantella sp. a. expectata “South” and Scaphio-
phryne sp. a. calcarata Ca); nally, we ) provide ref-
erence sequences for of the reptile taxa current-
ly known from this area. For seven taxa (Blaesodactylus
sakalava, Geckolepis typica, Grandidierina rubrocaudata,
Leioheterodon madagascariensis, Pseudoxyrhopus quin-
quelineatus, Tracheloptychus madagascariensis, and Zono-
saurus ornatus) we only have reports from literature (B-
, , H , G V ), as
those taxa were not observed by our team during the mul-
tiple surveys we conducted in Isalo. In his species inven-
tory from Isalo National Park, H () reported
on Lygodactylus tolampyae (G, ), a taxon al-
ready known from the Zombitse-Vohibasia National Park
(G V ), and on L. gaimardi (S,
). Although we could not verify the taxonomic identi-
ties of these records we think they might refer to one of the
two candidate species of Lygodactylus reported herein, and
to L. guentheri or Lycodryas sp. a. pseudogranuliceps Ca
“Andohahela”, respectively.
Overall, when comparing our results with those avail-
able from other dry deciduous forests in Madagascar, it
would appear that amphibian species richness ( species-
level taxa) in the Isalo Massif is relatively high and more
diverse than at other western sites such as the Tsingy de
Bemaraha National Park [ species; B et al. ()],
the Kirindy dry forest [; G ()], Ankarafantsika
National Park, and in the Montagne des Français [; M
et al. () and D’C et al. ()]. e scenario is
slightly dierent for reptiles: compared to the species-
level taxa of reptiles in Isalo, there are higher numbers in
Tsingy de Bemaraha (, B et al. ), in Mikea
(R ), in the Montagne des Français
(D’C et al. ), whereas Kirindy and Ankarafant-
sika host similar numbers ( and taxa, respectively;
B et al. , R R ).
If our results are compared with values available from the
eastern rainforests, amphibian richness is obviously much
lower (see for comparison G et al. , R et
al. , H et al. ), while values for rep-
tile richness are roughly similar (A et al. ,
G et al. , K , D’C et al. ,
G et al. ).
e high level of species richness and the apparently lo-
cally endemic species observed in Isalo can be interpreted
as a result of palaeoclimatic oscillations (R
N , M W ). If this is true,
the rainforest species could have expanded their ranges
and survived in the massif during warm and humid peri-
ods due to habitat availability and the presence of perma-
nent water and sub-humid forests, while dryness-adapted
species remained constrained to small refugia in suitable
areas (C , M W ); and the
situation would have been the opposite during colder and
drier periods. On the other hand, the peculiar position of
the Isalo Massif and the structure of the sandstone forma-
tion that provides a number of humid (canyons) and arid
habitats might have favoured the coexistence of taxa typi-
cal of multiple biomes. is heterogeneity allows for the
presence of species adapted to dierent habitats, from the
eastern humid forest, via the western dry deciduous forest
to the southern subarid savannas, as is demonstrated by
the presence of typical rainforest (e.g., Boophis luteus) and
dry habitat (e.g., Brookesia brygooi) species. For some taxa,
Isalo can also be characterized as a contact zone of dif-
ferent lineages such as those found in Trachylepis graven-
horstii and Madagascarophis meridionalis, and of closely
related taxa such as Scaphiophryne sp. a. calcarata Ca
and Ca. In the case of T. gravenhorstii, lineage a was al-
ready known from Isalo (Analalava Forest) as well as An-
toetra, Ranomafana and Vohiparara (V et al. ).
ese latter three localities are all located on the humid
eastern side of the island. Lineage b is instead widespread
in the subarid-subhumid southern area (Tolagnaro, Ando-
hahela, Manantanely, Tranomaro, Ambolavao and Toliara;
V et al. ). Similarly, the samples from Zahavo-
la, Ranohira and Malaso of M. meridionalis correspond to
the lineage known from Tsimanampetsotsa (arid environ-
ment) whereas the one from the Canyon des Rats, together
with samples known from Ifaty and Toliara, belongs to the
lineage present at Ihosy and Ranomafana (humid environ-
ment).
Figure 8. Photos of preserved specimens of Paroedura sp. a.
bastardi Ca01 “Marofandilia/Miandrivazo” (A; MRSN R2553)
and Paroedura sp. a. bastardi Ca03 “Ilakaka” (B; MRSN R2568).
195
e herpetofauna of the Isalo Massif, Madagascar
e analysis of populations of M. expectata (FigsA–C,
J), M. sp. a. expectata “South” (Figs D–E) and M.betsileo
(Figs F–I) revealed that these taxa vary greatly in their
colour patterns (Fig. ). Interestingly, in Sakavato, two
morphologically similar individuals with intermediate
(M.expectata/M. betsileo) chromatic traits (Figs E, G)
were identied by their mitochondrial DNA and their
analysis revealed that these individuals represent two dif-
ferent taxa (M. sp. a. expectata “South” – Fig. E, and
M.betsileo – Fig. G). is might be due to introgressive
hybridization of the mtDNA (C et al. , C-
et al. ) or convergent evolution of the same colora-
tion pattern promoted by living in the same environment
and sharing the same selective pressures, for example pre-
dation (Müllerian mimicry; C et al. ).
In this study, we provide a thorough taxonomic iden-
tication of most of the Isalo specimens hosted in the
MRSN collection (Supplementary Table S and S) and
found that only Scaphiophryne menabensis is not repre-
sented in its amphibian collection. As far as reptiles are
concerned, Crocodylus niloticus, Lygodactylus sp. a. pic-
tus Ca “Isalo”, Blaesodactylus sakalava, Geckolepis typica,
Paroedura sp. a. bastardi Ca “Isalo”, Phelsuma mutabi-
lis, Phelsuma standingi, Zonosaurus karsteni, Zonosaurus
ornatus, Trache loptychus madagascariensis, Grandidierina
rubrocaudata, amnosophis lateralis, Sanzinia volontany,
Acranto phis dumerili, Leioheterodon madagascariensis, and
Pseudoxyrhopus quinquelineatus are currently not repre-
sented in the MRSN collection. e ndings reported in
this study highlight the crucial importance of combining
extensive eld research with molecular taxonomic identi-
cation and with the morphological inspection of vouch-
er specimens hosted in museum collections (R et al.
). With this approach, it is possible to generate taxo-
nomically accurate species lists and (when necessary) up-
date previously published work to accurately assess the
bio diversity value of a surveyed area. In some instances,
the lack of reference sequences in public repositories did
not allow a sample to be unequivocally assigned to a de-
scribed or undescribed taxa. In these cases, their identi-
cation was facilitated only by the availability of corre-
sponding museum specimens (e.g., Paroedura vahiny and
Lycodryas guentheri). At the same time the availability of
preserved specimens enabled us to ascertain the consist-
ency of diagnostic characters. is was the case in our Leio-
heterodon samples that we assigned to L. modestus on the
basis of diagnostic morphological traits when molecular
data were misleading. It provided a possibility to extract
new tissue samples from existing specimens that facilitated
the sequencing and reassignment of one G. azzurrae para-
type (MRSN A) to G. corvus and the investigation of
other aspects of specimen morphology (e.g., coloration, as
in some specimens of Mantella spp. analysed in our study).
All this underscores the crucial role that historical and
modern collections play in cataloguing world biodiversity
and the importance of maintaining specimens in perma-
nent and accessible museum collections (D L S et
al. , A ).
Acknowledgements
Our thanks go to the Malagasy authorities for granting research
and export permits, to the Madagascar Institut pour la Conser-
vation des Ecosystèmes Tropicaux (MICET) for logistical help,
and to the Madagascar National Parks Association (MNP) for
granting us access to the Park. Particular thanks go to the col-
leagues, students and assistants who helped in the eld: A
(MNP park guide), D E, I L, D. J
H, M G, I A. I, A-
L, and S R; and to H. S
H and M K who contributed to the
laboratory work. A R helped us with logis-
tics and assistance in Isalo. Our eldwork was made possible with
the support of the Mohamed bin Zayed Species Conservation
Fund, EDGE, Zoological Society of London, Amphibian Special-
ist Group-Madagascar, Conservation International, Gondwana
Conservation and Research, Regione Piemonte, Reptiland, and
the Zurich Zoo. e Portuguese National Funds through FCT –
Foundation for Science and Technology supported the PhD fel-
lowship of WC (SFRH/BD//) and the Investigador
FCT (IF) grant to AC (IF//). is work is funded by
National Funds through FCT within theIF///CP/
CTExploratory Research Project.
References
A, M., M. J P, M. R L. K-
(): Focused on Old World iguanas: Karyotype
evolution in the Madagascar family Opluridae (Squamata:
Pleurodonta). – th International Chromosome Conference
(ICC), 23: –.
A, S. F., T. L. M, A. A. S, J. Z, Z.
Z, W. M D. J. L (): Gapped BLAST
and PSI-BLAST: a new generation of protein database search
programs. – Nucleic Acids Research, 25: –.
A, F. (): Collezioni sistematiche e ricerca: sde e
problemi per i musei naturalistici italiani. – Museologia Scien-
tica, 17: –.
A, F., F. G, R. A. N, C. J. R, M.
V J. E. R (): e amphibians and
reptiles of Nosy Be (NW Madagascar) and nearby islands: a
case study of diversity and conservation of an insular fauna. –
Journal of Natural History, 37: –.
A, G., F. A, D. F, A. P G.
O (): Chromosomal rearrangements occurred re-
peatedly and independently during species diversication in
Malagasy geckos, genus Paroedura. – African Zoology, 48:
–.
A, E., S. K. D, J. S (): Mitochondrial DNA
sequence divergence and phylogenetic relationships among
eight chromosome races of the Sceloporus grammicus complex
(Phrynosomatidae) in Central Mexico. – Systematic Biology,
43: –.
A, B. G. P., V. R. R, Z. J. N. R D.
K (): Community management of natural resources:
a case study from Ankarafantsika National Park, Madagascar.
– Ambio, 42: –.
B, H.–P. P. K (): Bemerkungen zum Verbrei-
tungsgebiet von Phelsuma standingi Methuen & Hewitt, .
– Herpetofauna, 21 (): –.
196
W C et al.
B, C., B. P. N, J. L. B, A. P. R, M.
V A. D. Y (): Multilocus phylogenetic and
geospatial analyses illuminate diversication patterns and
the biogeographic history of Malagasy endemic plated lizards
(Gerrhosauridae: Zonosaurinae). – Journal of Evolutionary
Biology, 28: –.
B, Q. M. C., J. L. B, E. R. R, H. J. A. R.
R, K. T. H, S. J. T J. U. G
(): Eects of logging on the reptile fauna of the Kirindy
forest with special emphasis on the Flat-tailed Tortoise (Pyxis
planicauda). – pp. – in: G, J. U. J. P. S
(eds): Ecology and economy of a tropical dry forest in Mada-
gascar. – Primate Report, 46: –.
B, P., C. J. R, R. R,
E. F. H, R. R. A, D. R-
, O. R. R, M. V, R. K. B.
J, F. G J. K (): Amphibians and rep-
tiles of the Tsingy de Bemaraha plateau, western Madagascar:
checklist, biogeography and conservation. – Herpetological
Conservation and Biology, 5: –.
B, F. M. C. M (): Convergent adaptive
radiations in Madagascan and Asian ranid frogs reveal cov-
ariation between larval and adult traits. – Proceedings of the
National Academy of Sciences of the USA, 97: –.
B, C. A. (): Morphology, relationships, and biogeo-
graphical signicance of an extinct horned crocodile (Croco-
dylia, Crocodylidae) from the Quaternary of Madagascar. –
Zoological Journal of the Linnean Society, 150: .
B, J. L., A. C, A. D. Y M. V (): A
necessarily complex model to explain the biogeography of the
amphibians and reptiles of Madagascar. – Nature Communi-
cations, 5: e.
B, J. L., N. S, F. G, P. B, D. R. V M.
V (): Spatial biodiversity patterns of Madagascar’s
amphibians and reptiles. – PLoS ONE, 11: e.
B, M. W., O. H, J. F. Y. B T. B
(): Single-locus and multilocus DNA ngerprinting. –
Oxford, IRL Press.
B, E. R. (): Reptiles sauriens Chamaeleonidae: genre
Chamaeleo. – Faune Madagascar, Orstom et CNRS, Paris,
pp.
B, E. R. (): Systématique des Lézards Scincides de la
region malgache. VII Revision des genres Voeltzkowia Boett-
ger, , Grandidierina Mocquard, , et Cryptoscincus Mo-
quard, . – Mémoires du Muséum National d’Histoire Na-
turelle. Série , : –.
B, E. R. (): Les Gerrhosaurinae de Madagascar Sau-
ria (Cordylidae). – Mémoires du Muséum National d’Histoire
Naturelle. Série A, Zoologie, 134: –.
B, F. T., R. L J. B. S (): Mitochon-
drial DNA phylogeography of the polytypic North American
rat snake (Elaphe obsoleta): a critique of the subspecies con-
cept. – Evolution, 54: –.
C, Y., M. V, D. R. V, F. R, P.
B, O. R R A. M
(): New evidence for parallel evolution of colour patterns
in Malagasy poison frogs (Mantella). – Molecular Ecology, 13:
–.
C, A., Y. C, V. M, A. M, M. V
F. A (): Into the canyons: the phylogeography
of the Malagasy frogs Mantella expectata and Scaphiophryne
gottlebei in the arid Isalo Massif, and its signicance for con-
servation (Amphibia: Mantellidae and Microhylidae). – Or-
ganisms Diversity & Evolution, 8: –.
C, A., P. S. G, F. G, D. J. H, A. L
M. V (): Deciphering the cryptic species diversity
of dull-coloured day gekos Phelsuma (Squamata: Gekkoni-
dae) from Madagascar, with description of a new species. –
Zootaxa, 2982: –.
C, A., D. J. H, I. A. I, A. L, S. R
G. M. R (): Conrming Domergue: Ithycyphus oursi
Domergue, predation upon Furcifer oustaleti (Mocquard,
). – Herpetology Notes, 3: –.
C, A., A. M, F. G, D. J. H, A. L
M. V (): Description of a new pygmy chameleon
(Chamaeleonidae: Brookesia) from central Madagascar. –
Zootaxa, 3490: –.
C, B. E. (): A rened chronology of prehistoric Mada-
gascar and the demise of the megafauna. – Quaternary Science
Reviews, 29: –.
D’C, N., J. K, M. F F. G (): A con-
servation assessment of the amphibians and reptiles of the
Forêt d’Ambre Special Reserve, North Madagascar. – Mada-
gascar Conservation & Development, 3: –.
D’C, N., J. S, K. G, J. D, C. G, J.
R, G. S, M. V F. G (): e
rst comprehensive survey of amphibians and reptiles at Mon-
tagne des Français, Madagascar. – Herpetological Conserva-
tion and Biology, 2: –.
D L S, N. U., S. A. B B. D. P ():
Getting back to the basics: museum collections and satel-
lite imagery are critical to analysing species diversity. – Bio-
Science, 67: –.
F, A. M, C. M. I, H. A. R, E. E.
L C. J. R (): Detecting cryptic specia-
tion in the widespread and morphologically conservative car-
pet chameleon (Furcifer lateralis) of Madagascar. – Journal of
Evolutionary Biology, 25: –.
F, A. M. C. J. R (): A phylogeographic as-
sessment of the Malagasy Giant Chameleons (Furcifer verruco-
sus and Furcifer oustaleti). – PLoS ONE, 11: e.
F, A., A. G, M. V, C. M, M. B N.
J. G (): Underestimation of species richness in
Neotropical frogs revealed by mtDNA analyses. – PLoS ONE,
2: e.
G, J. U., P. P. II L, G. E. S S. S
(): e biodiversity of Madagascar: one of the world’s hot-
test hotspots on its way out. – Oryx, 35: –.
G, C. J., C. J. R, K. M, A. P. R-
, R. J. S Z. G. D (): Comparing
methods for prioritising protected areas for investment: a case
study using Madagascar’s dry forest reptiles. – PLoS ONE, 10:
e.
G, P. S., F. M. R M. V (): Filling
the gaps: amphibian and reptile records from lowland rainfor-
ests in eastern Madagascar. – Salamandra, 46: –.
197
e herpetofauna of the Isalo Massif, Madagascar
G, F., H. R, I. I, P.-S. G, J. K M.
V (): A new species of nocturnal gecko (Paroedura)
from karstic limestone in northern Madagascar. – Zoosystem-
atics and Evolution, 90: –.
G, F. M. V (): A eld guide to the amphibians and
reptiles of Madagascar. – M. Vences & F. Glaw Verlags GbR.
G, F. M. V (): A eld guide to the amphibians
and reptiles of Madagascar. – M. Vences & F. Glaw Verlags
GbR.
G, J. (): e amphibian fauna of the Kirindy dry forest in
western Madagascar. – Salamandra, 39: –.
G, J., F. G M. V (): A new species of Scaphio-
phryne from western Madagascar. – Copeia, 2: –.
G, S. M. J. P. B (): e Natural history of
Madagascar. – e University of Chicago Press, pp.
G, S. M. J. P. B (): Updated estimates of
biotic diversity and endemism for Madagascar. – Oryx, 39:
–.
G S. M. W. L. J ():Extinct Madagas-
car: Picturing the Island’s Past. – e University of Chicago
Press,Chicago, Illinois, pp.
G, S. M. L. W (): Nouveaux résultats d’inven-
taires biologiques faisant référence à l’altitude dans la région
des massifs montagneux de Marojejy et d’Anjanaharibe-Sud.
– Recherches pour le Développement, Série Sciences Biolo-
giques, pp.
H, F. (): Isalo faunal inventory. Final report to the
Association Nationale pur la Gestion des Aires Protégées.
Landell Mills Limited, City, UK. pp. – in: R-
, H. A. S. M. G (eds): Rapid herpetofau-
nal surveys within ve isolated forests on sedimentary rock in
western Madagascar. – Herpetological Conservation and Bio-
lo gy, 6: –.
H, T. A. (): BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows //
NT. – Nucleic Acids Symposium Series, 41: –.
H, J., A. R, O. S, D. E, R.
D M. V (): Year-round activity patterns in
a hyperdiverse community of rainforest amphibians in Mada-
gascar. – Journal of Natural History, 49: –.
J, T. R., A. M. B, E. G, F. G M.
V (): Molecular phylogenetic relationships among
species of the Malagasy-Comoran gecko genus Paroedura
(Squa mata: Gekkonidae). – Molecular Phylogenetics and Evo-
lution, 46: –.
J, R. K. B., M. F. T, P. B, N. C, J. L.
B, L. C, F. A, A. A, R. R.
A, M. A, P. B, L. D.
B, E. F. H, F. G, R. A. G, C.
H-T, M. H, V. K, N.H. R-
, J. R, D. R, H. R-
, N. A. R, J. R-
, J. B. R, H. R, J. C.
R, H. H. R, J. E. R-
, H. R, A. P. R, A. R-
, F. M. R, C. J. R, E. R-
, F. R, P. P. D, A. D. Y-
M. V (): Extinction risks and the conserva-
tion of Madagascar’s reptiles. – PloS ONE, 9: e.
K, C. J. J. W. B (): Chamaeleonidae. Das Tier-
reich, . – Verlag Walter de Gruyter & Co, Berlin, New York,
pp.
K, C. (): e Masoala peninsula. – pp – in:
G S. M. J. P. B (eds): e Natural Histo-
ry of Madagascar. – e University of Chicago Press, Chicago
and London.
K, C., A. C, A. M, S. J. P, C. D.
T, H. B, J. D, B. L. F, F. G,
T. C. G, G. J. H, R. J. H, D. C. L, E. L,
R. A. N, C. J. R, A. R,
G. E. S, M. V, D. R. V, P. C. W M.
L. Z (): Aligning conservation priorities across taxa
in Madagascar with high-resolution planning tools. – Science,
320: –.
K, S., G. S K. T (): MEGA: Molecular
Evolutionary Genetics Analysis Version . for bigger datasets.
– Molecular Biology and Evolution, 33: –.
L, A. D. T. W R (): Molecular systematics of
the eastern fence lizard (Sceloporus undulatus): a comparison
of parsimony, likelihood, and Bayesian approaches. – System-
atic Biology, 51: –.
L, A., D. J. H, S. R, A. M, F. G M.
V ():Phylogenetic relationships of Trachyl epis skink
species from Madagascar and the Seychelles (Squamata: Scin-
cidae). – Molecular Phylogenetics and Evolution, 67: –.
M, J. L. W (): e Eco-Geo-Clim model: ex-
plaining Madagascar’s endemism. – Madagascar Conserva-
tion and Development, 8: –.
M, V. F. A (): e tadpoles of Scaphio-
phryne gottlebei (Microhylidae: Scaphiophryninae) and Man-
tella expectata (Mantellidae: Mantellinae) from Isalo Massif,
South-central Madagascar. – Alytes, 23: –.
M, V. F. A (): Two new canyon-dwelling
frogs from the arid sandstone Isalo Massif, central-southern
Madagascar (Mantellidae-Mantellinae). – Zootaxa, 1574: –
.
M, V., G. A, A. C, F. M, J. R-
, T. R F. A (): e
amphibians of Isalo Massif, southern-central Madagascar:
high frog diversity in an apparently hostile dry habitat. –
Monograe del Museo Regionale di Scienze Naturali di Tori-
no, –.
M, V., F. M, T. J. R F. A
(): A possible attempt of predation of Liophidium vaillan-
ti upon Dromicodryas bernieri observed in central-southern
Madagascar (Serpentes: Colubridae). – Salamandra, 42: –
.
M, M., F. A, G. A, F. G, G. O-
F. M. G (): Molecular phylogeny, biogeogra-
phy and chromosome evolution of Malagasy dwarf geckos of
the genus Lygodactylus (Squamata, Gekkonidae). – Zoologica
Scripta, 46: –.
M, A., F. G, F. M. R M. V ():
A likely microendemic new species of terrestrial iguana, ge-
nus Chalarodon, from Madagascar. – Zootaxa, 3946: –.
M, A., I. I M. H (): Herpetofauna of
Ampijoroa, Ankarafantsika Strict Nature Reserve, a dry forest
198
W C et al.
in northwestern Madagascar. – Herpetological Natural His-
tory, 10: –.
M, N., R. A. M, C. G. M, G. A. B.
F J. K (): Biodiversity hotspots for conser-
vation priorities. – Nature, 403: –.
M, T., K. C. W, F. G M. V
(): Molecular phylogeny and geographic variation of
Malagasy iguanas (Oplurus and Chalarodon). – Amphibia-
Reptilia, 29: –.
N, Z. T., U. J, M. W, F. G M. V ():
Multiple colonization of Madagascar and Socotra by colubrid
snakes: evidence from nuclear and mitochondrial gene phylo-
genies. – Proceedings of the Royal Society, London, B, 270:
–.
N, Z. T., F. G M. V (): Systematics of the
snake genera Stenophis and Lycodryas from Madagascar and
the Comoros. – Zoologica Scripta, 39: –.
N, Z. T., A. B. M, F. G, A. M, J. N,
M. V S. B. H (): Molecular systematics and
undescribed diversity of Madagascan scolecophidian snakes
(Squamata: Serpentes). – Zootaxa, 4040: –.
N, Z. T., G. S, F. G M. V (): First large-
scale DNA barcoding assessment of reptiles in the biodiversity
hotspot of Madagascar, based on newly designed COI prim-
ers. – PLoS ONE, 7: e.
O, Y. Y. K (): Mitogenomic perspectives
into iguanid phylogeny and biogeography: Gondwanan vi-
cariance for the origin of Madagascan oplurines. – Gene, 441:
–.
O- W, P., Z. T. N, D. R. V, M. V,
J. E. L (): Phylogeography and phylogenetic rela-
tionships of Malagasy tree and ground boas. – Biological Jour-
nal of the Linnean Society, 95: –.
P, S., A. M, S. R, W. O. MM, L. S
G. G (): e simple fool’s guide to PCR. – De-
partment of Zoology, Honolulu.
P, S. G., A. C, F. A, A. B, L. M. S.
R, M. W. H, C. S G. M.
R (): Combining old and new evidence to increase the
known biodiversity value of the Sahamalaza Peninsula, North-
west Madagascar. – Contribution to Zoology, 86: –.
P, R. G. B., Z. T. N, G. S, F. G, K. C. W
M. V (): DNA barcoding Madagascar’s amphi-
bian fauna. – Amphibia-Reptilia, 35: –.
P, D., K. C. W, M. V S. S ():
Volatile amphibian pheromones:macrolides of mantellid
frogs from Madagascar. – Angewandte Chemie International
Edition, 51: –.
P, M., F. G, D. R. V M. V (): Review
of the systematics, morphology and distribution of Malagasy
dwarf geckos, genera Lygodactylus and Microscalabotes (Squa-
mata: Gekkonidae). – Zootaxa, 2103: –.
P, M., M. T M. V (): Phylogeny and
biogeography of Malagasy dwarf geckos, Lygodactylus Gray,
: preliminary data from mitochondrial DNA sequences
(Squamata: Gekkonidae). – pp. – in: H, B. A. K.
H. L (eds): African Biodiversity – Molecules, Organisms,
Ecosystems. – Springer, Berlin.
P, R. A., F. T. B J. J. W (): A phylogeny
and revised classication of Squamata, including species
of lizards and snakes. – BMC Evolutionary Biology, 13: .
R, F. C. E., N. R R-
, O. R R, D. R-
, F. A, P. B, A. I. C, F. G,
T. R, D. V, D. R. V M. V
(): Malagasy poison frogs in the pet trade: a survey of lev-
els of exploitation of species in the genus Mantella. – pp. –
in: A, F. (ed.): A Conservation Strategy for the
Amphibians of Madagascar. – Monograe del Museo Regio-
nale di Scienze Naturali di Torino.
R, H. A. S. M. G (): Rapid her-
petofaunal surveys within ve isolated forests on sedimentary
rock in western Madagascar. – Herpetological Conservation
and Biology, 6: –.
R, J. B. N. R (): Evaluation ra-
pide de la diversité biologique des reptiles et amphibiens de la
Réserve Naturelle Intégrale d’Ankarafantsika. – pp. – and
– in: A, L. E., T. S. S, S. R
O. M (eds): Une evaluation biologique de la Réserve
Naturelle Intégrale d’Ankarafantsika, Madagascar. – Bulletin
RAP d’évaluation rapide No. , Conservational International,
Washington D.C., USA.
R, A. P. (): Herpétofaune des forets sèches
malgaches. – Malagasy Nature, 1: –.
R, A. P., B. N, K. P. K, J. G
A. D. Y (): Phylogeny and evolution of Malagasy
plated lizards. – Molecular Phylogenetics and Evolution, 50:
–.
R, A. P. D. R (): Chamaeleo-
nidae, Chameleons. – pp. – in: G S. M. J. P.
B (eds): e Natural History of Madagascar. – e
University of Chicago Press, Chicago and London.
R, C. J. R. A. N (): Biogeographic Pat-
terns of Reptiles in Eastern Madagascar. – pp. – in:
G S. M. B. P (eds): Natural change and
human impact in Madagascar. – Washington D. C., Smithso-
nian Institution Press.
R, H., K. R. E, P. N. B, A. P. R,
A. M M. V (): Multi-gene phylogeny of
Madagascar’s plated lizards, Zonosaurus and Tracheloptychus
(Squamata: Gerrhosauridae). – Molecular Phylogenetics and
Evolution, 69: –.
R, R. G., L. M. L. N L. J. R (): To-
ward a Tree-of-Life for the boas and pythons: Multilocus spe-
cies-level phylogeny with unprecedented taxon sampling. –
Molecular Phylogenetics and Evolution, 71: –.
R, L. A., A. A, G. A, F. A, C. C. B,
M. V. L. B, J. M. B, A. M. B, F. B, C.
M. B, M. L. B, D. C. B, S. B, F.
B, R. C. K. B, R. B, R. M. B, C. D. C-
, K. C, L. M. C, P. C, G.
C, J. H. C, K. D. C, B. B. C, A.
C, J. C, J. C, T. D, M. R. C-
, K. Q, F. D, R. D, J. P. D-
, A. E , M. V. E, W. E, C. R.
F, B. L. F, J. F, P. W. F, J. F, A.
G, A. G, M. G, T. G, G. R. G,
C. E. G, R. G, K. H, K. M. H,
199
e herpetofauna of the Isalo Massif, Madagascar
H. H, D. T. I, T. I, Z. J, H. F. J,
D. J, D. K, N. K, E. L, H.
K. L, P. L, J. M. L, H. L, J. L, M.
L, D. L. M, V. M, K. M,
G. C. M, H. M , J. MC, R. W. MD,
J. MG, M. J. M, R. M, R. D. M, C. M,
P. M, M. W. N, R. A. N, D. Ó F,
L. R. P, J. F. P, E. P, G. P, J. P-
E, A. P-M, S. P, J. P, D. L. R-
, J. E. R, J. D. R, D. R. R, M.-O.
R, M. T. R, P. R, L. R, M. J.
R, F. S, G. S, A. S, W. B. S,
W. F. S-V, V. G. S, M. S, J. G. T,
C. W. T, T. T, P. T, T. V, M. V-
, E. V, P. C. W, T. A. W,
W. T. W, K. W, J. T. W, G. W, E. O.
W, K. W, R. W C. C. W ():
Specimen collection: An essential tool. – Science, 344: –.
R, S., H. R, P.-S. G, F. G, D. P, D. J.
H M. V (): Phylogenetic systematics of day
geckos, genus Phelsuma, based on molecular and morphologi-
cal data (Squamata: Gekkonidae). – Zootaxa, 2429: –.
R, S., M. V, F. G, D. P D. J. H
(): Multigene phylogeny of Malagasy day geckos of the
genus Phelsuma. – Molecular Phylogenetics and Evolution, 52:
–.
R, G. M., F. A, A. C, J. S. H, J.
N, N. H. R, M. O. R, R. R-
C. J. R (): e amphibians of the relict
Betampona low-elevation rainforest, eastern Madagascar: an
application of the integrative taxonomy approach to biodiver-
sity assessments. – Biodiversity and Conservation, 21: –.
R, G. M., R. B, E. C, B. G, P. E
B F. A (): Case solved: presence of toxin-
secreting oral glands in the lamprophiid snake Mimophis mah-
falensis (Grandidier, ) from Madagascar. – Zoomorpho lo-
gy, 133: –.
R, G. M., V. M, A. C F. A ():
Predation of the snake Leioheterodon modestus (Günther,
) upon the microhylid frog Scaphiophryne gottlebei Busse
& Böhme, at Isalo, southern Madagascar. – Herpetology
Notes, 3: –.
R, S., F. T. B, B. R C. J.
R (): e cat-eyed snakes of Madagascar: phy-
logeny and description of a new species of Madagascarophis
(Serpentes: Lamprophiidae) from the Tsingy of Ankarana. –
Copeia, 104: –.
R, S., E. A. M, K. L, S. Y, R. S. W, M. J,
I. F, R. A. N, G. S, F. T. B-
C. J. R (): Unrecognized species di-
versity and new insights into colour pattern polymorphism
within the widespread Malagasy snake Mimophis (Serpen-
tes: Lamprophiidae). – Systematics and Biodiversity, DOI:
./...
S, H.-C., M. V M. V (): Molecular
phylogeny of Malagasy poison frogs, genus Mantella (An-
ura: Mantellidae): homoplastic evolution of colour pattern in
aposematic amphibians. – Organisms Diversity and Evolu-
tion, 2: –.
S, G. E. (): Endemism in the Malagasy tree ora. – pp.
– in: L W. R. S. M. G (eds): Biogeogra-
phy of Madagascar. – Memoires de la Societe de Biogeogra-
phie, Paris.
S, A., M. C. B, P. M, M. V, F.
G, R. A. N T. W. R (): Opening the
black box: phylogenetics and morphological evolution of the
Malagasy fossorial lizards of the subfamily ‘‘Scincinae”. – Mo-
lecular Phylogenetics and Evolution, 34: –.
S, P., J. K, M. V, A. S M. V ():
Preliminary molecular relationships of Comoroan day geckos
(Phelsuma). – pp. – in: V, M., J. K, T. Z-
W. B (eds): Herpetologia Bonnensis II. – Pro-
ceedings of the th Congress of the Societas Europaea Herpe-
tologica. – Zoologisches Forschungsmuseum A. Koenig and
Societas Europaea Herpetologica, Bonn.
T, T. M., D. R. V, F. G M. V ():
Testing species-level diversication hypotheses in Madagas-
car: the case of microendemic Brookesia leaf chameleons. –
Systematic Biology, 58: –.
V, M., F. G, V. M F. A (): Re-
view of the Malagasy tree snakes of the genus Stenophis. –
Sala mandra 40: –.
V, M., A. L, A. M F. G (): DNA bar-
coding assessment of genetic variation in two widespread
skinks from Madagascar, Trachylepis elegans and T. graven-
horstii (Squamata: Scincidae). – Zootaxa, 3755: –.
V, M., C. J. R, R. A. N F. G
(): A revision of the Scaphiophryne marmorata complex
of marbled toads from Madagascar, including the description
of a new species. – Herpetological Journal, 13: –.
V, M., M. T, R. M. B, D. R. V (b):
Deciphering amphibian diversity through DNA barcoding:
chances and challenges. – Philosophical Transactions of the
Royal Society B: Biological Sciences, 360: –.
V, M., M. T, A. M, Y. C D. R.
V (a): Comparative performance of the S rRNA
gene in DNA barcoding of amphibians. – Frontiers in Zoo lo-
gy, 2: .
V, M., D. R. V, F. G, H. B, J. K,
M. V A. M (): Multiple overseas dispersal in
amphibians. – Proceedings of the Royal Society of London B,
270: –.
V, M., S. W, D. R. V, W. R. B, F. G
A. M (): Natural colonization or introduction?
Phylo geographical relationships and morphological dieren-
tiation of house geckos (Hemidactylus) from Madagascar. –
Biological Journal of the Linnean Society, 83: –.
V, M., K. C. W, D. R. V D. C. L
(): Madagascar as a model region of species diversica-
tion. – Trends in Ecology and Evolution, 24: –.
V, D. R., K. C. W, F. A, J. K, F.
G M. V (): Vast underestimation of Mada-
gascar’s biodiversity evidenced by an integrative amphibian
inventory. – Proceedings of the National Academy of Sciences
of the United States of America, 106: –.
W, P. O., L. W, B. R, C. G, D.
R, Z. H. R, C. K, J. U.
G J. P. S (): Dry forests in Madagascar: ne-
glected and under pressure. International Forestry Review –
Special Issue: Global Dry Forests, 17: –.
200
W C et al.
Supplementary material
Supplementary Tables:
Table S. List of toponyms and corresponding GPS coordinates.
Table S. List of amphibian samples analysed for this study.
Table S. List of Isalo’s voucher specimens of amphibians un-
equivocally identied based on morphology and/or molecular
analyses.
Table S. List of reptile samples analysed for this study.
Table S. List of Isalo’s voucher specimens of reptiles unequivo-
cally identied based on morphology and/or molecular analyses.
Table S. Primer sequences and PCR conditions used in the
present study.
Table S. Pairwise genetic distances (p-distances) between and
within amphibian taxa according to S rRNA gene fragment se-
quence variation.
Table S. Pairwise genetic distances (p-distance) between and
within reptile taxa according to COI gene fragment sequence
variation.
I
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Supplementary Table S1. List of toponyms and corresponding GPS coordinates.
Locality Isalo Lat Long Locality Isalo Lat Long
Ambatovaky -23.403000° 45.102667° Kazofoty -22.123667° 45.408833°
Ambovo -22.508000° 45.352500° Lola -22.925667° 45.324667°
Amparambatomavo -22.301833° 45.356000° Malaso -22.591466° 45.357449°
Ampasibe -23.039167° 45.276167° Mandarano -23.414444° 45.111111°
Analalava Forest -22.587883° 45.130750° Marojana River -22.457167° 45.373333°
Analamangabe -22.484959° 45.384079° Morahariva -22.768667° 45.307000°
Andohaosy -22.516667° 45.333333° Motel d'Isalo
(Ranohira)
-22.552650° 45.422600°
Andohasahenina -22.833333° 45.188000° Namazaha Valley -22.536667° 45.374833°
Andozoky -22.483333° 45.300000° Oasis Mariany -22.631670° 45.363644°
Andranomangara -22.574028° 45.366361° Petit Nazareth valley -22.554167° 45.353833°
Andranombilahy -22.808500° 45.236000° Piscine Naturelle -22.559667° 45.371833°
Andranomena -22.740167° 45.275000° Ranohira -22.556233° 45.420005°
Andriamanero -22.367167° 45.392000° Ranohira Bas -22.489133° 45.391917°
Anjofo -22.369400° 45.361000° Reine de l'Isalo -22.623500° 45.339667°
Ankademoky -22.373333° 45.261667° Sahanafa -22.305833° 45.291333°
Antambonoa -22.371833° 45.291000° Sakamalio -22.434833° 45.255167°
Antoha -22.057833° 45.391833° Sakavato -23.483500° 44.934833°
Bemenara -22.801167° 45.250000° Sevalava -22.536944° 45.308889°
Bereketa -22.608333° 45.157833° Tsianerena -22.873000° 45.304333°
Bevato -22.506000° 45.355833° Tsimanolabero -22.576500° 45.383333°
Canyon des Makis -22.486497° 45.376649° Tsiombivositra -22.302500° 45.358333°
Canyon des Rats -22.479875° 45.376632° Tsitorina -22.058167° 45.356167°
Grotte des Portugais -22.301000° 45.306167° Vohimaro -22.290278° 45.358889°
Hazofotsy River
(Ranohira)
-22.555183° 45.476900° Vohitanana -22.635333° 45.341000°
Iambahatsy -22.405833° 45.268833° Zahavola -22.623000° 45.358667°
Ilakaka -22.695600° 45.221933°
II
Online Supplementary data – Walter Cocca et al.
Sample
ID
Fieldnumber Institutional collection
number
Family Subfamily Taxon Locality Cate gory 16S 3'
fragment
16S 5'
fragment
Cytb
ACP2352 ACZC 1976 UNAVAILABLE Mantellidae Boophinae Boophis doulioti Ranohira, Motel d’Isalo KX066561 - -
ACP2353 ACZC 1977 UNAVAILABLE Mantellidae Boophinae Boophis doulioti Ranohira, Motel d’Isalo KX066562 - -
ACP1443 FAZC 14716 MRSN A-uncatalogued Mantellidae Boophinae Boophis doulioti Zahavola KX066560 - -
AC655 FAZC 11891 MRSN A2827 Mantellidae Boophinae Boophis luteus Namazaha Valley KX066573 - -
AC656 FAZC 11890 MRSN A2828 Mantellidae Boophinae Boophis luteus Namazaha Valley KX066574 - -
AC657 FAZC 11870 MRSN A2829 Mantellidae Boophinae Boophis luteus Namazaha Valley KX066575 - -
ACP1455 FAZC 14747 UNAVAILABLE Mantellidae Boophinae Boophis obscurus Andriamanero KX066563 - -
ACP1456 FAZC 14748 UNAVAILABLE Mantellidae Boophinae Boophis obscurus Andriamanero KX066564 - -
ACP1458 FAZC 14753 UNAVAILABLE Mantellidae Boophinae Boophis obscurus Andriamanero KX066565 - -
ACP3360 FAZC 14343 MRSN A-uncatalogued Mantellidae Boophinae Boophis obscurus Anjofo MH063278 - -
AC400 FAZC 12735 MRSN A5387 Mantellidae Boophinae Boophis obscurus Canyon des Rats KX066566 - -
AC594 FAZC 12563 MRSN A4998 Mantellidae Boophinae Boophis occidentalis Andriamanero KX066569 - -
AC403 FAZC 12566 MRSN A5000 Mantellidae Boophinae Boophis occidentalis Andriamanero KX066571 - -
AC401 FAZC 12562 MRSN A5002 Mantellidae Boophinae Boophis occidentalis Andriamanero KX066568 - -
AC402 FAZC 12564 MRSN A5004 Mantellidae Boophinae Boophis occidentalis Andriamanero KX066572 - -
AC570 FAZC 12565 MRSN A5006 Mantellidae Boophinae Boophis occidentalis Andriamanero KX066570 - -
ACP2354 ACZC 1979 UNAVAILABLE Mantellidae Boophinae Boophis occidentalis Ranohira, Motel d’Isalo KX066567 - -
ACP1464 FAZC 14770 UNAVAILABLE Mantellidae Laliostominae Laliostoma labrosum Analalava Forest KX066666 - -
ACP1462 FAZC 14764 MRSN A6913 Mantellidae Laliostominae Laliostoma labrosum Malaso KX066668 - -
ACP1448 FAZC 14728 MRSN A-uncatalogued Mantellidae Laliostominae Laliostoma labrosum Namazaha Valley KX066655 - -
ACP1428 FAZC 14679 MRSN A6888 Mantellidae Laliostominae Laliostoma labrosum Ranohira Bas KX066653 - -
ACP1433 FAZC 14688 UNAVAILABLE Mantellidae Laliostominae Laliostoma labrosum Ranohira KX066654 - -
AC416 FAZC 12641 MRSN A5337 Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066660 - -
AC410 FAZC 12642 MRSN A5338 Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066663 - -
AC411 FAZC 12643 MRSN A5339 Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066656 - -
AC413 FAZC 12645 MRSN A5340 Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066658 - -
AC415 FAZC 12647 MRSN A5341 Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066667 - -
AC418 FAZC 12649 MRSN A5342 Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066665 - -
AC419 FAZC 12650 MRSN A5343 Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066661 - -
AC412 FAZC 12644 MRSN A-uncatalogued Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066657 - -
AC414 FAZC 12646 MRSN A-uncatalogued Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066659 - -
Supplementary Table S2. List of amphibian samples analysed for this study. For each tissue sample the ID, eldnumber, Institutional catalogue number, higher classication, species name, col-
lection locality and GenBank accession number are provided. AC and ACP, Angelica Crottini extraction codes; ACZC, Angelica Crottini Zoological Collection; ACZCV, Angelica Crottini Zoo-
logical Collection Voucher; FAZC, Franco Andreone Zoological Collection; MRSN A-, Amphibian collection of the Museo Regionale di Scienze Naturali of Torino, Italy; MT032, Meike Teschke
extraction code; SMF, Senckenberg Museum Frankfurt, Germany. $, individuals showing intermediate chromatic traits between M. betsileo and M. expactata; £, individual showing the chromatic
colouration typical of M. expectata; *, New species record; °, New Range extension; Category, Category of candidate species.
III
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample
ID
Fieldnumber Institutional collection
number
Family Subfamily Taxon Locality Cate gory 16S 3'
fragment
16S 5'
fragment
Cytb
AC417 FAZC 12648 MRSN A-uncatalogued Mantellidae Laliostominae Laliostoma labrosum Reine de l’Isalo KX066664 - -
AC420 FAZC 12652 MRSN A-uncatalogued Mantellidae Laliostominae Laliostoma labrosum Zahavola KX066662 - -
ACP1435 FAZC 14692 UNAVAILABLE Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Analalava Forest UCS KX066547 - -
ACP1419 FAZC 14659 PBZT-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Andranomangara UCS KX066548 - -
AC586 FAZC 12956 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066549 - -
AC593 FAZC 12957 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066550 - -
AC436 FAZC 12958 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066551 - -
AC437 FAZC 12959 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066552 - -
AC438 FAZC 12960 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066553 - -
AC439 FAZC 12961 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066554 - -
AC440 FAZC 12962 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066555 - -
AC441 FAZC 12963 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066556 - -
AC442 FAZC 12964 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066557 - -
AC443 FAZC 12965 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066558 - -
AC444 FAZC 12966 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio UCS KX066559 - -
ACP2521 FAZC 14348 MRSN A-uncatalogued Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Zahavola UCS KX066546 - -
ACP1421 FAZC 14665 MRSN A6900 Mantellidae Mantellinae Blommersia sp. a. wittei Ca05 “Isalo” Zahavola UCS KX066545 - -
AC430 FAZC 12567 MRSN A5309 Mantellidae Mantellinae Gephyromantis azzurrae Andriamanero KX066638 - -
AC431 FAZC 12568 MRSN A5310 Mantellidae Mantellinae Gephyromantis azzurrae Andriamanero KX066639 - -
AC432 FAZC 12569 MRSN A5311 Mantellidae Mantellinae Gephyromantis azzurrae Andriamanero KX066640 - -
ACP2298 ACZC 6914 ACZCV 0286 Mantellidae Mantellinae Gephyromantis azzurrae Andriamanero KX066641 - -
ACP2299 ACZC 6915 ACZCV 0287 Mantellidae Mantellinae Gephyromantis azzurrae Andriamanero KX066642 - -
ACP2300 ACZC 6916 ACZCV 0288 Mantellidae Mantellinae Gephyromantis azzurrae Andriamanero KX066645 - -
ACP2301 ACZC 6917 ACZCV 0289 Mantellidae Mantellinae Gephyromantis azzurrae Andriamanero KX066643 - -
ACP2302 ACZC 6918 ACZCV 0290 Mantellidae Mantellinae Gephyromantis azzurrae Andriamanero KX066644 - -
ACP2307 ACZC 6925 ACZCV 0293 Mantellidae Mantellinae Gephyromantis azzurrae Canyon des Rats KX066647 - -
ACP2308 ACZC 6926 ACZCV 0294 Mantellidae Mantellinae Gephyromantis azzurrae Canyon des Rats KX066646 - -
AC584 FAZC 12910 MRSN A5312 Mantellidae Mantellinae Gephyromantis azzurrae Iambahatsy KX066649 - -
ACP2287 ACZC 6896 ACZCV 0199 Mantellidae Mantellinae Gephyromantis azzurrae Namazaha Valley KX066648 - -
AC585 FAZC 12979
(MRSN A5314)
SMF 85859 Mantellidae Mantellinae Gephyromantis azzurrae Sakamalio KX066650 - -
AC433 FAZC 12980
(MRSN A5315)
SMF 85860 Mantellidae Mantellinae Gephyromantis azzurrae Sakamalio KX066651 - -
ACP2572 FAZC 12805 MRSN A5374 Mantellidae Mantellinae Gephyromantis azzurrae Tsitorina KX066652 - -
ACP2588 FAZC 13000 MRSN A5325 Mantellidae Mantellinae Gephyromantis corvus Ambovo KX066631 - -
ACP2574 FAZC 11813 MRSN A2783 Mantellidae Mantellinae Gephyromantis corvus Andohasahenina KX066637 - -
ACP2578 FAZC 11803 MRSN A2785 Mantellidae Mantellinae Gephyromantis corvus Andohasahenina KX066629 - -
IV
Online Supplementary data – Walter Cocca et al.
Sample
ID
Fieldnumber Institutional collection
number
Family Subfamily Taxon Locality Cate gory 16S 3'
fragment
16S 5'
fragment
Cytb
ACP2581 FAZC 11804 MRSN A2787 Mantellidae Mantellinae Gephyromantis corvus Andohasahenina KX066630 - -
ACP2573 FAZC 11993 MRSN A2784 Mantellidae Mantellinae Gephyromantis corvus Andranomena KX066627 - -
ACP2576 FAZC 11927 MRSN A2992 Mantellidae Mantellinae Gephyromantis corvus Ilakaka KX066628 - -
ACP2575 FAZC 14355 MRSN A-uncatalogued Mantellidae Mantellinae Gephyromantis corvus Isalo, no precise locality
info
KX066633 - -
ACP2597 FAZC 14630 MRSN A6928 Mantellidae Mantellinae Gephyromantis corvus Malaso KX066636 - -
ACP2587 FAZC 12661 MRSN A5323 Mantellidae Mantellinae Gephyromantis corvus Malaso KX066635 - -
ACP2285 ACZC 6894 ACZCV 0196 Mantellidae Mantellinae Gephyromantis corvus Malaso KX066621 - -
ACP2284 ACZC 6893 ACZCV 0197 Mantellidae Mantellinae Gephyromantis corvus Malaso KX066620 - -
ACP2286 ACZC 6895 ACZCV 0198 Mantellidae Mantellinae Gephyromantis corvus Malaso KX066622 - -
ACP2292 ACZC 6906 ACZCV 0297 Mantellidae Mantellinae Gephyromantis corvus Malaso KX066626 - -
ACP2278 ACZC 6870 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Malaso KX066615 - -
ACP2279 ACZC 6871 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Malaso KX066616 - -
ACP2280 ACZC 6882 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Malaso KX066617 - -
ACP2281 ACZC 6883 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Malaso KX066618 - -
ACP2282 ACZC 6884 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Malaso KX066619 - -
ACP2288 ACZC 6897 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Malaso KX066623 - -
ACP2289 ACZC 6898 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Malaso KX066624 - -
ACP2290 ACZC 6899 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Malaso KX066625 - -
ACP1453 FAZC 14741 MRSN A6916 Mantellidae Mantellinae Gephyromantis corvus Malaso KX066614 - -
AC575 FAZC 12951 MRSN A5313 Mantellidae Mantellinae Gephyromantis corvus Sakamalio KX066634 - -
ACP2586 FAZC 12859 MRSN A5373 Mantellidae Mantellinae Gephyromantis corvus Tsiombivositra KX066632 - -
ACP2585 FAZC 12758 MRSN A5324 Mantellidae Mantellinae Gephyromantis corvus Zahavola KX066613 - -
ACP2310 ACZC 6929 ACZCV 0292 Mantellidae Mantellinae Gephyromantis corvus Zahavola KX066612 - -
ACP2303 ACZC 6919 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Zahavola KX066609 - -
ACP2304 ACZC 6920 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Zahavola KX066610 - -
ACP2305 ACZC 6921 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Zahavola KX066611 - -
ACP1416 FAZC 14654 UNAVAILABLE Mantellidae Mantellinae Gephyromantis corvus Zahavola KX066608 - -
ACP2293 ACZC 6907 ACZCV 0200 Mantellidae Mantellinae Mantella betsileo Andriamanero KX066678 - -
AC115 FAZC 12808 MRSN A5217 Mantellidae Mantellinae Mantella betsileo Bereketa EF674843 - -
AC119 FAZC 12825 MRSN A-uncatalogued Mantellidae Mantellinae Mantella betsileo $ Sakavato EF674845 - -
AC160 FAZC 12879 MRSN A-uncatalogued Mantellidae Mantellinae Mantella betsileo Sahanafa EF674841 - -
AC161 FAZC 12880 MRSN A-uncatalogued Mantellidae Mantellinae Mantella betsileo Sahanafa EF674842 - -
AC169 FAZC 12692 MRSN A5211 Mantellidae Mantellinae Mantella betsileo Tsianerena EF674844 - -
MT032 FAZC 12769 MRSN A-uncatalogued Mantellidae Mantellinae Mantella betsileo Tsitorina KX066677 - -
AC379 FAZC 12938 MRSN A5153 Mantellidae Mantellinae Mantella expectata Ambovo KX066674 - -
AC017 FAZC E16 UNAVAILABLE Mantellidae Mantellinae Mantella expectata Andranomena EF674848 - -
V
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample
ID
Fieldnumber Institutional collection
number
Family Subfamily Taxon Locality Cate gory 16S 3'
fragment
16S 5'
fragment
Cytb
AC113 FAZC 12800.2 MRSN A-uncatalogued Mantellidae Mantellinae Mantella expectata Antoha - - MH063417
AC114 FAZC 12800.3 MRSN A-uncatalogued Mantellidae Mantellinae Mantella expectata Antoha - - MH063418
ACP2291 ACZC 6904 ACZCV 0298 Mantellidae Mantellinae Mantella expectata Malaso KX066675 - -
ACP2283 ACZC 6885 UNAVAILABLE Mantellidae Mantellinae Mantella expectata Malaso KX066676 - -
AC121 FAZC 12827 MRSN A5222 £ Mantellidae Mantellinae Mantella sp. a. expectata “South”* £ Sakavato DCL EF674847 - -
AC116 FAZC 12810 MRSN A5230 $ Mantellidae Mantellinae Mantella sp. a. expectata “South”* £ Sakavato DCL EF674846 - -
ACP1426 FAZC 14676 MRSN A6887 Mantellidae Mantellinae Mantidactylus femoralis Canyon des Makis KX066679 - -
ACP1447 FAZC 14727 MRSN A6890 Mantellidae Mantellinae Mantidactylus femoralis Namazaha Valley KX066680 - -
AC649 FAZC 13005 MRSN A5252 Mantellidae Mantellinae Mantidactylus noralottae Ambovo KX066599 - -
AC650 FAZC 13005
(MRSN A5253)
SMF 85861 Mantellidae Mantellinae Mantidactylus noralottae Ambovo KX066600 - -
AC651 FAZC 13008 MRSN A5254 Mantellidae Mantellinae Mantidactylus noralottae Ambovo KX066601 - -
AC652 FAZC 13005
(MRSN A5255)
SMF 85862 Mantellidae Mantellinae Mantidactylus noralottae Ambovo KX066602 - -
AC653 FAZC 13005
(MRSN A5256)
SMF 85863 Mantellidae Mantellinae Mantidactylus noralottae Ambovo KX066603 - -
AC654 FAZC 13005
(MRSN A5257)
SMF 85864 Mantellidae Mantellinae Mantidactylus noralottae Ambovo KX066604 - -
ACP1457 FAZC 14751 UNAVAILABLE Mantellidae Mantellinae Mantidactylus noralottae Andriamanero KX066598 - -
ACP3359 FAZC 14340 MRSN A-uncatalogued Mantellidae Mantellinae Mantidactylus noralottae Anjofo MH063279 - -
ACP2309 ACZC 6928 ACZCV 0295 Mantellidae Mantellinae Mantidactylus noralottae Canyon des Rats KX066606 - -
ACP2306 ACZC 6924 UNAVAILABLE Mantellidae Mantellinae Mantidactylus noralottae Canyon des Rats KX066605 - -
ACP2582 FAZC 14750 MRSN A6877 Mantellidae Mantellinae Mantidactylus noralottae Andriamanero KX066607 - -
ACP1411 FAZC 14645 MRSN A6891 Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Analalava Forest CCS KX066581 - -
ACP1465 FAZC 14771 MRSN A-uncatalogued Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Analalava Forest CCS KX066580 - -
ACP1459 FAZC 14754 UNAVAILABLE Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Andriamanero CCS KX066578 - -
ACP1460 FAZC 14755 UNAVAILABLE Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Andriamanero CCS KX066579 - -
AC434 FAZC 12737 MRSN A5397 Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Canyon des Makis CCS KX066585 - -
AC435 FAZC 12775 MRSN A-uncatalogued Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Kazofoty CCS KX066586 - -
ACP1446 FAZC 14725 UNAVAILABLE Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Namazaha Valley CCS KX066577 - -
AC660 FAZC 12797 MRSN A5398 Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Tsitorina CCS KX066587 - -
ACP1417 FAZC 14655 UNAVAILABLE Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Zahavola CCS KX066582 - -
ACP1442 FAZC 14711 PBZT-uncatalogued Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Zahavola CCS KX066584 - -
ACP1450 FAZC 14732 MRSN A6912 Mantellidae Mantellinae Mantidactylus sp. a. ulcerosus Ca14 “Isalo” Zahavola CCS KX066583 - -
ACP2294 ACZC 6908 ACZCV 0281 Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Andriamanero UCS KX066593 - -
ACP2295 ACZC 6909 ACZCV 0282 Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Andriamanero UCS KX066594 - -
ACP2296 ACZC 6911 ACZCV 0283 Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Andriamanero UCS KX066591 - -
ACP2297 ACZC 6912 ACZCV 0284 Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Andriamanero UCS KX066592 - -
VI
Online Supplementary data – Walter Cocca et al.
Sample
ID
Fieldnumber Institutional collection
number
Family Subfamily Taxon Locality Cate gory 16S 3'
fragment
16S 5'
fragment
Cytb
ACP1452 FAZC 14736 UNAVAILABLE Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Andriamanero UCS KX066595 - -
ACP1454 FAZC 14745 MRSN A6893 Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Andriamanero UCS KX066590 - -
ACP2583 FAZC 14737 MRSN A6885 Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Andriamanero UCS KX066596 - -
ACP1444 FAZC 14719 MRSN A6889 Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Namazaha Valley UCS KX066589 - -
ACP1449 FAZC 14729 MRSN A6901 Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Namazaha Valley UCS KX066588 - -
AC1267 FAZC 14351 UNAVAILABLE Mantellidae Mantellinae Mantidactylus sp. a. multiplicatus Ca65 “Isalo”* Piscine Naturelle UCS KX066597 - -
AC576 FAZC 12894 MRSN A5432 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Ankademoky CCS KX066681 - -
AC577 FAZC 12896 MRSN A5434 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Ankademoky CCS KX066682 - -
AC426 FAZC 12898 MRSN A5435 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Ankademoky CCS KX066683 - -
AC427 FAZC 12908 MRSN A5423 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Iambahatsy CCS KX066684 - -
AC578 FAZC 12909 MRSN A5424 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Iambahatsy CCS KX066685 - -
AC429 FAZC 12917 MRSN A5425 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Iambahatsy CCS KX066687 - -
AC581 FAZC 12919 MRSN A5426 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Iambahatsy CCS KX066689 - -
AC580 FAZC 12918 MRSN A5428 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Iambahatsy CCS KX066688 - -
AC579 FAZC 12911 MRSN A5436 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Iambahatsy CCS KX066686 - -
AC582 FAZC 12947 MRSN A5427 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Sakamalio CCS KX066690 - -
AC583 FAZC 12950 MRSN A5429 Mantellidae Mantellinae Mantidactylus sp. a. cowani Ca48 “small” Sakamalio CCS KX066691 - -
ACP1432 FAZC 14686 MRSN A-uncatalogued Microhylidae Dyscophinae Dyscophus insularis Ranohira KX066576 - -
ACP3570 FAZC 14368 MRSN A-uncatalogued Microhylidae Dyscophinae Dyscophus insularis Ranohira MH063280 - -
ACP3573 FAZC 14369 MRSN A-uncatalogued Microhylidae Scaphiophryninae Scaphiophryne brevis Ranohira, Motel d’Isalo - MH063338 -
ACP1431 FAZC 14685 MRSN A6924 Microhylidae Scaphiophryninae Scaphiophryne brevis Ranohira KX066693 - -
AC587 FAZC 12734 MRSN A5040 Microhylidae Scaphiophryninae Scaphiophryne brevis Reine de l’Isalo KX066694 - -
AC448 FAZC 12754 MRSN A5041 Microhylidae Scaphiophryninae Scaphiophryne brevis Reine de l’Isalo KX066695 - -
AC058 FAZC 13026 MRSN A5840 Microhylidae Scaphiophryninae Scaphiophryne gottlebei Bevato EF674849 - -
AC048 FAZC 12533 MRSN A5841 Microhylidae Scaphiophryninae Scaphiophryne gottlebei Malaso EF674850 - -
ACP2533 ACZC 6869 UNAVAILABLE Microhylidae Scaphiophryninae Scaphiophryne gottlebei Malaso KX066696 - -
ACP2534 FAZC 14674 PBZT-uncatalogued Microhylidae Scaphiophryninae Scaphiophryne gottlebei Malaso KX066697 - -
AC001 FAZC VS3 MRSN A-uncatalogued Microhylidae Scaphiophryninae Scaphiophryne gottlebei Zahavola EF674851 - -
ACP3362 FAZC 14360 MRSN A-uncatalogued Microhylidae Scaphiophryninae Scaphiophryne sp. a. calcarata Ca01 Isalo, no precise locality
info
UCS MH063281 - -
ACP3572 FAZC 14358 MRSN A-uncatalogued Microhylidae Scaphiophryninae Scaphiophryne sp. a. calcarata Ca01 Ranohira, Motel d’Isalo UCS MH063282 - -
ACP3571 FAZC 14359 MRSN A-uncatalogued Microhylidae Scaphiophryninae Scaphiophryne sp. a. calcarata Ca01 Ranohira, Motel d’Isalo UCS MH063283 - -
ACP1420 FAZC 14663 MRSN A6895 Microhylidae Scaphiophryninae Scaphiophryne sp. a. calcarata Ca02*° Ranohira CCS KX066692 - -
AC408 FAZC 12736 MRSN A5018 Hyperoliidae _ Heterixalus luteostriatus Canyon des Makis KX066673 - -
ACP1439 FAZC 14700 MRSN A-uncatalogued Hyperoliidae _ Heterixalus luteostriatus Ranohira KX066672 - -
ACP1410 FAZC 14641 MRSN A6896 Ptychadenidae _ Ptychadena mascareniensis Analalava Forest KX066670 - -
ACP1425 FAZC 14675 PBZT-uncatalogued Ptychadenidae _ Ptychadena mascareniensis Analamangabe KX066671 - -
ACP1461 FAZC 14763 MRSN A-uncatalogued Ptychadenidae _ Ptychadena mascareniensis Malaso KX066669 - -
VII
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Supplementary Table S3. List of Isalo’s voucher specimens unequivocally identied based on morphology and/or molecular analyses. e distribution of each species includes localities records from
museological specimens, molecular data from this study, GenBank and literature (mostly Mercurio et al. 2008; Glaw & Vences 2007). ACZCV, Angelica Crottini Zoological Collection Voucher;
FAZC, Franco Andreone Zoological Collection; MRSN A-, Amphibian collection of the Museo Regionale di Scienze Naturali of Torino, Italy; PBZT, Parc Botanique et Zoologique de Tsimbazaza,
Antananarivo, Madagascar; SMF, Senckenberg Museum Frankfurt, Germany. $, individuals showing intermediate chromatic traits between M. betsileo and M. expectata; £, individual showing the
chromatic colouration typical of M. expectata; *, New species record; °, New Range extension.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 11805 MRSN A2982 Mantellidae Boophis (Sahona) doulioti (Angel, 1934) Andohasahenina Andohasahenina, Andranomena, Can-
yon des Makis, Iambahatsy, Mandara-
no, Marojana River, Namazaha Valley,
Ranohira, Vohimaro, Zahavola
is frog is common in southern and western Madagascar
and, in Isalo, it lives in dierent habitats, like riverbeds
with slow-owing permanent waters or temporary swamps
inside savanna, but it can also be found within villages
and town. Dierent samples from Isalo are genetically
uniform.
FAZC 11965 MRSN A2981 Mantellidae Boophis (Sahona) doulioti (Angel, 1934) Andranomena
UNAVAIL-
ABLE
MRSN A767 Mantellidae Boophis (Sahona) doulioti (Angel, 1934) Canyon des
Makis
FAZC 12793 MRSN A5001 Mantellidae Boophis (Sahona) doulioti (Angel, 1934) Vohimaro
FAZC 12760 MRSN A4999 Mantellidae Boophis (Sahona) doulioti (Angel, 1934) Zahavola
FAZC 12555 MRSN A5003 Mantellidae Boophis (Sahona) doulioti (Angel, 1934) Zahavola
FAZC 14716 MRSN A-
uncatalogued
Mantellidae Boophis (Sahona) doulioti (Angel, 1934) Zahavola
FAZC 11891 MRSN A2827 Mantellidae Boophis (Boophis) luteus (Boulenger, 1882) Namazaha Valley Namazaha Valley is treefrog is present in canyons with evergreen gallery
vegetation along permanent streams. e three avail-
able samples of this species from Namazaha Forest have
a genetic diversity of 1.5% (p-distance transformed into
percent).
FAZC 11890 MRSN A2828 Mantellidae Boophis (Boophis) luteus (Boulenger, 1882) Namazaha Valley
FAZC 11870 MRSN A2829 Mantellidae Boophis (Boophis) luteus (Boulenger, 1882) Namazaha Valley
FAZC12664 MRSN A2779 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Andranombilahy Andohasahenina, Andranombilahy,
Andriamanero, Anjofo, Ankademoky,
Canyon des Makis, Canyon des Rats,
Iambahatsy, Marojana River, Namazaha
Valley, Vallée du Petit Nazareth,
Zahavola
is species has recently been resurrected from the
synonymy with Boophis goudoti (Glaw et al. 2010) and in
Mercurio et al. (2008) it was referred as B. cf. periegetes.
In Isalo these frogs can be found on the ground or
perched on branches and rocks in areas near to streams
even with small amount of water but constantly owing.
Dierent samples from Isalo are genetically uniform.
FAZC 12365 MRSN A2780 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Andranombilahy
FAZC 11928 MRSN A2781 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Andranombilahy
FAZC 11929 MRSN A2782 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Andranombilahy
FAZC 14343 MRSN A-
uncatalogued
Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Anjofo
FAZC 12823 MRSN A5388 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Ankademoky
VIII
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12338 MRSN A2856 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Canyon des
Makis
FAZC 12735 MRSN A5387 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Canyon des Rats
FAZC 12905 MRSN A5389 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Iambahatsy
FAZC 12906 MRSN A5390 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Iambahatsy
FAZC 12930 MRSN A5391 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Iambahatsy
FAZC 11876 MRSN A2853 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Namazaha Valley
FAZC 12342 MRSN A2854 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Namazaha Valley
FAZC 12343 MRSN A2855 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Namazaha Valley
FAZC 11884 MRSN A2857 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Namazaha Valley
FAZC 12344 MRSN A2858 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Namazaha Valley
FAZC 12042 MRSN A4104 Mantellidae Boophis (Boophis) obscurus (Boettger, 1913) Vallée du Petit
Nazareth
FAZC 12563 MRSN A4998 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Andriamanero Andriamanero, Canyon des Makis,
Iambahatsy, Namazaha Valley, Rano-
hira
is species is largely arboreal and is found along streams
with permanent or temporary waters in dry deciduous
forests. In 2009 one individual was found in the garden of
an Hotel in the town of Ranohira. Dierent samples from
Isalo are genetically uniform.
FAZC 12566 MRSN A5000 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Andriamanero
FAZC 12562 MRSN A5002 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Andriamanero
FAZC 12564 MRSN A5004 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Andriamanero
FAZC 12565 MRSN A5006 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Andriamanero
FAZC 12592 MRSN A5320 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Andriamanero
FAZC 12579 MRSN A5847 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Andriamanero
FAZC 12578 MRSN A5869 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Andriamanero
UNAVAIL-
ABLE
MRSN A754 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Canyon des
Makis
FAZC 12336 MRSN A2709 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Canyon des
Makis
FAZC 12337 MRSN A2711 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Canyon des
Makis
FAZC 12931 MRSN A5321 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Iambahatsy
FAZC 12356 MRSN A2706 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Isalo, no precise
locality info
FAZC 12357 MRSN A2707 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Isalo, no precise
locality info
FAZC 11878 MRSN A2708 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Namazaha Valley
FAZC 11877 MRSN A2710 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Namazaha Valley
FAZC 11873 MRSN A2712 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Namazaha Valley
IX
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
UNAVAIL-
ABLE
MRSN A2884 Mantellidae Boophis (Boophis) occidentalis Glaw & Vences, 1994 Isalo, no precise
locality info
FAZC 11850 MRSN A2761 Mantellidae Laliostoma labrosum (Cope, 1868) Andohasahenina Andohasahenina, Andranomena,
Andriamanero, Bemenara, Analalava
Forest, Iambahatsy, Lola, Malaso,
Namazaha Valley, Oasis Mariany,
Ranohira, Reine de l’Isalo, Sevalava,
Zahavola, Isalo, no precise locality info.
is is an arid-adapted species inhabiting all of western
Madagascar. A recent phylogeographic analyses revealed
Isalo is in the contact zone between two main genetic
subgroups, the central and the southern lineages (Pabijan
et al. 2015). e samples analysed for this study all belong
to the central lineage, which also in Pabijan et al. (2015)
seems to be the more abundant. e genetic distance
between these two lineages is of ca. 1%.
FAZC 11963 MRSN A2760 Mantellidae Laliostoma labrosum (Cope, 1868) Andranomena
FAZC 12907 MRSN A5346 Mantellidae Laliostoma labrosum (Cope, 1868) Iambahatsy
FAZC 12755 MRSN A5344 Mantellidae Laliostoma labrosum (Cope, 1868) Lola
FAZC 12756 MRSN A5345 Mantellidae Laliostoma labrosum (Cope, 1868) Lola
FAZC 12833 MRSN A5856 Mantellidae Laliostoma labrosum (Cope, 1868) Lola
FAZC 12832 MRSN A5884 Mantellidae Laliostoma labrosum (Cope, 1868) Lola
FAZC 12851 MRSN A6446 Mantellidae Laliostoma labrosum (Cope, 1868) Lola
FAZC 14764 MRSN A6913 Mantellidae Laliostoma labrosum (Cope, 1868) Malaso
FAZC 14728 MRSN A-
uncatalogued
Mantellidae Laliostoma labrosum (Cope, 1868) Namazaha Valley
FAZC 12685 MRSN A5880 Mantellidae Laliostoma labrosum (Cope, 1868) Oasis Mariany
FAZC 14679 MRSN A6888 Mantellidae Laliostoma labrosum (Cope, 1868) Ranohira Bas
FAZC 12634 MRSN A5336 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12641 MRSN A5337 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12642 MRSN A5338 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12643 MRSN A5339 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12645 MRSN A5340 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12647 MRSN A5341 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12649 MRSN A5342 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12650 MRSN A5343 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12653 MRSN A5870 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12654 MRSN A5879 Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12644 MRSN A-
uncatalogued
Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12646 MRSN A-
uncatalogued
Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12648 MRSN A-
uncatalogued
Mantellidae Laliostoma labrosum (Cope, 1868) Reine de l’Isalo
FAZC 12626 MRSN A5858 Mantellidae Laliostoma labrosum (Cope, 1868) Sevalava
X
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12652 MRSN A-
uncatalogued
Mantellidae Laliostoma labrosum (Cope, 1868) Zahavola
FAZC 11807 MRSN A2957 Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Andohasahenina Andohasahenina, Andranomangara,
Andriamanero, Analalava Forest,
Ranohira, Sakamalio, Zahavola
is undescribed species was referred to as B. sp. a. wittei
in Mercurio et al. 2008. is species is closely related
to B. wittei, to which is quite similar in morphology and
colouration. Some bioacoustics dierences exist, although
the mitochondrial phylogeography of the species does not
agree with the call dierences (M. Vences, pers. obser).
e genetic dierence between this UCS and B. wittei is of
about 7%, but dierent samples from Isalo are genetically
uniform.
FAZC 11808 MRSN A2958 Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Andohasahenina
FAZC 14659 PBZT-uncata-
logued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Andranomangara
FAZC 12988 MRSN A5855 Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12987 MRSN A5864 Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12989 MRSN A5867 Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12956 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12957 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12958 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12959 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12960 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12961 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12962 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12963 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12964 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12965 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 12966 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Sakamalio
FAZC 14348 MRSN A-
uncatalogued
Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Zahavola
XI
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 14665 MRSN A6900 Mantellidae Blommersia sp. a. wittei Ca05 “Isalo” Zahavola
FAZC 12567 MRSN A5309 Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Andriamanero Andriamanero, Canyon des rats, Iam-
bahatsy, Namazaha Valley, Sakamalio,
Tsitorina
is species belongs to the same subgenus (Phylacomantis)
of G. corvus, with which it occurs sympatrically, and in
some instances syntopically. Even if the co-existence of
two sympatric Phylacomantis species in Isalo is undoubt-
ful (p-distance = 9%), recent collected data urges for a
taxonomic revision of the Isalo species. is recently de-
scribed species is generally found within deep and forested
canyons. In comparison to the published data (Mercu-
rio et al. 2008, Mercurio & Andreone 2007) we here
report on three new localities within Isalo: Canyon des
rats, Namazaha Forest, and Tsitorina. Tsitorina reparesent
the northernmost known locality for the species and it is
found outside the Isalo National Park borders. Samples
from Sakamalio, Iambahatsy and Tsitorina are more simi-
lar to each other than the samples from Andriamanero,
Canyon des Rats and Namazaha Valley. e genetic
distance of these two groups is of about 1% (p-distance
transformed into percent).
FAZC 12568 MRSN A5310 Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Andriamanero
FAZC 12569 MRSN A5311 Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Andriamanero
ACZCV 0286 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Andriamanero
ACZCV 0287 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Andriamanero
ACZCV 0288 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Andriamanero
ACZCV 0289 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Andriamanero
ACZCV 0290 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Andriamanero
ACZCV 0293 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Canyon des Rats
ACZCV 0294 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Canyon des Rats
FAZC 12910 MRSN A5312 Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Iambahatsy
ACZCV 0199 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Namazaha Valley
XII
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12979
(MRSN
A5314)
SMF 85859 Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Sakamalio
FAZC 12980
(MRSN
A5315)
SMF 85860 Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Sakamalio
FAZC 12805 MRSN A5374 Mantellidae Gephyromantis (Phylacomantis) azzurrae Mercurio &
Andreone, 2007
Tsitorina
FAZC 13000 MRSN A5325 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Ambovo Ambovo, Andohasahenina, Andranom-
ena, Ilakaka, Malaso, Sakamalio,
Tsiombivositra, Zahavola
is species was for long time considered a microende-
mism of Isalo, but a recent survey recovered this species
also in Makay (Rakotondravony & Goodman 2011),
although genetic analyses are still needed to conrm spe-
cies identity. is species lives along streams and is locally
common in small, shallow canyons with temporary pools.
Gephyromantis corvus can be found in syntopy with its
congeneric G. azzurrae, although it seems that these two
species generally prefer two dierent habitats, with G.
azzurrae inhabiting forested deep canyon, while G. corvus
open shallow canyons. However, a taxonomic revision of
this sympatric sister species is currently needed to rene
species identity of G. corvus, whose name has probably
been misapplied. Due to this confusion, we here decided
to provide only a partial list of localities for its distribu-
tion. is list only includes individuals that have been
screened molecularly. Noteworthy, G. azzurrae paratype
specimen MRSN A5313 (Fig. 4) is here assigned to G.
corvus based on molecular data and morphological inspec-
tion of the specimen. is specimen was not analysed
genetically at the time of publication of the G. azzurrae
description (Mercurio & Andreone 2007) and was er-
roneously assigned to this new species.
FAZC 13001 MRSN A5326 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Ambovo
FAZC 11813 MRSN A2783 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Andohasahenina
FAZC 11803 MRSN A2785 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Andohasahenina
FAZC 11804 MRSN A2787 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Andohasahenina
FAZC 11921 MRSN A2963 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Andohasahenina
FAZC 11993 MRSN A2784 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Andranomena
XIII
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 11964 MRSN A2786 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Andranomena
FAZC 11838 MRSN A3181 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Ilakaka
FAZC 12041 MRSN A4251 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Ilakaka
FAZC 11801 MRSN A4262 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Ilakaka
FAZC 11792 MRSN A4776 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Ilakaka
FAZC 11950 MRSN A6447 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Ilakaka
FAZC 14355 MRSN A-
uncatalogued
Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Isalo, no precise
locality info
FAZC 14630 MRSN A6928 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Malaso
FAZC 12627 MRSN A5322 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Malaso
FAZC 12661 MRSN A5323 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Malaso
ACZCV 0196 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Malaso
ACZCV 0197 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Malaso
ACZCV 0198 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Malaso
ACZCV 0297 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Malaso
FAZC 14741 MRSN A6916 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Malaso
FAZC 12951 MRSN A5313 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Sakamalio
FAZC 12859 MRSN A5373 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Tsiombivositra
FAZC 12021 MRSN A2799 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Zahavola
FAZC 12020 MRSN A2800 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Zahavola
FAZC 12758 MRSN A5324 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Zahavola
XIV
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12848 MRSN A5872 Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Zahavola
ACZCV 0292 UNAVAIL-
ABLE
Mantellidae Gephyromantis (Phylacomantis) corvus (Glaw & Vences,
1994)
Zahavola
FAZC 11927 MRSN A2992 Mantellidae Gephyromantis (Phylacomantis) cf. corvus Andranombilahy Unassigned
FAZC 12596 MRSN A5372 Mantellidae Gephyromantis (Phylacomantis) cf. corvus Andriamanero Unassigned
ACZCV 0200 UNAVAIL-
ABLE
Mantellidae Mantella betsileo (Grandidier, 1872) Andriamanero Andrehitogna, Andriamanero, Antoha,
Bereketa, Kazofoty, Sahanafa, Sakavato,
Tsianerena, Tsitorina
is species generally occurs in small temporary streams
or ponds in open savannahs, although it can also be found
in canyons with vegetation. In Sahanafa and Tsianerena
this species was found syntopically with M. expectata
(see Fig. 3A (MRSN A5204) and in Sakavato with M. sp.
a. expectata “South” (Fig. 3D-E; MRSN A5222, MRSN
A5230) (Mercurio et al. 2008, Crottini et al. 2008).
Dierent samples from Isalo are genetically uniform at the
analysed 16S rRNA gene fragment.
FAZC 12784 MRSN A5232 Mantellidae Mantella betsileo (Grandidier, 1872) Antoha
FAZC 12785 MRSN A5233 Mantellidae Mantella betsileo (Grandidier, 1872) Antoha
FAZC 12786 MRSN A5235 Mantellidae Mantella betsileo (Grandidier, 1872) Antoha
FAZC 12808 MRSN A5217 Mantellidae Mantella betsileo (Grandidier, 1872) Bereketa
FAZC 12776 MRSN A5237 Mantellidae Mantella betsileo (Grandidier, 1872) Kazofoty
FAZC 12879 MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Sahanafa
FAZC 12880 MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Sahanafa
FAZC 12825
$
MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Sakavato
FAZC 12692 MRSN A5211 Mantellidae Mantella betsileo (Grandidier, 1872) Tsianerena
FAZC 12783 MRSN A5225 Mantellidae Mantella betsileo (Grandidier, 1872) Tsitorina
FAZC 12772 MRSN A5226 Mantellidae Mantella betsileo (Grandidier, 1872) Tsitorina
FAZC 12771 MRSN A5228 Mantellidae Mantella betsileo (Grandidier, 1872) Tsitorina
FAZC 12779 MRSN A5229 Mantellidae Mantella betsileo (Grandidier, 1872) Tsitorina
FAZC 12770 MRSN A5231 Mantellidae Mantella betsileo (Grandidier, 1872) Tsitorina
FAZC 12778 MRSN A5234 Mantellidae Mantella betsileo (Grandidier, 1872) Tsitorina
FAZC 12773 MRSN A5236 Mantellidae Mantella betsileo (Grandidier, 1872) Tsitorina
FAZC 12781 MRSN A5238 Mantellidae Mantella betsileo (Grandidier, 1872) Tsitorina
FAZC 12769 MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Tsitorina
FAZC 12572 MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Isalo, no precise
locality info
XV
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12780 MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Isalo, no precise
locality info
FAZC 12788 MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Isalo, no precise
locality info
FAZC 12782 MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Isalo, no precise
locality info
FAZC 12571 MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Isalo, no precise
locality info
FAZC 12774 MRSN A-
uncatalogued
Mantellidae Mantella betsileo (Grandidier, 1872) Isalo, no precise
locality info
FAZC 12818 MRSN A5158 Mantellidae Mantella expectata Busse & Böhme, 1992 Ambatovaky Ambatovaky, Ambovo, Amparambat-
omavo, Ampasibe, Andohaosy, Ando-
hasahenina, Andozoky, Andranomena,
Andravaka, Antambonoa, Antoha, Be-
menara, Bereketa, Grotte des Portugais,
Iambahatsy, Isalo Oasis, Lola, Malaso,
Morahariva, Petit Nazareth, Ranohira,
Reine de l’Isalo, Sahanafa, Sakamalio,
Sakavato, Tsianerena, Tsimanolabero,
Tsiombivositra, Vohitanana, Zahavola
is is an Isalo micro-endemism (Fig. 3A-C). It prefers
open sun-exposed areas, close to canyons and temporary
pools (Mercurio & Andreone 2006, Mercurio et al.
2008). It may be locally very abundant and likely widely
distributed all through the Isalo Massif. For this, the col-
lecting activity for the pet-trade appears not having large
impacts on the natural populations (Rabemanajara et
al. 2008). A phylogeographic analyses reveal a genetic
substructuring with less genetic variability in the North as
opposite to the South (Crottini et al. 2008). Interestingly,
in Antoha, where only M. betsileo were thus far reported,
at least two tadpoles (FAZC 12800.2 and FAZC 12800.3)
were unequivocally identied as M. expectata (this study).
Dierent samples from Isalo are genetically uniform at the
analysed 16S rRNA gene fragment.
FAZC 12817 MRSN A5190 Mantellidae Mantella expectata Busse & Böhme, 1992 Ambatovaky
FAZC 12938 MRSN A5153 Mantellidae Mantella expectata Busse & Böhme, 1992 Ambovo
FAZC 12942 MRSN A5171 Mantellidae Mantella expectata Busse & Böhme, 1992 Ambovo
FAZC 12992 MRSN A5178 Mantellidae Mantella expectata Busse & Böhme, 1992 Ambovo
FAZC 12993 MRSN A5219 Mantellidae Mantella expectata Busse & Böhme, 1992 Ambovo
FAZC 12864 MRSN A5199 Mantellidae Mantella expectata Busse & Böhme, 1992 Amparambato-
mavo
FAZC 12732 MRSN A5152 Mantellidae Mantella expectata Busse & Böhme, 1992 Ampasibe
FAZC 12729 MRSN A5174 Mantellidae Mantella expectata Busse & Böhme, 1992 Ampasibe
FAZC 12730 MRSN A5200 Mantellidae Mantella expectata Busse & Böhme, 1992 Ampasibe
FAZC 12726 MRSN A5202 Mantellidae Mantella expectata Busse & Böhme, 1992 Ampasibe
FAZC 12728 MRSN A5213 Mantellidae Mantella expectata Busse & Böhme, 1992 Ampasibe
FAZC 12731 MRSN A5218 Mantellidae Mantella expectata Busse & Böhme, 1992 Ampasibe
FAZC 12944 MRSN A5175 Mantellidae Mantella expectata Busse & Böhme, 1992 Andohaosy
FAZC 12943 MRSN A5185 Mantellidae Mantella expectata Busse & Böhme, 1992 Andohaosy
FAZC 11812 MRSN A3082 Mantellidae Mantella expectata Busse & Böhme, 1992 Andohasahenina
XVI
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 11855 MRSN A3228 Mantellidae Mantella expectata Busse & Böhme, 1992 Andohasahenina
FAZC 11802 MRSN A3435 Mantellidae Mantella expectata Busse & Böhme, 1992 Andohasahenina
FAZC 11855 MRSN A-
uncatalogued
Mantellidae Mantella expectata Busse & Böhme, 1992 Andohasahenina
FAZC 12941 MRSN A5198 Mantellidae Mantella expectata Busse & Böhme, 1992 Andozoky
FAZC 12940 MRSN A5215 Mantellidae Mantella expectata Busse & Böhme, 1992 Andozoky
FAZC 12001 MRSN A3191 Mantellidae Mantella expectata Busse & Böhme, 1992 Andranomena
FAZC 12011 MRSN A3432 Mantellidae Mantella expectata Busse & Böhme, 1992 Andranomena
FAZC 12010 MRSN A3433 Mantellidae Mantella expectata Busse & Böhme, 1992 Andranomena
FAZC 11980 MRSN A4695 Mantellidae Mantella expectata Busse & Böhme, 1992 Andravaka
FAZC 12887 MRSN A5143 Mantellidae Mantella expectata Busse & Böhme, 1992 Antambonoa
FAZC 12884 MRSN A5148 Mantellidae Mantella expectata Busse & Böhme, 1992 Antambonoa
FAZC 12886 MRSN A5189 Mantellidae Mantella expectata Busse & Böhme, 1992 Antambonoa
FAZC 12888 MRSN A5205 Mantellidae Mantella expectata Busse & Böhme, 1992 Antambonoa
FAZC
12800.2
MRSN A-
uncatalogued
Mantellidae Mantella expectata Busse & Böhme, 1992 Antoha
FAZC
12800.3
MRSN A-
uncatalogued
Mantellidae Mantella expectata Busse & Böhme, 1992 Antoha
FAZC 11956 MRSN A3080 Mantellidae Mantella expectata Busse & Böhme, 1992 Bemenara
FAZC 11958 MRSN A3083 Mantellidae Mantella expectata Busse & Böhme, 1992 Bemenara
FAZC 11959 MRSN A3084 Mantellidae Mantella expectata Busse & Böhme, 1992 Bemenara
FAZC 11955 MRSN A3086 Mantellidae Mantella expectata Busse & Böhme, 1992 Bemenara
FAZC 11954 MRSN A3189 Mantellidae Mantella expectata Busse & Böhme, 1992 Bemenara
FAZC 11959 MRSN A-
uncatalogued
Mantellidae Mantella expectata Busse & Böhme, 1992 Bemenara
FAZC 12870 MRSN A5220 Mantellidae Mantella expectata Busse & Böhme, 1992 Grotte des Por-
tugais
FAZC 12924 MRSN A5147 Mantellidae Mantella expectata Busse & Böhme, 1992 Iambahatsy
FAZC 12922 MRSN A5155 Mantellidae Mantella expectata Busse & Böhme, 1992 Iambahatsy
FAZC 12923 MRSN A5193 Mantellidae Mantella expectata Busse & Böhme, 1992 Iambahatsy
FAZC 12920 MRSN A5214 Mantellidae Mantella expectata Busse & Böhme, 1992 Iambahatsy
FAZC 12603 MRSN A5149 Mantellidae Mantella expectata Busse & Böhme, 1992 Malaso
FAZC 12600 MRSN A5173 Mantellidae Mantella expectata Busse & Böhme, 1992 Malaso
FAZC 12604 MRSN A5191 Mantellidae Mantella expectata Busse & Böhme, 1992 Malaso
FAZC 12605 MRSN A5223 Mantellidae Mantella expectata Busse & Böhme, 1992 Malaso
ACZCV 0298 UNAVAIL-
ABLE
Mantellidae Mantella expectata Busse & Böhme, 1992 Malaso
FAZC 12674 MRSN A5151 Mantellidae Mantella expectata Busse & Böhme, 1992 Morahariva
XVII
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12676 MRSN A5166 Mantellidae Mantella expectata Busse & Böhme, 1992 Morahariva
FAZC 12671 MRSN A5179 Mantellidae Mantella expectata Busse & Böhme, 1992 Morahariva
FAZC 12675 MRSN A5181 Mantellidae Mantella expectata Busse & Böhme, 1992 Morahariva
FAZC 12670 MRSN A5192 Mantellidae Mantella expectata Busse & Böhme, 1992 Morahariva
FAZC 12672 MRSN A5197 Mantellidae Mantella expectata Busse & Böhme, 1992 Morahariva
FAZC 12673 MRSN A5209 Mantellidae Mantella expectata Busse & Böhme, 1992 Morahariva
FAZC 12658 MRSN A5195 Mantellidae Mantella expectata Busse & Böhme, 1992 Reine de l’Isalo
FAZC 12659 MRSN A5216 Mantellidae Mantella expectata Busse & Böhme, 1992 Reine de l’Isalo
FAZC 12878 MRSN A5154 Mantellidae Mantella expectata Busse & Böhme, 1992 Sahanafa
FAZC 12877 MRSN A5162 Mantellidae Mantella expectata Busse & Böhme, 1992 Sahanafa
FAZC 12871 MRSN A5208 Mantellidae Mantella expectata Busse & Böhme, 1992 Sahanafa
FAZC 12946 MRSN A5159 Mantellidae Mantella expectata Busse & Böhme, 1992 Sakamalio
FAZC 12954 MRSN A5167 Mantellidae Mantella expectata Busse & Böhme, 1992 Sakamalio
FAZC 12952 MRSN A5194 Mantellidae Mantella expectata Busse & Böhme, 1992 Sakamalio
FAZC 12955 MRSN A5203 Mantellidae Mantella expectata Busse & Böhme, 1992 Sakamalio
FAZC 12935 MRSN A5224 Mantellidae Mantella expectata Busse & Böhme, 1992 Sakamalio
FAZC 12826 MRSN A5204 Mantellidae Mantella expectata Busse & Böhme, 1992 Sakavato
FAZC 12693 MRSN A5142 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsianerena
FAZC 12694 MRSN A5144 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsianerena
FAZC 12679 MRSN A5160 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsianerena
FAZC 12680 MRSN A5177 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsianerena
FAZC 12695 MRSN A5183 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsianerena
FAZC 12691 MRSN A5212 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsianerena
FAZC 12614 MRSN A5145 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsimanolabero
FAZC 12616 MRSN A5146 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsimanolabero
FAZC 12615 MRSN A5161 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsimanolabero
FAZC 12862 MRSN A5165 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsiombivositra
FAZC 12853 MRSN A5184 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsiombivositra
FAZC 12855 MRSN A5187 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsiombivositra
FAZC 12854 MRSN A5188 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsiombivositra
FAZC 12863 MRSN A5196 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsiombivositra
FAZC 12857 MRSN A5221 Mantellidae Mantella expectata Busse & Böhme, 1992 Tsiombivositra
FAZC 12036 MRSN A3085 Mantellidae Mantella expectata Busse & Böhme, 1992 Vallée du Petit
Nazareth
FAZC 12048 MRSN A3190 Mantellidae Mantella expectata Busse & Böhme, 1992 Vallée du Petit
Nazareth
FAZC 12610 MRSN A5150 Mantellidae Mantella expectata Busse & Böhme, 1992 Vohitanana
XVIII
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12520 MRSN A5157 Mantellidae Mantella expectata Busse & Böhme, 1992 Vohitanana
FAZC 12608 MRSN A5163 Mantellidae Mantella expectata Busse & Böhme, 1992 Vohitanana
FAZC 12607 MRSN A5182 Mantellidae Mantella expectata Busse & Böhme, 1992 Vohitanana
FAZC 12606 MRSN A5201 Mantellidae Mantella expectata Busse & Böhme, 1992 Vohitanana
FAZC 12029 MRSN A3081 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12038 MRSN A3434 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12655 MRSN A5156 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12750 MRSN A5164 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12611 MRSN A5168 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12621 MRSN A5169 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12751 MRSN A5170 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12612 MRSN A5172 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12619 MRSN A5176 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12617 MRSN A5180 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12739 MRSN A5186 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12657 MRSN A5206 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12738 MRSN A5207 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12618 MRSN A5210 Mantellidae Mantella expectata Busse & Böhme, 1992 Zahavola
FAZC 12827 MRSN A5222 Mantellidae Mantella sp. a. expectata “South” * £ Sakavato Sakavato is represent a new record for the studied area, com-
pared with the previous species inventory (Mercurio et
al. 2008). Mantella sp. a. expectata “South” was already
known from Tranomaro and Bemaraha (Rabemanajara
et al. 2008). ese specimens show a genetic distance
(16S) of ca 1% with both M. betsileo and M. expectata.
e 16S rRNA gene sequences of these two individuals
(EF674846-EF674847) were already published (Crottini
et al. 2008) and released in GenBank as M. cf. expectata/
betsileo. Interestingly, individual MRSN A 5222 was un-
equivocally identied as Mantella expectata (see Fig. 3D;
MRSN A5222) due to its M. expectata typical colorations.
Specimen MRSN A5230 shows chromatic traits intermedi-
ate between the two species M. expectata and M. betsileo
(see pics Fig. 3E). is aspect highlights the importance of
further investigate the genetic and chromatic variability of
these two species.
FAZC 12810 MRSN A5230 Mantellidae Mantella sp. a. expectata “South” * $ Sakavato
XIX
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12573 MRSN A5276 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Andriamanero Andriamanero, Canyon des Makis,
Canyon des Rats, Iambahatsy, Nama-
zaha Valley, Sakamalio, Tsimanolabero,
Zahavola
is species can be found on the ground or in the low
vegetation along brooks inside or outside of the primary
forest. Calling males can be found in the vegetation along
calm stretches of brooks. e systematic of all the Och-
thomantis species is still poorly understood and a revision
of the entire subgenus is needed to clarify their taxonomy.
Dierent from Mercurio et al. (2008), this taxon from
Isalo is here attributed to the true M. femoralis species due
it its morphological and genetic uniformity with M. femo-
ralis individuals from Anja Reserve (Ambalavao) which
is found in the East Betsileo region. However, future
taxonomic revisions might change this species attribution.
Dierent samples from Isalo are genetically uniform at the
analysed 16S rRNA gene fragment.
FAZC 12574 MRSN A5277 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Andriamanero
FAZC 12575 MRSN A5278 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Andriamanero
FAZC 12593 MRSN A5279 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Andriamanero
FAZC 12594 MRSN A5280 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Andriamanero
FAZC 12340 MRSN A2680 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Canyon des
Makis
FAZC 12341 MRSN A2681 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Canyon des
Makis
FAZC 12752 MRSN A5281 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Canyon des Rats
FAZC 12925 MRSN A5282 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Iambahatsy
FAZC 12348 MRSN A2682 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Namazaha Valley
FAZC 12347 MRSN A2683 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Namazaha Valley
FAZC 12349 MRSN A2684 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Namazaha Valley
FAZC 11895 MRSN A2685 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Namazaha Valley
FAZC 11879 MRSN A2686 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Namazaha Valley
FAZC 11871 MRSN A2690 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Namazaha Valley
XX
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12981 MRSN A5027 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Sakamalio
FAZC 13003 MRSN A5283 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Sakamalio
FAZC 12530 MRSN A5275 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Tsimanolabero
FAZC 12018 MRSN A2790 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Zahavola
FAZC 12019 MRSN A2791 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Zahavola
FAZC 14676 MRSN A6887 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Canyon des
Makis
FAZC 14727 MRSN A6890 Mantellidae Mantidactylus (Ochthomantis) femoralis (Boulenger,
1882)
Namazaha Valley
FAZC 13020 MRSN A5035 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo Ambovo, Andriamanero, Anjofo, Can-
yon des Rats
is recently described and micro-endemic species of
Isalo was until recently only known from the type local-
ity: Ambovo (Mercurio & Andreone 2007). With this
study we extended the known distribution of this species
to three additional localities within Isalo: Andriamanero,
Anjofo, Canyons des Rats. is species seems to be
restricted to canyons habitats. Dierent samples from Isalo
are genetically uniform at the analysed 16S rRNA gene
fragment. e genetic distance between M. noralottae and
the newly recorded Mantidactylus (Brygoomantis) sp. a.
multiplicatus Ca65 "Isalo" is of ca. 4%.
FAZC 13021 MRSN A5036 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 13005 MRSN A5252 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 13008 MRSN A5254 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 13023 MRSN A5317 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 13024 MRSN A5318 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 13022 MRSN A5319 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 13005
(MRSN
A5253)
SMF 85861 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
XXI
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 13005
(MRSN
A5255)
SMF 85862 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 13005
(MRSN
A5256)
SMF 85863 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 13005
(MRSN
A5257)
SMF 85864 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 12996 PBZT-uncata-
logued
Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 12998 PBZT-uncata-
logued
Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Ambovo
FAZC 14340 MRSN A-
uncatalogued
Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2008
Anjofo
ACZCV 0295 UNAVAIL-
ABLE
Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Canyon des Rats
FAZC 14750 MRSN A6877 Mantellidae Mantidactylus (Brygoomantis) noralottae Mercurio &
Andreone, 2007
Andriamanero
FAZC 12733 MRSN A5878 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Ampasibe Ampasibe, Andohasahenina, An-
driamanero, Ankademoky, Antoha,
Canyon des Makis, Analalava Forest,
Iambahatsy, Kazofoty, Lola, Namazaha
Valley, Ranohira, Sakamalio, Tsimano-
labero, Tsitorina, Petit Nazareth valley,
Zahavola
is undescribed species was referred to as M. sp. a. ul-
cerosus in Mercurio et al. (2008) and it is already known
to occur also in Tsingy de Bemaraha. It belongs to the
subgenus Brygoomantis and it is genetically closely related
to M. ulcerosus to which it is strongly dierentiated mo-
lecularly (ca. 11% p-distance) and bioacustically (Vieites
et al. 2009, Perl et al. 2014). In Isalo it was collected in
many localities generally in swamps or along slow moving
streams with gallery forest. Dierent samples from Isalo
are genetically uniform at the analysed 16S rRNA gene
fragment.
FAZC 11790 MRSN A2965 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Andohasahenina
FAZC 11788 MRSN A2966 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Andohasahenina
FAZC 11797 MRSN A2967 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Andohasahenina
FAZC 11795 MRSN A2968 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Andohasahenina
FAZC 11789 MRSN A2969 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Andohasahenina
FAZC 11787 MRSN A2970 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Andohasahenina
XXII
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 11793 MRSN A2971 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Andohasahenina
FAZC 12581 MRSN A5395 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Andriamanero
FAZC 12891 MRSN A5399 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Ankademoky
FAZC 12333 MRSN A2673 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Canyon des
Makis
FAZC 12737 MRSN A5397 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Canyon des
Makis
FAZC 14645 MRSN A6891 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Analalava Forest
FAZC 14771 MRSN A-
uncatalogued
Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Analalava Forest
UNAVAIL-
ABLE
MRSN A6027 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Isalo, no precise
locality info
UNAVAIL-
ABLE
MRSN A6028 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Isalo, no precise
locality info
UNAVAIL-
ABLE
MRSN A6029 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Isalo, no precise
locality info
UNAVAIL-
ABLE
MRSN A6030 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Isalo, no precise
locality info
UNAVAIL-
ABLE
MRSN A6031 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Isalo, no precise
locality info
UNAVAIL-
ABLE
MRSN A6032 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Isalo, no precise
locality info
UNAVAIL-
ABLE
MRSN A6034 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Isalo, no precise
locality info
FAZC 12775 MRSN A-
uncatalogued
Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Kazofoty
FAZC 12740 MRSN A5881 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Lola
FAZC 12345 MRSN A2671 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Namazaha Valley
FAZC 12346 MRSN A2672 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Namazaha Valley
FAZC 12983 MRSN A5021 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Sakamalio
FAZC 12984 MRSN A5022 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Sakamalio
XXIII
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12986 MRSN A5023 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Sakamalio
FAZC 12985 MRSN A5024 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Sakamalio
FAZC 13010 MRSN A5400 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Sakamalio
FAZC 12842 MRSN A5849 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Tsimanolabero
FAZC 12522 MRSN A5859 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Tsimanolabero
FAZC 12523 MRSN A5860 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Tsimanolabero
FAZC 12524 MRSN A5861 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Tsimanolabero
FAZC 12831 MRSN A5868 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Tsimanolabero
FAZC 12536 MRSN A5875 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Tsimanolabero
FAZC 12683 MRSN A5877 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Tsimanolabero
FAZC 12797 MRSN A5398 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Tsitorina
FAZC 12046 MRSN A2972 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Vallée du Petit
Nazareth
FAZC 12024 MRSN A2973 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Zahavola
FAZC 12529 MRSN A5392 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Zahavola
FAZC 12544 MRSN A5393 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Zahavola
FAZC 12546 MRSN A5394 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Zahavola
FAZC 12552 MRSN A5396 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Zahavola
FAZC 14711 PBZT-uncata-
logued
Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Zahavola
FAZC 14732 MRSN A6912 Mantellidae Mantidactylus (Brygoomantis) sp. a. ulcerosus Ca14
“Isalo”
Zahavola
XXIV
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 11785 MRSN A2964 Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Andohasahenina Andohasaheinina, Andriamanero,
Namazaha Valley, Piscine Naturelle
is undescribed species represents a new species record
for Madagascar. is species belongs to the complex of the
M. betsileanus and it shows a genetic similarity of ca. 96%
with almost all the other species of this complex. is tax-
on is phylogentically close to M. multiplicatus, M. sp Ca29
“Tolagnaro”, M. sp. Ca30 “Andohahela” and the sympatric
M. noralottae. is taxon went probably overlooked due to
the supercial morphological similarity with M. noralottae
(genetic divergence= 4.1%, p-distance).
ACZCV 0281 UNAVAIL-
ABLE
Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Andriamanero
ACZCV 0282 UNAVAIL-
ABLE
Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Andriamanero
ACZCV 0283 UNAVAIL-
ABLE
Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Andriamanero
ACZCV 0284 UNAVAIL-
ABLE
Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Andriamanero
FAZC 14745 MRSN A6893 Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Andriamanero
FAZC 14737 MRSN A6885 Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Andriamanero
FAZC 11875 MRSN A2689 Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Namazaha Valley
FAZC 11872 MRSN A2878 Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Namazaha Valley
FAZC 14719 MRSN A6889 Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Namazaha Valley
FAZC 14729 MRSN A6901 Mantellidae Mantidactylus (Brygoomantis) sp. a. multiplicatus Ca65
“Isalo” *
Namazaha Valley
FAZC 12899 MRSN A5419 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Ankademoky Ankademoky, Iambahatsy, Sakamalio is undescribed species was referred to as M. cf. lugubris
in Mercurio et al. (2008). It belongs to the subgenus
Hylobatrachus and it was already known to occur in the
Central-eastern Madagascar: Antoetra, Itremo, Manombo
and Ranomafana (Crottini et al. 2011, Perl et al. 2014,
Riemann et al. 2015, Strauss et al. 2016). Dierent sam-
ples from Isalo are genetically uniform at the analysed 16S
rRNA gene fragment and are genetically very similar (1%
p-distance) with samples from other known localities. Fur-
ther investigations are needed to disentangle the taxonomy
and phylogenetic relationships of this species complex.
FAZC 12900 MRSN A5420 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani “small”
Ca48
Ankademoky
XXV
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12901 MRSN A5421 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Ankademoky
FAZC 12902 MRSN A5422 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Ankademoky
FAZC 12894 MRSN A5432 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Ankademoky
FAZC 12895 MRSN A5433 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Ankademoky
FAZC 12896 MRSN A5434 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Ankademoky
FAZC 12898 MRSN A5435 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Ankademoky
FAZC 12908 MRSN A5423 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Iambahatsy
FAZC 12909 MRSN A5424 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Iambahatsy
FAZC 12917 MRSN A5425 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Iambahatsy
FAZC 12919 MRSN A5426 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Iambahatsy
FAZC 12918 MRSN A5428 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Iambahatsy
FAZC 12911 MRSN A5436 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Iambahatsy
FAZC 12912 MRSN A5437 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Iambahatsy
FAZC 12913 MRSN A5438 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Iambahatsy
FAZC 12947 MRSN A5427 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Sakamalio
FAZC 12950 MRSN A5429 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Sakamalio
FAZC 12936 MRSN A5439 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Sakamalio
FAZC 12948 MRSN A5440 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Sakamalio
FAZC 12978 MRSN A5441 Mantellidae Mantidactylus (Hylobatrachus) sp. a. cowani Ca48
“small”
Sakamalio
XXVI
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12846 MRSN A6024 Microhylidae Dyscophus insularis Grandidier, 1872 Lola Lola, Ranohira is is a fossorial species occurring in the western dry
forests of Madagascar. It occupies a range that goes from
Ankarafantsika and Ambanja in the north-west to Isalo
and Tsimanampetsotsa in the south-west. It breeds in
stagnant shallow waters, and in Isalo it has been reported
only from Ranohira and Lola. Dierent samples from Isalo
are genetically uniform at the analysed 16S rRNA gene
fragment and are genetically very similar (1% p-distance)
with samples from other known localities.
FAZC 12852 MRSN A6442 Microhylidae Dyscophus insularis Grandidier, 1872 Lola
FAZC 12742 MRSN A6445 Microhylidae Dyscophus insularis Grandidier, 1872 Lola
FAZC 12741 MRSN A6516 Microhylidae Dyscophus insularis Grandidier, 1872 Lola
FAZC 14367 MRSN A-
uncatalogued
Microhylidae Dyscophus insularis Grandidier, 1872 Ranohira
FAZC 14368 MRSN A-
uncatalogued
Microhylidae Dyscophus insularis Grandidier, 1872 Ranohira
FAZC 14686 MRSN A-
uncatalogued
Microhylidae Dyscophus insularis Grandidier, 1872 Ranohira
FAZC 11991 MRSN A2687 Microhylidae Scaphiophryne brevis (Boulenger, 1896) Andranomena Andranomena, Ilakaka, Ranohira,
Reine de l’Isalo,.
is species in known to occur in the dry south and
south-west of the Island. It is generally found in open
savanna close to temporary water bodies where it breeds.
In Isalo this species is quite widespread and in 2009 one
individual has been found freshly died in the pool of an
Hotel in Ranohira (specimen FAZC 14369). Dierent
samples from Isalo are genetically uniform at the analysed
16S rRNA gene fragment.
FAZC 14685 MRSN A6924 Microhylidae Scaphiophryne brevis (Boulenger, 1896) Ranohira
FAZC 14369 MRSN A-
uncatalogued
Microhylidae Scaphiophryne brevis (Boulenger, 1896) Ranohira, Motel
d’Isalo
FAZC 12734 MRSN A5040 Microhylidae Scaphiophryne brevis (Boulenger, 1896) Reine de l’Isalo
FAZC 12754 MRSN A5041 Microhylidae Scaphiophryne brevis (Boulenger, 1896) Reine de l’Isalo
UNAVAIL-
ABLE
MRSN A5308 Microhylidae Scaphiophryne brevis (Boulenger, 1896) Reine de l’Isalo
FAZC 12849 MRSN A6443 Microhylidae Scaphiophryne brevis (Boulenger, 1896) Reine de l’Isalo
FAZC 12850 MRSN A6444 Microhylidae Scaphiophryne brevis (Boulenger, 1896) Reine de l’Isalo
XXVII
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 13025 MRSN A5837 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Ambovo Ambovo, Amparambatomavo, An-
dohasahenina, Andranombilahy, An-
dranomena, Antambonoa, Bemenara,
Bevato, Canyon des Makis, Ilakaka,
Lola, Malaso, Marojana River, Mora-
hariva, Tsiombivositra, Petit Nazareth
valley, Vohitanana, Zahavola
is species is one of the most peculiar amphibians of
Isalo and thus far in known only from this region. It is
nocturnal and could be found in deep canyons and tem-
porary streams. is species is an explosive breeder, form-
ing large breeding aggregations that last few days just aer
the rst seasonal rainfall (Rosa et al. 2011). e genetic
variability at the Cytb mitochondrial gene fragment is very
low across its entire distributional range (Crottini et al.
2008). is high gene ow among dierent populations
inhabiting dierent canyons in the Isalo Massif seems
to be determined by the tadpoles that are washed away
when heavy rains aect the area, rather than the mobility
of the adults (Andreone et al. 2013). Adult individuals
of S. gottlebei have been conrmed to be part of the diet
of young Leioetherodon modestus (Rosa et al. 2010). Dif-
ferent samples from Isalo are genetically uniform at the
analysed 16S rRNA gene fragment. e genetic distance
between S. gottlebei and S. sp. Ca1, S. sp. Ca2 and S. brevis
is of 5% (p-distance transformed into percent).
FAZC 11858 MRSN A2810 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andohasahenina
FAZC 11915 MRSN A2811 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andohasahenina
FAZC 11822 MRSN A3090 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andohasahenina
FAZC 11827 MRSN A3092 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andohasahenina
FAZC 11821 MRSN A3094 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andohasahenina
FAZC 11829 MRSN A3096 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andohasahenina
FAZC 11826 MRSN A3099 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andohasahenina
FAZC 11815 MRSN A3101 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andohasahenina
FAZC 11828 MRSN A3105 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andohasahenina
FAZC 11922 MRSN A2805 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andranombilahy
FAZC 11978 MRSN A2806 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andranombilahy
FAZC 11996 MRSN A2802 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andranomena
FAZC 11994 MRSN A2807 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andranomena
FAZC 11997 MRSN A3102 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Andranomena
FAZC 11948 MRSN A2801 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Bemenara
FAZC 11949 MRSN A2804 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Bemenara
FAZC 11947 MRSN A3089 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Bemenara
FAZC 11938 MRSN A3091 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Bemenara
FAZC 11935 MRSN A3093 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Bemenara
FAZC 11934 MRSN A3097 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Bemenara
FAZC 11937 MRSN A3098 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Bemenara
XXVIII
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 11933 MRSN A3103 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Bemenara
FAZC 13026 MRSN A5840 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Bevato
UNAVAIL-
ABLE
MRSN A2596 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Ilakaka (from
captivity)
UNAVAIL-
ABLE
MRSN A2597 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Isalo, no precise
locality info
FAZC 12531 MRSN A5843 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Isalo, no precise
locality info
FAZC 12681 MRSN A5838 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Malaso
FAZC 12533 MRSN A5841 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Malaso
FAZC 12534 MRSN A5857 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Malaso
FAZC 12686 MRSN A5882 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Malaso
FAZC 12532 MRSN A4961 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Marojana River
FAZC 12531 MRSN A5842 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Marojana River
FAZC 12039 MRSN A2618 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Vallée du Petit
Nazareth
FAZC 12040 MRSN A2619 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Vallée du Petit
Nazareth
FAZC 12034 MRSN A2808 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Vallée du Petit
Nazareth
FAZC 12035 MRSN A3104 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Vallée du Petit
Nazareth
FAZC 12015 MRSN A2803 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Zahavola
FAZC 12014 MRSN A2809 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Zahavola
FAZC 12026 MRSN A3095 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Zahavola
FAZC 12027 MRSN A3100 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Zahavola
FAZC 13268 MRSN A5839 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Zahavola
FAZC 12556 MRSN A5854 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Zahavola
FAZC 12508 MRSN A5866 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Zahavola
FAZC 12688 MRSN A5873 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Zahavola
FAZC 12507 MRSN A5876 Microhylidae Scaphiophryne gottlebei Busse & Böhme, 1992 Zahavola
FAZC 14360 MRSN A-
uncatalogued
Microhylidae Scaphiophryne sp. a. calcarata Ca01 Isalo, no precise
locality info
Unknown is species was formerly named S. calcarata in Mercu-
rio et al. (2008), or S. sp. a. calcarata B or S. sp. Ca1 in
Vieites et al. (2009) and Perl et al. (2014). As far as we
know, the S. calcarata complex clearly consists of at least
three distinct species but assigning any of these to the no-
men “calcarata” or its junior synonyms is still diculted by
the poor state of conservation and lack of detailed locality
information for the type series. is undescribed species
was already known form Tolagnaro and Berenty.
XXIX
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 14358 MRSN A-
uncatalogued
Microhylidae Scaphiophryne sp. a. calcarata Ca01 Ranohira, Motel
d’Isalo
FAZC 14359 MRSN A-
uncatalogued
Microhylidae Scaphiophryne sp. a. calcarata Ca01 Ranohira, Motel
d’Isalo
FAZC 14663 MRSN A6895 Microhylidae Scaphiophryne sp. a. calcarata Ca02 * ° Ranohira Unknown is undescribed species represents a new record for
Isalo. is species was formerly named S. calcarata in
Mercurio et al. (2008), or S. sp. a. calcarata A or S. sp.
Ca2 in Vieites et al. (2009) and Perl et al. (2014). is
undescribed species was already known form Kirindy
and Menabe. is study revealed Isalo as the contact zone
between these two undescribed species of the S. calcarata
complex. e genetic distance between S. sp. Ca1 and S.
sp. Ca2 is of ca. 4% (p-distance).
FAZC 11992 MRSN A2882 Microhylidae Scaphiophryne sp. Ca? Andranomena Unassigned
FAZC 12736 MRSN A5018 Hyperoliidae Heterixalus luteostriatus (Andersson, 1910) Canyon des
Makis
Canyon des Makis, Ranohira, Vohi-
maro
is treefrog is the most widely distributed Heterixalus
species of Madagascar and it can be found from the Saha-
malza Peninsula (Penny et al. 2017) in the north to Isalo,
Ihosy and Zombitse in the south, mostly living in swamps
and rice elds, but it can also be found within town and
villages. e analysed individuals of H. luteostriatus from
Isalo have a genetic distance of about 2-3% with popula-
tions from northern localities (Ambanja and Ankarafan-
tsika).
FAZC 14700 MRSN A-
uncatalogued
Hyperoliidae Heterixalus luteostriatus (Andersson, 1910) Ranohira
FAZC 12796 MRSN A5017 Hyperoliidae Heterixalus luteostriatus (Andersson, 1910) Vohimaro
FAZC 14675 PBZT-uncata-
logued
Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Analamangabe Ambovobe, Analamangabe, Andohasa-
henina, Andranomena, Andriamanero,
Analalava Forest, Iambahatsy, Ilakaka,
Malaso, Morahariva, Oasis Mariany,
Oasis Mariany, Ranohira, Reine de
l’Isalo, Sahanafa, Sevalava, Vallée du
petit Nazareth, Zahavola
A recent phylogeographic analysis of the entire P. mascar-
eninensis species complex revealed the occurrence of three
endemic genetic lineages in Madagascar, which have their
closest relative in Tanzania (Zimkus et al. 2017). e lin-
eage occurring in Isalo belong to OTU 1 (sensu Zimkus et
al. 2017), which is the most widely distributed lineage and
the one that can be found within all four biogeographic
zones of Madagascar: eastern humid, central highland,
western arid, and southwestern sub-arid. is species is
usually absent from forests and abundant in temporary
and permanent water bodies as well as swamps and rice
elds. Dierent samples from Isalo are genetically uniform
at the analysed 16S rRNA gene fragment and the genetic
distance between OTU 1 (occurring in Isalo) and OTU 2
and OTU 3 is of 3% and 4% (p-distance), respectively.
FAZC 11847 MRSN A2719 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Andohasahenina
FAZC 11798 MRSN A2721 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Andohasahenina
FAZC 11966 MRSN A2720 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Andranomena
XXX
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Cata-
logue Number
Family Taxon Locality Distribution Remarks
FAZC 12597 MRSN A5403 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Andriamanero
FAZC 14641 MRSN A6896 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Analalava Forest
FAZC 14763 MRSN A-
uncatalogued
Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Malaso
FAZC 12704 MRSN A5352 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Morahariva
FAZC 12696 MRSN A5405 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Morahariva
FAZC 12697 MRSN A5406 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Morahariva
FAZC 12698 MRSN A5407 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Morahariva
FAZC 12699 MRSN A5408 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Morahariva
FAZC 12700 MRSN A5409 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Morahariva
FAZC 12701 MRSN A5410 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Morahariva
FAZC 12702 MRSN A5411 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Morahariva
FAZC 12706 MRSN A5412 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Morahariva
FAZC 12843 MRSN A5850 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Oasis Mariany
FAZC 12845 MRSN A5853 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Oasis Mariany
FAZC 12829 MRSN A5883 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Oasis Mariany
UNAVAIL-
ABLE
MRSN A763 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Ranohira
FAZC 12872 MRSN A5413 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Sahanafa
FAZC 12629 MRSN A5404 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Sevalava
FAZC 12044 MRSN A3128 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Vallée du Petit
Nazareth
FAZC 12030 MRSN A3127 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Zahavola
FAZC 12537 MRSN A5402 Ptychadenidae Ptychadena mascareniensis (Duméril & Bibron, 1841) Zahavola
XXXI
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Andreone, F, P. E. Bergò, V. Mercurio & G. M . Rosa (2013):
Spatial Ecology of Scaphiophryne gottlebei in the canyons
of the Isalo Massif, Madagascar. – Herpetologica, 69: 11–21.
Crottini, A., M. Barbuto, M. Casiraghi & F. Andreone
(2011b): A rapid amphibian survey at Itremo-Ambato-
nandrahana, central Madagascar, with conrmed absence
of chytrid fungus and recommendations for future moni-
toring activities. – North-Western Journal of Zoology, 7:
346–351.
Crottini, A., Y. Chiari, V. Mercurio, A. Meyer, M.
Vences & F. Andreone (2008): Into the canyons: the
phylogeography of the Malagasy frogs Mantella expectata
and Scaphiophryne gottlebei in the arid Isalo Massif, and
its signicance for conservation (Amphibia: Mantellidae
and Microhylidae). – Organisms Diversity & Evolution,
8: 368–377.
Glaw, F., J. Köhler, I. De La Riva, D. R. Vieites & M. Ven-
ces (2010): Integrative taxonomy of malagasy treefrogs:
combination of molecular genetics, bioacoustics and
comparative morphology reveals twelve additional spe-
cies of Boophis. – Zootaxa, 82: 1–82.
Mercurio, V. & F. Andreone (2006): e tadpoles of
Scaphiophryne gottlebei (Microhylidae: Scaphiophryni-
nae) and Mantella expectata (Mantellidae: Mantellinae)
from Isalo Massif, South-central Madagascar. – Alytes,
23: 81–95.
Mercurio, V. & F. Andreone (2007): Two new canyon-
dwelling frogs from the arid sandstone Isalo Massif, cen-
tral-southern Madagascar (Mantellidae-Mantellinae). –
Zootaxa, 1574: 31–47.
Mercurio, V., G. Aprea, A. Crottini, F. Mattioli, J. Ran-
drianirina, T. Razafindrabe & F. Andreone (2008):
e amphibians of Isalo Massif, southern-central Mada-
gascar: high frog diversity in an apparently hostile dry
habitat. – Monograe del Museo Regionale di Scienze
Naturali di Torino, 5–58.
Pabijan, M., J. Brown, L. M. Chan, H. Rakotondravony,
A. P. Raselimanana, A. D. Yoder, F. Glaw & M. Ven-
ces (2015):Phylogeography of the arid-adapted Malagasy
bullfrog, Laliostoma labrosum, inuenced by past connec-
tivity and habitat stability. – Molecular Phylogenetics and
Evolution 92: 11-24.
Penny, S. G., F. Andreone, A. Crottini, A. Bellati, L.
M. S. Rakotozafy, M. W. Holderied, C. Schwitzer &
G. M. Rosa (2017): Combining old and new evidence to
increase the known biodiversity value of the Sahamala-
za Peninsula, Northwest Madagascar. – Contribution to
Zoo logy, 86: 273-296.
Perl, R. G. B., Z. T. Nagy, G. Sonet, F. Glaw, K. C. Wollen-
berg & M. Vences (2014): DNA barcoding Madagascar’s
amphibian fauna. – Amphibia-Reptilia, 35: 197–206.
Rabemananjara, F. C. E., A. Crottini, Y. Chiari, F. An-
dreone, F. Glaw, R. Duguet, P. Bora, O. Ravoahangi-
malala Ramilijaona & M. Vences (2007): Molecular
systematics of Malagasy poison frogs in the Mantella bet-
sileo and M. laevigata species groups. – Zootaxa, 1501: 31-
44.
Rabemananjara, F. C. E., N. Rasoamampionona Ramino-
soa, O. Ravoahangimalala Ramilijaona, D. Rako-
tondravony, F. Andreone, P. Bora, A. I. Carpenter,
F. Glaw, T. Razafindrabe, D. Vallan, D. R. Vieites
& M. Vences (2008): Malagasy poison frogs in the pet
trade: a survey of levels of exploitation of species in the
genus Mantella. – pp. 277-300 in: Andreone, F. (ed.): A
Conservation Strategy for the Amphibians of Madagas-
car. – Monograe del Museo Regionale di Scienze Natu-
rali di Torino.
Rakotondravony, H. A. & S. M. Goodman (2011): Rapid
herpetofaunal surveys within ve isolated forests on sed-
imentary rock in western Madagascar. – Herpetological
Conservation and Biology, 6: 297–311.
Riemann, J. C., S. H. Ndriantsoa, N. R. Raminosoa, M. O.
Rödel & J. Glos (2015): e value of forest fragments for
maintaining amphibian diversity in Madagascar. – Bio-
logical Conservation, 191: 707–715.
Rosa, G. M., V. Mercurio, A. Crottini & F. Andreone
(2010): Predation of the snake Leioheterodon modestus
(Günther, 1863) upon the microhylid frog Scaphiophryne
gottlebei Busse & Böhme, 1992 at Isalo, southern Mada-
gascar. – Herpetology Notes, 3: 259–261.
Rosa, G. M., V. Mercurio, A. Crottini & F. Andreone
(2011): Explosion into the canyon: breeding aggregation
in Scaphiophryne gottlebei Busse & Böhme, 1992 – North-
Western Journal of Zoology, 7(2): 329-333.
Strauss, A., F. Guilhaumon, R. D. Randrianiaina, C. W.
Valero, M. Vences & J. Glos (2016): Opposing patterns
of sasonal change in functional and phylogenetic diversity
of tadpole assemblages. PLoS ONE: 1–18.
Vieites, D. R., K. C. Wollenberg, F. Andreone, J. Köh-
ler, F. Glaw & M. Vences (2009): Vast underestimation
of Madagascar’s biodiversity evidenced by an integra-
tive amphibian inventory. – Proceedings of the National
Academy of Sciences of the United States of America, 106:
8267–8272.
Zimkus, B. M., L. P. Lawson, M. F. Barej, C. D. Barratt,
A. Channing, K. M. Dash, J. M. Dehling, L. Du Preez,
P.-S. Gehring, E. Greenbaum, V. Gvozdík, J. Harvey,
J. Kielgast, C. Kusamba, Z. T. Nagy, M. Pabijan, J.
Penner, M.-O. Rödel, M. Vences & S. Lötters (2017):
Leapfrogging into new territory: How Mascarene ridged
frogs diversied across Africa and Madagascar to main-
tain their ecological niche. – Molecular Phylogenetics and
Evolution, 106: 254–269.
XXXII
Online Supplementary data – Walter Cocca et al.
Supplementary Table S4. List of reptile samples analysed for this study. For each tissue the ID, eld number, institutional catalogue number, higher classication, species name, collection
locality and GenBank accession number are provided. AC and ACP, Angelica Crottini extraction codes; ACZC, Angelica Crottini Zoological Collection; FAZC, Franco Andreone Zoological
Collection; FGMV, Frank Glaw and Miguel Vences eld number; ZCMV, Zoological Collection of Miguel Vences; MRSN R-, Reptiles ollection of the Museo Regionale di Scienze Naturali
of Torino, Italy; TM, Tobias Müuenchenberg. *, individual molecularly identied as L. geayi using the COI marker but conrmed L. modestus aer morphological inspecion; °,New range
extension; Category, Category of candidate species.
Sample ID Fieldnumber Institutional
collection
number
Order Family Taxon Locality Cate-
gory
COI 16S 3'
fragment
ND1 ND2 ND4 Cytb
ACP1430 FAZC 14682 MRSN R3737 Chelonia Pelomedusidae Pelomedusa subrufa Zahavola MH063339 - - - - -
ACP1429 FAZC 14680 UNAVAIL-
ABLE
Loricata Crocodylidae Crocodylus niloticus ° Ranohira MH063340 - - - - -
ACP2560 ACZC 2569 UNAVAIL-
ABLE
Squamata:
Lacertilia
Chamaeleonidae Brookesia brygooi Namazaha Valley MH063341 - - JX101759 - -
ACP1424 FAZC 14672 UNAVAIL-
ABLE
Squamata:
Lacertilia
Chamaeleonidae Furcifer major Malaso MH063342 MH063284 - - - -
ACP2546 ACZC 1869 UNAVAIL-
ABLE
Squamata:
Lacertilia
Chamaeleonidae Furcifer major Zahavola MH063343 MH063285 - - - -
ACP1409 FAZC 14640 UNAVAIL-
ABLE
Squamata:
Lacertilia
Chamaeleonidae Furcifer major Zahavola MH063344 MH063286 - - - -
AC405 FAZC 12816 MRSN R3161 Squamata:
Lacertilia
Chamaeleonidae Furcifer oustaleti Bereketa - MH063287 - - - -
ACP2549 ACZC 1921 UNAVAIL-
ABLE
Squamata:
Lacertilia
Chamaeleonidae Furcifer oustaleti Namazaha Valley MH063345 MH063288 - - - -
ACP2550 ACZC 1962 UNAVAIL-
ABLE
Squamata:
Lacertilia
Chamaeleonidae Furcifer oustaleti Namazaha Valley MH063346 - - - - -
ACP2604 FAZC 12814 MRSN R3165 Squamata:
Lacertilia
Chamaeleonidae Furcifer verrucosus Sakavato MH063347 MH063289 - - - -
ACP2603 FAZC 12813 MRSN R3169 Squamata:
Lacertilia
Chamaeleonidae Furcifer verrucosus Sakavato MH063348 MH063290 - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Blaesodactylus sakalava Isalo, no precise
locality info
- - - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UMMZ
196575
Squamata:
Lacertilia
Gekkonidae Geckolepis typica Bereketa - - - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UMMZ
196576
Squamata:
Lacertilia
Gekkonidae Geckolepis typica Bereketa - - - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UMMZ
215902
Squamata:
Lacertilia
Gekkonidae Geckolepis typica Analalava Forest - - - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UMMZ
215903
Squamata:
Lacertilia
Gekkonidae Geckolepis typica Analalava Forest - - - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UMMZ
215904
Squamata:
Lacertilia
Gekkonidae Geckolepis typica Sahanafa - - - - - -
XXXIII
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Fieldnumber Institutional
collection
number
Order Family Taxon Locality Cate-
gory
COI 16S 3'
fragment
ND1 ND2 ND4 Cytb
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Geckolepis typica Isalo, no precise
locality info
- - - - - -
ACP2350 ACZC 1939 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Hemidactylus mercatorius Isalo, no precise
locality info
MH063349 - - - - -
ACP1414 FAZC 14650 PBZT-uncata-
logued
Squamata:
Lacertilia
Gekkonidae Hemidactylus mercatorius Malaso MH063350 - - - MH063422 -
ACP2351 ACZC 1945 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Hemidactylus mercatorius Namazaha Valley MH063351 - - - - -
ACP2552 ACZC 1974 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Hemidactylus mercatorius Namazaha Valley MH063352 MH063291 - - - -
ACP2355 ACZC 1984 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Hemidactylus mercatorius Ranohira, Motel
d’Isalo
MH063353 - - - - -
ACP2753 FAZC 14652 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Hemidactylus mercatorius Zahavola MH063354 - - - - -
1468 WME45 UNAVAIL-
ABLE
ZMA 19595 Squamata:
Lacertilia
Gekkonidae Lygodactylus sp. a. pictus
Ca01 “Isalo”
Analalava Forest UCS - AY653238 - - - -
ACP1413 FAZC 14649 MRSN R3746 Squamata:
Lacertilia
Gekkonidae Lygodactylus sp. a. tu-
berosus Ca02 “Isalo”
Malaso UCS MH063355 MH063292 - - MH063423 -
ACP1418 FAZC 14656 MRSN R3749 Squamata:
Lacertilia
Gekkonidae Lygodactylus sp. a. tu-
berosus Ca02 “Isalo”
Malaso UCS MH063356 MH063293 - - - -
ACP2569 I036 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Paroedura picta Andriamanero MH063357 - - - MH063424 -
ACP2541 ACZC 1834 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Paroedura picta Zahavola MH063358 MH063294 - - MH063425 -
ACP2758 FAZC 14743 MRSN R3736 Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca01 “Marofandilia/Mian-
drivazo” °
Zahavola UCS MH063359 MH063295 - - - -
ACP1402 FAZC 14631 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca01 “Marofandilia/Mian-
drivazo” °
Zahavola UCS MH063360 MH063296 - - MH063426 -
ACP3349 FAZC 14661 MRSN R3745 Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca01 “Marofandilia/Mian-
drivazo” °
Zahavola UCS MH063361 MH063297 - - - -
ACP3344 FAZC 11940 MRSN R2553 Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca01 “Marofandilia/Mian-
drivazo” °
Isalo, no precise
locality info
UCS MH063362 - - - - -
ACP2547 ACZC 1868 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca02 “Isalo”
Zahavola Campsite UCS MH063363 MH063298 - - - -
ACP2543 ACZC 1828 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca02 “Isalo”
Zahavola UCS MH063364 MH063299 - - - -
XXXIV
Online Supplementary data – Walter Cocca et al.
Sample ID Fieldnumber Institutional
collection
number
Order Family Taxon Locality Cate-
gory
COI 16S 3'
fragment
ND1 ND2 ND4 Cytb
ACP2755 FAZC 14657 PBZT-uncata-
logued
Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca02 “Isalo”
Zahavola UCS MH063365 MH063300 - - - -
ACP3346 FAZC 11800 MRSN R2569 Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca03 “Ilakaka”
Isalo, no precise
locality info
UCS MH063366 MH063301 - - - -
ACP3345 FAZC 11819 MRSN R2568 Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca03 “Ilakaka”
Isalo, no precise
locality info
UCS MH063367 MH063302 - - - -
ACP3343 FAZC 11932 MRSN R2529 Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca03 “Ilakaka”
Isalo, no precise
locality info
UCS MH063368 MH063303 - - - -
ACP3347 FAZC 12790 MRSN R3205 Squamata:
Lacertilia
Gekkonidae Paroedura sp. a. bastardi
Ca03 “Ilakaka”
Kazofoty UCS MH063369 - - - -
ACP2592 FAZC 14730 MRSN R3748 Squamata:
Lacertilia
Gekkonidae Paroedura vahiny Malaso MH063370 MH063304 - - - -
REPT_F358 REPT_F358 ZSM 192/2004 Squamata:
Lacertilia
Gekkonidae Phelsuma hielscheri Isalo, no precise
locality info
JQ909529 - - - -
ACP2348 ACZC 1972 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Phelsuma mutabilis Namazaha Valley MH063371 MH063305 - - MH063427 -
Sound-P31 Sound-P31 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gekkonidae Phelsuma standingi Isalo, no precise
locality info
- DQ270564 - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UNAVAIL-
ABLE
Squamata:
Lacertilia
Gerrhosauridae Tracheoleptychus madagas-
cariensis
Isalo, no precise
locality info
- - - - - -
AC450 FAZC 12763 MRSN R3213 Squamata:
Lacertilia
Gerrhosauridae Zonosaurus laticaudatus Canyon des Makis - MH063306 - - - -
ACP2598 FAZC 12767 MRSN R-
uncatalogued
Squamata:
Lacertilia
Gerrhosauridae Zonosaurus laticaudatus Isalo, no precise
locality info
MH063372 MH063307 - - - -
ACP2602 FAZC 12761 MRSN R3232 Squamata:
Lacertilia
Gerrhosauridae Zonosaurus madagas-
cariensis
Canyon des Makis MH063373 MH063308 - - - -
ACP2605 ACZC 6992 UNAVAIL-
ABLE
Squamata:
Lacertilia
Gerrhosauridae Zonosaurus madagas-
cariensis
Isalo, no precise
locality info
MH063374 - - - - -
ACP1438 FAZC 14698 PBZT-uncata-
logued
Squamata:
Lacertilia
Gerrhosauridae Zonosaurus karsteni Ranohira Bas MH063375 MH063309 MH063420 - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UNAVAIL-
ABLE
Squamata:
Lacertilia
Gerrhosauridae Zonosaurus ornatus Isalo, no precise
locality info
- - - - - -
TM85 FGMV
2002_1465
UADBA 21059 Squamata:
Lacertilia
Opluridae Chalarodon madagas-
cariensis
Analalava Forest - EU099706 - - - -
ACP3316 FAZC 12792 PBZT-uncata-
logued
Squamata:
Lacertilia
Opluridae Chalarodon madagas-
cariensis
Vohimaro MH063376 MH063310 - - - -
TM89 UNAVAIL-
ABLE
ZSM 939/2003 Squamata:
Lacertilia
Opluridae Oplurus cyclurus Analalava Forest - EU099720 - - - -
TM92 UNAVAIL-
ABLE
ZSM 940/2003 Squamata:
Lacertilia
Opluridae Oplurus cyclurus Analalava Forest - EU099732 - - - -
XXXV
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Fieldnumber Institutional
collection
number
Order Family Taxon Locality Cate-
gory
COI 16S 3'
fragment
ND1 ND2 ND4 Cytb
TM90 FGMV
2002.1474
UNAVAIL-
ABLE
Squamata:
Lacertilia
Opluridae Oplurus cyclurus Analalava Forest - EU099721 - - - -
TM91 FGMV
2002.1475
UNAVAIL-
ABLE
Squamata:
Lacertilia
Opluridae Oplurus cyclurus Analalava Forest - EU099722 - - - -
TM93 FGMV
2002.1479
UNAVAIL-
ABLE
Squamata:
Lacertilia
Opluridae Oplurus cyclurus Analalava Forest - EU099723 - - - -
TM94 FGMV
2002.1517
UNAVAIL-
ABLE
Squamata:
Lacertilia
Opluridae Oplurus cyclurus Analalava Forest - EU099724 - - - -
AC445 FAZC 12665 MRSN R3239 Squamata:
Lacertilia
Opluridae Oplurus cyclurus Malaso - MH063311 - - - -
ACP2545 ACZC 1842 UNAVAIL-
ABLE
Squamata:
Lacertilia
Opluridae Oplurus cyclurus Malaso MH063377 MH063312 - - MH063428 -
ACP1408 FAZC 14637 UNAVAIL-
ABLE
Squamata:
Lacertilia
Opluridae Oplurus cyclurus Malaso MH063378 MH063313 - - MH063429 -
ACP2752 FAZC 14639 UNAVAIL-
ABLE
Squamata:
Lacertilia
Opluridae Oplurus cyclurus Malaso MH063379 MH063314 - - - -
ACP2599 FAZC 12789 MRSN R3215 Squamata:
Lacertilia
Opluridae Oplurus grandidieri Antoha MH063380 MH063315 - - - -
ACP2539 FAZC 14687 MRSN R-
uncatalogued
Squamata:
Lacertilia
Opluridae Oplurus quadrimaculatus Malaso MH063381 MH063316 - - MH063430 -
ACP2595 FAZC 12812 UNAVAIL-
ABLE
Squamata:
Lacertilia
Opluridae Oplurus saxicola ° Sakavato MH063382 MH063317 - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UNAVAIL-
ABLE
Squamata:
Lacertilia
Scincidae Grandidierina rubrocauda-
ta
Isalo, no precise
locality info
- - - - - -
ACP2548 ACZC 1838 UNAVAIL-
ABLE
Squamata:
Lacertilia
Scincidae Trackylepis elegans Malaso MH063383 - MH063421 - - -
ACP2555 ACZC 1957 UNAVAIL-
ABLE
Squamata:
Lacertilia
Scincidae Trackylepis elegans Ranohira, Motel
d’Isalo
MH063384 - - - - -
ACP2557 ACZC 1927 UNAVAIL-
ABLE
Squamata:
Lacertilia
Scincidae Trachylepis gravenhorstii
lineage 4a
Ranohira MH063385 MH063318 - - - -
ACP2554 ACZC 1967 UNAVAIL-
ABLE
Squamata:
Lacertilia
Scincidae Trachylepis gravenhorstii
lineage 4a
Ranohira MH063386 MH063319 - - - -
ACP2553 ACZC 1978 UNAVAIL-
ABLE
Squamata:
Lacertilia
Scincidae Trachylepis gravenhorstii
lineage 4a
Ranohira MH063387 MH063320 - - - -
ACP1406 FAZC 14635 MRSN R-
uncatalogued
Squamata:
Lacertilia
Scincidae Trachylepis gravenhorstii
lineage 4b °
Malaso MH063388 MH063321 - - - -
AC424 FAZC 12724 MRSN R3221 Squamata:
Lacertilia
Scincidae Trachylepis gravenhorstii
lineage 4b °
Zahavola - MH063322 - - - -
ACP1403 FAZC 14632 PBZT-uncata-
logued
Squamata:
Lacertilia
Scincidae Trachylepis nancycoutuae Malaso MH063389 - - - - -
XXXVI
Online Supplementary data – Walter Cocca et al.
Sample ID Fieldnumber Institutional
collection
number
Order Family Taxon Locality Cate-
gory
COI 16S 3'
fragment
ND1 ND2 ND4 Cytb
ACP1415 FAZC 14651 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Dromicodryas bernieri Andranomangara MH063390 - - - - -
ACP1434 FAZC 14689 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Dromicodryas bernieri Ranohira MH063391 - - - - -
AC404 FAZC 12631 MRSN R3226 Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Dromicodryas bernieri Zahavola - MH063323 - - - -
ACP2590 FAZC 12764 MRSN R3120 Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Ithycyphus oursi Canyon des Makis MH063392 MH063324 - - - -
ACP2556 ACZC 1932 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Ithycyphus oursi Namazaha Valley MH063393 - - - - -
ACP1437 FAZC 14697 MRSN R3741 Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Madagascarophis meridi-
onalis
Canyon des Rats MH063394 - - - - -
ACP1348 ACZC 1841 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Madagascarophis meridi-
onalis
Malaso MH063395 - - - - -
ACP1346 FAZC 14658 PBZT-uncata-
logued
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Madagascarophis meridi-
onalis
Malaso MH063396 - - - - -
ACP1349 ACZC 1855 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Madagascarophis meridi-
onalis
Namazaha Valley MH063397 - - - - -
ACP1340 MADCOL MRSN R-
uncatalogued
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Madagascarophis meridi-
onalis
Namazaha Valley MH063398 MH063325 - - - -
ACP1351 ACZC 1956 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Madagascarophis meridi-
onalis
Ranohira, Motel
d’Isalo
MH063399 - - - - -
AC425 FAZC 12664 MRSN R3183 Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Madagascarophis meridi-
onalis
Reine de l’Isalo - MH063326 - - - -
AC574 FAZC 12807 MRSN R-
uncatalogued
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Madagascarophis meridi-
onalis
Tsitorina - MH063327 - - - -
ACP1347 ACZC 1826 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Madagascarophis meridi-
onalis
Zahavola MH063400 MH063328 - - - -
ACP1427 FAZC 14677 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Psammophiinae
Mimophis mahfalensis Malaso MH063401 - - - - -
ACP1451 FAZC 14735 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Psammophiinae
Mimophis mahfalensis Ranohira MH063402 - - - - -
ACP1407 FAZC 14636 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Psammophiinae
Mimophis mahfalensis Zahavola MH063403 - - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Leioheterodon madagas-
cariensis
Bereketa - - - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Leioheterodon madagas-
cariensis
Isalo, no precise
locality info
- - - - - -
ACP1436 FAZC 14695 MRSN R-
uncatalogued
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Leioheterodon modestus * Analalava Forest MH063404 MH063329 - - - -
XXXVII
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Fieldnumber Institutional
collection
number
Order Family Taxon Locality Cate-
gory
COI 16S 3'
fragment
ND1 ND2 ND4 Cytb
AC421 FAZC 12725 MRSN R3233 Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Leioheterodon modestus Lola - MH063330 - - - -
ACP2551 ACZC 1965 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Leioheterodon modestus Ranohira, Motel
d’Isalo
MH063405 - - - - -
ACP2756 FAZC 14668 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Leioheterodon modestus Ranohira MH063406 - - - - -
ACP2537 FAZC 14704 PBZT-uncata-
logued
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Leioheterodon modestus Ranohira MH063407 MH063331 - - - -
AC422 FAZC 12666 MRSN R3210 Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Liophidium vaillanti Zahavola - MH063332 - - - MH063419
ACP1405 FAZC 14634 MRSN R3739 Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Lycodryas guentheri° Zahavola MH063408 MH063333 - - - -
ACP2594 FAZC 12806 MRSN R3216 Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Lycodryas sp. a. pseudo-
granuliceps Ca01 “Ando-
hahela” °
Antoha CCS MH063409 MH063334 - - - -
UNAVAIL-
ABLE
UNAVAIL-
ABLE
UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
Pseudoxyrhopus quinque-
lineatus
Isalo, no precise
locality info
- - - - - -
ACP2591 FAZC 12632 MRSN R-
uncatalogued
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
amnosophis lateralis Andriamanero MH063410 MH063335 - - - -
ACP2558 ACZC 1928 UNAVAIL-
ABLE
Squamata:
Serpentes
Lamprophiidae:
Pseudoxyrhophinae
amnosophis lateralis Namazaha Valley MH063411 - - - - -
Ad1-LB417 Ad1-LB417 UNAVAIL-
ABLE
Squamata:
Serpentes
Sanziniidae Acrantophis dumerili Isalo, no precise
locality info
- EU419793 - - - -
Smv2-ISA229 Smv2-ISA229 UNAVAIL-
ABLE
Squamata:
Serpentes
Sanziniidae Sanzinia volontany Isalo, no precise
locality info
- EU419803 - - - -
REPT_M5540 ZCMV 5540 UNAVAIL-
ABLE
Squamata:
Serpentes
Typhlopidae Madatyphlops arenarius Isalo, no precise
locality info
JQ909606 - - - - -
XXXVIII
Online Supplementary data – Walter Cocca et al.
Supplementary Table S5. List of Isalo’s voucher specimens of reptiles unequivocally identied based on morphology and/or molecular analyses. e distribution of each species includes
localities records from museological specimens, molecular data from this study, GenBank. ACZCV, Angelica Crottini Zoological Collection Voucher; FAZC, Franco Andreone Zoologi-
cal Collection; FGMV, Frank Glaw and Miguel Vences eld number; MRSN R-, Reptile collection of the Museo Regionale di Scienze Naturali of Torino, Italy; PBZT, Parc Botanique et
Zoologique de Tsimbazaza, Antananarivo, Madagascar; UADBA, Université d’Antananarivo Département de Biologie Animale, Madagascar; ZMA, Zoological Museum of Amsterdam, e
Netherlands; ZSM, Zoologische Staatssammlung München, Germany.*, individual molecularly identied as L. geayi using based onthe the COI marker but conrmed L. modestus aer
morphological inspection; °, New Range extentsion.
Sample ID Museum Catalogue Number Family Taxon Locality Notes
FAZC 12820 MRSN R3207 Pelomedusidae Pelomedusa subrufa (Lacépède, 1788) Ambatovaky
FAZC 14682 MRSN R3737 Pelomedusidae Pelomedusa subrufa (Lacépède, 1788) Zahavola
FAZC 14784 PBZT-uncatalogued Crocodylidae Crocodylus niloticus Laurenti, 1768 Ranohira
FAZC 11867 MRSN R2546 Chamaeleonidae Brookesia brygooi Raxworthy & Nussbaum, 1995 Namazaha Valley
FAZC 11972 MRSN R2891 Chamaeleonidae Furcifer major (Brygoo, 1971) Andranomena
UNAVAILABLE MRSN R1185 Chamaeleonidae Furcifer major (Brygoo, 1971) Ranohira
FAZC 12023 MRSN R2474 Chamaeleonidae Furcifer major (Brygoo, 1971) Zahavola
FAZC 12022 MRSN R2475 Chamaeleonidae Furcifer major (Brygoo, 1971) Zahavola
FAZC 12816 MRSN R3161 Chamaeleonidae Furcifer oustaleti (Mocquard, 1894) Bereketa
FAZC 12814 MRSN R3165 Chamaeleonidae Furcifer verrucosus (Cuvier, 1829) Sakavato
FAZC 12813 MRSN R3169 Chamaeleonidae Furcifer verrucosus (Cuvier, 1829) Sakavato
UNAVAILABLE UMMZ 196575 Gekkonidae Geckolepis typica GRANDIDIER, 1867 Bereketa
UNAVAILABLE UMMZ 196576 Gekkonidae Geckolepis typica GRANDIDIER, 1867 Bereketa
UNAVAILABLE UMMZ 215902 Gekkonidae Geckolepis typica GRANDIDIER, 1867 Analalava Forest
UNAVAILABLE UMMZ 215903 Gekkonidae Geckolepis typica GRANDIDIER, 1867 Analalava Forest
UNAVAILABLE UMMZ 215904 Gekkonidae Geckolepis typica GRANDIDIER, 1867 Sahanafa
FAZC 12230 MRSN R2567 Chamaeleonidae Calumna cf. gastrotaenia Ambohimandrozo Village Unassigned
FAZC 11897 MRSN R2406 Gekkonidae Hemidactylus mercatorius Gray, 1842 Analalava Forest
FAZC 11898 MRSN R2407 Gekkonidae Hemidactylus mercatorius Gray, 1842 Analalava Forest
FAZC 14650 PBZT-uncatalogued Gekkonidae Hemidactylus mercatorius Gray, 1842 Malaso
FAZC 13027 MRSN R3206 Gekkonidae Hemidactylus mercatorius Gray, 1842 Ranohira
FAZC 14633 MRSN R3747 Gekkonidae Hemidactylus mercatorius Gray, 1842 Zahavola
UNAVAILABLE ZMA 19595 Gekkonidae Lygodactylus sp. a. pictus Ca01 “Isalo” Analalava Forest
FAZC 14649 MRSN R3746 Gekkonidae Lygodactylus sp. a. tuberosus Ca02 “Isalo” Malaso
FAZC 14656 MRSN R3749 Gekkonidae Lygodactylus sp. a. tuberosus Ca02 “Isalo” Malaso
FAZC 12669 MRSN R3209 Gekkonidae Lygodactylus sp. Zahavola Unassigned
FAZC 14743 MRSN R3736 Gekkonidae Paroedura sp. a. bastardi Ca01 “Marofandilia/Miandrivazo” ° Zahavola
FAZC 14661 MRSN R3745 Gekkonidae Paroedura sp. a. bastardi Ca01 “Marofandilia/Miandrivazo” ° Zahavola
FAZC 11940 MRSN R2553 Gekkonidae Paroedura sp. a. bastardi Ca01 “Marofandilia/Miandrivazo” ° Isalo, no precise locality info
XXXIX
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Catalogue Number Family Taxon Locality Notes
FAZC 12360 MRSN R2448 Gekkonidae Paroedura cf. bastardi Ca01 “Marofandilia/Miandrivazo” ° Namazaha Valley
FAZC 14657 PBZT-uncatalogued Gekkonidae Paroedura sp. a. bastardi Ca02 “Isalo” Zahavola
FAZC 11932 MRSN R2529 Gekkonidae Paroedura sp. a. bastardi Ca03 “Ilakaka” Isalo, no precise locality info
FAZC 11819 MRSN R2568 Gekkonidae Paroedura sp. a. bastardi Ca03 “Ilakaka” Isalo, no precise locality info
FAZC 11800 MRSN R2569 Gekkonidae Paroedura sp. a. bastardi Ca03 “Ilakaka” Isalo, no precise locality info
FAZC 12790 MRSN R3205 Gekkonidae Paroedura sp. a. bastardi Ca03 “Ilakaka” Kazofoty
FAZC 14730 MRSN R3748 Gekkonidae Paroedura vahiny Malaso
FAZC 11816 MRSN R2400 Gekkonidae Paroedura vahiny Andohasahenina
FAZC 11919 MRSN R2415 Gekkonidae Paroedura cf. bastardi Andohasahenina Unassigned
FAZC 11967 MRSN R2396 Gekkonidae Paroedura cf. bastardi Andranomena Unassigned
FAZC 11968 MRSN R2397 Gekkonidae Paroedura cf. bastardi Andranomena Unassigned
FAZC 11969 MRSN R2398 Gekkonidae Paroedura cf. bastardi Andranomena Unassigned
FAZC 12032 MRSN R2417 Gekkonidae Paroedura cf. bastardi Zahavola Unassigned
FAZC 11941 MRSN R2552 Gekkonidae Paroedura cf. bastardi Isalo, no precise locality info Unassigned
REPT_F358 ZSM 192/2004 Gekkonidae Phelsuma hielscheri Rösler, Obst & Seipp, 2001 Isalo, no precise locality info
FAZC 12031 MRSN R2486 Gekkonidae Phelsuma hielscheri Rösler, Obst & Seipp, 2001 Zahavola
FAZC 12763 MRSN R3213 Gerrhosauridae Zonosaurus laticaudatus (Grandidier, 1869) Canyon des Makis
FAZC 12767 MRSN R-uncatalogued Gerrhosauridae Zonosaurus laticaudatus (Grandidier, 1869) Isalo, no precise locality info
FAZC 12761 MRSN R3232 Gerrhosauridae Zonosaurus madagascariensis (Gray, 1831) Canyon des Makis
FAZC 14698 PBZT-uncatalogued Gerrhosauridae Zonosaurus karsteni ° Ranohira Bas
FGMV 2002_1465 UADBA 21059 Opluridae Chalarodon madagascariensis Peters, 1854 Analalava Forest
FAZC 12890a MRSN R3127 Opluridae Chalarodon madagascariensis Peters, 1854 Antambonoa
FAZC 12890b MRSN R3128 Opluridae Chalarodon madagascariensis Peters, 1854 Antambonoa
FAZC 12762 MRSN R3219 Opluridae Chalarodon madagascariensis Peters, 1854 Canyon des Makis
GA 78 MRSN R2446 Opluridae Chalarodon madagascariensis Peters, 1854 Isalo, no precise locality info
GA 77 MRSN R2447 Opluridae Chalarodon madagascariensis Peters, 1854 Isalo, no precise locality info
FAZC 12792 PBZT-uncatalogued Opluridae Chalarodon madagascariensis Peters, 1855 Vohimaro
UNAVAILABLE ZSM 939/2003 Opluridae Oplurus cyclurus (Merrem, 1820) Analalava Forest
UNAVAILABLE ZSM 940/2003 Opluridae Oplurus cyclurus (Merrem, 1820) Analalava Forest
FAZC 12371 MRSN R2454 Opluridae Oplurus cyclurus (Merrem, 1820) Andohasahenina
FAZC 11970 MRSN R2377 Opluridae Oplurus cyclurus (Merrem, 1820) Andranomena
FAZC 12889 MRSN R3238 Opluridae Oplurus cyclurus (Merrem, 1820) Antambonoa
FAZC 12665 MRSN R3239 Opluridae Oplurus cyclurus (Merrem, 1820) Malaso
FAZC 12789 MRSN R3215 Opluridae Oplurus grandidieri Mocquard, 1900 Antoha
FAZC 11843 MRSN R2380 Opluridae Oplurus quadrimaculatus ° Andohasahenina
XL
Online Supplementary data – Walter Cocca et al.
Sample ID Museum Catalogue Number Family Taxon Locality Notes
FAZC 11988 MRSN R2378 Opluridae Oplurus quadrimaculatus ° Andranomena
FAZC 11942 MRSN R2379 Opluridae Oplurus quadrimaculatus ° Andranomena
FAZC 11943 MRSN R2381 Opluridae Oplurus quadrimaculatus ° Andranomena
UNAVAILABLE MRSN R3270 Opluridae Oplurus quadrimaculatus ° Isalo, no precise locality info
UNAVAILABLE MRSN R3266 Opluridae Oplurus quadrimaculatus ° Isalo, no precise locality info
UNAVAILABLE MRSN R3269 Opluridae Oplurus quadrimaculatus ° Isalo, no precise locality info
UNAVAILABLE MRSN R3267 Opluridae Oplurus quadrimaculatus ° Isalo, no precise locality info
UNAVAILABLE MRSN R3265 Opluridae Oplurus quadrimaculatus ° Isalo, no precise locality info
UNAVAILABLE MRSN R3268 Opluridae Oplurus quadrimaculatus ° Isalo, no precise locality info
FAZC 14687 MRSN R-uncatalogued Opluridae Oplurus quadrimaculatus ° Malaso
FAZC 13263 MRSN R3243 Opluridae Oplurus saxicola ° Sakavato
FAZC 13264 MRSN R3244 Opluridae Oplurus saxicola ° Sakavato
FAZC 13265 MRSN R3245 Opluridae Oplurus saxicola ° Sakavato
FAZC 13266 MRSN R3246 Opluridae Oplurus saxicola ° Sakavato
FAZC 13019 MRSN R3224 Scincidae Trachylepis elegans (Peters, 1854) Andohaosy
FAZC 11931 MRSN R2393 Scincidae Trachylepis elegans (Peters, 1854) Andranombilahy
FAZC 11990 MRSN R2437 Scincidae Trachylepis elegans (Peters, 1854) Andranomena
UNAVAILABLE MRSN R1173 Scincidae Trachylepis elegans (Peters, 1854) Isalo, no precise locality info
FAZC 12045 MRSN R2455 Scincidae Trachylepis elegans (Peters, 1854) Petit Nazareth valley
FAZC 12549 MRSN R3123 Scincidae Trachylepis elegans (Peters, 1854) Zahavola
FAZC 14635 MRSN R-uncatalogued Scincidae Trachylepis gravenhorstii (Duméril & Bibron, 1839) lineage 4b ° Malaso
FAZC 12724 MRSN R3221 Scincidae Trachylepis gravenhorstii (Duméril & Bibron, 1839) lineage 4b ° Zahavola
FAZC 12362 MRSN R2449 Scincidae Trachylepis gravenhorstii (Duméril & Bibron, 1839) Namazaha Valley
FAZC 11973 MRSN R2401 Scincidae Trachylepis nancycoutuae (Nussbaum & Raxworthy, 1998) Andranomena
FAZC 11951 MRSN R2430 Scincidae Trachylepis nancycoutuae (Nussbaum & Raxworthy, 1998) Bemenara
FAZC 14632 PBZT-uncatalogued Scincidae Trachylepis nancycoutuae (Nussbaum & Raxworthy, 1998) Malaso
FAZC 12667 MRSN R3212 Scincidae Trachylepis nancycoutuae (Nussbaum & Raxworthy, 1998) Zahavola
FAZC 12007 MRSN R2367 Lamprophiidae Dromicodryas bernieri (Duméril, Bibron & Duméril, 1854) Andranomena
FAZC 12765 MRSN R3227 Lamprophiidae Dromicodryas bernieri (Duméril, Bibron & Duméril, 1854) Lola
FAZC 11824 MRSN R2366 Lamprophiidae Dromicodryas bernieri (Duméril, Bibron & Duméril, 1854) Ranohira
FAZC 12631 MRSN R3226 Lamprophiidae Dromicodryas bernieri (Duméril, Bibron & Duméril, 1854) Zahavola
FAZC 12764 MRSN R3120 Lamprophiidae Ithycyphus oursi Domergue, 1986 Canyon des Makis
FAZC 12006 MRSN R2336 Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Andranomena
FAZC 14697 MRSN R3741 Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Canyon des Rats
FAZC 14658 PBZT-uncatalogued Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Malaso
XLI
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Sample ID Museum Catalogue Number Family Taxon Locality Notes
FAZC 14788 PBZT-uncatalogued Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Malaso
FAZC 11869 MRSN R2334 Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Namazaha Valley
FAZC 11868 MRSN R2339 Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Namazaha Valley
FAZC 12664 MRSN R3183 Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Reine de l’Isalo
FAZC 12807 MRSN R-uncatalogued Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Tsitorina
FAZC 12047 MRSN R2335 Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Vallée du Petit Nazareth
FAZC 12519 MRSN R3182 Lamprophiidae Madagascarophis meridionalis (Domergue, 1987) Zahavola
FAZC 12009 MRSN R2363 Lamprophiidae Mimophis mahfalensis (Grandidier, 1867) Andranomena
FAZC 11944 MRSN R2351 Lamprophiidae Mimophis mahfalensis (Grandidier, 1867) Bemenara
FAZC 12368 MRSN R2352 Lamprophiidae Mimophis mahfalensis (Grandidier, 1867) Bemenara
FAZC 12815 MRSN R3176 Lamprophiidae Mimophis mahfalensis (Grandidier, 1867) Bereketa
FAZC 14695 MRSN R-uncatalogued Lamprophiidae Leioheterodon modestus (Günther, 1863) * Analalava Forest
FAZC 12995 MRSN R3236 Lamprophiidae Leioheterodon modestus (Günther, 1863) Andozoky
FAZC 12766 MRSN R3234 Lamprophiidae Leioheterodon modestus (Günther, 1863) Canyon des rats
FAZC 12725 MRSN R3233 Lamprophiidae Leioheterodon modestus (Günther, 1863) Lola
FAZC 14704 PBZT-uncatalogued Lamprophiidae Leioheterodon modestus (Günther, 1863) Ranohira
FAZC 12666 MRSN R3210 Lamprophiidae Liophidium vaillanti (Mocquard, 1901) Zahavola
FAZC 14634 MRSN R3739 Lamprophiidae Lycodryas guentheri (Boulenger, 1896) ° Zahavola
FAZC 12806 MRSN R3216 Lamprophiidae Lycodryas sp. a. granuliceps Ca01 “Andohahela” ° Antoha
FAZC 12632 MRSN R-uncatalogued Lamprophiidae amnosophis lateralis (Duméril, Bibron & Duméril, 1854) Andriamanero
FAZC 11833 MRSN R2369 Typhlopidae Madatyphlops arenarius (Grandidier, 1872) Ranohira
FAZC 11844 MRSN R2368 Typhlopidae Madatyphlops arenarius (Grandidier, 1872) Ranohira
FAZC 14696 MRSN R-uncatalogued Typhlopidae Madatyphlops arenarius (Grandidier, 1872) Ilakaka
XLII
Online Supplementary data – Walter Cocca et al.
Supplementary Table S6. Primer sequences and PCR conditions used in the present study; *: originally from Arévalo et al. (1994); modied primer sequences developed by Ed Louis,
Omaha’s Henry Doorly Zoo; **: originally from Burbrink et al. (2000); modied primer sequences developed by De Queiroz et al. (2002).
Gene Primer name Sequence (5’-3’) Source PCR conditions
16S rRNA 3’ terminus AC_16s_ar CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 94 (90), [94 (45), 55 (45), 72 (90) x33], 72 (300)
16S rRNA 3’ terminus AC_16s_br CCGGTYTGAACTCAGATCAYGT Modied from Palumbi et al. (1991)
16S rRNA 5’ terminus 16SL3 AGCAAAGAHYWWACCTCGTACCTTTTGCAT Vences et al. (2003) 94 (90), [94 (45), 55 (45), 72 (90) x33], 72 (350)
16S rRNA 5’ terminus 16SAH ATGTTTTTGATAAACAGGCG Vences et al. (2003)
COX1 RepCOI-F TNTTMTCAACNAACCACAAAGA Nagy et al. (2012) 94 (180), [94 (40), 49 (30), 72 (60) x40], 72 (420)
COX1 RepCOI-R ACTTCTGGRTGKCCAAARAATCA Nagy et al. (2012)
ND1 + associated tRNAs ND1 intf2 AAYCGVGCVCCWTTYGACCTWACAGA Schmitz et al. (2005) 95 (120), [95 (30), 50 (30), 72 (60) x40], 72 (600)
ND1 + associated tRNAs ND1 tmet TCGGGGTATGGGCCCRARAGCTT Leaché & Reeder (2002)
ND4 ND4 CACCTATGACTACCAAAAGCTCATGTAGA Arévalo et al. (1994)* 94 (90), [94 (45), 47 (45), 72 (90) x33], 72 (600)
ND4 leutRNA AGCCATTACTTTTACTTGGATTTGCACC Arévalo et al. (1994)*
Cytb - amphibians Cytb-a CCATGAGGACAAATATCATTYTGRGG Bossuyt & Milinkovitch (2000) 94(90), [94 (30), 53 (45), 72 (90) x 35], 72 (600)
Cytb - amphibians Cytb-c CTACTGGTTGTCCTCCGATTCATGT Bossuyt & Milinkovitch (2000)
Cytb - reptiles L14910 GACCTGTGATMTGAAAAACCAYCGTTGT Burbrink et al. (2000)** 94 (420), [94 (40), 49,3 (30), 72 (60) x40], 72 (420)
Cytb - reptiles H16064 CTTTGGTTTACAAGAACAATGCTTTA Burbrink et al. (2000)**
XLIII
Online Supplementary data – e herpetofauna of the Isalo Massif, Madagascar
Supplementary Table S7. Pairwise genetic distances (p-distance) between (below the diagonal) and within (along the diagonal, bold) amphibian taxa according to 16S rRNA gene fragment
sequence variation; *, New species record.
B. doulioti
B. luteus
B. obscurus
B. occidentalis
L. labrosum
B. sp. Ca05
G. azzurrae
G. corvus
M. betsileo
M. sp. a. expectata South*
M. expectata
M. femoralis
M. noralottae
M. sp. Ca14
M. sp. Ca65*
M. sp. Ca48
D. insularis
S. brevis
S. gottlebei
S. sp. Ca01
S. sp. Ca02*
H. luteostriatus
P. mascareniensis
B. doulioti 0.001
B. luteus 0.137 0.014
B. obscurus 0.136 0.114 0.002
B. occidentalis 0.149 0.116 0.095 0.001
L. labrosum 0.118 0.157 0.156 0.150 0.002
Blommersia sp. Ca05 0.124 0.151 0.162 0.149 0.112 0.001
G. azzurrae 0.183 0.190 0.183 0.160 0.153 0.157 0.003
G. corvus 0.159 0.169 0.175 0.176 0.148 0.144 0.091 0.001
M. betsileo 0.159 0.182 0.180 0.170 0.122 0.107 0.171 0.153 0.006
M. sp. a. expectata South*0.162 0.184 0.179 0.168 0.115 0.108 0.179 0.164 0.015 0.000
M. expectata 0.153 0.179 0.183 0.168 0.118 0.103 0.177 0.154 0.017 0.009 0.002
M. femoralis 0.155 0.174 0.190 0.182 0.145 0.147 0.173 0.163 0.160 0.162 0.155 0.004
M. noralottae 0.146 0.169 0.196 0.167 0.130 0.139 0.165 0.164 0.142 0.133 0.137 0.115 0.000
Mantidactylus sp. Ca14 0.156 0.166 0.195 0.187 0.122 0.147 0.177 0.165 0.158 0.152 0.153 0.143 0.106 0.000
Mantidactylus sp. Ca65* 0.143 0.168 0.181 0.180 0.122 0.139 0.171 0.150 0.142 0.140 0.133 0.121 0.041 0.101 0.001
Mantidactylus sp. Ca48 0.156 0.166 0.180 0.181 0.133 0.166 0.174 0.145 0.152 0.154 0.156 0.122 0.115 0.134 0.112 0.000
D. insularis 0.170 0.196 0.210 0.189 0.163 0.184 0.200 0.191 0.196 0.197 0.188 0.180 0.174 0.174 0.172 0.200 0.002
S. brevis 0.168 0.174 0.175 0.158 0.147 0.161 0.181 0.172 0.166 0.167 0.168 0.180 0.158 0.162 0.155 0.186 0.116 0.004
S. gottlebei 0.164 0.171 0.171 0.152 0.151 0.162 0.175 0.165 0.166 0.169 0.168 0.177 0.155 0.165 0.158 0.192 0.124 0.047 0.005
Scaphiophryne sp. Ca01 0.169 0.174 0.173 0.150 0.159 0.161 0.172 0.165 0.169 0.179 0.175 0.175 0.158 0.168 0.159 0.176 0.124 0.056 0.052 0.001
Scaphiophryne sp. Ca02* 0.175 0.185 0.178 0.160 0.163 0.156 0.167 0.171 0.163 0.179 0.166 0.178 0.165 0.172 0.161 0.180 0.125 0.050 0.051 0.038 n/c
H. luteostriatus 0.217 0.216 0.232 0.223 0.200 0.197 0.204 0.208 0.208 0.211 0.205 0.225 0.213 0.196 0.200 0.213 0.173 0.147 0.153 0.160 0.156 0.000
P. mascareniensis 0.172 0.164 0.186 0.188 0.168 0.184 0.180 0.186 0.188 0.194 0.191 0.181 0.181 0.184 0.176 0.201 0.168 0.168 0.172 0.168 0.176 0.183 0.000
XLIV
Online Supplementary data – Walter Cocca et al.
Supplementary Table S8. Pairwise genetic distances (p-distance) between (below the diagonal) and within (along the diagonal, bold) reptile taxa according to COI gene fragment sequence variation.
P. subrufa
C. niloticus
B. brygooi
F. major
F. oustaleti
F. verrucosus
H. mercatorius
L. sp. a. tuberosus Ca02
P. picta
P. sp. a. bastardi Ca01
P. sp. a. bastardi Ca02
P. sp. a. bastardi Ca03
P. vahiny
P. hielscheri
P. mutabilis
Z. laticaudatus
Z. madagascariensis
Z. karsteni
C. madagascariensis
O. cyclurus
O. grandidieri
O. quadrimaculatus
O. saxicola
T. elegans
T. gravenhorstii
T. nancycoutuae
D. bernieri
I. oursi
M. meridionalis
M. mahfalensis
L. modestus
L. guentheri
L. sp. a. granuliceps Ca02
T. lateralis
M. arenarius
P. subrufa n/c
C. niloticus 0.249 n/c
B. brygooi 0.288 0.276 n/c
F. major 0.303 0.303 0.188 0.002
F. oustaleti 0.302 0.291 0.190 0.096 0.000
F. verrucosus 0.301 0.271 0.191 0.105 0.087 0.007
H. mercatorius 0.280 0.253 0.315 0.301 0.300 0.297 0.026
L. sp. a. tuberosus Ca02 0.250 0.250 0.302 0.290 0.300 0.281 0.229 0.000
P. picta 0.290 0.298 0.309 0.287 0.293 0.304 0.262 0.239 0.021
P. sp. a. bastardi Ca01 0.289 0.286 0.334 0.320 0.330 0.301 0.277 0.255 0.279 0.001
P. sp. a. bastardi Ca02 0.286 0.265 0.327 0.331 0.325 0.291 0.240 0.265 0.282 0.263 0.000
P. sp. a. bastardi Ca03 0.273 0.286 0.312 0.325 0.335 0.322 0.248 0.227 0.249 0.246 0.233 0.004
P. vahiny 0.280 0.286 0.312 0.325 0.335 0.322 0.248 0.227 0.249 0.244 0.233 0.215 n/c
P. hielscheri 0.277 0.253 0.298 0.296 0.311 0.286 0.252 0.243 0.267 0.295 0.263 0.258 0.258 n/c
P. mutabilis 0.254 0.263 0.285 0.271 0.283 0.271 0.250 0.237 0.271 0.275 0.249 0.254 0.254 0.198 n/c
Z. laticaudatus 0.249 0.222 0.280 0.258 0.261 0.244 0.235 0.225 0.282 0.261 0.274 0.246 0.246 0.237 0.234 n/c
Z. madagascariensis 0.235 0.225 0.259 0.284 0.261 0.279 0.257 0.237 0.293 0.288 0.254 0.271 0.271 0.238 0.236 0.159 0.007
Z. karsteni 0.250 0.221 0.280 0.272 0.273 0.261 0.248 0.250 0.292 0.276 0.271 0.261 0.261 0.235 0.228 0.146 0.172 n/c
C. madagascariensis 0.256 0.241 0.276 0.276 0.273 0.266 0.257 0.251 0.268 0.282 0.227 0.235 0.259 0.235 0.246 0.211 0.200 0.202 n/c
O. cyclurus 0.271 0.263 0.312 0.295 0.305 0.294 0.245 0.257 0.276 0.294 0.258 0.261 0.261 0.240 0.265 0.227 0.230 0.210 0.186 0.000
O. grandidieri 0.233 0.248 0.278 0.290 0.305 0.318 0.251 0.253 0.265 0.280 0.241 0.254 0.254 0.245 0.250 0.207 0.217 0.199 0.166 0.170 n/c
O. quadrimaculatus 0.253 0.245 0.281 0.310 0.284 0.301 0.225 0.249 0.292 0.295 0.236 0.280 0.290 0.233 0.256 0.204 0.196 0.229 0.170 0.158 0.154 n/c
O. saxicola 0.244 0.242 0.281 0.291 0.282 0.288 0.239 0.255 0.275 0.281 0.242 0.265 0.270 0.239 0.247 0.207 0.209 0.210 0.167 0.160 0.139 0.000 n/c
T. elegans 0.267 0.267 0.288 0.311 0.309 0.271 0.242 0.258 0.276 0.279 0.250 0.253 0.253 0.253 0.260 0.212 0.204 0.220 0.195 0.213 0.219 0.219 0.208 0.003
T. gravenhorstii 0.268 0.265 0.310 0.310 0.308 0.272 0.242 0.260 0.279 0.284 0.241 0.254 0.254 0.266 0.254 0.221 0.212 0.210 0.198 0.202 0.198 0.220 0.209 0.106 0.035
T. nancycoutuae 0.237 0.226 0.302 0.309 0.291 0.288 0.247 0.231 0.262 0.288 0.273 0.250 0.250 0.267 0.244 0.210 0.196 0.215 0.227 0.194 0.216 0.224 0.224 0.189 0.185 n/c
D. bernieri 0.272 0.285 0.296 0.296 0.313 0.268 0.288 0.272 0.310 0.313 0.300 0.286 0.286 0.279 0.279 0.254 0.268 0.264 0.266 0.273 0.267 0.272 0.279 0.278 0.282 0.281 0.005
I. oursi 0.293 0.295 0.304 0.303 0.325 0.256 0.278 0.289 0.325 0.310 0.327 0.298 0.298 0.302 0.293 0.277 0.280 0.266 0.308 0.303 0.281 0.274 0.285 0.275 0.305 0.289 0.196 0.000
M. meridionalis 0.285 0.274 0.306 0.290 0.296 0.270 0.273 0.285 0.278 0.313 0.303 0.279 0.279 0.288 0.273 0.287 0.286 0.274 0.266 0.286 0.267 0.290 0.287 0.283 0.289 0.283 0.188 0.205 0.036
M. mahfalensis 0.267 0.254 0.293 0.299 0.310 0.308 0.290 0.257 0.281 0.299 0.312 0.299 0.299 0.284 0.268 0.272 0.234 0.271 0.262 0.277 0.288 0.280 0.274 0.283 0.282 0.252 0.193 0.226 0.187 0.001
L. modestus 0.280 0.279 0.283 0.287 0.299 0.258 0.289 0.266 0.296 0.310 0.286 0.254 0.254 0.260 0.242 0.264 0.261 0.257 0.261 0.282 0.258 0.274 0.265 0.275 0.285 0.274 0.177 0.221 0.198 0.183 0.078
L. guentheri 0.290 0.268 0.295 0.280 0.296 0.244 0.275 0.273 0.298 0.318 0.310 0.297 0.295 0.284 0.265 0.269 0.265 0.250 0.261 0.278 0.265 0.282 0.267 0.284 0.287 0.276 0.177 0.211 0.185 0.184 0.180 0.000
L. sp. a. granuliceps Ca02 0.306 0.312 0.285 0.305 0.323 0.301 0.311 0.284 0.326 0.323 0.331 0.282 0.282 0.289 0.270 0.276 0.298 0.278 0.296 0.319 0.283 0.342 0.297 0.299 0.298 0.293 0.184 0.215 0.207 0.218 0.208 0.138 n/c
T. lateralis 0.286 0.294 0.293 0.310 0.326 0.271 0.294 0.287 0.295 0.322 0.318 0.292 0.292 0.287 0.285 0.282 0.287 0.274 0.294 0.296 0.280 0.289 0.292 0.295 0.289 0.288 0.200 0.219 0.224 0.226 0.191 0.211 0.212 0.008
M. arenarius 0.277 0.267 0.295 0.296 0.292 0.293 0.269 0.272 0.272 0.293 0.290 0.246 0.246 0.274 0.271 0.257 0.256 0.243 0.269 0.266 0.262 0.281 0.261 0.272 0.265 0.264 0.244 0.265 0.260 0.230 0.243 0.251 0.259 0.274 n/c
