Content uploaded by Philippe Silar
Author content
All content in this area was uploaded by Philippe Silar on Jan 11, 2023
Content may be subject to copyright.
Cryptogamie, Mycologie, 2017, 38 (4): 485-506
©2017 Adac. Tous droits réservés
doi/10.7872/crym/v38.iss4.2017.485
Species delimitation in the Podospora anserina/
P. pauciseta/P. comata species complex (Sordariales)
Charlie BOUCHER, Tinh-Suong NGUYEN &Philippe SILAR*
Univ Paris Diderot, Sorbonne Paris Cité,
LaboratoireInterdisciplinairedes Énergies de Demain,
75205 Paris Cedex 13 France
Abstract –Podospora anserina is amodel ascomycete that has been used for over acentury
to study many biological phenomena including ageing, prions and sexual reproduction. Here,
through the molecular and phenotypic analyses of several strains, we delimit species that are
hidden behind the P. anserina/P. pauciseta and P. comata denomination in culture collections.
Molecular analyses of several regions of the genome as well as growth characteristics show
that these strains form aspecies complex with at least seven members. None of the traditional
morphology-based characters such as ascospore and perithecium sizes or presence of setae at
the neck are able to differentiate all the species, unlike the ITS barcode, mycelium growth
characteristics and repartition of perithecia on the thallus. Interspeci½ccrosses are nearly
sterile and most F1 progeny is female sterile. As aresult of our analyses, the taxonomy of
the P. anserina complex is clari½ed by lecto- and epitypi½cations of the names P. anserina,
P. pauciseta and P. comata,aswell as descriptions of the new species P. bellae-mahoneyi,
P. pseudoanserina,P. pseudocomata,and P. pseudopauciseta. We also report on the ability
of species from this complex to form a Cladorrhinum-like asexual morph and to produce tiny
sclerotium-like structures.
Podospora anserina /Podospora pauciseta /Podospora comata /Lasiosphaeriaceae /
Sordariales /Cladorrhinum-like /sclerotium-like /microsclerotium /spermatia
Résumé–Podospora anserina est un ascomycète modèle qui est utilisédepuis plus d’un
siècle pour étudier de nombreux phénomènes biologiques incluant le vieillissement, les
prions ou la reproduction sexuée. Nous délimitons grâce àune analyse moléculaire et
phénotypique les espèces cachées derrière les dénominations P. anserina/P.pauciseta
et P. comata des souches de collections. Les analyses moléculaires de plusieurs régions
du génome ainsi que les caractéristiques de croissance montrent que ces espèces forment
un complexe avec au moins sept membres. Aucun des caractères utilisésusuellement tels que
la taille des ascospores et des périthèces, ou la présence de setae au col ne peut différencier
les espèces, au contraire des analyses du code-barres ITS, des caractéristiques de croissance
et de la répartition des périthèces sur le thalle. Les croisements interspéci½ques sont trèspeu
fertiles et la plupart de la descendance F1 est femelle stérile. Il en résulte une clari½cation
par lecto- et epitypi½cations des noms P. anserina,P. pauciseta and P. comata,ainsi que
la description de quatreespèces nouvelles : P. bellae-mahoneyi,P. pseudoanserina,
P. pseudocomata,and P. pseudopauciseta. Nous montrons aussi la capacitéde ces espèces à
former un anamophe de type Cladorrhinum ainsi que des microsclérotes.
Podospora anserina /Podospora pauciseta /Podospora comata /Lasiosphaeriaceae /
Sordariales /anamorphe de type Cladorrhinum /microsclérotes /spermaties
*Corresponding author: philippe.silar@univ-paris-diderot.fr
486 C. Boucher et al.
INTRODUCTION
Podospora anserina,the “friendly mold”,isamodel fungus that has been
widely used for over acentury to analyze various biological processes ranging from
cell fusion, ageing, prions, sexual reproduction, differentiation and development to
plant biomass degradation (Silar 2013). This species is acommon inhabitant of
herbivore dung and appears to have acosmopolitan distribution (Table 1). In
addition, to dung there is one report of its isolation as aplant endophyte (Matasyoh
et al. 2011) and one strain deposited in the Westerdijk Institute Culture Collection
has been retrieved from soil (Table 1, CBS 415.72). Presently,only the teleomorph
is known as no asexual morph has been described. This species is pseudo-homothallic,
meaning that it is formallyheterothallic, i.e.,with two different mating types (mat+
and mat-), but it produces asci with four ascospores carrying mat+ and mat- nuclei.
The heterokaryotic thalli germinating from these ascospores are thus self-fertile.
Ascospores are obliquely uniseriateinthe asci and measure about 20 µm×35 µm.
They have atypical cellular appendage (20 µm×5µm) located at the opposite of
the germination pore and two non-cellular appendages at the opposite ends of the
ascospore. The fruiting body produced is aperithecium with adiameter of about
0.3 mm with awell-de½ned neck ornamented with setae.
As noted by Atkinson in afootnote of apaper by Wolf (Wolf 1912) as early
as the beginning of the 20th century,the name of this species is somewhat uncertain.
Indeed, it is mostly known in scienti½cpublications dealing with genetics, molecular
biology biochemistry and genomics as Podospora anserina (Rahb.) Winter (Wolf
1912) or Podospora anserina (Ces.) Rehm (as for example in Rizet &Engelmann
(1949) or in Esser (1956). Another infrequently used synonym is Pleurage anserina
(Ces.) Kuntze (e.g.,Hodgkiss &Harvey 1971; Moreau &Moreau 1951). However,
strains of this species are preserved under the name of Podospora pauciseta (Ces.)
Trav.inmany culture collections including that of the We sterdijk Institute, and many
taxonomists use this epithet in their publications. The species appears to have been
described ½rst as Sphaeria pauciseta by Cesati (see Botanische Zeitung 1852 vol. 10,
pp 285-288) and later asecond time as Malinvernia anserina also by Cesati and
reported by Rabenhorst (1857). Traverso validated the combination in Podospora,
P. pauciseta (Ces.) Trav.(Traverso 1907), but some authors continued to call it
P. anserina, as initiated by Niessl (1883) and Winter (1887). To confuse the matter,
it is possible that P. anserina and P. pauciseta are two different species, afact hinted
at by Mirza and Cain (1969). Original syntype materials of both P. pauciseta (as
Sphaeria pauciseta Ces. under n°1642 in the “Klotzschii herbarium vivum
mycologicum sistens fungorum per totam germaniam crescentium collectionem
perfectam –Centuria XVII”)and P. anserina (as Malinvernia anserina Ces. under
n°526 in the “Klotzschii herbarium vivum mycologicum sistens fungorum per
totam germaniam crescentium collectionem perfectam –Editio nova Series Prima
Centuria VI”)are available as dried dung. However,Lundqvist (1972) stated that he
could not ½nd the fungus on these authentic types. Moreover,atthe time of its ½rst
descriptions the fungus was collected directly from the wild and not cultivated in
pure culture. Hence, the original types, including those of Cesati deposited in Rome’s
herbarium, may contain additional species and unfortunately cannot anymore be
used as reference for the fungus. To complicate further the situation, asecond
supposedly closely-related species, Podospora comata,has been described
(Milovtzova 1937). It differed from typical P. anserina by smaller spores, slender
perithecia and lack of setae decorating the neck (as deduced from the drawing of
Milovtzova). It is not clear whether this species is atrue species or aminute form
Species delimitation in Podospora 487
Table 1. Strains used in this study.The new sequences are in bold
Strain Previously
identiìed as
Proposed new
name Origin Substrate Year Ascosporesize
(µm)
Perithecium
diameter 4
%with
setae 5
GenBank numbers
ITS Rchr3 Rchr4 Rchr6
AP. anserina P. anserina Normandie, France dung 1937 35 ±2×18 ±1323 ±12 60 MF380256 MF379740 MF379732 MF379769
BP. anserina P. anserina Normandie, France dung 1941 35 ±1×19 ±1313 ±12 60 AY525771.1 MF379766 MF379798 MF379796
EP. anserina P. anserina ?dung ? 36 ±2×20 ±1371 ±14 45 MF380240 MF379744 MF379768 MF379789
FP. anserina P. anserina ?dung ? 36 ±1×20 ±1329 ±25 35 MF380246 MF379746 MF379781 MF379799
HP. anserina P. anserina Bourgogne, France dung ? 33 ±1×20 ±1369 ±10 40 MF380244 MF379730 MF379778 MF379739
IP. anserina P. anserina ?dung ? 33 ±1×18 ±1296 ±27 55 MF380247 MF379802 MF379735 MF379793
MP. anserina P. anserina Picardie, France dung ? 35 ±1×19 ±1311 ±24 65 MF380242 MF379708 MF379743 MF379760
NP. anserina P. anserina ?dung ? 33 ±1×18 ±1268 ±13 60 MF380239 MF379806 MF379783 MF379787
RP. anserina P. anserina ?dung ? 33 ±1×18 ±1337 ±37 40 MF380264 MF379697 MF379784 MF379795
S(big S)1P. anserina P. anserina Normandie, France dung ? 35 ±1×19 ±1280 ±29 60 AY278557.1 MF379758 MF379804 MF379755
s(small s) P. anserina P. anserina Normandie, France dung ? 33 ±1×19 ±1284 ±15 50 MF380241 MF379726 MF379754 MF379723
UP. anserina P. anserina Picardie, France dung ? 35 ±1×19 ±1351 ±11 50 MF380253 MF379786 MF379713 MF379788
VP. anserina P. anserina Picardie, France dung ? 35 ±1×19 ±1304 ±18 60 MF380236 MF379717 MF379780 MF379759
WP. anserina P. anserina ?dung ? 37 ±1×19 ±1314 ±750
MF380261 MF379718 MF379775 MF379803
XP. anserina P. anserina Picardie, France dung ? 37 ±1×19 ±1285 ±32 60 MF380252 MF379701 MF379748 MF379738
YP. anserina P. anserina ?dung ? 36 ±1×19 ±1299 ±12 50 MF380237 MF379707 MF379772 MF379800
ZP. anserina P. anserina ?dung ? 35 ±1×19 ±1288 ±19 25 MF380243 MF379765 MF379791 MF379733
Pscj14 New to this study P. anserina Ile de France, France dung 2003 36 ±1×19 ±1341 ±12 15 MF380255 MF379720 MF379807 MF379704
PSN14 New to this study P. anserina Picardie, France dung 2007 36 ±1×19 ±1341 ±17 40 MF380249 MF379774 MF379705 MF379801
PSN42 New to this study P. anserina Picardie, France dung 2008 35 ±1×20 ±1321 ±27 29 MF380257 MF379750 MF379805 MF379709
CB1 New to this study P. anserina France dung 2014 34 ±1×19 ±1356 ±19 5 MF380235 MF379761 MF379729 MF379700
CB2 New to this study P. anserina France dung 2014 34 ±1×19 ±1338 ±17 20 MF380259 MF379706 MF379724 MF379794
CB3 New to this study P. anserina France dung 2014 35 ±1×19 ±1380 ±27 12 MF380245 MF379776 MF379741 MF379782
CB4 New to this study P. anserina France dung 2014 36 ±1×19 ±1340 ±16 54 MF380254 MF379702 MF379767 MF379779
CB5 New to this study P. anserina France dung 2014 34 ±1×19 ±1349 ±36 28 MF380248 MF379752 MF379773 MF379764
CB6 New to this study P. anserina Ile de France, France dung 2014 35 ±2×19 ±1343 ±14 82 MF380250 MF379710 MF379703 MF379756
CB7 New to this study P. anserina Ile de France, France dung 2015 36 ±1×20 ±1320 ±27 66 MF380258 MF379737 MF379728 MF379716
CBS 433.50 P. pauciseta P. anserina Ontario dung 1944 NA6NA6NA6MF380260 MF379753 MF379698 MF379747
CBS 333.63 P. pauciseta P. pauciseta Argentina dung ? 35 ±1×19 ±1314 ±20 29 GQ922516.1 MF415406 MF379749 MF379762
CBS 451.62 P. pauciseta P. pauciseta Argentina dung ? 34 ±1×18 ±1308 ±62 24 GQ922517.1 MF415407 MF379742 MF379797
CBS 237.71 P. comata P. pauciseta Israel dung 1970 32 ±1×19 ±1247 ±24 1 MF380263 MF415408 MF379722 MF379792
CBS 112042 P. pauciseta P. bellae-mahoneyi We stern Australia dung 2001 39 ±1×23 ±12397 ±31 50 DQ166956.1 MF379763 MF379736 MF379719
CBS 411.78 P. comata Ppseudopauciseta Ve nezuela dung 1972 32 ±1×19 ±1372 ±18 30 MF415409 MF379731 MF379770 MF379790
CBS 253.71 P. pauciseta P. pseudoanserina Central Africac dung ? 34 ±1×19 ±1253 ±71 38 GQ922515.1 MF379745 MF379777 MF379715
CBS 124.78 P. pauciseta P. pseudoanserina India dung 1977 33 ±1×19 ±1326 ±18 27 MF380251 MF379711MF379785 MF379712
TP. comata P. comata France dung ? 32 ±1×17 ±13228 ±16 65 AF443849.1 MF379757 MF379734 MF379725
CBS 415.72 P. pauciseta P. pseudocomata Pakistan soil ? 33 ±1×19 ±1277 ±17 13 MF380238 MF379771 MF379751 MF379721
1Sequenced strain (Espagne et al. 2008; Grognet et al. 2014); deposited as CBS141519 for the mat+ and CBS141520 for the mat- homokaryons and as n°6597 in the collection of the Museum National d’Histoire
Naturelle de Paris for the mat+/mat- heterokaryon. –2Ascospore height and width are signi½cantly larger than most of the other strains. –3Ascospore width is signi½cantly smaller than most of the other strains. –
4Average diameter of the largest mature perithecia when cultivated on M2 medium with 4g/L of dextrin as carbon source. –5Percentage of perithecia with clearly differentiatedsetae when cultivated on medium
with wood shavings as carbon source. –6Strain CBS 433.50 has lost sexual reproduction by loss of the mat- nuclei.
488 C. Boucher et al.
of P. anserina (Krug &Khan 1989). Note that the long awaited revision of the
species related to P. anserina is unlikely to improve the matter.The genus Podospora
is polyphyletic (Miller &Huhndorf 2005) and belongs to the Lasiosphaericeae,a
paraphyletic family from which stem the mostly monophyletic Chaetomiaceae and
Sordariaceae (Cai et al. 2006; Kruys et al. 2015; Madrid et al. 2011; Miller &
Huhndorf 2005). Although, the type species of the genus is Podospora ìmiseda,an
eight-spored species (Niessl 1883) and aclose relative in molecular phylogeny to
Podospora pauciseta (Kruys et al. 2015), aformal taxonomic revision of the family
will likely result in achange of genus name for most species, including possibly that
of P. anserina,P. pauciseta and P. comata.Here, as astart, we have undertaken the
analysis of most available strains of P. pauciseta, P. anserina and P. comata present
in culture collections and show that they belong to aspecies complex with not three,
but at least seven members.
MATERIALS AND METHODS
Strain sampling
Strains AtoZ(Table 1), including S(big S), s(small s) and T, were from
the collection of Georges Rizetand have been used for many early studies on
P. anserina (see for example Bernet 1965 and Marcou 1961). Both mat+ and mat-
isolates were already available for all these strains. They were crossed and fresh
mat+ and mat- homokaryotic progeny for each strain was selected for phenotypic
analysis. The S(=big S) strain is the reference strain for which the genomes of the
mat+ (Espagne et al. 2008) and mat- (Grognet et al. 2014) nuclei have been
sequenced. The origin of some of these strains (date and location of sampling) is
unfortunately not known. Moreover,they were kept in the lab for over 60 years and
some may have acquired mutation(s), possibly accounting for some of the deviation
seen for afew characters. Nonetheless, most of them look exactly like the newer
isolates, indicating that phenotypically-relevant mutations have not accumulatedat
high level. The newer strains, PSN14, Pscj14, PSN42 and CB1 to CB7, were
obtained from dung sampled from various French regions and at different dates
(Table 1). Ascospores ejected from perithecia present on the dung were collected and
germinated. Thalli produced from these ascospores were immediately stocked at
–80°Ctoprevent any mutation accumulation. These self-fertile thalli were incubated
for the production of perithecia. Homokaryotic mat+ and mat- ascospores, recognized
by their small sizes, were collected and selected for phenotypic analysis. The
remaining strains were purchased from the Westerdijk Institute. Like for the previous
strains, homokaryotic progeny for all Westerdijk Institute strains were used for
phenotypic analysis. Note that for some strain of the Westerdijk Institute Culture
Collection, “incolore”mutations that frequently occur in P. anserina (Rizet 1939)
were detected. Only progenies devoid of this mutation were selected for analysis.
Phenotypic analysis
Standard culture conditions, media and genetic methods for P. anserina
have been described (Rizet &Engelmann 1949; Silar 2013) and can be accessed at
http://podospora.i2bc.paris-saclay.fr.M0minimal base medium has the following
Species delimitation in Podospora 489
composition KH2PO4 0.25 g/L, K2HPO40.3 g/L, MgSO4/7H2O0.25 g/L, Urea
0.5 g/L, Thiamine 0.05 mg/L, Biotine 0.25 µg/L, Citric Acid 2.5 mg/L, ZnSO4
2.5 mg/L, CuSO40.5 mg/L, MnSO4 125 µg/L, Boric Acid 25 µg/L, Sodium
Molybdate 25 µg/L, Iron Alum 25 µg/L, Agar 12,5 g/L. It can be supplemented with
Dextrins at 4g/L or 6g/L to yield the M2 minimal medium, crystalline cellulose (cat
n°CC41 from Whatman) at 5g/L to yield M4 medium or 1gofGuiboursia deumeusi
wood shavings.Importantly,when cultivated on these media, all strains yielded in 7
to 10 days matured perithecia typical of the species. These looked alike perithecia
obtained on sterile horsedung, amore natural growth medium for the fungus.
Germination medium was ammonium acetate 4.4 g/L, bactopeptone 15 g/L and Agar
13 g/L. Perithecium formation was assayed as in (Tangthirasunun et al. 2016).
Ascospore and perithecium sizes were the average +SDof10different samples.
Hyphal Interference was assayed as in (Silar 2005). Crippled Growth as in (Haedens
et al. 2005). Microsclerotia developed on plates with wood shavingsand the
Cladorrhinum-likeanamorphic structures were obtained by incubating homokaryotic
strains on M2 medium overlaid with acellophane sheet for three weeks at 18°C.
DNA extraction, PCR amplidcation and sequencing
Genomic DNA was extracted as described by Lecellier &Silar (1994). The
ITS locus was ampli½ed using primers ITS1 and ITS4 primers (White et al. 1990).
The ampli½ed three intergenic loci were (1) aregion between Pa_3_1380 and
Pa_3_1390 on chromosome 3(Rchr3) using primers 1380F (acgcgcacatacacagg)
1380R (tggatgccattgggctat), (2) aregion on chromosome 4between Pa_4_7610 and
Pa_4_7620 (or Rchr4) with primers 7610F (tcctggtgagctgtatgtaggctggacacg) and
7610-2R (accaggcagtagagtgaaaaggtcgaaggc) and (3) aregion on chromosome 6
between Pa_6_5500 and Pa_6_5510 (or Rchr6) with primers 5500F
(agatgggttcttgtcatgagagggctggttt) and 5500R (tgggcttgatatcgtgctatattggcggcc). The
sequencing was performed by Genewiz UK (Takeley,UK), with primers ITS1, ITS4,
1380F,7610F and 5500F.Sequences were manually assembled.
Phylogenetic analyses
DNA sequences were compared using Mafft with the default parameters
(Katoh &Standley,2014) and transferred to Jalview for visualization (Waterhouse
et al.,2009). Alignments were used to construct phylogenetic trees using the
maximum likelihood method (PhyML software) with the GTR model (Guindon &
Gascuel, 2003; Guindon et al.,2005). The optimized trees were transferred to the
iToL server for visualization (Letunic &Bork, 2007). Bootstrap values are expressed
as percentages of 100 replicates.
RESULTS AND DISCUSSION
Molecular phylogeny
To delimit potential species, we sequenced four genomic regions (Table 1):
(1) the nucITS rRNA (ITS1-5.8S-ITS2) locatedonchromosome3, (2) an intergenic
490 C. Boucher et al.
region (called Rchr3) also situated on chromosome 3and closely linked to alocus
under balanced selection, the Het-s/het-S incompatibility locus (Debets et al. 2012),
(3) an intergenic region situated on chromosome 4(Rchr4) and an intergenic region
on chromosome 6(Rchr6). The last three regions were chosen because, being
intergenic, they likely accumulated more differences than the elongation factor 1-α
or tubulin genes used frequently for phylogenetic analysis. Moreover,Rchr3 being
associated with alocus under balanced selection should exhibit more polymorphisms
than Rchr4 and Rchr6.
All three intergenic regions differentiated the same seven sets (Fig. 1).
Moreover,these sets were identical to those de½ned by the ITS sequence (Fig. 2).
We ½nd no evidence of recombination between the four regions between the species
sets, suggesting that the seven sets represented in fact seven species. The largest set
contained all strains from the Rizet collection except strain T, all the strains newly
collected from France (i.e.,Pscj14, PSN14, PSN42 and CB1 to CB7) and strain CBS
433.50. They all had the same ITS, Rchr4 and Rchr6. They could only be differentiated
by Rchr3, which clustered them into two subgroups (Fig. 2). As expected, this
clustering re¸ectedthe one obtained when the Het-s/Het-S region was analyzed
(Debets et al. 2012), with the S(big S) strain belonging to one subgroup and the s
(= small s) strain to the other.The six additional sets were (1) strain T, (2) strain
CBS 112042, (3) strain CBS 411.78, (4) strains CBS 237.71, CBS 451.62 and CBS
333.63, (5) strain CBS 415.72 and (6) strains CBS 253.71 and CBS 124.78. As
expected when combined, phylogeny with the four sequences gave seven statistically-
well-supported sets (Fig. 3). Although individual branches for each set are statistically
well supported, the branching order is poorly de½ned by the present data (Fig. 2
and 3). Most strains are equally distant from each other,except groups (5) and (6)
that seem to be more closely related to each other than to the other strains (Fig. 3
and Table 2). Note that the percentage of similarity of the sequences between the
sets was ten times greater than those within sets (Table 2) in the range of 1-3%,
which are typical of differencesbetween species rather than those of different strains
from the same species. Fertility of interspeci½ccrosses was very low (few hundreds
of ascospores obtained per Petri plate, instead of the hundreds of thousands obtained
in most intraspeci½ccrosses). F1 progeny from interspeci½ccrosses often had poor
growth and most of them were female sterile.This showed that the seven sets were
in fact seven species, aconclusion supported by morphological and cultural properties
of the strains (see below). Names for these species are indicated in Figs 1, 2, 3, 5
and 7aswell as in Table 1and 2.
Table 2. Percentage of nucleotide sequence identity between the indicated species
P. anserina P. pauciseta P. comata P. bellae-
mahoneyi P. pseudoanserina P. pseudopauciseta P. pseudocomata
P. anserina <0.1% a
P. pauciseta 1.8% <0.1%
P. comata 2.2% 2.4% NA
P. bellae-mahoneyi 2.7% 3.2% 3.1% NA
P. pseudoanserina 2.0% 2.3% 2.6% 3.1% 0%
P. pseudopauciseta 2.3% 2.5% 2.8% 3.4% 0.7% NA
P. pseudocomata 1.7% 2.1% 2.1% 2.7% 2.1% 2.3% NA
aThis number is obtained when the Rchr3 region is omitted; when this region under balanced selection is included, the percentage of
identity reached 0.3%.
Species delimitation in Podospora 491
Fig. 1. Phylogenetic trees constructed using Rchr3, Rchr4 and Rchr6. The trees were constructed by maximum likelihood with PhyML. Bootstrap supports
(> 80%; 100 replicas) are indicated by the dots.
Fig. 2. Comparison of the ITS1 &ITS2 regions. The 5.8S is masked; no difference was found in the 5.8S gene.
492 C. Boucher et al.
Taxonomy
Podospora pauciseta Traverso, Flora Italica Cryptogama Pars I: Fungi Pyrenomycetae,
p. 431 (1907) Fig. 7B
=Sphaeria pauciseta Ces., Botanische Zeitung vol. 10, p. 285 (1852)
Lectotypiìcation:ITA LY,Vercelli, on pig dung, Cesati, Rabenh. Herb. Vi v.
Mycol., Cent. XVII, 1642 (HAL, lectotypus hic designatus,Mycobank:
MBT#249597).
Epitypiìcation:Mycobank: MBT#121083: ISRAEL, Northern Region,
between Moledet and Jubla, isolated from Antelope dung, Apr.1970, J.C. Krug
(PC0735081 epitypus hic designatus;duplicate deposited at HAL sub nr.3208 F,;
ex-epitype culture: CBS 237.71).
Notes:The three strains available for this species produce perithecia all
over the culture on M2 medium and on aring similar to that of P. anserina on M4.
They fructify abundantly on wood shavings. Their ITS sequence differs at one
position from the P. anserina reference ITS: ITS2 –Cinsertion after nucl. n°11.
Fig. 3. Species tree inferred from the concatenated dataset (ITS +Rchr3 +Rchr4 +Rchr6).
Bootstrap support values (> 80%; 100 replicas) are indicated by the dots. Known regions where strains
from the relevant species were collected are indicated.
Species delimitation in Podospora 493
Fig. 4. (A)Variation of the size of the perithecia. Arrows point towards ascospores that originated from
small perithecia, showing that these were matured. (B)Peritheciaofstrain CBS 411.78 on two different
media containing either dextrin or crystalline cellulose as carbon source. (C)Strain CBS 237.71 has
very low percentage (1%) of perithecia with setae (arrows), while strain Shas 60%.
494 C. Boucher et al.
Fig. 5. Perithecium differentiation patterns on various carbon sources. Only representative strains
are illustrated. M0 +WS= M0 supplemented with wood shavings as carbon source. Arrowheads on the
M2 plate of CBS 253.71 point towards sectors of altered growth.
Species delimitation in Podospora 495
Fig. 6. Microsclerotia (A) and Cladorrhinum anamorphs (B). P: protoperithecium.
496 C. Boucher et al.
Podospora anserina Niessl Ueber die Theilung der Gattung Sordaria.Hedwigia 22:
156. (1883)
=Malinvernia anserina Ces., Rabenhorst, Erklärung der Taf. XV.
Hedwigia 1: 116 –pl. 115 ½g. 114(1857)
Lectotypiìcation:ITALY,Vercelli, on goose dung, Cesati, Rabenh., Herb.
Viv. Mycol., Ed. Nov., Cent. VI, 526 (HAL, Lectotypus hic designatus,
MBT#183160).
Epitypiìcation:FRANCE. Normandie, isolated from dung. Date of
collection unknown but around 1940 (PC0735082 &HAL 3205 F; Epitypus hic
designatus,Mycobank: MBT#100818); ex-epitype culture: Strain Sdeposited at the
Museum National d’Histoire Naturelle, Paris n°6597; Fig. 7A).
Notes:Many strains are available for this species. Diagnostic features are
the presence of aring of perithecia on M2 for mat+/mat- heterokaryotic cultures and
the ability to undergo Crippled Growth. Perithecia form alarger and more diffuse
ring on M4 medium and are produced all over wood shavings. Sequence of its ITS,
the ½rst sequenced, is ade½ning feature and is used as reference for all the other
strains of the species complex. This species seems to be prevalent in Western Europe.
Podospora comata Milovtz., Trav.Inst. Bot. Kharkov 2: 20 (1937) Fig. 7C
Lectotypiìcation (Mycobank MBT#261400): UKRAINE, on horse dung,
Trav.Inst. Bot. Kharkov vol. 2: 20 ½g. 2(1937), lectotypus hic designatus.
Fig. 7. For each species on the left are the perithecia obtained on sterile dung and on the right squash
mount of perithecia obtained on M2 showing perithecial wall, neck and centrum with asci. Left panel,
white bar =0.3 mm, right panel black bar =0.25 mm.
Species delimitation in Podospora 497
Epitypiìcation (Mycobank MBT#261400): FRANCE. Isolated from dung.
(PC0735083, epitypus hic designatus,duplicate deposited at HAL sub nr.3207 F;
ex-epitype culture: Strain Tdeposited at the Mycotheque du Museum National
d’Histoire Naturelle de Paris, n°6598).
Notes:Type material of P. comata could not be traced and is not preserved
in the herbarium of the Kharkov National University (Dr.A.Akulov,pers. comm.).
Therefore, the original illustration published in Milovtzova (1937), which is part of
the original material (Art. 9.3), is designated as lectotype (Art. 9.2), and the current
application of P. comata is clari½ed by epitypi½cation. The only strain available for
this rede½ned species was collected in France. It has smaller ascospores (32 +1×
17 +1µm) and perithecia on M2 (diam. =228 +16µm) than strains of the other
species. This strain requires at least 6g/L of dextrin in M2 for abundant pigmentation
and fructi½cation. It is poorly able to utilize the crystalline cellulose present in the
M4 medium. It is however very fertile on wood shavings. Its ITS sequence differs
at three positions from the P. anserina reference ITS: ITS1 –nucl. n°12 GtoA,
ITS1 –nucl. n°26 GtoAand ITS2 –CC insertion after nucl. n°141.
Podospora bellae-mahoneyi C. Boucher,TSNguyen &PSilar, sp. nov. Fig. 7D
Mycobank:MB821832.
Etymology.Refers to Ann Bell and David Mahoney who isolated and
deposited the strain.
Type:Western Australia. Isolated from kangaroo dung, Feb. 2001, leg. A.
Bell &D.P.Mahoney (PC0735079 holotypus;HAL 3206 Fisotypus; ex-type
culture: CBS 112042).
Description:Perithecium diameter 397 +31mm, pyriform, membranous,
semitransparent, pale brown, covered with numerous hyphoid hairs. Neck blackish,
coriaceous, often with atuft of dark, rigid, agglutinated hairs, sometimes with afew
scattered hairs too. Asci 4-spored, clavate-lageniform. Spores spoon-shaped in the
early stages. Mature spores obliquely uniseriate: spore head 38 +1×23 +1mm,
ellipsoidal sometimesslightly asymmetrical, ¸attened at the base, smooth, thick-
walled, with acentral germ pore. Presence of aprimary appendage (pedicel) 20-22 ×
5-6 mm (exceptionally longer), cylindrical, slightly tapering towards the apex. Upper
secondary appendage (cauda) lash-shaped, not covering the germ pore; lower cauda
solid, ½liform, ephemeral, arising from the pedicel apex and with three additional
short, quite coiled appendages at the pedicel base, near the septum.
Notes:The only strain available for this species makes bigger spores (39 +
1×23 +1µm) and perithecia on M2 (diam. =397 +31µm) than all the strains
from the other species. It produces few perithecia on M2 and none on M4. It
produces many perithecia on wood shavings. Its ITS sequence differs at one position
from the P. anserina reference ITS: ITS1 –Ainsertion after nucl. n°146.
Podospora pseudoanserina C. Boucher,TSNguyen &PSilar sp. nov. Fig. 7G
Mycobank:MB821835.
Etymology:Refers to its relatedness to P. anserina.
Type:Central Africa. Isolated from dung of Cobus defassa,leg, R. Cailleux
(PC0735075 holotypus;HAL 3209 Fisotypus; ex-type culture: CBS 253.71).
Description:Perithecium diameter 200-400 mm, pyriform, membranous,
semitransparent, pale brown, covered with numerous hyphoid hairs. Neck blackish,
coriaceous, often with atuft of dark, rigid, agglutinated hairs, sometimes with afew
scattered hairs too. Asci 4-spored, clavate-lageniform. Spores spoon-shaped in the
early stages. Mature spores obliquely uniseriate: spore head 34 +1×19 +1mm,
498 C. Boucher et al.
ellipsoidal sometimes slightly asymmetrical, ¸attened at the base, smooth, thick-
walled, with acentral germ pore. Presence of aprimary appendage (pedicel), 20-22
×5-6 mm (exceptionally longer), cylindrical, slightly tapering towards the apex.
Upper secondary appendage (cauda) lash-shaped, not coveringthe germ pore; lower
cauda solid, ½liform, ephemeral, arising from the pedicel apex and with three
additional short, quite coiled appendages at the pedicel base, near the septum.
Notes:The two strains available for this species produce perithecia with
very different size. Moreover,sizes differ on M2 and M4 but in opposite directions
for both strains. Diagnostic feature of both strains appears to be the production of
perithecia as adisk of 2cmofdiameter on M2. Their ITS sequence differs at one
position from the P. anserina reference ITS: ITS2 –nucl. n°144 CtoA.
Podospora pseudocomata C. Boucher,TSNguyen &PSilar, sp. nov. Fig. 7F
Mycobank:MB821833.
Etymology:refers to its relatedness to P. comata.
Type:PAKISTAN. Lahore, Jamrud-Landi Kotal Road, isolated from soil,
leg. S. Ahmed (PC0735078 holotypus;HAL 3210 Fisotypus; ex-type culture: CBS
415.72).
Description:Perithecium diameter 277 +17mm, pyriform, membranous,
semitransparent, pale brown, covered with numerous hyphoid hairs. Neck blackish,
coriaceous, often with atuft of dark, rigid, agglutinated hairs, sometimeswith afew
scattered hairs too. Asci 4-spored, clavate-lageniform. Spores spoon-shaped in the
early stages. Mature spores obliquely uniseriate: spore head 33 +1×19 +1mm,
ellipsoidal sometimes slightly asymmetrical, ¸attened at the base, smooth, thick-
walled, with acentral germ pore. Presence of aprimary appendage (pedicel) 20-22 ×
5-6 mm (exceptionally longer), cylindrical, slightly tapering towards the apex. Upper
secondary appendage (cauda) lash-shaped, not covering the germ pore; lower cauda
solid, ½liform, ephemeral, arising from the pedicel apex and with three additional
short, quite coiled appendages at the pedicel base, near the septum.
The only strain available for this species was isolated from soil. This strain
undergoes senescence rapidly on M2 and produces abundant and large perithecia on
M4. Its ITS sequence differs at one position from the P. anserina reference ITS:
ITS2 –Cinsertion after nucl. n°141. Point of insertion is the same as CC insertion
in P. comata.
Podospora pseudopauciseta C. Boucher,TSNguyen &PSilar, sp. nov. Fig. 7E
Mycobank:MB821834.
Etymology:refers to its relatedness to P. pauciseta.
Type:VENEZUELA. Edo Anzoategui, We st of Barcelona, isolated from
cow dung, July 1972, J.C. Krug.(PC0735080 holotypus;HAL 3211Fisotypus;
ex-type culture: CBS 411.78)
Diagnosis: differs from other Podospora in its ability to produce perithecia
ten times more voluminous on M4 than on M2. Its ITS sequence differs at two
positions from the P. anserina reference ITS: ITS1 –nucl. n°109 CtoAand ITS2
–nucl. n°144 CtoA.Change in ITS2 –nucl. n°144 CtoAis also present in
P. pseudoanserina.
Description:Perithecium diameter 372 +18mm, pyriform, membranous,
semitransparent, pale brown, covered with numerous hyphoid hairs. Neck blackish,
coriaceous, often with atuft of dark, rigid, agglutinated hairs, sometimeswith afew
scattered hairs too. Asci 4-spored, clavate-lageniform. Spores spoon-shaped in the
early stages. Mature spores obliquely uniseriate: spore head 32 +1×19 +1mm,
Species delimitation in Podospora 499
ellipsoidal sometimesslightly asymmetrical, ¸attened at the base, smooth, thick-
walled, with acentral germ pore. Presence of aprimary appendage (pedicel) 20-22 ×
5-6 mm (exceptionally longer), cylindrical, slightly tapering towards the apex. Upper
secondary appendage (cauda) lash-shaped, not covering the germ pore; lower cauda
solid, ½liform, ephemeral, arising from the pedicel apex and with three additional
short, quite coiled appendages at the pedicel base, near the septum.
Notes:The only available strain for this species was isolated from dung
from Venezuela. It produced perithecia all over the thallus on M2 in amanner
similar to P. pauciseta.Diagnostic feature exhibited by the strain is its ability to
produce perithecia ten times more voluminous on M4 than on M2. Its ITS sequence
differs at two positions from the P. anserina reference ITS: ITS1 –nucl. n°109 C
to Aand ITS2 –nucl. n°144 CtoA.Change in ITS2 –nucl. n°144 CtoAisalso
present in P. pseudoanserina.
Ascospore, perithecium size and setae arenot able to differentiate species
Measure of ascospore sizes showed that only two strains statistically
differed from all the others (p <5%). CBS 112042 had signi½cantlylarger ascospores
(both in length and width) and strain Thad signi½cantly narrower ascospores
(Table 1). However,the differences were small. All the other strains had ascospores
of about the same size, including the two strains labelled as P. comata in the
Westerdijk Institute Culture Collection (CBS 411.78 and CBS 237.71). Regarding
the size of the perithecium, we observed variation in their diameter even for mature
perithecia (Fig. 4A). Moreover,for some strains, perithecium diameter depended
greatly upon the medium they were cultivated on. For example, strain CBS 411.78
produced perithecia nearly ten times more voluminous when fed with crystalline
cellulose than when fed with dextrins (Fig. 4B). Interestingly,strains from
P. pseudoanserina (group 6) behaved in opposite direction with respected to their
perithecium size: CBS 124.78 produced larger perithecia on crystalline cellulose
than on dextrin (413 +48vs326 +18), while CBS 253.71 produced smaller ones
(185 +32vs253 +71). Note that neck size depends upon lighting, because
perithecium necks orient towards light and perithecia grown under low light radiating
from the side have longer necks than those illuminated from above with an intense
light. Perithecium height cannot thus be used for differentiating strains. Consequently,
Table 1gives only the diameter of the largest mature perithecia when cultivated on
M2 medium with 4g/L of dextrin as carbon source. While strain Tand CBS 112042
had perithecia with the smallest and largest diameters, respectively,these were not
statisticallydifferent from those of strains having similar sized perithecia (e.g.,strain
Nfor small perithecia and strain CB3 for large ones).
Presence of setae at the neck is also often used to differentiate P. comata
from P. pauciseta/anserina.However,analysis of setae in the various strains showed
that they were not present on all perithecia (Fig. 4C). Moreover,the proportion of
perithecia with setae as well as the length of the setae varied with the medium. For
example for strain S, setae were short and not clearly visible on M2 medium in
which dextrin was present at 4g/L; they decorated 60% of the perithecia (n =100).
On M2 medium with 6g/L, setae were more readily observed, but only in 25% of
the perithecia (n =100). On medium with wood shavings as carbon source, they
were clearly observed and present in 55% of the perithecia (n =100) (Fig. 4C) and
on medium with crystalline cellulose, they were shorter and present in 30% of the
perithecia (n =100). Finally,onhorse dung, anatural substrate of the fungus, they
were easily seen and present in 60% of the perithecia (n =100). Table 1gives the
500 C. Boucher et al.
proportion of setae when the strains were grown on wood shaving medium, as setae
were the most clearly counted on this medium (Fig. 4C). Percentage of setae was
very low in CBS 237.71 (1%), identi½ed as a P. comata strain in the We sterdijk
Institute Culture Collection (now a P. pauciseta strain), but also in CB1 anewly-
isolated strain of P. anserina.All the other strains had setae on more than 15% of
their perithecia, typically in around 50% of them (Table 1). Note that variation in
setae was previously reported (Grif½ths 1901).
Overall, these data showed that the characters traditionally used to
differentiate P. comata from P. pauciseta/anserina were not reliable in differentiating
most species of the complex. Nevertheless, based on the small sizes of its ascospore
and perithecia, strain Tappears to be the closest to the one described by Milovtzova.
At the other end, strain CBS 112042 has larger spore and perithecia than all the other
strains. These morphological differences con½rmed the fact that these two strains
belong to two different species having speci½cintergenic and ITS sequences different
from all the other strains.
Perithecium repartition pattern in different cultureconditions can
discriminate between species
While morphological attributes of ascospores and perithecia were often
poor discriminators for the species, we notice that perithecium formation patterns
delimitated the various species fairly well, especially when different carbon sources
were assayed (Fig. 5). This con½rmed that the seven species de½ned by sequence
analysis were bona ìde species. On the M2 minimal medium containing 4g/L of
dextrin as carbon source, all the strains of P. anserina formed aring of small
perithecia with an inner diameter of about 1cmand awidth of about 1cm, with
little strain-dependent variations. Some additional perithecia appeared later following
alarger and more diffuse ring. On M4 that contained5.5 g/L of crystalline cellulose,
all P. anserina strains formed larger rings of small perithecia with inner diameters
of about 2cmand widths of about 2cm. On wood shaving medium, they formed
small perithecia on most of the wood shavings. None of the other strains had a
similar pattern. On M2, strains of P. pauciseta formed perithecia on most of the
thallus as did strains of P. pseudopauciseta.Yet strains of P. pauciseta also formed
aring on M4 similar to P. anserina,while P. pseudopauciseta produced fewer,but
much enlarged perithecia (Fig. 4), at the center of the plate. On wood shavings both
strains produced more perithecia than P. anserina.P. comata produced few small
perithecia at the center of the plate on M2 containing 4g/L of dextrin, while it was
much more fertile on M2 with 6g/L of dextrin (i.e.,itproduced more and larger
perithecia; data not shown). Differences on perithecium production between 4g/L
and 6g/L of dextrin were not as pronounced in the other species as in P. comata.
Fertility of P. comata on M4 was also poor,but important on wood shaving, where
perithecia concentrated at the periphery of the plates. P. bellae-mahoneyi produced
few perithecia at the center of M2 plates, none on M4 and amedium amount of large
perithecia mostly at the periphery of the plate on wood shavings. P. pseudocomata
differs in having many perithecia on M2 mostly along aring similar to that of
P. anserina.Itformed large perithecia on M4 and smaller ones on wood shaving.
The two strains of P. pseudoanserina both formed adisk of perithecia on M2, amore
diffuse ring on M4 and numerous ones on wood shavings. However,because CBS
124.78 produced fewer but larger perithecia than CBS 253.71, especially on M4, the
½gures for these two strains appeared different.
Species delimitation in Podospora 501
Species from the complex can form microsclerotia and cladorrhinum like-
anamorphs
All strains from the P. anserina species complex were able to produce
microsclerotium-like structures (Fig. 6, Ta ble 3) when cultivated with wood shavings
as carbon source. These structures measured up to about 50 µmindiameter and
started as an orange material deposited at discrete region of the mycelium. Upon
aging the material turned blackish (Fig. 6).
One-celled uni-nucleated “conidia”have been reported for P. anserina as
early as 1916 (Satina 1916). Because they do not germinate readily on all tested
media, they were thought to serve only as male gametes during fertilization and thus
renamed spermatia (Dodge 1936). They are carried by small peg-like hyphae called
phialides (if one thinks that they are actual conidia) or spermogonia (if one sees
them only as male gametes) that look like atypical cladorrhinum anamorph.
Although accumulation of phialides/spermogonia into branched conidiophores has
been described (Dodge 1936), the available descriptions never mention them as
visible to the naked eye. Interestingly,atlow temperature (18°C) in the dark on M2
overlaid with cellophane, most strains from the P. anserina species complexwere
able to form anamorphic structures visible with the naked eye (Fig. 6, Table 3).
However,production of these structures was rather unreliable even when the strains
were tested in standardized conditions, making it apoor discriminating criterion to
characterize the species. Table 3lists the species for which we were able to see
clearly some anamorphic structures. Lack of detection in our experiments does not
preclude the formation of Cladorrhinum-like anamorphs by the strains when
additional experiments will be carried out. These were composed of numerous
branched hyphae carrying phialides interspersed with long sterile hyphae, as
described for Bahupaathra samala (Subramanian &Lodha 1964), syn. Cladorrhinum
samala (Mouchacca &Gams 1993). The phialides thus observed carry several
Table 3. Main phenotypic features of the various species of the Podospora anserina species
complex
P. anserina P. pauciseta P. comata P. bellae-
mahoneyi
P. pseudo-
anserina
P. pseudo-
comata
P. pseudo-
paucistea
Cladorrhinum-like
anamorph +1
CBS 333.63:–
CBS 237.71:+
CBS 451.62:–
++ –++
Microsclerotia yes yes yes yes yes yes yes
Appressorium-like yes yes yes yes yes yes yes
Hyphal Interference
(oxidative burst) ++
CBS 333.63:++
CBS 237.71:++
CBS 451.62:–
–+CBS 253.71: +
CBS 124.78: ++ ++ +
Hyphal Interference
(killing) ef½cient inef½cient inef½cient inef½cient inef½cient inef½cient inef½cient
Crippled Growth yes no no no no no no
Other sector-like
phenomenon no no yes no CBS 253.71: yes
CBS 124.78: no no yes
Senescence yes yes yes yes yes yes yes
1Cladorrhinum-like anamorphs were detected for all strains except for Psjc14.
502 C. Boucher et al.
dozens of uninucleated cells of 3to5µminsome mucilage, tentatively suggesting
that they are actual conidia used for dispersal. Low level of germination of spermatia
in the range of one out of 103to 102has been described to occur on medium with
sorbose and yeast extract (Esser &Prillinger1972). Attempts to reproduce these
data with typical spermatia obtained on M2 medium or with the uninucleated cells
from the Cladorrhinum-like morph have so far failed; only about one out of
106typically germinates. Media tested for their germination included sorbose +
yeast extract, M2, potato dextrose, V8 and malt +yeast extract media.A30minutes
heat shock at 65°Cdoes not improve germination rate. The low percentage of
germination of these cells may be due to the fact that we have yet to ½nd the proper
trigger.
Additional features common to all species and features unique to some species
Strain S(Big S) of P. anserina is known to exhibit several biological
features that can easily be evaluated. We thus assayed whether these were conserved
in the other strains. Firstly,strain Sisable to form appressorium-like structures to
penetrate cellophane (Brun et al. 2009). All the strains investigated here were also
able to form these structures in afew days (Table 3). It is known that their production
is controlled by the same pathways as the ones involved in germination of the
ascospores (Lambou et al. 2008). Accordingly,all the strains had the same pattern
for ascospore germination. Their ascospores germinated with nearly 100% ef½ciency
on Gmedium and sterile dung, but failed to germinated with good ef½ciency on M2
medium (i.e.,typicalless than 1% germination was observed), unless aheat shock
(65°Cfor 30 min.) was applied in which case germination occurred for about 80%
of the ascospores. As previously described (Geydan et al. 2012; Marcou 1961), all
strains of all species underwent senescence (Table 3).
Strain Sisable to present ahyphal interference defense mechanism when
encountering other ½lamentousfungi (Silar 2005). This phenomenon is associated
with an oxidativeburst at the contact point with the contestant andmay result in
the hyphaldeath of the contestant upon contact withthe Sstrain hyphae. Both the
burstand the cell death can be assayed by colorimetric tests andare notcorrelated
(i.e.,mutant strains with the highestburst may not be the best killers (Silar 2005).
We evaluated whether theother strainsexhibited such phenomenon when
confronted with Penicillium chrysogenum,aspecies readily killed by the Sstrain
(Table 3). All P. anserina strainswere ef½cientatgeneratingaburst and good at
killing P. chrysogenum.Onthe contrary,strains from the other species were not
ef½cientatkilling,although some of themgenerated an important oxidativeburst
(Table 3).
P. anserina strain Sisknown to produce sectors of “Crippled Growth”
when cultivated on M2 medium supplemented with 5g/L of yeast extract (M2 +YE;
Haedens et al. 2005; Silar et al. 1999). Crippled Growth can readily be assayed by
inoculating explants taken from stationary phase culture onto fresh M2 +YE
medium; thalli initiated from such explantsexhibit large sectors of Crippled Growth
(Haedens et al. 2005; Silar et al. 1999). All strains of P. anserina presented this cell
degeneration when explants were taken from stationary phase (Table 3). On the
contrary,none of the strains for the six other species were able to undergo Crippled
Growth (Table 3), indicating that this cell degeneration is speci½ctoP. anserina.
However,wenoticed that strains T, CBS 411.78 and CBS 253.71 (visible for
this strain on the M2 plates of Fig. 5) also produced sectors of abnormal growth,
Species delimitation in Podospora 503
although of adifferent morphology than Crippled Growth and appearing with
different modalities since they were not induced by passage into stationary phase.
These sectors had thus agenetic or epigenetic basis that was different from that of
Crippled Growth.
CONCLUSION
Overall, the data showed that strains identi½ed as P. pauciseta/P.anserina
or P. comata belong to aspecies complex that contains at least seven bona ìde
species sharing many features. All these species are pseudo-homothallics that
produce similarly-shaped perithecia, asci and ascospores after seven days of
incubation on M2 medium or dung, and ten days on M4 and wood shavings media.
Descriptions for the morphology of these structures are available in (Lundqvist
1972) under the name P. pauciseta and in (Doveri 2004) under the name P. anserina.
They are illustrated for the seven species in Fig. 7. All strains produce on M2 a
mycelium growing at about 7mm/d and that accumulates agreen pigment at the
center of the thallus. All strains senesce after 10 to 20 cm of growth on M2.
Modalities of ascospore germination are conserved for all strains. They can however
be distinguished by the sequence of their Rchr3, Rchr4 and Rchr6 regions as well
as their ITS, some mycelium characteristics (Table 3) and their perithecium formation
patterns on various media (Fig. 5). Tw ospecies also differ from all the others by the
size of their ascospores and fruiting bodies. We thus rede½ne three species and
propose four new ones (Figs 2, 3, 4, 7and in Ta ble 1). We propose to retain
P. pauciseta for two strains known under this name in the We sterdijk Institute
Culture Collection: CBS 451.62 and CBS 333.63, as well as for CBS 237.71 that is
referenced as a P. comata in the Westerdijk Institute Culture Collection. We attribute
the name P. anserina for the strains that has been used in most studies under this
name, including strain Sused for genome sequencing. We propose to keep P. comata
for strain Tofthe G. Rizet collection, as this strain seems to be the closest to the
one described by Milovtzova, based on its ascospore and perithecium size. Moreover,
most sequences for P. comata present in Genbank, including the ITS region, were
obtained from this strain. Additionally,strain Thas been used under the name of
P. comata in afew scienti½cpublications (e.g.,(Belcour et al. 1997; Deleu et al.
1993; Koll et al. 1996). New species are P. bellae-mahoneyi (CBS 110242),
P. pseudoanserina (CBS 124.78 and CBS 253.71), P. pseudocomata (CBS 411.78)
and P. pseudopauciseta (CBS 415.72).
Podospora pauciseta/anserina is awidespread and frequent coprophilous
fungus that has been reported from all continents and climates. Like its Sordariales
relatives in the genera Neurospora (e.g.,N. crassa)and Sordaria (e.g.,S. macrospora
and S. ìmicola), it has been used for over acentury in many genetical and biochemical
studies thanks to the ease in obtaining its complete lifecycle under arti½cial
conditions. Yet, little is known about its genetic diversity.Importantly, P. comata,a
second closely related species has been described and several strains have been
deposited under this name in culture collections. Phenotypic analyses of P. comata,
P. anserina and P. pauciseta strains showed that the characters traditionally used to
differentiate these species, i.e.,ascospore and perithecium sizes as well as presence
of erect setae at the base of the neck, were often not reliable. Importantly,molecular
analyses of four regions of the genome located on three different chromosomes
504 C. Boucher et al.
showed that seven species could be recognized. Further phenotypic analyses
con½rmed the molecular data and were able to differentiate the seven species mostly
based on their growth and fertility behavior on various media differing by their
carbon sources. Finally,fertilityofinterspeci½ccrosses was very low.Key diagnostic
feature is the sequence of the ITS region, which is speci½cfor each species.
Regrettably,strains deposited under different names in the culture collection may
belong to the same species and strains deposited under the same name may belong
to different ones (Table 1).
Although specimens of the morpho-species have been described from all
continents, our results tentatively suggest that the seven bona ìde species may
present some geographical structure (Table 3, Fig. 3). Indeed, all strains of P. anserina
now rede½ned have been obtained from Western Europe with one exception from
Ontario. Another strain (CBS 455.64) likely belonging to this species (as deduced
from its ITS sequence), present in the We sterdijk Institute Culture Collection but not
analyzed here, has been isolated from Switzerland. All the strains from the other
species come from different geographic locations, except strain Twhich has also
been found in France. Unfortunately,the sample size from the six other species is
too small to draw any de½nitive conclusions. Moreover,transport of domesticated
animals by human to various regions of the world as well as natural migration may
obscure geographical structure. Only analyses of large samples should be able to
decide on the matter.However,itisnoteworthy that the different species show
different abilities to exploit various carbon sources. This may be related to the
differencesinthe ¸oras and faunas present in the different regions of the world. It
is thus possible that each species is better suited for particular dung produced in
relation to the major ¸oras and faunas present in the different parts of the world.
Acknowledgments. We thank Pr.Uwe Braun for his help with the taxonomy
section, Dr.Else Ve llinga for critically reading the manuscript and Pr.Joëlle Dupont for
useful discussions.
REFERENCES
BELCOUR L., ROSSIGNOL M., KOLL F. ,SELLEM C. H. &OLDANI C., 1997 —Plasticity of the
mitochondrial genome in Podospora.Polymorphism for 15 optional sequences: group-I,
group-II introns, intronic ORFs and an intergenic region. Current Genetics 31: 308-317.
BERNET J., 1965 —Mode d’action des gènes de “barrage”et relation entre l’incompatiblitécellulaire
et l’incompatibilitésexuelle chez Podospora anserina.Annales des Sciences Naturelles,
Botaniques Paris 6: 611-768.
BRUN S., MALAGNAC F.,BIDARD F.,LALUCQUE H. &SILAR P. ,2009 —Functions and
regulation of the Nox family in the ½lamentous fungus Podospora anserina:anew role in
cellulose degradation. Molecular Microbiology 74: 480-496.
CAI L., JEEWON R. &HYDE K. D., 2006 —Molecular systematics of Zopìella and allied genera:
evidence from multi-gene sequence analyses. Mycological Research 110: 359-368.
DEBETS A. J. M., DALSTRA H. J. P.,SLAKHORST M., KOOPMANSCHAP B., HOEKSTRA R. F.
&SAUPE S. J., 2012 —High natural prevalence of afungal prion. Proceedings of the
National Academy of Sciences U.S.A. 109: 10432-10437.
DELEU C., CLAVÉC. &BÉGUERET J., 1993 —Asingle amino acid difference is suf½cient to elicit
vegetative incompatibility in the fungus Podospora anserina.Genetics 135: 45-52.
DODGE B. O., 1936 —Spermatia and nuclear migration in Pleurage anserina.Mycologia 28: 284-291.
DOVERI F.,2004 —Fungi Fimicoli Italici.Associazione Micologia Bresadola, Trento.
ESPAGNE E., LESPINET O., MALAGNAC F. ,DASILVA C., JAILLON O., PORCEL B. M.,
COULOUX A., AURYJ.M., SEGURENS B., POULAIN J., ANTHOUARD V. ,
GROSSETETE S., KHALILI H., COPPIN E., DEQUARD-CHABLATM., PICARD M.,
Species delimitation in Podospora 505
CONTAMINE V.,ARNAISE S., BOURDAIS A., BERTEAUX-LECELLIER V. ,
GAUTHERET D., DE VRIES R. P. ,BATTA GLIA E., COUTINHO P. M., DANCHIN E. G.,
HENRISSATB., KHOURYR.E., SAINSARD-CHANET A., BOIVIN A., PINAN-
LUCARRE B., SELLEM C. H., DEBUCHY R., WINCKER P. ,WEISSENBACH J. &
SILAR P.,2008 —The genome sequence of the model ascomycete fungus Podospora
anserina.Genome Biology 9: R77.
ESSER K., 1956 —Gen-Mutaten von Podospora anserina (Ces.) Rehm mit männlicher Ve rhalten.
Naturwissenschaften 43: 284.
ESSER K. &PRILLINGER H., 1972 —Anew technique to use spermatia for the production of mutants
in Podospora.Mutation Research 16: 417-419.
GEYDAN T. D., DEBETS A. J., VERKLEY G. J. &VAN DIEPENINGEN A. D., 2012 —Correlated
evolution of senescence and ephemeral substrate use in the Sordariomycetes.Molecular
Ecology 21: 2816-2828.
GRIFFITHS D., 1901 —North american Sordariaceae., pp. 59-61, 127 –Pl. 125, Figs 124-126 in
Memoirs of the Torrey Botanical Club.
GROGNET P.,BIDARD F. ,KUCHLYC., TONG L. C., COPPIN E., BENKHALI J. A., COULOUX A.,
WINCKER P.,DEBUCHY R. &SILAR P. ,2014 —Maintaining TwoMating Ty pes:
Structure of the Mating Ty pe Locus and Its Role in Heterokaryosis in Podospora anserina.
Genetics 197: 421-432.
HAEDENS V. ,MALAGNAC F. &SILAR P. ,2005 —Genetic control of an epigenetic cell degeneration
syndrome in Podospora anserina.Fungal Genetics &Biology 42: 564-577.
HODGKISS I. J. &HARVEY R., 1971 —Factors affecting fruiting of Pleurage anserina in culture.
Transactions of the British Mycological Society 57: 533-536.
KOLL F.,BOULAYJ., BELCOUR L. &D’AUBENTON-CARAFAY., 1996 —Contribution of ultra-
short invasive elements to the evolution of the mitochondrial genome in the genus Podospora.
Nucleic Acids Research 24: 1734-1741.
KRUG J. C. &KHAN R. S., 1989 —New records and new species of Podospora from East Africa.
Canadian Journal of Botany 67: 1174-1182.
KRUYS A., HUHNDORF S. M. &MILLER A. N., 2015 —Coprophilous contributions to the phylogeny
of Lasiosphaeriaceae and allied taxa within Sordariales (Ascomycota,Fungi). Fungal
Diversity 70: 101-113.
LAMBOU K., MALAGNACF., BARBISAN C., THARREAU D., LEBRUN M. H. &SILAR P. ,2008
—The crucial role during ascospore germination of the Pls1 tetraspanin in Podospora
anserina provides an example of the convergent evolution of morphogenetic processes in
fungal plant pathogens and saprobes. Eukaryotic Cell 7: 1809-1818.
LECELLIER G. &SILAR P. ,1994 —Rapid methods for nucleic acids extraction from Petri dish grown
mycelia. Current Genetics 25: 122-123.
LUNDQVIST N., 1972 —5. Podospora pauciseta,pp. 147-152 in Nordic Sordariaceae S. Lat. Acta
Universitatis Upsaliensis,Uppsala.
MADRID H., CANO J., GENÉJ. &GUARRO J., 2011 —Twonew species of Cladorrhinum.
Mycologia 103: 795-805.
MARCOU D., 1961 —Notion de longévitéet nature cytoplasmique du déterminant de la sénescence
chez quelques champignons. Annales des Sciences Naturelles, Botaniques Paris Sér.12, 2:
653-764.
MATASYOH J. C., DITTRICH B., SCHUEFFLER A. &LAATSCH H., 2011 —Larvicidal activity of
metabolites from the endophytic Podospora sp. against the malaria vector Anopheles
gambiae.Parasitology Research 108: 561-566.
MILLER A. N. &HUHNDORF S. M., 2005 —Multi-gene phylogenies indicate ascomal wall
morphology is abetter predictor of phylogenetic relationships than ascospore morphology in
the Sordariales (Ascomycota,Fungi). Molecular Phylogenetics and Evolution 35: 60-75.
MILOVTZOVAM., 1937 —Data on the micro¸ora of Ukraine (in Ukrainian). Travaux de l’Institut de
Botanique, Kharkov 2: 17-22.
MIRZA J. H. &CAIN R. F.,1969 —Revision of the genus Podospora.Canadian Journal of Botany
47: 1999-2048.
MOREAU F. &MOREAU M., 1951 —Observations cytologiques sur les Ascomycètes du genre
Pleurage.Revue de Mycologie 16: 198.
MOUCHACCA J. &GAMS W.,1993 —The hyphomycete genus Cladorrhinum and its teleomorph
connections. Mycotaxon 48: 415-440.
NIESSL, 1883 —Ueber die Theilung der Gattung Sordaria.Hedwigia 22: 153-156.
RABENHORST L., 1857 —Erklärung der Ta f. XV. Hedwigia 1: 116 –pl. 115 ½g.114.
506 C. Boucher et al.
RIZET G., 1939 —De l’héréditédu caractère absence de pigment dans le mycélium d’un ascomycète
du genre Podospora.Comptes-Rendus de l’Académie des Sciences, Paris 209: 771-774.
RIZET G. &ENGELMANN C., 1949 —Contribution àl’étude génétique d’un Ascomycète tétrasporé:
Podospora anserina (Ces.) Rehm. Revue de Cytologie et Biologie Végétale 11:201-304.
SATINA S., 1916 —Studies in the development of certain species of the Sordariaceae.Bulletin de la
Société impériale des naturalistes de Moscou, nouvelle série. 30: 106-142 Pl. 101-102.
SILAR P.,2005 —Peroxide accumulation and cell death in ½lamentous fungi induced by contact with
acontestant. Mycolological Research 109: 137-149.
SILAR P.,2013 —Podospora anserina:from laboratory to biotechnology,pp. 283-309 in Genomics of
Soil –and Plant-Associated Fungi,edited by Benjamin A. Horwitz, P. K. M., Mala Mukherjee,
Christian P. Kubicek. Springer,HeidelbergNew Yo rk Dordrecht London.
SILAR P.,HAEDENS V. ,ROSSIGNOL M. &LALUCQUE H., 1999 —Propagation of anovel
cytoplasmic, infectious and deleterious determinant is controlled by translational accuracy in
Podospora anserina.Genetics 151: 87-95.
SUBRAMANIAN C. V. &LODHA B. C., 1964 —Four new coprophilous hyphomycetes. Antonie van
Leeuwenhoek 30: 317-330.
TANGTHIRASUNUN N., NAVARRO D., GARAJOVAS., CHEVRET D., CHAN HO TONG L.,
GAUTIER V. ,HYDE K. D., SILAR P. &BERRIN J. G., 2016 —Inactivation of Podospora
anserina cellobiose dehydrogenases modi½es its cellulose degradation mechanism. Applied
&Environmental Microbiology 83: e02716-02716.
TRAVERSO J. B., 1907 —Flora Italica Cryptogama Pars I: Fungi Pyrenomycetae.
WHITE T. J., LEE S. &TAY LOR J., 1990 —Ampli½cation and direct sequencing of fungal ribosomal
RNA genes for phylogenetics, pp. 315-322 in PCR Protocols: aGuide to Methods and
Applications,edited by Innis, M., D. Gelfand, J. Sninsky &T.White. Academic Press, New
York.
WINTER G., 1887 —CLXI. Podospora,pp. 169-177 in Dr.L.Rabenhorst’sKyrogamen-Flora von
Deutschland, Oesterreich und der Schweiz Zweite auåage.
WOLF F. A., 1912 —Spore formation in Podospora anserina (Rahb.) Winter.Annals of Mycology 10:
60-64.
