Access to this full-text is provided by Springer Nature.
Content available from BMC Developmental Biology
This content is subject to copyright. Terms and conditions apply.
R E S E A R C H A R T I C L E Open Access
Molecular signatures of epithelial oviduct
cells of a laying hen (Gallus gallus
domesticus) and quail (Coturnix japonica)
Katarzyna Stadnicka
1*
, Anna Sławińska
1
, Aleksandra Dunisławska
1
, Bertrand Pain
2
and Marek Bednarczyk
1
Abstract
Background: In this work we have determined molecular signatures of oviduct epithelial and progenitor cells. We
have proposed a panel of selected marker genes, which correspond with the phenotype of oviduct cells of a laying
hen (Gallus gallus domesticus) and quail (Coturnix japonica). We demonstrated differences in characteristics of those
cells, in tissue and in vitro,with respect to different anatomical and functional parts of the oviduct (infundibulum
(INF), distal magnum (DM, and proximal magnum (PM)). The following gene expression signatures were studied:
(1) oviduct markers (estrogen receptor 1, ovalbumin, and SPINK7 - ovomucoid), (2) epithelial markers (keratin 5,
keratin 14, and occludin) and (3) stem-like/progenitor markers (CD44 glycoprotein, LGR5, Musashi-1, and sex determining
region Y-box 9, Nanog homebox, OCT4/cPOUV gene encoding transcription factor POU5F3).
Results: In chicken, the expression of oviduct markers increased toward the proximal oviduct. Epithelial markers
keratin14 and occludin were high in distal oviduct and decreased toward the proximal magnum. In quail oviduct
tissue, the gene expression pattern of oviduct/epithelial markers was similar to chicken. The markers of progenitors/
stemness in hen oviduct (Musashi-1 and CD44 glycoprotein) had the highest relative expression in the infundibulum
and decreased toward the proximal magnum. In quail, we found significant expression of four progenitor markers
(LGR5 gene, SRY sex determining region Y-box 9, OCT4/cPOUV gene, and CD44 glycoprotein) that were largely present
in the distal oviduct. After in vitro culture of oviduct cells, the gene expression pattern has changed. High secretive
potential of magnum-derived cells diminished by using decreased abundance of mRNA. On the other hand, chicken
oviduct cells originating from the infundibulum gained ability to express OVM and OVAL. Epithelial character of the
cells was maintained in vitro.Among progenitor markers, both hen and quail cells expressed high level of SOX9, LGR5
and Musashi-1.
Conclusion: Analysis of tissue material revealed gradual increase/decrease pattern in majority of the oviduct markers
in both species. This pattern changed after the oviductal cells have been cultured in vitro. The results can provide
molecular tools to validate the phenotype of in vitro biological models from reproductive tissue.
Keywords: Laying hen, Laying quail, Oviduct, Epithelial cells, Progenitor cells, Molecular signatures
Background
Avian oviduct in biomedical research
Avian species are excellent biological models in
reproduction and tumorigenesis [1] as well as efficient
source of secreting cells for use in bioreactors [2–4].
Both hen and quail oviduct cells secrete human thera-
peutic proteins after genetic modification [3]. Therefore
the oviduct epithelium is a useful and fast in vitro model
to test for the efficiency of viral [5] and nonviral genetic
constructs [6] to study the modified secretome. Both
quail and hen produce cellular substrates for the devel-
opment of vaccines [7]. Genetic markers, including
markers of stemness, are useful to identify mechanisms
of malignant changes in a fallopian tube, because the
somatic stem cells contribute to a population of tumor-
initiating cells [8]. Recently, the knowledge about cell
differentiation, physiology, and cancerogenic changes in
avian oviduct has been extrapolated to women fallopian
* Correspondence: katarzyna.stadnicka@utp.edu.pl
1
Department of Animal Biochemistry and Biotechnology, UTP University of
Science and Technology, Mazowiecka 28, 85-084 Bydgoszcz, Poland
Full list of author information is available at the end of the article
© The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Stadnicka et al. BMC Developmental Biology (2018) 18:9
https://doi.org/10.1186/s12861-018-0168-2
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
tube and uterine tract [9,10]. However, in avian species,
markers of stemness in oviduct cells have not been re-
ported yet. There is a knowledge gap regarding distinct-
ive features of the epithelial cells in in vitro conditions
vs. their status in tissue, which limits full understanding
and characterization of this cellular model. In this paper,
we have made initial attempts to confirm progenitor
molecular signatures in oviducts of laying hen (Gallus
gallus domesticus) and quail (Coturnix japonica), both in
tissue and in cultured oviduct epithelial cells (in vitro
assay). We have addressed the following questions: What
is the location of progenitor cells in avian oviduct tissue?
What is an individual molecular characteristic of distal
oviduct tissue compartments? Is this distinctive charac-
teristic stable once the cells are plated in in vitro condi-
tion? Is the molecular pattern shared between these two
model species (laying hen and quail) used for oviduct
studies? Altogether, this study aims to provide a new un-
derstanding of molecular characteristic of oviduct epi-
thelial cells in avian species.
Adult epithelial cells in the oviduct
In adult tissue, epithelial progenitor cells have limited
potential to divide and they can develop only into few
differentiated cell types. They express stem cell markers
and can differentiate into epithelial cells with various
phenotypes.
Mucous epithelium of an avian oviduct is composed of
simple columnar cells equipped with cilia to move the
ovum from distal to proximal oviduct and of nonciliated
secreting cells. Both cell types require sustained renewal
from the stem cell compartment and a high proliferation
and maturation activity from the progenitor compart-
ment. Those compartments are putatively based under
the luminal epithelium as cellular niches [11]. In a mam-
malian fallopian tube, stem cells niches were tracked
using antibodies and genetic markers and were found to
be localized in the distal fallopian tube [8,12]. In our
earlier research, we determined faster proliferation of
cultivated hen oviduct cells derived from infundibulum/
distal magnum compared to the cells that were sourced
from a proximal magnum. We have also determined that
distal oviduct compartments were positively immuno-
stained against CD44 and p63, which are known to be
epithelial stem/progenitor markers [13]. Thereby, we
have hypothesized that distal segments of avian oviduct
contain progenitor gene expression signatures.
Genetic markers of distinctive signatures in avian oviduct
epithelium
Characterization of oviduct cells using molecular markers
for epithelial progenitors contributes to the understanding
of differentiation and regeneration processes, which occur
in the oviduct epithelium. As reported earlier, the self-
renewal activity of cells in the fallopian tube occurs in its
distal part [14,15]. Thereby, in this paper, we have focused
on distal parts of the oviduct (the closest to ovaries and
abdomen) to follow the molecular characteristics of the
cells in tissue and in vitro. We propose a panel of epithelial
genetic markers to determine the progenitor/epithelial cell
pattern in selected compartments of the oviduct (Fig. 1).
In particular, we have aimed to reveal which of the avian
oviduct compartments (infundibulum (INF), distal mag-
num (DM), or proximal magnum (PM)) carry known pro-
genitor signatures.
Methods
Isolation of the oviduct tissue
In this study, all the procedures involving experimental
animals were approved by the Local Ethics Committee
for Animal Research (http://lke.utp.edu.pl) located at the
Faculty of Animal Breeding and Biology, UTP University
of Science and Technology in Bydgoszcz (study approval
reference number 35/2012, in accordance with the
2010_63_UE_PL Directive). The Hybrid Tetra SL laying
hens (n= 6, 40 weeks old) were obtained from a com-
mercial farm (Nowosc, Pradocin, Poland). Laying Japanese
quails (n= 6, 10 weeks old) were obtained from a com-
mercial producer (K. Drazek, Wyzne, Poland). All birds
laid eggs at a daily rate and no hormonal stimulation was
applied for this study. Immediately upon transportation,
the animals were sacrificed by cervical dislocation. Only
the oviducts after egg passage, with ovum position in a
shell gland, were used for the experiments. Each oviduct
was rinsed twice in tube filled out with 25 mL physio-
logical buffered saline (PBS) w/o Mg, w/o Ca (Lonza Bio-
sciences, Celllab, Warszawa, Poland), which was gently
mixed with Penicillin-Streptomycin solution at 1:100 (v:v;
Life Technologies, Warszawa, Poland).
In vitro culture of oviduct epithelial cells
The epithelial cells were isolated from the oviduct tissue
using the methodology described earlier [16]. Immedi-
ately after tissue collection, three oviduct fragments were
dissected: infundibulum, distal magnum, and proximal
magnum, each 3 cm long. Each fragment was cleaned
off the mesentery tissue and minced with a scalpel blade
on a Petri dish. The minced fragments were digested in
a solution of 1 mg/mL collagenase P (Sigma-Aldrich,
Poznan, Poland) in Advanced Dulbecco’s Modified Ea-
gles Medium-F12 (DMEM/F-12; Life Technologies,
Warszawa, Poland) for 30 min at 37 °C, on a shaker.
Due to the size of oviductal tubes, the amount of minced
tissue was ~ 50% less in quail than in hen. Thus, ad-
equately lower volumes of digestion solution were ap-
plied to process the quail oviduct tissue. The cells were
counted manually using Neubauer hemocytometer and
seeded at a density of 4 × 10
4
cells/cm
2
into 25 cm
2
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 2 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
vented BD type Primaria flasks (Becton Dickinson, Diag-
med, Warszawa, Poland). The cells were incubated in
7% CO
2
atmosphere at 37 °C. The oviduct cells were
maintained in DMEM-F12 supplemented with 5% (v/v)
fetal bovine serum (FBS; Life Technologies, cat. 16,140-
063, batch No. 41G4541K, Warszawa, Poland), 1% (v/v)
nonessential amino acids (Sigma-Aldrich, Poznan, Poland),
20 mM L-glutamine (Sigma-Aldrich, Poznan, Poland),
10 ng/mL human epidermal growth factor (human EGF;
R&D Bioscience, Biokom, Janki, Poland), 1% (v/v)
antibiotic –antimycotic solution (Life Technologies,
Warszawa, Poland), 0.5 μg/mL hydrocortisone (Sigma
Aldrich, Poznan, Poland) and 5 μg/mL insulin-transferrin-
selenium (ITS; Sigma-Aldrich, Poznan, Poland). The via-
bility and the proliferation of oviduct cells were measured
by a real-time cell analyzer (RTCA) supplied by xCELLi-
gence system (Roche Applied Science, Basel, Switzerland).
The measurements of proliferating cells were conducted
at 3.1 h intervals through 287 h post seeding, in accord-
ance with the producer’s manual. The cells intended for
sampling were cultivated for 5–7 days prior to harvesting
and analysis. Every second day, the epithelial colonies were
counted and photographed under an objective with phase
contrast (Zeiss Axiovert 40) equipped with a digital cam-
era (Canon EOS 600). The cells were harvested upon
reaching 80% of growth confluence. Cultured oviduct epi-
thelial cells were referred as chicken oviduct epithelial
cells (COEC) or quail oviduct epithelial cells (QOEC) in
further parts of this paper.
RNA isolation from oviduct tissue, COEC, and QOEC
RNA was isolated from three different sections of the ovi-
ducttube(INF,DM,andPM)andcultivatedoviductcells,
derived from the respective birds. For in vivo assay, INF,
DM, and PM fragments, each 1 cm long, were cut off asep-
tically and put separately into Eppendorf tubes containing
3.0 mL RNAfix (EURx, Gdansk, Poland). Tissue samples
were kept for 24 h at 4 °C and subsequently stored at −
20 °C until isolation of RNA. For RNA isolation from
COEC, confluent cells were detached using Accutase® solu-
tion (A&E Life Sciences, Gentaur, Sopot, Poland) and
centrifuged at 220×gfor 5 min at room temperature (RT).
Cell pellets were resuspended in 0.5 mL RNAfix (EURx,
Gdansk, Poland) to preserve cells prior to RNA isolation.
RNA was extracted using the universal RNA purification
kit (EURx, Gdansk, Poland) according to manufacturer’s
recommendation. RNA was quantified using spectropho-
tometry and RNA quality by gel electrophoresis.
RT-qPCR analysis
Reverse transcription was performed with Maxima First
Strand cDNA synthesis kit for RT-qPCR (Thermo Scien-
tific/Fermentas, Vilnius, Lithuania). cDNA was diluted to a
final concentration of 70 ng/μL and stored at −20°C. Re-
verse transcription-quantitative polymerase chain reaction
(RT-qPCR) was performed in a total volume of 10 μL,
which included Maxima SYBR Green qPCR Master Mix
(Thermo Scientific/Fermentas, Vilnius, Lithuania), 1 μMof
each primer (forward and reverse), and 2 μL of diluted
Fig. 1 A graphical representation of selected panel of epithelial genetic markers associated with oviduct cells. Three panels of epithelial genetic
markers were proposed to provide a pattern of molecular signatures in the oviduct of hen and quail in 3 compartments: INF –infundibulum, DM –
distal magnum, PM –proximal magnum. The first panel shown in the picture refers to stem-like markers: Nanog homebox (NANOG), octamer-binding
protein 4 (OCT4/cPOUV) and sex determining region Y-box 9 (SOX9); and epithelial progenitor cells: cell surface glycoprotein CD44, leucine-rich repeat
containing G protein-coupled receptor 5 (LGR5), and Musashi-1 (MSI-1). The second panel refers to epithelial cells: keratins KRT 5 and 14 and occludin
(OCLN). The third panel refers to functional avian oviduct cells: estrogen receptor-1 (ESR1), ovalbumin (OVAL) and ovomucoid (OVM)
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 3 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
cDNA (140 ng). Primer sequences (Table 1) were derived
from the literature or designed with NCBI Primer Blast,
based on cDNA reference sequences [17]. Thermal cycling
was conducted in LightCycler II 480 (Roche Applied
Science, Basel, Switzerland). qPCR thermal profile consisted
of initial denaturation at 95 °C for 20 min, followed by
40 cycles of amplification including 15 s of denaturation at
95 °C, 20 s of annealing at 58 °C, and 20 s of elongation at
72 °C. After completion of the amplification reaction, a melt-
ing curve was generated to test for the specificity of RT-
qPCR. For this purpose, the temperature was gradually in-
creased to 98 °C with continuous fluorescence measurement.
Relative quantification of gene expression
Relative gene expression analysis was performed for each
experimental group with ΔΔCt method [18], using
Table 1 Primer sequences used in RT-qPCR study
Gene Forward (F) and reverse (R) primers
(5′➔3′)
Amplicon size (bp) Genome Reference
a
CD44 F: ACGAGGAGCAAAGCATGTGA
R: GTGAGCCGTCCTCATTGTCA
94 A [6]
CD44 F: CGGAGTACTGAGGGCATCAC
R: TGACTGTTGTGATGATGGTGGT
133 B this study
ESR1 F: CAGGCCTGCCGACTAAGAAA
R: GGTCTTTCCGGATTCCACCT
64 A this study
ESR1 F: CAGGCCTGCCGACTAAGAAA
R: CTGGACTCCTGCTCCTCTCT
119 B this study
KRT5 F: GGGTGTTGGAGCCGTGAGTGTC
R: TGCCAAGACCACTGCCCATGC
137 A [26]
KRT14 F: GCGAGGACGCCCACATCTCTTC
R: TGAGCGCCATCTGCTCACGG
150 A [26]
LGR5 F: GAAATGCTTTGATGGGCTCC
R: TGATAGCAGTGGGGAACTCG
80 A this study
LGR5 F: AACCAACTACGCCAGGTTCC
R: CATCCAGGCGTAGAGACTGC
70 B this study
MSI1 F: TTCGGGTTCGTCACGTTCAT
R: TCGTTCGGGTCACCATCTTG
139 A this study
MSI1 F: AGTACTTCAGCCAGTTCGGC
R: CCTTCGGGTCAATCTGGATCT
83 B this study
NANOG F: TGCACACCAGGCTTACAGCAGTG
R: TGCTGGGTGTTGCAGCTTGTTC
120 A [26]
NANOG F: TCTACCACAGAGCGGGTTTC
R: CCCATTCCCGTAAGTCTGGC
148 B this study
OCLN F: GAGGAGTGGGTGAAGAACGTG
R: GGTGCCCGAGGGGTAGTA
150 A this study
OCLN F: TCCCGGCTGCCATTTTAAGG
R: GAACATGGTGAACCTCCGCC
50 B this study
OCT4/
cPOUV
F: TGCAATGCAGAGCAAGTGCTGG
R: ACTGGGCTTCACACATTTGCGG
114 A [26]
OVAL F: CGTTCAGCCTTGCCAGTAGA
R: AGTATTCTGGCAGGATTGGGT
60 A this study
OVM F: TATGCCAACACGACAAGCGA
R: CCCCCTGCTCTACTTTGTGG
133 A this study
SOX9 F: GAGGAAGTCGGTGAAGAACG
R: GCTGATGCTGGAGGATGACT
124 A [36]
SOX9 F: CAGCAAGAACAAACCCCACG
R: TTCAACAGCCTCCACAGCTT
147 B this study
ACTB F: CACAGATCATGTTTGAGACCTT
R: CATCACAATACCAGTGGTACG
101 A [37]
UB F: GGGATGCAGATCTTCGTGAAA
R: CTTGCCAGCAAAGATCAACCTT
147 A [38]
a
Primer sequences reported in this study were designed based on the cDNA reference sequence and NCBI Primer Blast [17]. Oligonucleotide primers spanned
exon–exon boundaries to avoid unspecific gDNA amplification. Genome A –chicken (G. gallus),B–quail (C. japonica)
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 4 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Ubiqutin C (UB)andβ-actin (ACTB) as reference house-
keeping genes. Geometric means of Ct value of both refer-
ence genes was used in calculations. For tested samples,
ΔCt was calculated by subtracting mean Ct values of the
reference genes from Ct values of the target gene. A base
sample (calibrator) was defined by an origin different from
the reproductive system. For in tissue study, muscle sam-
ples from the same birds were used. For in vitro study, the
chicken macrophage-like cell line [19] was used as a cali-
brator. ΔΔCt was then calculated using the equation: ΔCt
sample –ΔCt calibrator. Fold change of the gene expres-
sion was calculated as: R=2
–ΔΔCt
.
Statistical analysis
RT-qPCR results were statistically analyzed using SAS
Enterprise Guide 6.1 (SAS Institute, Cary, NC, USA). All
tests were conducted on ΔCt values. First, Shapiro-Wilk
test was used to assess the normality of data distribution.
Then the significance of changes in the gene expression
(in comparison to calibrator samples) was conducted by
Student’st-test (P< 0.05). Finally, multiple comparisons
for all pairs (e.g., oviduct fragments or donor species)
were performed with one-way ANOVA followed by
Tukey’s HSD post hoc test. Standard error of the mean
(SEM) was used as a parameter of variability within the
group.
Results
Primary cultures of hen and quail oviduct epithelial cells
Cultivated oviduct cells of hen (COEC) and quail
(QOEC) reached the confluence after 5–7 days after
seeding. The COEC and QOEC isolated from the infun-
dibulum region typically occurred as cellular spheres,
which attached to the polystyrene culture vessel after
3 days post seeding and were consequently creating
epithelial-like colonies, which spread on the surface of
the culture vessel. Once the small epithelial colonies ap-
peared beneath the spheres, they enter a high prolifera-
tion phase to rapidly form a confluent monolayer.
Typical cultures from the infundibulum region were
characterized by numerous compact epithelial islands,
oval in shape, surrounded by elongated cells of mesen-
chymal or fibroblast-like phenotype (Fig. 2a, b). Epithe-
lial cells isolated from the region of distal magnum (a
transition region between infundibulum and proximal
magnum) formed visible epithelial islands 3 days after
seeding, which was sooner compared to the infundibu-
lum region. In the case of distal magnum, spheres that
formed epithelial-like colonies in vitro were half the size
of those isolated from the infundibulum and about two
times less colonies were initiated, compared to those
from the infundibulum region on day 3 (Fig. 2c, d). In
most cases, the epithelial colonies from the distal mag-
num proliferated fast and were ready for passage by 6–
7 days after seeding. The cells from the region of prox-
imal magnum usually did not form spheres in the begin-
ning of the cultivation (Fig. 2e, f ). Typically, in proximal
magnum, the proliferating epithelial colonies were ob-
served in 3–5 days post seeding. The microscopic obser-
vations of growing colonies were in line with the
measurements acquired from the xCELLigence real-time
cell monitoring system. The peak of the proliferation
was determined for the cells from all oviduct compart-
ments after 3 days post seeding: at 78.27 h for the INF
part, at 79.05 h for the DM part, and at 79.05 h for the
PM part. Then, the cell proliferation entered the plateau,
which lasted 16.22 h for INF cells, 15.5 h for PM cells,
and 10.85 h for DM cells. The cells from PM displayed
larger morphology than cells from INF, and the shape of
colonies was not compact, but oval and irregular. The
confluent monolayer was heteromorphic, consisting of
epithelial and fibroblast-like colonies (Fig. 2e, f ). Motile
cilia, which are characteristic for oviduct ciliated cells,
were observed in the cultivated primary colonies, but
only until the first passage. A movie file shows this in
more detail (Additional file 1).
Gene expression analysis
In this study, we have used three gene panels to
characterize oviduct fragments of hen and quail, and the
respective primary epithelial cell cultures that were de-
rived from them. Those panels were comprised of oviduct
(ESR1,OVAL,andOVM), epithelial (KRT5, KRT14,and
OCLN), and stem-like/progenitor (LGR5,MSI1,SOX9,
NANOG,andOCT4/cPOUV) gene expression signatures.
Table 2presents the overview of the gene function and
the sequence similarity between a hen and a quail.
The overall gene expression of the markers analyzed in
both species (hen and quail) and sample types (tissue and
in vitro) is presented in Table 3. All twelve genes were
expressed only in COEC. Ten out of twelve genes were
expressed in oviduct tissues—sourced from both hen and
quail. In the hen tissue, two progenitor markers (LGR5
and OCT4/cPOUV) were at a level too low to be detected.
In the quail tissue, one epithelial marker (OCLN)andone
progenitor marker (LGR5) were not detected. In QOEC,
OVAL and OVM (oviduct markers) were not expressed as
well as OCLN (epithelial marker). In both species, LGR5,a
progenitor marker, was absent in the oviduct tissue, but
then we detected it in the oviduct epithelial cell culture.
OCLN was not expressed in quail oviduct—neither in the
tissue, nor in the cell culture.
Characterization of gene expression signatures in hen
and quail oviduct tissue
Hereby we have characterized gene expression profile in
different parts (INF, DM, and PM) of hen and quail
oviduct tissue (Fig. 3). In hen oviduct (Fig. 3a), the
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 5 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
expression of oviduct markers (ESR1,OVAL and OVM)
increased spatially, from distal to proximal part of the
oviduct with a peak in PM (P< 0.05). Reversely, the ex-
pression of epithelial markers, KRT14 and OCLN,was
high in INF and it decreased toward PM (P< 0.05).
KRT5 was expressed at much lower level and only in
INF (P< 0.05). As for progenitor markers, SOX9 was
uniformly expressed at high level across all fragments of
the oviduct in hen (P< 0.05). Expression of MSI1 and
CD44 was the highest in INF and it gradually decreased
toward PM (P< 0.05). Expression of NANOG was de-
tected, but was not significant (P> 0.05).
In quail oviduct (Fig. 3b), we had to use chicken pri-
mer sequences to show the expression pattern of OVAL,
OVM,KRT5,KRT14, and OCT4/cPOUV. We have
determined a similar pattern of the gene expression for
two oviduct markers OVAL and OVM, which were
expressed in all the studied oviduct compartments (INF,
DM and PM). Whereas, oviduct marker for ESR1 was
significantly expressed in INF and DM compartments of
a quail oviduct (P< 0.05). Among epithelial markers, the
expression of KRT14 and KRT5 was high and increased
toward INF, but expression of OCLN did not reach the
significance threshold. In quail, we found significant
expression of as much as four progenitor markers
(LGR5,OCT4/cPOUV, SOX9,andCD44)(P<0.05).
LGR5 and OCT4/cPOUV were most abundant in INF
and DM compartments of the quail oviduct. Expres-
sion of NANOG was detected but it was not signifi-
cant (P>0.05).
Fig. 2 Phenotypes displayed by hen and quail oviduct cell colonies in vitro.a–b: confluent monolayers and visible spheres of colony-initiating
cells isolated from the region of infundibulum neck (INF); magnification: × 100. c–d: confluent monolayers of epithelial cells isolated from distal
magnum (DM), showing typical cobble-like morphology; magnification × 100. e–f: confluent epithelial monolayer, typically observed in cultivated
cells that are originating from the oviduct magnum, showing mostly fibroblast-like morphology; magnification × 100. In each case, the cells were
seeded at a density of 4 × 10
4
cells/cm
2
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 6 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Table 2 List of genes with functional annotations proposed as markers of avian oviduct epithelial cells
Gene symbol/ Gene name Species/
NCBI reference
Gene function
(Gene atlas)
Biological process Reference
(Function)
% of identity with
human protein
sequence
% of identity with
quail genomic
sequence
a
ESR1 estrogen receptor 1 G. gallus
396,099
Encodes the protein estrogen receptor
alpha, plays role in the sex differentiation
of reproductive tract, regulates the
expression of oviduct genes
4A- nuclear receptor; transcription
regulator; binding estradiol, epithelial cell
development, cell differentiation
[34,39]79 99
C. japonica
107,311,566
Transcription regulator; binding estradiol,
epithelial cell development, cell
differentiation
[40] n/a
OVAL Ovalbumin-
SERPINB14
G. gallus
396,058
Encodes ovalbumin in Ov-serpin family,
located in extracellular space
Oviduct secretome, binds calcium,
responds to steroid hormones,
constitutes egg white
[41]41 93
C. japonica
107,309,565
Oviduct secretome, constitutes egg
white, responds to steroid hormones
[42] n/a
OVM SPINK7- serine
peptidase inhibitor,
Kazal type 7
G. gallus
416,236
Encodes ovomucoid protein to the
extracellular space, responds to steroid
hormones, binds IgE, IgG
Secreted as egg white protein, allergenic
as a food component, responsive to
steroid hormones (progesterone),
allergenic component of an egg white
[43,44]44 96
C. japonica
107,320,484
n/a
KRT5 keratin 5 407,779 Encodes protein keratin 5, type II
cytoskeletal 5
Interacts with KRT14 to form cytoskeleton
of basal epithelium, expressed in stem
cells of fallopian tube, epithelial
differentiation
[15]80
b
98
KRT14 keratin, type I
cytoskeletal 14
408,039 Marker of the stratified epithelium as
keratin filament
Interacts with KRT5 to form the
cytoskeleton of basal epithelium,
expressed in tumor cells of fallopian tube,
marker of chicken keratinocytes, epithelial
differentiation
[26] 69 100
OCLN occludin G. gallus
396,026
Encodes protein occludin, marker of tight
junctions in epithelial cells
Component of plasma membrane, role in
cellular binding, forms tight junctions
[26]47 96
C. japonica
107,325,447
n/a
CD44 cell surface
glycoprotein CD44
G. gallus
395,666
Encodes CD44 antigen, marker of
epithelial stem cells in fallopian tube
Role in cell adhesion (cell to cell) and
postponement of the apoptotic process
[15] 48 100
C. japonica
107,314,385
n/a
LGR5 Leucine-rich repeat
containing G protein-
coupled receptor 5
G. gallus
427,867
Encodes protein LGR5, induced by Wnt/
β-Catenin signaling
Marker of stem cells in the ovary and
tubal epithelia
[14]30
c
99
C. japonica
107,310,333
n/a
MSI-1 Musashi-1; Musashi
RNA binding protein- 1
G. gallus
416,979
Marker of epithelial early lineage, marker
of stem cells in human endometrium
Maintains proliferation and multipotent
potential of epithelial cells (emerging
from Müllerian duct)
[45] 80 100
C. japonica
107,321,418
[31] n/a
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 7 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Table 2 List of genes with functional annotations proposed as markers of avian oviduct epithelial cells (Continued)
Gene symbol/ Gene name Species/
NCBI reference
Gene function
(Gene atlas)
Biological process Reference
(Function)
% of identity with
human protein
sequence
% of identity with
quail genomic
sequence
a
NANOG Nanog homebox G. gallus
100,272,166
Encodes transcriptional factor of
pluripotency: homebox protein NANOG,
Marker of stem cells in ovarian epithelium
Maintains stem cell population, chicken
stem cell marker
[32] 89 100
C. japonica
107,318,297
[46] n/a
OCT4/
cPOUV
POU domain class 5
transcription factor 3,
Octamer-binding
protein 4
427,781 Encodes transcription factor POU5F3 Maintains cell pluripotency, maintains
population of somatic stem cells, shows
responses to wounding
[33]43 97
SOX9 SRY sex determining
region Y-box 9
G. gallus
374,148
Encodes HMG box transcription factor,
marker of epithelial early lineage,
transcription epithelial-mesenchymal
transition marker
Negatively regulates the differentiation of
epithelial cells, maintains the population
of somatic stem cells, plays role in
transdifferentiation; regulation of cell
adhesion, activated during chondrogenesis
in chicken
[28] 99 100
C. japonica
107,322,214
[29] n/a
a
Blasted with http://viewer.shigen.info/uzura/blast_result.php.
b
similarity for gene is given; no protein sequence of protein KRT5 is available for G. gallus.
c
UNIPROT blasting tool shows for only 30% identity of a G.
gallus sequence with human LGR5, but the same protein sequence shows 95% identity with human VAV3 GDP/GTP exchange factor. For a quail, only 900 proteins are annotated in existing UniProt databases. Thus,
when a gap in quail database [22] limits the interpretation of a sequence, a relevant genomic alignment onto chicken was performed [23]. Depending on the database used (ENSEMBL, NCBI, and/or UniProt),
sequences of the genes selected for this study had 89%–100% similarity. Thereby, gene expression assays developed were comparable between both species
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 8 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Gene profiling of the gene expression signatures in COEC
and QOEC
After having determined gene expression signatures in
three specific fragments of chicken and quail oviducts,
we have established the respective cell cultures, which
were analyzed for the presence of the same markers. Re-
sults of the relative gene expression analysis in chicken
and quail oviduct epithelial cells are presented in Fig. 4a.
In COEC (Fig. 4a) only few markers were numerically
and significantly upregulated, namely OVAL, OVM,
KRT14, and SOX9 (P< 0.05). In the case of QOEC, we
routinely found the abundance of ovalbumin in quail
oviduct cell culture using antichicken OVA antibody and
western blot detection. MSI1 was upregulated statisti-
cally (P< 0.05), though it did not have high numerical
values of fold induction. In both, COEC and QOEC,
OCT4/cPOUV was significantly downregulated (P<0.
05). We did not determine any significant differences be-
tween COEC derived from different fragments of the
oviduct, apart from the expression of OCLN (epithelial
marker) and LGR (progenitor marker) that was high in
the INF compartment (P> 0.05).
In QOEC, a similar significant expression, as in COEC,
was found for progenitor markers SOX9 and MSI1 as
well as epithelial marker KRT14. The remaining epithe-
lial and stem-like/progenitor markers were significantly
expressed in the cultivated quail cells derived from all
studied compartments of oviduct (P> 0.05).
Discussion
Among avian species, laying hen (Gallus gallus domesti-
cus) and Japanese quail (C. japonica) provide two excellent
experimental oviduct models to study the immunology
and reproductive biology [20]. Particular properties of ovi-
ductal cells include hormonal regulators as well as biosyn-
thetic and secretive activity, which can be used for
biomedical applications. Firstly, the secreting function of
an oviduct epithelium makes it an ideal natural bioreactor
to obtain human therapeutic proteins by using genetic
manipulation of the oviduct secretome. The product is ac-
cumulated in the egg white and is easily harvested [3].
Secondly, both hen and quail are recognized to reflect the
development and chemoprevention of spontaneous leio-
myoma, also known as fibroids of the oviduct in relation
to human cancer [21]. Thirdly, the development of new
oviduct cell lines would allow selectively propagating and
studying important pathogens including Campylobacter
and Salmonella strains or influenza and Coronaviruses.
Such cell lines offer new in vitro substrates for pathogens
originating from a reproductive tract.
For this purpose, we have attempted to provide a util-
ity set of molecular markers to characterize the avian
oviduct tissue in hen and quail and in vitro-derived ovi-
duct epithelial cell culture. For a quail, only 900 proteins
are annotated in the existing UniProt databases. Thus,
when a gap in quail database [22] limits the interpret-
ation of a sequence, a relevant genomic alignment onto
the chicken is performed [23]. Depending on the data-
base used (ENSEMBL, NCBi, and/or UniProt), se-
quences of the genes selected for this study had 89%–
100% similarity. Thereby, gene expression assays devel-
oped were comparable between both species.
In our study, all 12 analyzed genes were expressed in
both hen and quail. In the first part, we have characterized
gene expression signatures in three compartments of the
oviduct tissue in hen and quail. The mRNA abundance of
the oviduct markers (ESR1,OVAL,andOVM) increased
toward proximal parts of the oviduct. Those differences
between infundibulum and magnum compartments were
significant only in hen earlier, but we have determined a
clear numerical pattern also in quail. Such a pattern of the
oviduct markers reflects physiological functions of distinct
compartments, e.g., oocyte transport and sperm storage in
the infundibulum vs. egg white protein production in the
magnum. For this reason, ESR1, which encodes the estro-
gen receptor 1, whose major function is binding estra-
diol—a major sex hormone of laying birds, was expressed
in all parts of the oviduct. On the other hand, OVAL and
OVM, which encode major egg white proteins, were
expressed only in the magnum. Such a pattern of the gene
expression across the avian oviduct has been widely re-
ported in the literature [24,25] and it validates the func-
tional setup of this experiment.
Table 3 Expression of the oviduct, epithelial, and progenitor
markers in oviduct tissue and cultured oviduct epithelial cells in
hen and quail
Gene panel Gene Hen Quail
Tissue
a
Cell culture
b
Tissue
a
Cell culture
b
Oviduct markers ESR1 ++ ++
OVAL ++ +ND
OVM ++ +ND
Epithelial markers KRT5 ++ ++
KRT14 ++ ++
OCLN ++ ++
Stem-like/Progenitor
markers
CD44 ++ ++
LGR5 ND + + +
MSI1 ++ ++
SOX9 ++ ++
NANOG ++ ++
OCT4/
cPOUV
ND + + +
a
Hen/quail oviduct tissue, divided into three fragments: INF infundibulum, DM
distal magnum, and PM proximal magnum;
b
Hen/quail oviduct epithelial cell
culture derived from different parts of the oviduct (INF, DM, or PM) and
cultured in vitro; “+”denotes positive result of RT-qPCR analysis (Ct < 35),
meaning that the gene was expressed in a given sample. ND not detected
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 9 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
In a panel of epithelial markers characterized in tissue,
we have determined a reverse pattern, i.e., decrease of
mRNA abundance from distal toward proximal parts of
oviduct, in particular of KRT14, which was strongly
expressed in the infundibulum of both, hen and quail.
KRT5 appeared to be more abundant in quail and OCLN
was significantly expressed in chicken oviduct. Keratins
encode for cytoskeletal proteins of highly proliferating
basal epithelial cells [26]. Infundibulum is lined with cili-
ated epithelia, which are highly used by the frequent
transportation of the oocyte and protein secretion. They
require constant renewal from the basal epithelium,
which is intensively proliferating. Strong induction of
keratin genes is related with this function of the infun-
dibulum. Previously, we have detected cytokeratins in
chicken infundibulum by using immunohistochemistry
technique, both in tissue and in vitro [6], which is in line
with the results of the current study.
As for stem-like/progenitor markers analyzed in tissue,
chicken expressed high mRNA abundance of CD44 and
SOX9; moderate abundance of MSI1 and low of
NANOG.OCT4/cPOUV and LGR5 were not expressed
in the chicken oviduct tissue. In quail, we determined a
high-fold induction of LGR5 and OCT4/cPOUV and a
moderate abundance of CD44 and SOX9. CD44 is a cell
surface glycoprotein and an established progenitor/stem-
like cell marker in fallopian tube in mammals. CD44-
positive cell population showed the capacity for clonal
growth and differentiation into tubal epithelial cells, par-
ticularly in the distal region of the tube [15,27]. We
Fig. 3 Expression of oviduct, epithelial, and progenitor markers in different fragments of hen (a)andquail(b) oviduct tissue. Relative gene expression
analysis was conducted with RT-qPCR method in three oviduct fragments: infundibulum (INF), distal magnum (DM) and proximal magnum (PM).
Pairwise t-test was conducted to determine the significant modulation of the gene expression in the oviduct as compared to the external calibrator
(breast muscle) (P< 0.05). An asterisk (*) indicates that the gene is differentially expressed, compared to the calibrator. Letters A, B, and C in brackets
indicate results of one-way ANOVA multiple comparisons between different fragments of the oviduct (P<0.05)
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 10 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
earlier showed a high immunochemical stain of CD44 in
the distal oviduct of a hen [6]. SOX9 is a transcription
factor in early epithelial lineage [28,29]. It is involved in
the organogenesis of different tissues and its main func-
tion is to maintain a population of undifferentiated som-
atic stem cells. SOX9 was recently announced as a novel
cancer stem cell marker [30]. In our study, we consider
this gene as a marker for precursor epithelial oviduct
cells of avian species. Musashi-1 is expressed in intes-
tinal crypts and human endometrium, where it main-
tains multipotent potential for epithelial cells emerging
from Müllerian duct (precursor of oviduct in verte-
brates) [31]. OCT4/cPOUV and NANOG are chicken
stem cell markers [32,33], while LGR5 is recognized as
marker stem cells in tubal epithelia [14]. In our study,
LGR5 and OCT4/cPOUV were detected at high level in
quail oviduct. Overall, the pattern of expression of pro-
genitor markers supports the designation of distal
oviduct compartments as the source of progenitor epi-
thelial cells.
After being transferred to in vitro conditions, pheno-
types of COEC and QOEC have changed in some as-
pects. Secretive potential of magnum-derived cells was
retained as reflected by the expression of OVM and
OVAL in COEC and ESR1 in QOEC. Primary cultured
cells, such as highly specialized oviduct epithelial cells,
are prone to rapid differentiation in vitro. This way, they
may easily lose their original phenotype, for example,
the ability for protein secretion. On the other hand,
INF-derived COEC gained secretive potential after being
cultured in vitro, which was reflected by changing the
downregulation of OVM and OVAL to upregulation of
those genes as compared to donor tissues. Stimulation
with estrogen was reported as necessary to maintain re-
sponsiveness of hen oviduct cells to this sex hormone
[34]. However, in this experiment, neither the birds were
Fig. 4 Expression of oviduct, epithelial, and progenitor markers in chicken (a)andquail(b) oviduct epithelial cells. Relative gene expression analysis
was performed with RT-qPCR method in three oviduct fragments: infundibulum (INF), distal magnum (DM) and proximal magnum (PM). Pairwise t-test
was conducted to determine the significant modulation of the gene expression in the oviduct as compared to the external calibrator (breast muscle)
(P< 0.05). An asterisk (*) indicates that the gene is differentially expressed, compared to the calibrator. Letters A, B, and C in brackets indicate results of
one-way ANOVA multiple comparisons between different fragments of the oviduct (P< 0.05)
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 11 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
stimulated with the estrogen prior to tissue harvesting,
nor the cultivated cells were treated with estrogen,
which might explain the lack of ESR-1 mRNA in the cul-
tivated COEC. Epithelial character of both COEC and
QOEC was maintained, especially in KRT14 (COEC) and
other epithelial markers (QOEC) mRNA abundance.
Expression of progenitor markers of early epithelial
lineage (SOX9,MSI1,andLGR5) in both oviduct epithelial
cultures was determined. LGR5 was significantly upregu-
lated in cultivated cells, and has been proven to mark the
stem cells in murine oviduct/fimbria [14]. Precursor char-
acter of certain populations of cultured cells allowed for
their proliferation and differentiation in vitro. INF-derived
COEC gained gene expression signatures of oviduct se-
cretive cells (OVM and OVAL). Population of progenitor
cells is required for the establishment of a primary cell
culture [35]. In our study, we have confirmed progenitor
gene expression signatures in proliferating cultures. Based
on the morphological assessment, a subpopulation of the
cultured cells displayed epithelial character of ciliated and
secreting cells. But there was also a large subpopulation of
differentiated mesenchymal and fibroblast-like forms in
both COEC and QOEC, after passaging. With these obser-
vations, a stable oviduct epithelial cell line could be prob-
ably established from both in vitro models, with the prior
purification of progenitor cells from the heterogeneous
starting cell populations.
Conclusion
In this study, we have characterized the expression of
oviduct, epithelial, and stem/progenitor markers in the
oviduct tissue and cell culture of two avian species, the
hen and the quail. Analysis of the oviduct tissue and cul-
tured cells allowed for characterizing the molecular
makeup of those cells in tissue, in relation to the source
of the oviduct compartment (infundibulum, distal mag-
num, and proximal magnum). Further analysis from in
vitro-cultivated cells showed molecular pattern that was
different from noncultivated oviduct cells. In conclusion,
the analysis of tissue material revealed a gradual in-
crease/decrease pattern in majority of the markers in
both species. This pattern changed after those cells had
been cultured in vitro. A progenitor marker, OCT4/
cPOUV was strongly downregulated in both in vitro
models, whereas the expression of SOX9 and the epithe-
lial marker KRT14 were not changed compared to the
calibrator (FC ~ 1). Cultivated hen cells (COEC) gained
the expression of LGR5 progenitor marker, which could
indicate a shift toward a more specific epithelial progeni-
tor cell type. These results can contribute to further
research on creating new biological models from repro-
ductive tissue and the characterization required to de-
velop new avian cell lines.
Additional file
Additional file 1: Visualization of a typical phenotype of cultivated
oviductal epithelial cells. The recording of the cultivated oviduct epithelial
cells allows one to follow the typical cobble-like structure of lining
epithelial cells and the rotatory movement of cilia on the nonsecreting
ciliated cells, which are coisolated with the secreting tubular gland cells.
(MP4 12,229 kb)
Abbreviations
ACTB: β-actin; C. japonica:Coturnix japonica; CD44: Cell surface glycoprotein;
COEC: Chicken oviduct epithelial cells; Ct: Cycle threshold; DM: Distal
magnum; DMEM-F12: Dulbecco’s Modified Eagles Medium-F12;
ESR1: Estrogen receptor 1; FBS: Fetal bovine serum; FC: Fold Change; G.
gallus:Gallus gallus; GDP/GTP exchange factor VAV3: Guanyl nucleotide
exchange factor; HMG: High mobility group box transcription factor;
INF: Infundibulum; ITS: Insulin-Transferrin-Selenium; KRT14: Keratin 14;
LGR5: Leucine-rich repeat containing G protein-coupled receptor 5; MSI-
1: Musashi-1; NANOG: Nanog homebox; OCLN: Occludin; OCT4/
cPOUV: Octamer-binding protein 4; OVAL: Ovalbumin; OVM: Ovomucoid;
PM: Proximal magnum; QOEC: Quail oviduct epithelial cells; RT-qPCR: Reverse
transcription - quantitative polymerase chain reaction; SEM: Standard error of
the mean; SOX9: Sex determining region Y-box 9; UB: Ubiquitin C
Acknowledgements
Not applicable
Funding
This work was supported by the Polish National Science Center under grant
agreement No. UMO-2011/03/N/NZ9/03814, the National Center for Research
and Development under grant agreement No. PBS3/A8/30/2015 and the
French-Polish project for collaborative research POLONIUM 2015–2016,
granted to Bertrand Pain and Marek Bednarczyk. The research in this work
was performed with equipment granted in the project “Implementation of
the second phase of the Regional Center of Innovation”cofinanced by the
European Regional Development Fund under the Regional Operational
Program of Kujawsko-Pomorskie for the years 2007–2013.
Availability of data and materials
The data supporting the conclusions of this article are included within the
article and its additional file. Any additional datasets which was used and/or
analyzed during the current study are available from the corresponding
author on reasonable request.
Authors’contributions
KS and AS made substantial contribution to conception and design of this
manuscript. KS and AD acquired and interpreted the data reported. KS
supervised the project and writing. KS, AS, and AD provided the original
draft. MB BP and KS reviewed and edited the final manuscript. All authors
read and approved the final manuscript.
Ethics approval and consent to participate
The study was approved by the Local Ethics Committee for Animal Research
(http://lke.utp.edu.pl) located at the Faculty of Animal Breeding and Biology,
UTP University of Science and Technology in Bydgoszcz (study approval
reference number 35/2012).
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 12 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Author details
1
Department of Animal Biochemistry and Biotechnology, UTP University of
Science and Technology, Mazowiecka 28, 85-084 Bydgoszcz, Poland.
2
University of Lyon, Université Lyon 1, INSERM, INRA, Stem Cell and Brain
Research Institute, U1208, USC1361, Bron, France.
Received: 6 June 2017 Accepted: 21 March 2018
References
1. Trevino LS, Johnson PA. Estrogen receptor subtype expression is altered in
the hen model of ovarian Cancer. J Mol Genet Med 2016;10. https://doi.org/
10.4172/1747-0862.1000203.
2. Doran TJ, Cooper CA, Jenkins KA, Tizard MLV. Advances in genetic
engineering of the avian genome: “Realising the promise.”. Transgenic Res.
2016;25:307–19.
3. Cao D, Wu H, Li Q, Sun Y, Liu T, Fei J, et al. Expression of recombinant
human lysozyme in egg whites of transgenic hens. PLoS One 2015;10.
https://doi.org/10.1371/journal.pone.0118626.
4. Zhang Z, Sun P, Yu F, Yan L, Yuan F, Zhang W, et al. Transgenic quail
production by microinjection of lentiviral vector into the early embryo
blood vessels. PLoS One. 2012;7:e50817.
5. Kwon SC, Choi JW, Jang H-J, Shin SS, Lee SK, Park TS, et al. Production of
biofunctional recombinant human interleukin 1 receptor antagonist
(rhIL1RN) from transgenic quail egg white. Biol Reprod. 2010;82:1057–64.
6. Stadnicka K, Bodnar M, Marszałek A, Bajek A, Drewa T, Płucienniczak G, et al.
Efficient source of cells in proximal oviduct for testing non-viral expression
constructs in the chicken bioreactor model and for other in vitro studies.
Folia Biol (Krakow). 2016;64:37–46.
7. Genzel Y. Designing cell lines for viral vaccine production: where do we
stand? Biotechnol J. 2015;10:728–40.
8. Garson K, Vanderhyden BC. Epithelial ovarian cancer stem cells: underlying
complexity of a simple paradigm. Reproduction. 2015;149:R59–70.
9. Jo G, Lim W, Bae SM, Bazer FW, Song G. Avian SERPINB12 expression in the
avian oviduct is regulated by estrogen and up-regulated in epithelial cell-
derived ovarian carcinomas of laying hens. PLoS One. 2014;9:e99792.
10. Machado S, Bahr JM, Hales DB, Braundmeier AG, Quade BJ, Nowak R.
Validation of the aging hen (Gallus gallus domesticus) as an animal model
for uterine leiomyomas. Biol Reprod. 2012;87:86.
11. Kessler M, Zietlow R, Meyer TF. Adult Stem Cell Niches —Stem Cells in the
Female Reproductive System. In: Wislet-Gendebien S, editor. Medicine- Stem
Cell Research. InTech; 2014. https://doi.org/10.5772/58842. ISBN 978-953-51-
1718-6.
12. Snegovskikh V, Mutlu L, Massasa E, Taylor HS. Identification of putative
fallopian tube stem cells. Reprod Sci. 2014;21:1460–4.
13. Stadnicka K, Marszałek A, Kozłowska I, Walasik K, Bodnar M, Bajek A, et al.
The expression of p63 and Ck HMW in magnum and infundibulum of
Gallus domesticus oviduct. Folia Biol (Krakow). 2014;62:179–85.
14. Ng A, Tan S, Singh G, Rizk P, Swathi Y, Tan TZ, et al. Lgr5 marks stem/
progenitor cells in ovary and tubal epithelia. Nat Cell Biol. 2014;16:745–57.
15. Paik DY, Janzen DM, Schafenacker AM, Velasco VS, Shung MS, Cheng D, et
al. Stem-like epithelial cells are concentrated in the distal end of the
fallopian tube: a site for injury and serous cancer initiation. Stem Cells. 2012;
30:2487–97.
16. Kasperczyk K, Bajek A, Joachimiak R, Walasik K, Marszalek A, Drewa T, et al. In
vitro optimization of the Gallus domesticus oviduct epithelial cells culture.
Theriogenology. 2012;77:1834–45.
17. Ye J, Coulouris G, Zaretskaya I, Cutcutahe I, Rosen S, Madden TL. Primer-
BLAST: a tool to design target-specific primers for polymerase chain
reaction. BMC Bioinformatics. 2012;13:134.
18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2-ÄÄCT method. Methods. 2001;25:402–8.
https://doi.org/10.1006/meth.2001.1262.
19. Beug H, von Kirchbach A, Döderlein G, Conscience JF, Graf T. Chicken
hematopoietic cells transformed by seven strains of defective avian
leukemia viruses display three distinct phenotypes of differentiation. Cell.
1979;18:375–90.
20. Hosseini F, Hamsekolaei MHM, Moghaddam AKZ, Arabha H, Tohidifar SS.
Normal ultrasonographic images of reproductive organs of female Japanese
quails (Coturnix coturnix japonica): a laboratory animal model. Lab Anim
2016; https://doi.org/10.1177/0023677215625607.
21. Tuzcu M, Sahin N, Ozercan I, Seren S, Sahin K, Kucuk O. The effects of
selenium supplementation on the spontaneously occurring fibroid tumors
of oviduct, 8-hydroxy-2′-deoxyguanosine levels, and heat shock protein 70
response in Japanese quail. Nutr Cancer. 2010;62:495–500.
22. Kawahara-Miki R, Sano S, Nunome M, Shimmura T, Kuwayama T, Takahashi
S, et al. Next-generation sequencing reveals genomic features in the
Japanese quail. Genomics. 2013;101:345–53.
23. Kayang BB, Fillon V, Inoue-Murayama M, Miwa M, Leroux S, Fève K, et al.
Integrated maps in quail (Coturnix japonica) confirm the high degree of
synteny conservation with chicken (Gallus gallus) despite 35 million years of
divergence. BMC Genomics. 2006;7:101.
24. Zhao J, Zhang Q, Jiao H, Wang X, Jiang M, Luo H, et al. Ovalbumin
expression in the oviduct magnum of hens is related to the rate of egg
laying and shows distinct stress-type-specific responses. J Anim Physiol
Anim Nutr (Berl). 2016;100:876–83.
25. Nys Y, Gautron J, McKee MD, Garcia-Ruiz JM, Hincke MT. Biochemical and
functional characterisation of eggshell matrix proteins in hens. Worlds Poult
Sci J. 2001;57:401–13.
26. Couteaudier M, Trapp-Fragnet L, Auger N, Courvoisier K, Pain B, Denesvre C,
et al. Derivation of keratinocytes from chicken embryonic stem cells:
establishment and characterization of differentiated proliferative cell
populations. Stem Cell Res. 2015;14:224–37.
27. Wang Y, Sacchetti A, van Dijk MR, van der Zee M, van der Horst PH, Joosten
R, et al. Identification of quiescent, stem-like cells in the distal female
reproductive tract. PLoS One. 2012;7:e40691.
28. Chue J, Smith CA. Sex determination and sexual differentiation in the avian
model. FEBS J. 2011;278:1027–34.
29. Takada S, Ota J, Kansaku N, Yamashita H, Izumi T, Ishikawa M, et al.
Nucleotide sequence and embryonic expression of quail and duck Sox9
genes. Gen Comp Endocrinol. 2006;145:208–13.
30. Kawai T, Yasuchika K, Ishii T, Miyauchi Y, Kojima H, Yamaoka R, et al. SOX9 is
a novel cancer stem cell marker surrogated by osteopontin in human
hepatocellular carcinoma. Sci Rep. 2016;6:e30489.
31. Lu X, Lin F, Fang H, Yang X, Qin L. Expression of a putative stem cell marker
Musashi-1 in endometrium. Histol Histopathol. 2011;26:1127–33.
32. Lavial F, Acloque H, Bertocchini F, Macleod DJ, Boast S, Bachelard E, et al.
The Oct4 homologue PouV and Nanog regulate pluripotency in chicken
embryonic stem cells. Development. 2007;134:3549–63.
33. Lavial F, Pain B. Chicken embryonic stem cells as a non-mammalian
embryonic stem cell model. Develop Growth Differ. 2010;52:101–14.
34. Jung JG, Park TS, Kim JN, Han BK, Lee SD, Song G, et al. Characterization
and application of oviductal epithelial cells in vitro in Gallus domesticus.
Biol Reprod. 2011;85:798–807.
35. Drewa T, Wolski Z, Pokrywka L, Debski R, Styczynski J. Progenitor cells are
responsible for formation of human prostate epithelium primary cultures.
Exp Oncol. 2008;30:148–52.
36. Caetano LC, Gennaro FGO, Coelho K, Araújo FM, Vila RA, Araújo A, et al.
Differential expression of the MHM region and of sex-determining-related
genes during gonadal development in chicken embryos. Genet Mol Res.
2014;13:838–49.
37. Sevane N, Bialade F, Velasco S, Rebolé A, Rodríguez ML, Ortiz LT, et al. Dietary
inulin supplementation modifies significantly the liver transcriptomic profile of
broiler chickens. PLoS One 2014;9. https://doi.org/10.1371/journal.pone.0098942.
38. De Boever S, Vangestel C, De Backer P, Croubels SSU. Identification and
validation of housekeeping genes as internal control for gene expression in
an intravenous LPS inflammation model in chickens. Vet Immunol
Immunopathol. 2008;122:312–7.
39. Palmiter RD, Wrenn JT. Interaction of estrogen and progesterone in chick
oviduct development. 3. Tubular gland cell cytodifferentiation. J Cell Biol.
1971;50:598–615.
40. Ichikawa K, Yamamoto I, Tsukada A, Saito N. cDNA cloning and mRNA
expression of estrogen receptor alpha in Japanese quail. J Poult Sci. 2003;40:
121–9.
41. Means AR, Comstock JP, O'Malley BW. Ovalbumin messenger RNA of chick
oviduct: partial characterization, estrogen dependence, and translation in
vitro. Proc Natl Acad Sci United States Am. 1972;69:1146–50.
42. Fertuck HC, Newstead JD. Fine structural observations on magnum mucosa
in quail and hen oviducts. Z Zellforsch Mikrosk Anat. 1970;103:447–59.
43. Palmiter RD. Regulation of protein synthesis in Chick oviduct. I. Independent
regulation of ovalbumin, conalbumin, ovomucoid, and lysozyme induction.
J Biol Chem. 1972;247:6450–61.
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 13 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
44. Kato I, Schrode J, Kohr WJ, Laskowski M. Chicken ovomucoid: determination
of its amino acid sequence, determination of the trypsin reactive site, and
preparation of all three of its domains. Biochemistry. 1987;26:193–201.
45. Asai R, Okano H, Yasugi S. Correlation between Musashi-1 and c-hairy-1
expression and cell proliferation activity in the developing intestine and
stomach of both chicken and mouse. Develop Growth Differ. 2005;47:
501–10.
46. Auersperg N. The stem-cell profile of ovarian surface epithelium is
reproduced in the oviductal fimbriae, with increased stem-cell marker
density in distal parts of the fimbriae. Int J Gynecol Pathol. 2013;32:444–53.
• We accept pre-submission inquiries
• Our selector tool helps you to find the most relevant journal
• We provide round the clock customer support
• Convenient online submission
• Thorough peer review
• Inclusion in PubMed and all major indexing services
• Maximum visibility for your research
Submit your manuscript at
www.biomedcentral.com/submit
Submit your next manuscript to BioMed Central
and we will help you at every step:
Stadnicka et al. BMC Developmental Biology (2018) 18:9 Page 14 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com
Content uploaded by Aleksandra Dunisławska
Author content
All content in this area was uploaded by Aleksandra Dunisławska on Apr 04, 2018
Content may be subject to copyright.
