Available via license: CC BY 4.0
Content may be subject to copyright.
RESEARCH ARTICLE
Rhinoscleroma pathogenesis: The type K3
capsule of Klebsiella rhinoscleromatis is a
virulence factor not involved in Mikulicz cells
formation
Barbara Corelli
1,2,3,4
, Ana S. Almeida
1,2¤a
, Fabiane Sonego
3¤b
, Virginia Castiglia
3
,
Cindy Fevre
5¤c
, Sylvain Brisse
6
, Philippe J. Sansonetti
1,2,7
, Re
´gis Tournebize
1,2,3
*
1Molecular Microbial Pathogenesis Unit, Department of Cell Biology and Infection, Institut Pasteur, Paris,
France, 2INSERM U1202, Paris, France, 3Unit of Technology and Service Photonic BioImaging (UTechS
PBI), Center for Innovation and Technological Research (Citech), Institut Pasteur, Paris, France, 4Universite
´
Paris Diderot, Sorbonne Paris Cite
´, Paris, France, 5Genotyping of Pathogens and Public Health, Institut
Pasteur, Paris, France, 6Biodiversity and Epidemiology of Bacterial Pathogens, Institut Pasteur, Paris,
France, 7Chaire de Microbiologie et Maladies Infectieuses, Collège de France, Paris, France
¤a Current address: APC Microbiome Institute and School of Microbiology, University College Cork, Cork,
Ireland.
¤b Current address: genOway, Lyon, France.
¤c Current address: Pherecydes-Pharma, Romainville, France.
*regis.tournebize@pasteur.fr
Abstract
Rhinoscleroma is a human specific chronic granulomatous infection of the nose and upper
airways caused by the gram-negative bacterium Klebsiella pneumoniae subsp. rhinoscler-
omatis. Although considered a rare disease, it is endemic in low-income countries where
hygienic conditions are poor. A hallmark of this pathology is the appearance of atypical
foamy monocytes called Mikulicz cells. However, the pathogenesis of rhinoscleroma
remains poorly investigated. Capsule polysaccharide (CPS) is a prominent virulence factor
in bacteria. All K.rhinoscleromatis strains are of K3 serotype, suggesting that CPS can be
an important driver of rhinoscleroma disease. In this study, we describe the creation of the
first mutant of K.rhinoscleromatis, inactivated in its capsule export machinery. Using a
murine model recapitulating the formation of Mikulicz cells in lungs, we observed that a K.
rhinoscleromatis CPS mutant (KR cps
-
) is strongly attenuated and that mice infected with a
high dose of KR cps
-
are still able to induce Mikulicz cells formation, unlike a K.pneumoniae
capsule mutant, and to partially recapitulate the characteristic strong production of IL-10.
Altogether, the results of this study show that CPS is a virulence factor of K.rhinoscleroma-
tis not involved in the specific appearance of Mikulicz cells.
Author summary
Rhinoscleroma is a human specific chronic infection characterized by the formation of
granuloma in the nose and upper airways. It is a rare disease endemic in low-income
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 1 / 19
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Corelli B, Almeida AS, Sonego F, Castiglia
V, Fevre C, Brisse S, et al. (2018) Rhinoscleroma
pathogenesis: The type K3 capsule of Klebsiella
rhinoscleromatis is a virulence factor not involved
in Mikulicz cells formation. PLoS Negl Trop Dis 12
(1): e0006201. https://doi.org/10.1371/journal.
pntd.0006201
Editor: Joseph M. Vinetz, University of California
San Diego School of Medicine, UNITED STATES
Received: September 19, 2017
Accepted: December 31, 2017
Published: January 30, 2018
Copyright: ©2018 Corelli et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information
files.
Funding: This work was supported by funding
from the European Union Seventh Framework
Programme Marie Curie Initial Training Networks
(FP7-PEOPLE-2012-ITN) for the project INBIONET
(http://inbionet.eu/) under grant agreement PITN-
GA-2012-316682 (BC), from the Fondation pour la
Recherche Me
´dicale (BC), from the Fundac¸ao para
countries where hygienic conditions are poor and caused by the gram-negative bacterium
Klebsiella pneumoniae subsp. rhinoscleromatis. A hallmark of this pathology is the appear-
ance of atypical foamy monocytes called Mikulicz cells. Very little is known about the cel-
lular and molecular mechanisms underlying this disease and the bacterial virulence
factors of K.rhinoscleromatis are unknown. In this study, we created the first mutant
made in K.rhinoscleromatis and inactivated the production of capsule, an outer-mem-
brane-anchored polysaccharide. Using a murine model recapitulating the formation of
Mikulicz cells and this bacterial capsule mutant, we observed that capsule is a virulence
factor for K.rhinoscleromatis which is not required for the formation of Mikulicz cells,
indicating that other specific virulence factors are present in the genome of the bacterium.
This works opens the way to further genetic analysis of K.rhinoscleromatis and identifica-
tion of new specific virulence factors.
Introduction
Rhinoscleroma is a chronic granulomatous infectious disease that affects the nose and other
parts of the respiratory tract down to the trachea [1]. Although few sporadic cases are typically
described in Western Europe and in the USA, this disease is still endemic in impoverished
areas of the Middle East, Eastern Europe, tropical Africa, South East Asia, Central and South
America. A delay in the diagnosis can lead to complications such as physical deformity, upper
airway obstruction and, rarely, sepsis. Treatment can be challenging and includes surgery and
prolonged course of antibiotics to avoid relapses. The bacterium implicated as the causative
agent of rhinoscleroma is Klebsiella pneumoniae subsp. rhinoscleromatis (hereafter mentioned
as K.rhinoscleromatis or KR), a subspecies of Klebsiella pneumoniae. Despite being geographi-
cally broadly distributed, K.rhinoscleromatis has been isolated mainly in human [2] although
three recent reports mention the identification of K.rhinoscleromatis in cockroaches [3,4] or
chickens [5] in low hygiene settings. K.rhinoscleromatis is very closely related to Klebsiella
pneumoniae subsp. pneumoniae but can be distinguished from K.pneumoniae sensu stricto by
biochemical properties and multilocus sequence typing [6].
Rhinoscleroma development is typically described clinically and pathologically into three
overlapping stages: catarrhal stage, proliferative stage, and sclerotic stage [7]. The catarrhal
stage is marked by purulent rhinorroea and nasal obstruction, which persists for months. His-
tological examination shows evidence of squamous metaplasia with a subepithelial infiltrate of
polymorphonuclear cells. However, in the subepithelial layer, bacteria are incompletely
digested and further released into tissues. The proliferative stage is characterized by symptoms
of epistaxis, nasal deformity and other problems depending on the other areas affected. In
addition, histology shows the appearance of Mikulicz cells, a hallmark of rhinoscleroma [8].
These cells are large foamy macrophages with numerous enlarged vacuoles containing viable
or non-viable bacteria. Finally, the sclerotic stage is characterized by increasing deformity,
granulomatous areas and scar formation. Most patients are diagnosed in the proliferative
stage, when the lesion appears as a bluish-red, rubbery granuloma and the typical Mikulicz
cells can be observed.
Mikulicz cells are only documented in rhinoscleroma and have been described as atypical
inflammatory monocytes specifically recruited from the bone-marrow upon K.rhinoscleroma-
tis infection [9]. These cells represent a peculiar state of highly vacuolated inflammatory
monocytes unable to digest bacteria. Moreover, it has been shown that IL-10, an anti-
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 2 / 19
a Ciência e a Tecnologia from Portugal (ASA), from
the French Government’s Investissement d’Avenir
program Laboratoire d’Excellence "Integrative
Biology of Emerging Infectious Diseases" (grant
ANR-10-LABX-62-IBEID), from Infrastructure
d’Avenir en Biologie et Sante
´"France Life Imaging"
(grant ANR-11-INBS-0006) and France-BioImaging
supported by the French National Research Agency
(ANR-10-INBS-04)”. The funders had no role in
study design, data collection and analysis, decision
to publish, or preparation of the manuscript.
Competing interests: The authors have declared
that no competing interests exist.
inflammatory cytokine, is essential in the establishment of a proper environment leading to
the phenotypic maturation of Mikulicz cells [9].
Different virulence factors have been implicated in the pathogenesis of K.pneumoniae. Cap-
sule polysaccharide (CPS) is recognized as one of the most important virulence determinants
of this pathogen. The presence of CPS inhibits the deposition of complement components
onto the bacterium [10–12], impedes adhesion and reduces phagocytosis of the bacterium by
macrophages and epithelial cells [10,12–17]. Using in vivo models of colonization and patho-
genesis, CPS mutants have been shown to be unable to colonize either pulmonary or systemic
tissues [13,18,19]. Clearly, CPS plays an important role in the interplay between K.pneumoniae
and the innate immune system.
K.pneumoniae and K.rhinoscleromatis are heavily capsulated bacteria. K.pneumoniae
express 134 different capsular serotypes that they are easily transferred via homologous recom-
bination [20,21]. Interestingly, despite their scattered geographical distribution, all K.rhino-
scleromatis isolates belong to capsular type 3 (K3) [6]. This is raising the question of whether
the K3 serotype capsule composition plays any specific role in rhinoscleroma pathology.
Indeed the K3 capsule repeated unit is rich in mannose residues, its repeated unit being com-
posed of !2-[(4,6-(S)-pyruvate)-α-D-Man-(1!4)]-α-D-GalA-(1!3)-α-D-Man-(1!2)-α-
D-Man-(1!3)-ß-D-Gal-(1![22]. This is also suggestive of possible interaction of the bacteria
with mannose receptors mainly carried by macrophages and dendritic cells. Indeed, the K3
capsule has been shown to be one of the few Klebsiella K types able to bind to the mannose
receptor [23]. The complete sequence of the genomic region comprising the capsule polysac-
charide synthesis gene cluster was determined [24]. However, to date, the link between CPS
and K.rhinoscleromatis virulence remains to be elucidated. The role of the K.rhinoscleromatis
CPS has never been tested in vivo since, currently, there are no K.rhinoscleromatis CPS
mutants available.
As CPS is a prominent factor in other bacteria, here we explored the possibility that K.rhi-
noscleromatis CPS is implicated in the peculiar pathophysiological aspects of rhinoscleroma.
We have previously established an intranasal mouse model of K.rhinoscleromatis infection
recapitulating the formation of Mikulicz cells, the major histological feature of the disease [9].
In this work, we successfully constructed a K.rhinoscleromatis CPS mutant strain, representing
the first report of the use of genetic tools in K.rhinoscleromatis. Further, using our mouse
model, we compared the host responses to wild-type and K.rhinoscleromatis CPS mutant
infections by examining cytokine production and pulmonary histology. We report that the K.
rhinoscleromatis CPS mutant is attenuated in vivo but also that Mikulicz cells are observed
upon infection with high dose of K.rhinoscleromatis CPS mutant. Our data indicate that cap-
sule is a virulence factor of K.rhinoscleromatis but is not involved in the specific appearance of
Mikulicz cells.
Materials and methods
Ethics statement
All protocols involving animal experiments were carried out in accordance with the ethical
guidelines of Pasteur Institute, Paris and approved by the Comite
´d’Ethique de l’Institut Pas-
teur (CETEA) (comite
´d’e
´thique en expe
´rimentation animale n˚89) under the protocol license
number: 2013–0031. All mice had free access to food and water and were under controlled
light/dark cycle, temperature and humidity. Animals were handled with regard for pain allevi-
ation of suffering. Animals were anesthetized using ketamine and xylazine, and euthanized
with CO2.
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 3 / 19
Bacterial strains, plasmids and media
Bacterial strains and plasmids used in this study are listed in Table 1. The K.pneumoniae
subsp. rhinoscleromatis SB3432 strain (KR WT) was isolated in 2004 at the Avicenne hospital,
Bobigny, France, from a biopsy of the left nasal cavity of an 11-years old patient diagnosed
with rhinoscleroma. The K.pneumoniae subsp. pneumoniae Kp52145 strain is a previously
described clinical isolate (serotype O1:K2) [25]. The Escherichia coli strains used in the cloning
experiments were DH5α λpir (Invitrogen) and ß2163, kind gift from Didier Mazel (Institut
Pasteur, France). pGEM-T (Promega) is TA cloning vector used for cloning PCR products.
pDS132 was a kind gift from Dominique Schneider (Universite
´Joseph Fourier, France). A
kanamycin cassette was PCR amplified from the plasmid pKD4 [26] and recombineering plas-
mid pSIM6 expressing Red system was used to create mutant in Kp52145 [27]. The plasmid
pAT881 carrying the luxABCDE operon was used to make bioluminescent strains [28].
Bacteria were grown in Lysogeny Broth (LB) medium at 37˚C with shaking. When appro-
priate, antibiotics were added at the following concentrations: ampicillin (Amp) 100 μg/ml;
chloramphenicol (Cm) 30 μg/ml; kanamycin (Kan) 50 μg/ml. When necessary, DAP was sup-
plemented to a final concentration of 0,3 mM. For selection against sacB, LB medium was sup-
plemented with sucrose to a final concentration of 5% (wt/vol).
Inocula were prepared from overnight bacterial cultures grown on a loan on LB plates at
37˚C resuspended in physiological saline.
Construction of a cps mutant in K.rhinoscleromatis and in K.pneumoniae
Capsule K.rhinoscleromatis mutant (KR cps
-
) was obtained by insertion of the plasmid pAM1
in the wzc gene. Briefly, a kanamycin cassette flanked by 1kb of upstream (wzb) and 1 kb of
downstream (wbaP) sequences of wzc using a three-step PCR method [29] was cloned into
Table 1. Bacterial strains and plasmids used in this study.
Strain Description Reference or source
E.coli
DH5α λpir F- Δlac169 rpoS(Am) robA1 creC510 hsdR514 endA recA1 uidA(ΔMluI)::pir Invitrogen
β2163 (F−) RP4-2-Tc::Mu ΔdapA::(erm-pir) [Km
R
Em
R
] [32]
K.rhinoscleromatis
KR WT (strain SB3432) Wild-type; K3 serotype [6]
KR-lux Transformant from KR WT harbouring pAT881 This study
KR cps
-
Capsule mutant harbouring pDS132 This study
KR cps
—
lux Capsule mutant harbouring pAT881 This study
K.pneumoniae
Kp52145 Wild-type; K2 serotype [25]
Kp52-pSIM6 Kp52145 wild-type harbouring pSIM6 This study
Kp52Δwzc Capsule mutant; the wzc gene was inactivated This study
Plasmid Description Reference or source
pGEM-T Cloning vector Promega
pDS132 Derived from pCVD442 (R6K ori,mobRP4,bla,sacB), without ISlsequences, bla gene replaced by cat gene (Cm
R
) [33]
pKD4 Template plasmid carrying kanamycin resistance gene flanked by FRT sites [26]
pSIM6 red genes expression vector (Amp
R
); low copy number (pSC101 replication origin) [27]
pAT881 pGB2OP
ami
luxABCDE [28]
pAM1 pGEM-T vector with the wzb-kana-wbaP fragment inserted in SacI site This study
pAM2 pDS132 vector with the wzb-kana-wbaP fragment inserted in SacI site This study
https://doi.org/10.1371/journal.pntd.0006201.t001
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 4 / 19
pGEM-T and then subcloned into pDS132 suicide vector. The resulting plasmid was intro-
duced in the E.coli ß2163 donor strain (DAP
-
) and the recombinant strain was used for conju-
gation with K.rhinoscleromatis. KR cps
-
mutants were selected onto Kan/DAP
-
plates.
K.pneumoniae 52Δwzc (Kp52Δwzc) was generated using the λRED recombination tech-
nique [26]. Briefly, a kanamycin cassette was amplified by PCR from the pKD4 plasmid using
primers Kp52WzcUpKan (5’-ATCAGTGTTCAAACTTATTGAGCAATCTGCACTGTTATG
GGCTGAGAAATTAAAAGCTTAGAAATTCAGGAAATAATGCATGATTGAACAAGAT
GGATTG -3’) and Kp52WzcDownKan (5’- CGATATGGATGACGTTCATTATTATCCTTT
TATTATATATTTTAAAAAAGGGGATTCTTCGTCCCCTTCTTGAGTAACTCAGAAG
AACTCGTCAAGAAGG -3’). The PCR product was purified onto a column, digested with
DpnI, repurified and electroporated into K.pneumoniae carrying pSIM6, which encodes the λ
RED recombinase. Kan-resistant clones were screened for successful genomic replacement of
the entire wzc. Deletion of wzc on the K.pneumoniae 52145 chromosome was confirmed by
PCR and sequencing.
Infection of mice, determination of CFUs and LD50
Female BALB/cJ mice were purchased from Janvier (Le Genest-Saint-Isle, France). All proto-
cols involving animal experiments were approved and carried out in accordance with the ethi-
cal guidelines of Pasteur Institute, Paris (license number: 2013–0031). All mice had free access
to food and water and were under controlled light/dark cycle, temperature and humidity. Ani-
mals were handled with regard for pain alleviation of suffering. Six to eight weeks-old mice
were anesthetized with a mixture of ketamine (50 mg/kg) and xylazine (5 mg/kg) and then
infected intranasally with 20 μl bacterial suspension. Control animals were inoculated with the
same volume of PBS. At various time post-infection mice were euthanized with CO
2
.
Inocula of WT and mutant bacteria used in this study are 2.10
7
bacteria for KR WT, 2.10
7
,
4.10
8
and 10
9
for KR cps
-
and 10
9
for Kp52Δwzc. When appropriate, similar inocula of the
respective bioluminescent strains were used.
Bacterial counts were determined as colony forming units (CFU) by plating serial dilutions
of lung homogenates in 3 ml ice-cold PBS supplemented with 0,5% Triton X-100 and EDTA-
free protease inhibitors (Fisher Scientific).
For survival studies, mice received either 2.10
7
KR WT or 2.10
7
, 4.10
8
, 10
9
KR cps
-
by the
intranasal route. Following infection, animals were returned to standard housing and observed
for 14 days. A census of survivors was taken daily.
Bioluminescence imaging
In order to maintain the plasmid conferring luciferase expression, mice were injected intraper-
itoneally twice daily from 1 day post-infection with 20 mg/kg spectinomycin (Spectam). Fol-
lowing isoflurane anesthesia, bioluminescence imaging was performed using an IVIS
Spectrum (Perkin Elmer). Analysis and quantification of bioluminescence were done using
Living Image (Perkin Elmer).
Histology and Fluorescence In situ Hybridization (FISH)
At 96h post-infection lungs were inflated with 4% PFA and fixed overnight at 4˚C. Paraffin-
embedded tissue blocks were cut into 7 μm sections and stained with hematoxylin-eosin (HE).
Images were acquired with the AxioScan.Z1 (Zeiss) using the Zeiss Zen2 software.
FISH staining was performed as follows. Paraffin lung sections were deparaffinized, rehy-
drated in PBS and covered with a solution of lysozyme at 10 mg/ml in PBS during 30 min at
37˚C. Slides were then washed twice in PBS, preincubated 30 min at 42˚C in hybridization
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 5 / 19
buffer (20 mM Tris-HCl [pH 8], 0.9 M NaCl, 0.01% SDS, 30% formamide) and incubated
overnight at 55˚C in hybridization buffer containing 50 nM of the pan-bacteria probe
Eub338-Alexa555 50-GCTGCCTCCCGTAGGAGT-3 [30]. After washing in 1X SSC (1 SSC is
0.15 M NaCl plus 0.015 M sodium citrate), slides were covered for 1 min with DAPI to visual-
ize the nuclei, washed in PBS and mounted in Prolong Gold reagent. Images were acquired on
an upright fluorescence microscope equipped with the Apotome technology (Zeiss AxioIma-
ger with Apotome2, Carl Zeiss Jena).
Images analysis
The number of Mikulicz cells was estimated from HE stained sections by manually segmenting
region containing high number of Mikulicz cells in Zen Blue software (Zeiss). Regions con-
taining Mikulicz cells within dense infiltrate of inflammatory cells were not included. Mikulicz
cells-containing region was quantified as % area of the total lung area.
The number of bacteria present in the tissue section was quantified from fluorescence
images using the Fiji plugin TrackMate [31]. Bacteria were defined as spots of 1.5 μm after
Laplace Gaussian fitting.
Capsule quantification
Capsule was quantified as the concentration of uronic acid in the samples from a standard
curve of D-glucuronic acid as described by Favre-Bonte et al [14]. The uronic acid content was
expressed in nanograms per 10
6
CFU.
Quantification of cytokines by ELISA
At various time post-infection the five pulmonary lobes were removed and collected in
ceramic-beads containing tubes (Precellys lysing kit CK28) with 2,5 ml of ice cold PBS supple-
mented with 0,5% Triton X-100 and EDTA-free protease inhibitors (Fisher Scientific). Sam-
ples were then crushed using the Precellys homogenizer with the following program: 3 cycles
of 15 sec at 5.000 ×g with 10 sec pause. Twenty microliters were removed to determine the
number of CFU/lung. After adding 10 μl of Pen/Strep (100X, Sigma), samples were centrifuged
at 300 ×g for 10 min and left on ice for 30 min. The supernatants were frozen rapidly in dry-
ice ethanol bath and stored at -80˚C. The following cytokines were measured: IL1ß, IL-10, IL-
17, TNFα(Duoset, all from R&D Systems). Assays were performed according to the manufac-
turer’s instructions.
Statistical analysis
Correlation between bioluminescence signal and CFU number was analyzed by Pearson corre-
lation using GraphPad Prism 5.
Results
Genotypic and phenotypic characterization of the K.rhinoscleromatis
capsule mutant strain
To investigate the role of capsule in K.rhinoscleromatis virulence, we constructed a KR capsule
mutant (KR cps
-
) from the K.rhinoscleromatis wild-type strain SB3432 (KR WT) by insertion
of a suicide plasmid. It has been shown that inactivation of wzc gene, whose product is
involved in capsular polysaccharide export machinery, leads to a capsule-minus phenotype in
K.pneumoniae [13]. We decided thus to mutate the capsular operon in SB3432 by replacing
the wzc gene by a kanamycin cassette by using the suicide plasmid pAM2. Although this
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 6 / 19
suicide plasmid can be normally excised following double crossover using sacB counter-selec-
tion, we did not manage to obtain the desired gene replacement, possibly because KR does
not grow on media without salt which is required for sacB counter-selection. Nevertheless,
sequencing of KR cps
-
confirmed the integration of the suicide plasmid in the wzb gene leading
to a polar effect and one base deletion in the sacB gene leading to the production of a truncated
SacB protein, hence explaining the selection of this mutant during the counter-selection step.
A schematic representation of the wild-type KR and the capsule mutant KR cps
-
capsule export
portion of cps operon is shown in Fig 1A. As expected, colonies of KR cps
-
did not show the
slimy and mucoid phenotype characteristic of surface polysaccharide-producing KR colonies
(Fig 1B). We also quantified the amount of capsule produced and observed a drastic reduction
from 329±59 to 10±9 ng uronic acid / 10
6
bacteria for KR WT and KR cps
-
respectively. Alto-
gether, these results indicated that this KR mutant is an effective capsule mutant.
Capsule is a well-characterized virulence factor of K.pneumoniae.K.pneumoniae capsule
mutants are avirulent and they are not able to cause pneumonia or urinary tract infections
[13,19,34]. We sought to analyze whether the KR cps
-
strain was attenuated in vivo. Anticipat-
ing that at identical inoculum of KR WT and KR cps
-
this would be the case, we wondered
whether we could recapitulate part of the disease by increasing the infectious dose of the KR
cps
-
. BALB/c mice were thus infected intranasally with 2.10
7
KR WT or 2.10
7
, 4.10
8
or 10
9
KR
Fig 1. Characterization of the K.rhinoscleromatis capsule mutant strain (KR cps
-
). (A) Schematic representation of the wild-type K.rhinoscleromatis (top) and KR
cps
-
(bottom) capsule export region of the capsule locus. The insertion of the suicideplasmid pDS132 occurred at the level of the wzb gene. The asterisk indicates the
base deletion in the sacB gene leading to aberrant protein production. (B) Morphology of the colonies of KR WT and KRcps
-
strains after overnight culture on LB agar
plates. (C) Quantification of capsule expressed as amount of uronic acid / 10
6
bacteria in KR WT and KR cps
-
. (D) Mice survival after pulmonary infection with KR WT
or KR cps
-
strains. BALB/c mice were infected with 2.10
7
KR WT, 2.10
7
KR cps
-
, 4.10
8
KR cps
-
or 10
9
KR cps
-
. Survival was followed overtime. Data are representative of
10 mice per group from two independent experiments.
https://doi.org/10.1371/journal.pntd.0006201.g001
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 7 / 19
cps
-
and survival was monitored over 14 days (Fig 1C). While all mice infected with 2.10
7
bac-
teria of KR WT strain succumbed within 6 days post-infection, mice infected with 2.10
7
or
4.10
8
KR cps
-
bacteria recovered from the infection and survived. However, a 50% death rate
was observed with the highest dose of 10
9
KR cps
-
. Altogether, these findings show that the KR
cps
-
strain is attenuated in vivo, confirming the crucial role of capsule in KR virulence.
The capsule is a virulence factor of K.rhinoscleromatis
In order to compare KR WT and KR cps
-
infections, we tested the capacity of bioluminescent
bacteria to colonize the lungs after intranasal instillation. Mice were infected with either 2.10
7
bioluminescent KR WT or 2.10
7
, 4.10
8
or 10
9
bioluminescent KR cps
-
, and bioluminescence
imaging was performed and quantified 6, 24, 48, 72, 96 hours post-infection (Fig 2A and 2B).
Mice infected with bioluminescent KR WT showed a gradual increase in lungs biolumines-
cence with a 430 fold signal increase at 4 days post-infection as compared after 6 hours. On the
other hand, the bioluminescence signal started to decrease from 6 hours post-infection with
2.10
7
KR cps
-
and reached background level at day 1. A similar but less pronounced decrease
was observed in mice infected with 4.10
8
or 10
9
KR cps
-
indicating a higher persistence of the
mutant bacteria in the lungs. Moreover, because of a more viscous inoculum at high infection
doses leading to difficulties to achieve proper intranasal infection, some mice swallowed part
of the inoculum and showed a bioluminescent signal in the gut that disappeared in most of the
animals at day 4, indicating that the bacteria transited in the gut before being eliminated. To
correlate the bioluminescent signal with the bacterial load, we quantified the number of CFU
in the lungs after bioluminescence imaging 96 hours post-infection. After subtraction of the
background signal, we observed a significant correlation between bioluminescence and CFU
in mice infected with 2.10
7
KR WT and 4.10
8
or 10
9
KR cps
-
(S1 Fig), allowing a good estimate
of CFU greater than 5.10
5
bacteria in the lungs from the bioluminescence signal.
We also directly monitored the lungs bacterial load during the same time course in mice
infected with inocula of 2.10
7
KR WT or 2.10
7
, 4.10
8
KR cps
-
(Fig 2C). While the number of
bacteria in mice infected with 2.10
7
KR WT gradually increased from 4.10
7
bacteria per lungs
6 hours post-infection to reach 4.10
9
bacteria at 96 hours, the number of bacteria in animals
infected with the same inoculum of KR cps
-
decreased gradually until the bacteria were being
completely cleared from the organ in 72 hours. However, lungs from mice infected with a
higher inoculum of 4.10
8
KR cps
-
presented a still significant amount of bacteria in the organ 4
days post-infection, providing a more relevant comparison to the wild-type infection. By 96
hours after infection with 4.10
8
KR cps
-
, 33% of mice successfully cleared the infection while
the others were still being colonized and had between 5.10
5
and 10
9
bacteria in their lungs.
These results indicated that the KR cps
-
mutant is strongly attenuated but that at a higher inoc-
ulum, after a certain threshold, KR cps
-
is able to persist and proliferate within the host.
The formation of Mikulicz cells in K.rhinoscleromatis is not capsule-
dependent
To examine the pathology induced by KR cps
-
, lungs of mice were also examined histologically
at 4 days post-infection (Fig 3A). Animals infected by 2.10
7
KR WT presented the classical
extensive but moderately destructive inflammation of the lungs characterized by the recruit-
ment and formation of large Mikulicz cells filling alveoli. By contrast, mice infected with
2.10
7
KR cps
-
showed localized dense inflammatory lesions with signs of hemorrhages and
recruitment of monocytic and polymorphonuclear cells. No classical Mikulicz cells could be
observed. This phenotype reflects the inflammatory response that was required to eradicate
the bacteria. Interestingly, when mice were challenged with 4.10
8
or 10
9
KR cps
-
, many alveoli
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 8 / 19
Fig 2. Bioluminescence imaging and bacterial loads quantification in mice infected by wild-type K.rhinoscleromatis and KR cps
-
.(A) BALB/c mice
were infected with bioluminescent 2.10
7
KR WT, 2.10
7
KR cps
-
, 4.10
8
KR cps
-
, and 10
9
KR cps
-
. The bioluminescent signal in lungs was measured 6, 24, 48,
72, and 96 hours post-infection using the IVIS Imaging System. All images are shown using the same bioluminescence signal intensity scale (in photons/
sec/cm
2
/sr). (B) Quantification of bioluminescent signal detected from six mice per group. Means are indicated as line. The dotted line indicates
background level, and the dashed line shows the minimal signal shown in (A). (C) Bacterial load in lungs of mice infected with 2.10
7
KR WT (left), 2.10
7
KR cps
-
(centre) or 4.10
8
KR cps
-
(right). Data for bacterial loads are shown as log CFU per organ from 6 to 12 mice from two to five independent
experiments. Means are indicated as line.
https://doi.org/10.1371/journal.pntd.0006201.g002
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 9 / 19
Fig 3. Histology of BALB/c lungs infected by wild-type K.rhinoscleromatis and KR cps
-
.(A) Lungs of mice infected with 2.10
7
KR WT, 2.10
7
KR cps
-
, 4.10
8
KR cps
-
,
and 10
9
KR cps
-
were resected 4 days post-infection and examined by histology. Lungs infected with 2.10
7
KR WT (left) presented the classical pattern characterized by
many alveoli, with an intact epithelial layer, filled with Mikulicz cells. On the contrary, lungs infected with 2.10
7
KR cps
-
(middle left) showed dense inflammatory
infiltrate containing numerous polymorphonuclear cells and absence of Mikulicz cells. Lungs of mice infected with 4.10
8
KR cps
-
(middle right) or 10
9
KR (right)
showed the presence of Mikulicz cells similarly to wild-type infection. Insets show magnification of representative zones of the lungs. Scale bars are 1 mm (top), 200 μm
(middle row) and 50 μm (bottom). Images are representative of 4 (KR WT), 4 (2.10
7
KR cps
-
), 4 (4.10
8
KR cps
-
) or 5 (10
9
KR cps
-
) mice from 2 to 3 independent
experiments. (B) Correlation between the area covered by Mikulicz cells and number of bacteria spots in lungs sections of mice at 96 hours after infection with 2.10
7
KR
WT, 2.10
7
KR cps
-
, 4.10
8
KR cps
-
, 10
9
KR cps
-
.
https://doi.org/10.1371/journal.pntd.0006201.g003
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 10 / 19
were filled almost exclusively with Mikulicz cells, similarly to what is observed with KR WT,
although the alveolar lining was more often disrupted. Regions with dense and localized
inflammatory regions, characterized by infiltration of numerous polymorphonuclear cells,
were also observed (Fig 3A, highlighted zone). Of note, all mice infected with 4.10
8
or 10
9
KR
cps
-
out of 9 examined histologically presented Mikulicz cells. Altogether, these observations
suggested that while capsule is a virulence factor in KR, it is not required to induce the forma-
tion of Mikulicz cells in KR pathogenesis.
As mice infected with the KR cps
-
strain showed variations in the intensity of the Mikulicz
cells infiltrate observed by histology, we wondered whether this variation was correlated to the
bacterial burden. Because we cannot directly quantify total CFU and perform an histological
analysis on the same sample, we estimated the number of bacteria by fluorescence in situ
hybridization and quantified the Mikulicz cells infiltrate by manually segmenting regions con-
taining highly visible Mikulicz cells on adjacent lungs sections (S2 Fig). Mice infected with KR
cps
-
showed different number of bacteria spots and extend of Mikulicz cells infiltrate in the
lung section (Fig 3B). Both parameters were significantly correlated, suggesting that the local
bacterial load drives the intensity of recruitment of Mikulicz cells.
IL-10 production is capsule-independent
Cytokines are key mediators of immune responses and the anti-inflammatory cytokine IL-10
has been shown to be highly produced after K.rhinoscleromatis infection and to play a crucial
role in the establishment of a proper environment leading to Mikulicz cells maturation [9].
Therefore, we characterized the production of some major cytokines in mouse lung extracts
upon KR cps
-
infection. When BALB/c mice were infected with 2.10
7
KR WT or 4.10
8
KR cps
-
,
the pro-inflammatory cytokines IL-1β, IL-17 and TNF-αwere produced in high amounts
from 6 hours post-infection onwards (Fig 4A and S3 Fig). However, although produced in
similar amounts at the beginning of the infection in mice infected with 2.10
7
KR cps
-
, the level
of these cytokines diminished overtime because bacteria were progressively cleared from the
organ. As previously shown, the anti-inflammatory cytokine IL-10 was highly produced upon
infection with 2.10
7
KR WT but not in mice infected with 2.10
7
KR cps
-
. IL-10 was also pro-
duced in mice infected with 4.10
8
KR cps
-
, but to a lower extend and in more variable manner
as compared to KR WT (Fig 4B). These observations indicate that a high inoculum of KR cps
-
allows recapitulating a high production of IL-10, thereby suggesting that capsule does not have
a direct role in IL-10 production upon KR infection.
Because we observed a high variability in the production of IL-10 in mice infected with
4.10
8
KR cps
-
, we wondered whether it was correlated with the burden of the infection. We
thus compared the production of IL-1β, IL-17, TNF-αand IL-10 to the number of CFU in the
lungs at 96 hours post-infection for each animal. While a high production of IL-1β(>3.10
5
pg/ml) is indicative of the presence of bacteria in the lungs (mainly ranging from 10
5
−10
9
bac-
teria), IL-1βis expressed at intermediate levels (500–3.000 pg/ml) when mice managed to clear
the infection (Fig 4C). Similar observation was made for IL-17 and TNF-α(S4 Fig). On the
other hand, this is different for IL-10 (Fig 4D). A first group of mice mildly colonized (between
5.10
5
and 2.10
7
CFU) showed intermediate level of IL-10 (between 70 and 200 pg/ml) while a
second group of mice that were unable to control the infection (>2.10
7
CFU) were character-
ized by an intense production of IL-10 (>10
3
pg/ml) suggesting that KR is able to induce an
intense production of IL-10 only above a certain threshold of KR bacteria in the lungs.
To establish that the occurrence of Mikulicz cells observed with 4.10
8
and 10
9
KR cps
-
was
not due to the higher inoculum of KR cps
-
as compared to KR, we measured bacterial loads
and cytokines expression in animals inoculated with the same high inoculum (10
9
bacteria) of
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 11 / 19
Kp52Δwzc 4 days post-instillation. The Kp52Δwzc strain is a similar capsule mutant from K.
pneumoniae strain Kp52145 obtained after deletion of the wzc gene showing a drastic reduc-
tion of capsule expression from 256±22 ng uronic acid / 10
6
bacteria for Kp52145 to 34±13 ng
uronic acid / 10
6
bacteria (S5 Fig). We observed that the bacterial load of mice infected with
10
9
Kp52Δwzc was around 10
5
bacteria per organ and was lower than the bacterial load of
mice infected with 10
9
KR cps
-
indicating that a wzc mutant in Kp52145 is less virulent that its
counterpart in KR (Fig 5A).
We then measured the cytokines levels in lungs of infected animals (Fig 5B and S6 Fig).
Pro-inflammatory cytokines IL-1β, IL-17 and TNF-αwere expressed in similar amounts in
mice infected with Kp52Δwzc or KR cps
-
. However, IL-10 was expressed at low level after 10
9
Kp52Δwzc infection (53–63 pg/ml), contrasting the higher amount observed after 10
9
KR cps
-
infection in some mice. By histology, we observed an intense and dense inflammation charac-
terized by a strong recruitment of monocytes and polymorphonuclear cells and an absence of
Mikulicz cells formation (Fig 5C). Altogether, and combined with the histological data, these
Fig 4. Production of IL-1βand IL-10 in lungs of BALB/c mice infected by wild-type K.rhinoscleromatis, KR cps
-
, Kp52Δwzc or Kp52145. BALB/c
mice were infected with 2.10
7
KR WT, 2.10
7
KR cps
-
or 4.10
8
KR cps
-
or saline-injected for 6, 24, 48, 72 or 96 hours. Lungs were then homogenized and the
pro-inflammatory IL-1β(A) and the anti-inflammatory IL-10 (B) cytokines were measured by ELISA. Data are mean from 6 to 10 mice from three
independent experiments. Correlation between production of IL-1β(C) or IL-10 (D) and the amount of bacteria recovered from lungs of mice at 96 hours
after injection with saline (control) or infection with 2.10
7
KR WT, 2.10
7
KR cps
-
, 4.10
8
KR cps
-
, 10
9
KR cps
-
, 10
9
Kp52Δwzc or 2.10
4
Kp52145.
https://doi.org/10.1371/journal.pntd.0006201.g004
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 12 / 19
observations suggest that when present in high concentration in the lungs from 3 days of infec-
tion without being lethal, KR or its capsule mutant are able to induce the recruitment and mat-
uration of Mikulicz cells and drive a strong production of IL-10.
Discussion
The diversity of capsule types in Klebsiella pneumoniae species is strikingly very large, as 134
different capsule loci have been identified up to now [21]. This tends to indicate that K.pneu-
moniae species is under strong selection pressure to diversify its capsule. However, and strik-
ingly, all K.rhinoscleromatis strains isolated so far are of the KL3 (K3) serotype despite having
been isolated from diverse geographical locations [6]. Because of this homogeneity, we specu-
lated that this specific K3 serotype could be an important factor driving the rhinoscleroma dis-
ease. By creating a capsule mutant in K.rhinoscleromatis, we showed that if capsule is an
important virulence factor for this species, it is not necessary to induce the formation of Miku-
licz cells, the hallmark of rhinoscleroma, as these cells have been observed when using high
inocula of this mutant.
Fig 5. The capsule mutant Kp52Δwz c is not able to induce the formation of Mikulicz cells. (A) Bacterial load in lungs of BALB/c mice after infection
with 2.10
7
KR WT, 10
9
KR cps
-
or 10
9
Kp52Δwzc. Data show CFU in whole lungs after 96 hours post-infection from 5 to 11 mice from one to five
independent experiments. Means are indicated as line. (B) Production of IL-1βand IL-10 in the lungs of BALB/c mice infected with 2.10
7
KR WT, 10
9
KR
cps
-
or 10
9
Kp52Δwzc. Cytokines were measured 96 hours post-infection by ELISA. Data are mean from 5 to 9 mice from two independent experiments.
(C) Histology, representative example of lung from mice infected with 10
9
Kp52Δwzc. Zones of dense inflammation can be observed with absence of
Mikulicz cells. Scale bars are 1 mm (left), 200 μm (middle) and 50 μm (right).
https://doi.org/10.1371/journal.pntd.0006201.g005
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 13 / 19
The saccharide composition of the capsule has been linked to some extent to K.pneumoniae
virulence. K1 and K2 serotypes have been suggested to be major determinants in liver abscess-
causing K.pneumoniae [35,36]. Strains from other serotypes, including K5, K16, K20, K54 and
K57, have also been described as highly virulent [37]. In addition, switching the capsular sero-
type of a highly virulent K2 strain to a weakly virulent K21a strain has been shown to lead to a
decrease in virulence in mouse and in survival in blood and to an increased binding to macro-
phages. Conversely, switching the capsule serotype of the K21a strain to virulent K2 resulted in
an increased virulence in mouse and in survival in blood and to a lower binding to macro-
phages [38,39]. In addition, switching highly conserved genes of the capsule cluster involved in
capsule export from K1 into K20 hypervirulent strain strongly reduced its bacterial virulence
in mice while increasing its neutrophil phagocytosis and survival in macrophages, although it
is still not known whether this is due to a change in capsule expression[40]. However, a recent
pan-genomic analysis did not reveal any correlation between capsule serotype and strains
responsible of invasive community-acquired infection but rather suggested that the presence
of one or several siderophores explains bacterial virulence [41]. Thus the exact role of capsule
composition in virulence still remains to be clearly determined.
Capsule plays an important role in immune cells evasion by preventing binding of comple-
ment and antibodies to the bacteria thereby decreasing opsono-phagocytosis and comple-
ment-mediated killing [10–13,42–45]. Moreover, Klebsiella capsule composition has been
shown to influence the binding of the bacteria to macrophages. K3, K46 and K64 K.pneumo-
niae capsule are binding more to the mannose receptor, which is highly expressed on macro-
phages, than other serotypes, in a mannose-dependent manner, while other serotypes
presented no binding [23]. A common feature of these three different serotypes is that they
have two or three mannose residues in their repeated unit. Though, other K serotypes that
present also two mannose residues did not show any binding to the mannose receptor, sug-
gesting that binding of mannose-bearing capsule to the mannose receptor is influenced by
other factors than its mannose composition. However, as all K.rhinoscleromatis strains are of
the K3 serotype, and even though K3 capsule interacts with mannose receptor, our results
obtained with a high infection dose of KR cps
-
suggest that this step is not important in driving
the development of Mikulicz cells.
Some results obtained with the high inocula of KR cps
-
were heterogeneous: the bacterial
load 4 days post-infection was spread over 4 logs, IL-10 levels in the lungs were quite variable
and some mice showed some bacteria in the digestive tract by bioluminescence. This variabil-
ity is a consequence of the use of higher inocula, which are thicker and more viscous than
lower inocula used for the KR WT and of KR cps
-
strains that are more fluid. As a consequence,
part of the inoculum is swallowed by mice and passes into the digestive tract. This is also sug-
gesting that above a certain threshold of cps
-
bacteria delivered to the lungs, the animal cannot
control the infection and the bacteria are able to multiply and maintain themselves in high
number, although to a lower burden than WT bacteria. We wondered whether there was a cor-
relation between the number of bacteria in the lungs and the level of IL-10 produced. Indeed
we observed that IL-10 was produced in high amount when the bacterial load was high, raising
the possibility that high IL-10 expression was the result of a high bacterial burden and not spe-
cific to K.rhinoscleromatis. To verify this one needs to compare IL-10 production upon similar
bacterial burdens, greater than 10
8
bacteria, at 4 days post-infection with different bacteria.
We first thought to use a high dose of a K.pneumoniae mutant inactivated in the same gene as
the KR cps
-
strain, but showed that the bacterial load was lower (10
4
−10
5
bacteria) than the
lowest ones obtained with high KR cps
-
(10
6
to 10
8
bacteria) and that IL-10 levels were also
quite low. This showed that this Kp52Δwzc mutant was actually more attenuated than KR cps
-
and suggested that K.rhinoscleromatis is better adapted to surviving in lungs. Some virulent K.
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 14 / 19
pneumoniae strains can cause intense and severe and acute pneumonia in mice with high bur-
den. We had previously observed that a variable bacterial load can be achieved 3 and 5 days
post-infection with a low dose of the virulent strain Kp52145 [9] and that about 30% of mice
were presenting a high bacteria burden 3 and 5 days post-infection. By measuring CFU loads
and cytokines in mice infected with Kp52145 we observed that mice that had a high bacterial
load were producing IL-10 in amount similar to those that were less colonized. Comparable
high bacterial burden were obtained with the widely used K.pneumoniae strain 43816
[18,19,46] and IL-10 was produced in similar low amounts 3 days post-infection [18]. Hence
these observations indicate that the intense IL-10 production observed upon infection with KR
WT or KR cps
-
is specific of K.rhinoscleromatis and does not result from a global high bacterial
load.
Moreover, all high dose KR cps
—
infected mice out of 9 observed by histology show the pres-
ence of Mikulicz cells in their lungs, although to various extent. We also observed that the den-
sity of the Mikulicz cells infiltrate is correlated to the number of bacteria. We also tried to see
whether there was a similar correlation with the amount of IL-10 on a mouse to mouse basis,
but were unable to detect directly this cytokine by immunohistochemistry. Nevertheless, the
variation in the host response to KR cps
-
infection is likely correlated to the amount of IL-10
produced: lower number of bacteria lead to fewer Mikulicz cells and low amounts of IL-10
whereas an intense IL-10 production is accompanied by high number of bacteria and Mikulicz
cells and less destructive inflammation.
Recently, IL-10 has been shown to regulate metabolic processes in activated macrophages
and thus control the inflammatory response. IL-10 impedes glycolysis and promotes oxidative
phosphorylation maintaining mitochondrial fitness. This metabolic reprogramming of macro-
phages is controlled by IL-10 through inhibition of mechanistic target of rapamycin (mTOR)
signaling pathway [47]. Interestingly, deregulation of mTOR signaling, such as prolonged
mTORC1 activation, leads to metabolic changes, hyperproliferation of macrophages and gran-
uloma formation, contributing to disease progression in human granulomatous sarcoidosis
[48]. These mechanisms might be associated with formation of granulomas in rhinoscleroma,
where Mikulicz cells could undergo similar metabolic remodeling mediated by IL-10.
The fact that the capsule is not required for Mikulicz cells recruitment and formation
indicates that the factors responsible of this process are still unknown and remain to be identi-
fied. Current in vivo screening approaches, such as signature tagged mutagenesis, cannot be
used as they identify mutants unable to grow in specific experimental conditions, but not
those that are required for the expression of a particular phenotype, such as the appearance of
Mikulicz cells. Therefore an in vitro screening assay has to be developed. However, in vivo
phagocytosis assays can often be difficult to set up and standardize due to the high expression
of capsule in K pneumoniae species and its strong anti-phagocytic effect. Our results show that
capsule is not required for the formation of Mikulicz cells, opening the way to in vitro assays of
Mikulicz cells formation and to in vitro screening of factors that are driving this maturation in
vivo.
Supporting information
S1 Fig. Bioluminescence signal and CFU correlation. Bioluminescence signal after back-
ground subtraction was correlated with the CFU number for mice infected with 2.10
7
KR WT,
4.10
8
KR cps
-
and 10
9
KR cps
-
.
(EPS)
S2 Fig. Quantification of bacteria spots by FISH. Bacteria were detected in lungs section by
FISH using pan bacteria probe. Bacteria spots were quantified using the plugin Trackmate in
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 15 / 19
Fiji. (A) shows a representative image of a lung section from a mouse infected with 2.10
7
KR
(top left) with the bacteria labelled in orange, a high resolution zoom showing individual bac-
terial spots (middle left) and the corresponding spots detected by TrackMate (middle right). A
corresponding HE image with the manually segmented area containing Mikulicz cells is
shown (top right). (B) Representative image from a mouse infected with 2.10
7
KR cps
-
. Bottom
images in A and B are 140 μm wide.
(EPS)
S3 Fig. Production of IL-17 and TNF-αin lungs of BALB/c mice infected by wild-type K.
rhinoscleromatis or KR cps
-
.BALB/c mice were infected with 2.10
7
KR WT, 2.10
7
KR cps
-
or
4.10
8
KR cps
-
or saline-injected for 6, 24, 48, 72 or 96 hours. Lungs were homogenized and the
pro-inflammatory cytokines IL-17 (A) and TNF-α(B) were measured by ELISA. Data are
mean from 6 to 10 mice from three independent experiments.
(EPS)
S4 Fig. Cytokines production and CFU correlation. Correlation between production of IL-
17 (A) or TNF-α(B) and the amount of bacteria recovered from lungs of mice at 96 hours
after injection with saline or infection with 2.10
7
KR WT, 2.10
7
KR cps
-
, 4.10
8
KR cps
-
, 10
9
KR
cps
-
, 10
9
Kp52Δwzc or 2.10
4
Kp52145.
(EPS)
S5 Fig. Quantification of capsule in Kp52145 and mutant Kp52Δwzc. Data are expressed as
ng of uronic acid / 10
6
bacteria.
(EPS)
S6 Fig. Production of IL-17 (A) and TNF-α(B) in lungs of BALB/c mice infected by wild-
type K.rhinoscleromatis, KR cps
-
or Kp52Δwzc.BALB/c mice were infected with 2.10
7
KR
WT, 10
9
KR cps
-
or 10
9
Kp52Δwzc. Cytokines were measured 96 hours post-infection by
ELISA. Data are mean from 5 to 9 mice from two independent experiments.
(EPS)
Acknowledgments
We thank Claude Parsot for his constant interest and advice during this work, Ce
´line Mulet
for advice and help with histology and FISH staining, Julien Fernandes for help with FISH
image acquisition, and Giulia Nigro, Geneviève Milon and Thierry Pedron for critical reading
of the manuscript.
Author Contributions
Conceptualization: Barbara Corelli, Ana S. Almeida, Cindy Fevre, Sylvain Brisse, Philippe J.
Sansonetti, Re
´gis Tournebize.
Funding acquisition: Ana S. Almeida, Philippe J. Sansonetti, Re
´gis Tournebize.
Investigation: Barbara Corelli, Ana S. Almeida, Fabiane Sonego, Virginia Castiglia, Cindy
Fevre, Re
´gis Tournebize.
Supervision: Re
´gis Tournebize.
Visualization: Barbara Corelli, Ana S. Almeida, Re
´gis Tournebize.
Writing – original draft: Barbara Corelli, Ana S. Almeida, Fabiane Sonego, Virginia Castiglia,
Re
´gis Tournebize.
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 16 / 19
References
1. Gaafar HA, Gaafar AH, Nour YA. Rhinoscleroma: an updated experience through the last 10 years.
Acta Otolaryngol. 2011; 131: 440–446. https://doi.org/10.3109/00016489.2010.539264 PMID:
21198342
2. De Pontual L, Ovetchkine P, Rodriguez D, Grant A, Puel A, Bustamante J, et al. Rhinoscleroma: a
French national retrospective study of epidemiological and clinical features. Clin Infect Dis. 2008; 47:
1396–1402. https://doi.org/10.1086/592966 PMID: 18947330
3. Jeffery J, Sulaiman S, Oothuman P, Vellayan S, Zainol-Ariffin P, Paramaswaran S, et al. Domiciliary
cockroaches found in restaurants in five zones of Kuala Lumpur Federal Territory, peninsular Malaysia.
Trop Biomed. 2011; 29: 3309–3316.
4. Moges F, Eshetie S, Endris M, Huruy K, Muluye D, Feleke T, et al. Cockroaches as a Source of High
Bacterial Pathogens with Multidrug Resistant Strains in Gondar Town, Ethiopia. Biomed Res Int. 2016;
2016: 2825056. https://doi.org/10.1155/2016/2825056 PMID: 27340653
5. Fielding BC, Mnabisa A, Gouws PA, Morris T. Antimicrobial-resistant Klebsiella species isolated from
free-range chicken samples in an informal settlement. Arch Med Sci. 2012; 8: 39–42. https://doi.org/10.
5114/aoms.2012.27278 PMID: 22457672
6. Brisse S, Fevre C, Passet V, Issenhuth-Jeanjean S, Tournebize R, Diancourt L, et al. Virulent clones of
Klebsiella pneumoniae: identification and evolutionary scenario based on genomic and phenotypic
characterization. PLoS ONE. 2009; 4: e4982. https://doi.org/10.1371/journal.pone.0004982 PMID:
19319196
7. Hart CA, Rao SK. Rhinoscleroma. J Med Microbiol. 2000; 49: 395–396. https://doi.org/10.1099/0022-
1317-49-5-395 PMID: 10798549
8. Canalis RF, Zamboni L. An interpretation of the structural changes responsible for the chronicity of rhi-
noscleroma. Laryngoscope. 2001; 111: 1020–1026. https://doi.org/10.1097/00005537-200106000-
00016 PMID: 11404614
9. Fevre C, Almeida AS, Taront S, Pedron T, Huerre M, Prevost M-C, et al. A novel murine model of rhino-
scleroma identifies Mikulicz cells, the disease signature, as IL-10 dependent derivatives of inflammatory
monocytes. EMBO Mol Med. 2013; 5: 516–530. https://doi.org/10.1002/emmm.201202023 PMID:
23554169
10. de Astorza B, Corte
´s G, Crespı
´C, Saus C, Rojo JM, Albertı
´S. C3 promotes clearance of Klebsiella
pneumoniae by A549 epithelial cells. Infect Immun. Am Soc Microbiol; 2004; 72: 1767–1774. https://
doi.org/10.1128/IAI.72.3.1767–1774.2004
11. Alvarez D, Merino S, Toma
´s JM, Benedı
´VJ, Albertı
´S. Capsular polysaccharide is a major complement
resistance factor in lipopolysaccharide O side chain-deficient Klebsiella pneumoniae clinical isolates.
Infect Immun. 2000; 68: 953–955. PMID: 10639470
12. Corte
´s G, A
´lvarez D, Saus C, Albertı
´S. Role of lung epithelial cells in defense against Klebsiella pneu-
moniae pneumonia. Infect Immun. Am Soc Microbiol; 2002; 70: 1075–1080. https://doi.org/10.1128/IAI.
70.3.1075–1080.2002
13. Corte
´s G, Borrell N, de Astorza B, Go
´mez C, Sauleda J, Albertı
´S. Molecular analysis of the contribution
of the capsular polysaccharide and the lipopolysaccharide O side chain to the virulence of Klebsiella
pneumoniae in a murine model of pneumonia. Infect Immun. Am Soc Microbiol; 2002; 70:2583–2590.
https://doi.org/10.1128/IAI.70.5.2583–2590.2002
14. Favre-Bonte S, Joly B, Forestier C. Consequences of reduction of Klebsiella pneumoniae capsule
expression on interactions of this bacterium with epithelial cells. Infect Immun. 1999; 67: 554–561.
PMID: 9916058
15. Moranta D, Regueiro V, March C, Llobet E, Margareto J, Larrate E, et al. Klebsiella pneumoniae Cap-
sule Polysaccharide Impedes the Expression of -Defensins by Airway Epithelial Cells. Infect Immun.
2010; 78: 1135–1146. https://doi.org/10.1128/IAI.00940-09 PMID: 20008534
16. Sahly H, Podschun R, Oelschlaeger TA, Greiwe M, Parolis H, Hasty D, et al. Capsule impedes adhe-
sion to and invasion of epithelial cells by Klebsiella pneumoniae. Infect Immun. 2000; 68: 6744–6749.
PMID: 11083790
17. Clements A, Gaboriaud F, Duval JFL, Farn JL, Jenney AW, Lithgow T, et al. The major surface-associ-
ated saccharides of Klebsiella pneumoniae contribute to host cell association. PLoS ONE. 2008; 3:
e3817. https://doi.org/10.1371/journal.pone.0003817 PMID: 19043570
18. Lawlor MS, Handley SA, Miller VL. Comparison of the host responses to wild-type and cpsB mutant
Klebsiella pneumoniae infections. Infect Immun. 2006; 74: 5402–5407. https://doi.org/10.1128/IAI.
00244-06 PMID: 16926436
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 17 / 19
19. Lawlor MS, Hsu J, Rick PD, Miller VL. Identification of Klebsiella pneumoniae virulence determinants
using an intranasal infection model. Mol Microbiol. 2005; 58: 1054–1073. https://doi.org/10.1111/j.
1365-2958.2005.04918.x PMID: 16262790
20. Wyres KL, Gorrie C, Edwards DJ, Wertheim HFL, Hsu LY, Van Kinh N, et al. Extensive Capsule Locus
Variation and Large-Scale Genomic Recombination within the Klebsiella pneumoniae Clonal Group
258. Genome Biol Evol. 2015; 7: 1267–1279. https://doi.org/10.1093/gbe/evv062 PMID: 25861820
21. Wyres KL, Wick RR, Gorrie C, Jenney A, Follador R, Thomson NR, et al. Identification of Klebsiella cap-
sule synthesis loci from whole genome data. Microb Genom. 2016; 2: e000102. https://doi.org/10.1099/
mgen.0.000102 PMID: 28348840
22. Dutton GG, Parolis H, Joseleau JP, Marais MF. The use of bacteriophage depolymerization in the struc-
tural investigation of the capsular polysaccharide from Klebsiella serotype K3. Carbohydrate Research.
1986; 149: 411–423. PMID: 3756950
23. Zamze S, Martinez-Pomares L, Jones H, Taylor PR, Stillion RJ, Gordon S, et al. Recognition of bacterial
capsular polysaccharides and lipopolysaccharides by the macrophage mannose receptor. J Biol Chem.
2002; 277: 41613–41623. https://doi.org/10.1074/jbc.M207057200 PMID: 12196537
24. Fevre C, Passet V, Deletoile A, Barbe V, Frangeul L, Almeida AS, et al. PCR-based identification of
Klebsiella pneumoniae subsp. rhinoscleromatis, the agent of rhinoscleroma. PLoS Negl Trop Dis. 2011;
5: e1052. https://doi.org/10.1371/journal.pntd.0001052 PMID: 21629720
25. Nassif X, Fournier JM, Arondel J, Sansonetti PJ. Mucoid phenotype of Klebsiella pneumoniae is a plas-
mid-encoded virulence factor. Infect Immun. 1989; 57: 546–552. PMID: 2643575
26. Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using
PCR products. Proc Natl Acad Sci USA. 2000; 97: 6640–6645. https://doi.org/10.1073/pnas.
120163297 PMID: 10829079
27. Datta S, Costantino N, Court DL. A set of recombineering plasmids for gram-negative bacteria. Gene.
2006; 379: 109–115. https://doi.org/10.1016/j.gene.2006.04.018 PMID: 16750601
28. Foucault ML, Thomas L, Goussard S, Branchini BR, Grillot-Courvalin C. In vivo bioluminescence imag-
ing for the study of intestinal colonization by Escherichia coli in mice. Appl Environ Microbiol. 2010; 76:
264–274. https://doi.org/10.1128/AEM.01686-09 PMID: 19880653
29. Derbise A, Lesic B, Dacheux D, Ghigo JM, Carniel E. A rapid and simple method for inactivating chro-
mosomal genes in Yersinia. FEMS Immunology & Medical Microbiology. 2003; 38: 113–116. https://doi.
org/10.1016/S0928-8244(03)00181-0
30. Tomas J, Mulet C, Saffarian A, Cavin J-B, Ducroc R, Regnault B, et al. High-fat diet modifies the PPAR-
γpathway leading to disruption of microbial and physiological ecosystem in murine small intestine. Proc
Natl Acad Sci USA. 2016; 113: E5934–E5943. https://doi.org/10.1073/pnas.1612559113 PMID:
27638207
31. Tinevez J-Y, Perry N, Schindelin J, Hoopes GM, Reynolds GD, Laplantine E, et al. TrackMate: An open
and extensible platform for single-particle tracking. Methods. 2017; 115: 80–90. https://doi.org/10.1016/
j.ymeth.2016.09.016 PMID: 27713081
32. Demarre G, Gue
´rout A-M, Matsumoto-Mashimo C, Rowe-Magnus DA, Marlière P, Mazel D. A new fam-
ily of mobilizable suicide plasmids based on broad host range R388 plasmid (IncW) and RP4 plasmid
(IncPalpha) conjugative machineries and their cognate Escherichia coli host strains. Res Microbiol.
2005; 156: 245–255. https://doi.org/10.1016/j.resmic.2004.09.007 PMID: 15748991
33. Philippe N, Alcaraz J-P, Coursange E, Geiselmann J, Schneider D. Improvement of pCVD442, a suicide
plasmid for gene allele exchange in bacteria. Plasmid. 2004; 51: 246–255. https://doi.org/10.1016/j.
plasmid.2004.02.003 PMID: 15109831
34. Struve C, Krogfelt KA. Role of capsule in Klebsiella pneumoniae virulence: lack of correlation between
in vitro and in vivo studies. FEMS Microbiol Lett. 2003; 218: 149–154. PMID: 12583911
35. Yeh K-M, Kurup A, Siu LK, Koh YL, Fung C-P, Lin J-C, et al. Capsular serotype K1 or K2, rather than
magA and rmpA, is a major virulence determinant for Klebsiella pneumoniae liver abscess in Singapore
and Taiwan. J Clin Microbiol. 2007; 45: 466–471. https://doi.org/10.1128/JCM.01150-06 PMID:
17151209
36. Yeh K-M, Chiu S-K, Lin C-L, Huang L-Y, Tsai Y-K, Chang J-C, et al. Surface antigens contribute differently
to the pathophysiological features in serotype K1 and K2 Klebsiella pneumoniae strains isolated from liver
abscesses. Gut Pathog. 2016; 8: 4. https://doi.org/10.1186/s13099-016-0085-5 PMID: 26893615
37. Shon AS, Bajwa RPS, Russo TA. Hypervirulent (hypermucoviscous) Klebsiella pneumoniae: a new and
dangerous breed. Virulence. 2013; 4: 107–118. https://doi.org/10.4161/viru.22718 PMID: 23302790
38. Ofek I, Kabha K, Athamna A, Frankel G, Wozniak DJ, Hasty DL, et al. Genetic exchange of determi-
nants for capsular polysaccharide biosynthesis between Klebsiella pneumoniae strains expressing
serotypes K2 and K21a. Infect Immun. 1993; 61: 4208–4216. PMID: 8104896
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 18 / 19
39. Kabha K, Nissimov L, Athamna A, Keisari Y, Parolis H, Parolis LA, et al. Relationships among capsular
structure, phagocytosis, and mouse virulence in Klebsiella pneumoniae. Infect Immun. 1995; 63: 847–
852. PMID: 7868255
40. Lin C-L, Chen F-H, Huang L-Y, Chang J-C, Chen J-H, Tsai Y-K, et al. Effect in virulence of switching
conserved homologous capsular polysaccharide genes from Klebsiella pneumoniae serotype K1 into
K20. Virulence. 2016;: 1–7. https://doi.org/10.1080/21505594.2016.1228508 PMID: 27565716
41. Holt KE, Wertheim H, Zadoks RN, Baker S, Whitehouse CA, Dance D, et al. Genomic analysis of diver-
sity, population structure, virulence, and antimicrobial resistance in Klebsiella pneumoniae, an urgent
threat to public health. Proc Natl Acad Sci USA. 2015; 112: E3574–81. https://doi.org/10.1073/pnas.
1501049112 PMID: 26100894
42. Merino S, Camprubı
´S, Albertı
´S, Benedı
´VJ, Toma
´s JM. Mechanisms of Klebsiella pneumoniae resis-
tance to complement-mediated killing. Infect Immun. Am Soc Microbiol; 1992; 60: 2529–2535.
43. Domenico P, Salo RJ, Cross AS, Cunha BA. Polysaccharide capsule-mediated resistance to opsono-
phagocytosis in Klebsiella pneumoniae. Infect Immun. 1994; 62: 4495–4499. PMID: 7927714
44. Evrard B, Balestrino D, Dosgilbert A, Bouya-Gachancard J-LJ, Charbonnel N, Forestier C, et al. Roles
of capsule and lipopolysaccharide O antigen in interactions of human monocyte-derived dendritic cells
and Klebsiella pneumoniae. Infect Immun. 2010; 78: 210–219. https://doi.org/10.1128/IAI.00864-09
PMID: 19841082
45. March C, Cano V, Moranta D, Llobet E, Pe
´rez-Gutie
´rrez C, Toma
´s JM, et al. Role of bacterial surface
structures on the interaction of Klebsiella pneumoniae with phagocytes. March C, Cano V, Moranta D,
Llobet E, Pe
´rez-Gutie
´rrez C, Toma
´s JM, et al., editors. PLoS ONE. 2013; 8: e56847. https://doi.org/10.
1371/journal.pone.0056847 PMID: 23457627
46. Bachman MA, Oyler JE, Burns SH, Caza M, Le
´pine F, Dozois CM, et al. Klebsiella pneumoniae yersi-
niabactin promotes respiratory tract infection through evasion of lipocalin 2. Infect Immun. 2011; 79:
3309–3316. https://doi.org/10.1128/IAI.05114-11 PMID: 21576334
47. Ip WKE, Hoshi N, Shouval DS, Snapper S, Medzhitov R. Anti-inflammatory effect of IL-10 mediated by
metabolic reprogramming of macrophages. Science. 2017; 356: 513–519. https://doi.org/10.1126/
science.aal3535 PMID: 28473584
48. Linke M, Pham HTT, Katholnig K, Schno
¨ller T, Miller A, Demel F, et al. Chronic signaling via the meta-
bolic checkpoint kinase mTORC1 induces macrophage granuloma formation and marks sarcoidosis
progression. Nat Immunol. 2017; 18: 293–302. https://doi.org/10.1038/ni.3655 PMID: 28092373
Capsule in Klebsiella rhinoscleromatis infection
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0006201 January 30, 2018 19 / 19
