Study of Molecular Pathway Genes VMAT2, SLC18A2,GABA in Trust for God of origin Human

Abstract

Trust in God and worship him, a natural need and man's inner state that Adam and Eve Angel, has been retained to this day. Decades of communism in the world of religious authority, could this natural need of the human and spiritual surrender. Man is always in crisis situations where social or environmental damage, learning is more evident upon him. And in such situations the natural need of the human and esoteric activity of several genes, is written. But a gene crucial role to play in this need of God and the name of the gene VMAT2 is. And the role of this gene in the human being religious, we have evaluated. In this study of 2,00 people of whom 1,00 religious and 1,00 others were less religious were analyzed. P a g e | 2

Full text

P a g e | 1
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Study of Molecular Pathway Genes VMAT2, SLC18A2,GABA in
Trust for God of origin Human
Shahin Asadi and Mahsa Jamali
Tell;+989379923364
Email;shahin.asadi1985@gmail.com
Corresponding Author; Shahin Asadi-Molecular Genetics-IRAN-TABRIZ. Director of the Division of Medical
Genetics and Molecular Research.
Receiving date: Oct 24, 2017; Acceptance date: Nov 22, 2017; Publication date: Dec 05, 2017
Copyright: © 2017 Asadi S, et al. This is an open-access article distributed under the terms of the Creative
Commons Attribution License, which permits unrestricted use, distribution and reproduction in any medium,
provided the original author and source are credited.
Abstract
Trust in God and worship him, a natural need and man's inner state that Adam and Eve Angel, has been retained
to this day. Decades of communism in the world of religious authority, could this natural need of the human and
spiritual surrender. Man is always in crisis situations where social or environmental damage, learning is more
evident upon him. And in such situations the natural need of the human and esoteric activity of several genes, is
written. But a gene crucial role to play in this need of God and the name of the gene VMAT2 is. And the role of
this gene in the human being religious, we have evaluated. In this study of 2,00 people of whom 1,00 religious
and 1,00 others were less religious were analyzed.

P a g e | 2
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Keywoords; Trust in God,VMAT2,SLC18A2,GABA Genes,Adam & Eva,Pray God.
Introduction
Adam and Eve, according to the creation myth of the Abrahamic religions,[1][2] were the first man and woman.
They are central to the belief that humanity is in essence a single family, with everyone descended from a single
pair of original ancestors.[3] It also provides the basis for the doctrines of the fall of man and original sin that are
important beliefs in Christianity, although not held in Judaism or Islam.[4]
In the Book of Genesis of the Hebrew Bible, chapters one through five, there are two creation narratives with
two distinct perspectives. In the first, Adam and Eve are not mentioned (at least not mentioned by name).
Instead, God created humankind in God's image and instructed them to multiply and to be stewards over
everything else that God had made. In the second narrative, God fashions Adam from dust and places him in the
Garden of Eden. Adam is told that he can till the ground and eat freely of all the trees in the garden, except for a

P a g e | 3
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
tree of the knowledge of good and evil. Subsequently, Eve is created from one of Adam's ribs to be Adam's
companion. They are innocent and unembarrassed about their nakedness. However, a serpent deceives Eve into
eating fruit from the forbidden tree, and she gives some of the fruit to Adam. These acts give them additional
knowledge, but it gives them the ability to conjure negative and destructive concepts such as shame and evil.
God later curses the serpent and the ground. God prophetically tells the woman and the man what will be the
consequences of their sin of disobeying God. Then he banishes them from the Garden of Eden.
The story underwent extensive elaboration in later Abrahamic traditions, and it has been extensively analyzed
by modern biblical scholars. Interpretations and beliefs regarding Adam and Eve and the story revolving around
them vary across religions and sects; for example, the Islamic version of the story holds that Adam and Eve
were equally responsible for their sins of hubris, instead of Eve being the first one to be unfaithful. The story of
Adam and Eve is often depicted in art, and it has had an important influence in literature and poetry. The story
of the fall of Adam is often understood to be an allegory.

P a g e | 4
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
There is no physical evidence that Adam and Eve ever literally existed, and their literal existence is
incompatible with human evolutionary genetics. However, there is in some countries a large discrepancy
between the scientific consensus and popular opinion; a 2014 poll reports that 56% of Americans believe that
"Adam and Eve were real people", and 44% believe so with strong or absolute certainty.[5]
Adam and Eve in the Hebrew Bible narrative
Adam and Eve are figures from the Primeval History (Genesis 1 to 11), the Bible's mythic history of the first
years of the world's existence.[6] The History tells how God creates the world and all its beings and places the
first man and woman (Adam and Eve) in his Garden of Eden, how the first couple are expelled from God's
presence, of the first murder which follows, and God's decision to destroy the world and save only the righteous
Noah and his sons; a new humanity then descends from these sons and spreads throughout the world, but
although the new world is as sinful as the old God has resolved never again to destroy the world by flood, and
the History ends with Terah, the father of Abraham, from whom will descend God's chosen people, the
Israelites.[7]
The Hebrew Bible contains an internal chronology, in which Adam and Eve are created on the sixth day of the
first year of creation.

P a g e | 5
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Adam and Eve are the Bible's first man and first woman.[8][9] Adam's name appears first in Genesis 1 with a
collective sense, as "mankind"; subsequently in Genesis 2-3 it carries the definite article ha, equivalent to
English "the", indicating that this is "the man".[8] In these chapters God fashions "the man" (ha adam) from earth
(adamah), breathes life into his nostrils, and makes him a caretaker over creation.[8] God next creates for the
man an ezer kenegdo, a "helper corresponding to him", from his side or rib.[9] She is called issa, "woman",
because, the text says, she is formed from is, "man".[9] The man receives her with joy, and the reader is told that
from this moment a man will leave his parents to "cling" to a woman, the two becoming one flesh.[9]
Eden narrative (the Fall)
The first man and woman are in God's garden of Eden, where all creation is vegetarian and there is no violence.
They are permitted to eat of all the trees save one, the tree of the knowledge of good and evil, the woman is
tempted by a talking serpent to eat the forbidden fruit, and gives some to the man, who eats also.[9] (Contrary to
popular myth she does not beguile the man, who appears to have been present at the encounter with the
serpent).[9] God curses all three, the man to a lifetime of hard labour followed by death, the woman to the pain of
childbirth and to subordination to her husband, and the serpent to go on his belly and suffer the enmity of both

P a g e | 6
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
man and woman.[9] God then clothes the nakedness of the man and woman, who have become god-like in
knowing good and evil, then banishes them from the garden lest they eat the fruit of a second tree, the tree of
life, unmentioned up to this point, and live forever.[10]
Cain and Abel and the Generations of Adam
Genesis 4 introduces the humans in their life outside God's garden. The chapter deals with the birth of Adam's
sons Cain and Abel and the story of the first murder, followed by the birth of a third son, Seth. Genesis 5, the
Book of the Generations of Adam, lists the descendants of Adam from Seth to Noah with their ages at the birth
of their first sons (except Adam himself, for whom his age at the birth of Seth, his third son, is given) and their
ages at death (Adam lives 930 years). The chapter notes that Adam had other sons and daughters after Seth, but
does not name them. Adam has already named the woman Eve at the end of the Eden narrative, and in Genesis
4:25 and for the first time, he is called Adam as a personal name.

P a g e | 7
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
The Fall and expulsion from Eden
The Adam and Eve story continues in Genesis 3 with the "expulsion from Eden" narrative. A form analysis of
Genesis 3 reveals that this portion of the story can be characterized as a parable or "wisdom tale" in the wisdom
tradition. The poetic addresses of the chapter belong to a speculative type of wisdom that questions the
paradoxes and harsh realities of life. This characterization is determined by the narrative's format, settings, and
the plot. The form of Genesis 3 is also shaped by its vocabulary, making use of various puns and double
entendres.[11] The chapter is said to date to around 900s BCE during the reigns of King David or Solomon.[12]
The documentary hypothesis for this narrative portion can be attributed to Yahwist (J), due to the use of the
tetragrammaton.[13]

P a g e | 8
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
The expulsion from Eden narrative begins with a dialogue between the woman and a serpent,[14] identified in
Genesis 3:1 as an animal that was more crafty than any other animal made by God, although Genesis does not
identify the serpent with Satan.[15]:16 The woman is willing to talk to the serpent and respond to the creature's
cynicism by repeating God's prohibition against eating fruit from the tree of knowledge (Genesis 2:17).[16] The
woman is lured into dialogue on the serpent's terms which directly disputes God's command.[17] The serpent
assures the woman that God will not let her die if she ate the fruit, and, furthermore, that if she ate the fruit, her
"eyes would be opened" and she would "be like God, knowing good and evil" (Genesis 3:5). The woman sees
that the fruit of the tree of knowledge is a delight to the eye and that it would be desirable to acquire wisdom by
eating the fruit. The woman eats the fruit and gives some to the man (Genesis 3:6). With this the man and
woman recognize their own nakedness, and they make loincloths of fig leaves (Genesis 3:7).[18]
In the next narrative dialogue, God questions the man and the woman (Genesis 3:8–13),[14] and God initiates a
dialogue by calling out to the man with a rhetorical question designed to consider his wrongdoing. The man
explains that he hid in the garden out of fear because he realized his own nakedness (Genesis 3:10).[19] This is
followed by two more rhetorical questions designed to show awareness of a defiance of God's command. The
man then points to the woman as the real offender, and he implies that God is responsible for the tragedy

P a g e | 9
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
because the woman was given to him by God (Genesis 3:12).[20] God challenges the woman to explain herself,
whereby she shifts the blame to the serpent (Genesis 3:13).[21]
The God gene hypothesis proposes that a specific gene, called vesicular monoamine transporter 2 (VMAT2),
predisposes humans towards spiritual or mystic experiences. The idea has been postulated by geneticist Dean
Hamer, the director of the Gene Structure and Regulation Unit at the U.S. National Cancer Institute, and author
of the 2005 book The God Gene: How Faith is Hardwired into our Genes.

P a g e | 10
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
The God gene hypothesis is based on a combination of behavioral genetic, neurobiological and psychological
studies. The major arguments of the hypothesis are: (1) spirituality can be quantified by psychometric
measurements; (2) the underlying tendency to spirituality is partially heritable; (3) part of this heritability can be
attributed to the gene VMAT2;[1] (4) this gene acts by altering monoamine levels; and (5) spiritual individuals
are favored by natural selection because they are provided with an innate sense of optimism, the latter producing
positive effects at either a physical or psychological level. According to this hypothesis, the God gene (VMAT2)
is a physiological arrangement that produces the sensations associated, by some, with mystic experiences,
including the presence of God or others, or more specifically spirituality as a state of mind.

P a g e | 11
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access

P a g e | 12
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Based on research by psychologist Robert Cloninger, this tendency toward spirituality is quantified by the self-
transcendence scale, which is composed of three sub-sets: "self-forgetfulness" (as in the tendency to become
totally absorbed in some activity, such as reading); "transpersonal identification" (a feeling of connectedness to
a larger universe); and "mysticism" (an openness to believe things that remain unproven, such as ESP)(This is
an incorrect definition of mysticism). Cloninger suggests that taken together, these measurements are a
reasonable way to quantify (make measurable) how spiritual someone is feeling.
The self-transcendence measure was shown to be heritable by classical twin studies conducted by Lindon Eaves
and Nicholas Martin. Interpretors of these studies argue that specific religious beliefs (such as belief in Jesus)
have no genetic basis and are instead memes,[citation needed] cultural units transmitted by imitation (non genetic
means).
In order to identify some of the specific genes involved in self-transcendence, Hamer analyzed DNA and
personality score data from over 1000 individuals and identified one particular locus, VMAT2, with a

P a g e | 13
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
significant correlation. VMAT2 codes for a vesicular monoamine transporter that plays a key role in regulating
the levels of the brain chemicals serotonin, dopamine and norepinephrine. These monoamine transmitters are in
turn postulated to play an important role in regulating the brain activities associated with mystic beliefs.
The evolutionary advantage this might convey, or whether it could be a side effect of a separate adaptation, have
yet to be fully explored. However, Dr. Hamer has hypothesized that self-transcendence makes people more
optimistic, which makes them healthier and likely to have more children.
Although it is always difficult to determine the many interacting functions of a gene, VMAT2 appears to be
involved in the transport of monoamine neurotransmitters across the synapses of the brain. PZ Myers argues:
"It's a pump. A teeny-tiny pump responsible for packaging a neurotransmitter for export during brain activity.
Yes, it's important, and it may even be active and necessary during higher order processing, like religious
thought. But one thing it isn't is a 'god gene.'"[2]
Carl Zimmer claimed that VMAT2 can be characterized as a gene that accounts for less than one percent of the
variance of self-transcendence scores. These, Zimmer says, can signify anything from belonging to the Green
Party to believing in ESP. Zimmer also points out that the God Gene theory is based on only one unpublished,
unreplicated study.[3] However Hamer notes that the importance of the VMAT2 finding is not that it explains all
spiritual or religious feelings, but rather that it points the way toward one neurobiological pathway that may be
important.
The vesicular monoamine transporter 2 (VMAT2) also known as solute carrier family 18 member 2
(SLC18A2) is a protein that in humans is encoded by the SLC18A2 gene.[4] VMAT2 is an integral membrane
protein that transports monoamines—particularly neurotransmitters such as dopamine, norepinephrine,
serotonin, and histamine—from cellular cytosol into synaptic vesicles.[5] In nigrostriatal pathway and
mesolimbic pathway dopamine-releasing neurons, VMAT2 function is also necessary for the vesicular release
of the neurotransmitter GABA.[6]

P a g e | 14
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
One binding site is that of dihydrotetrabenazine (DTBZ) and reserpine. Lobeline binds at this site. Amphetamine
(TBZ site) and methamphetamine (reserpine site) bind at distinct sites to on VMAT2 to inhibit its function.[7]
Although the amphetamines inhibit VMAT2 presynaptically leading to diminished neurotransmitter, the primary
mechanism for the enhancement of extracellular monoamines, like dopamine, is reversal of the dopamine
transporter (DAT).[8] Other VMAT2 inhibitors such as GZ-793A inhibit the reinforcing effects of
methamphetamine, but without producing stimulant or reinforcing effects themselves.[9]
VMAT2 is essential in the presynaptic neuron's ability to facilitate the release of neurotransmitters into the
synaptic cleft. If VMAT2 function is inhibited or compromised, neurotransmitters, such as dopamine, cannot be
released via normal transport (exocytosis, action potential) into the synapse. VMAT2 function inhibition can
have many various effects on neurotransmitter function. Specifically of importance is its effect on the
neurotransmitter dopamine.
Cocaine users display a marked reduction in VMAT2 immunoreactivity. Sufferers of cocaine-induced mood
disorders displayed a significant loss of VMAT2 immunoreactivity; this might reflect damage to dopamine axon
terminals in the striatum. These neuronal changes could play a role in causing disordered mood and motivational
processes in more severely addicted users.[10]

P a g e | 15
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Materials and Methods
The study of 2,00 people of whom 1,00, and 1,00 others were pious religious people and religious people in low
grade was used. We chose the 100 religious man from among those who have always participated in the prayers
of God and always friendly and good things God had done. And 1,00 others among those who never attend
religious services once during their life and God were not friendly company, chose As well as the people never
done good work and God were friendly.
After obtaining written consent from all individuals participating in the study, blood samples were taken to 10
ml. Peripheral blood samples and the samples are mixed and combined with EDTA were frozen at a temperature
of -70c °. Then the people from peripheral blood samples, DNA was extracted by PCR. DNA extracted from
whole blood using standard methods carried out and the quality of DNA were analyzed by OD 260/280
absorption rate and in all cases the ratio is between 1 / 7-1 / 9, respectively. DNA kits Hilden Germany QiaGene
product according to the manufacturer's protocol contained in brochures product was extracted. The extracted
DNA was washed in 20 ml Tris-EDTA solution containing (20 mM Tris and 2 mM EDTA) and were kept at a
temperature of -20c °. This study was used for polymerase chain reaction PCR and primers used were designed
using information from NCBI genomic database.

P a g e | 16
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Figure 1: Schematic view of the banding pattern and formed a band in the gene VMAT2.
Gene, VMAT2, which in the long arm of chromosome 10 is located on 10q26.1 form. In exon 1 gene VMAT2
by Master Cycler, micro initially for 120 seconds at 95 ° C were heated and then 20 seconds at 95 ° C and 60
seconds at 72 ° C for 5 times, and next, the sequence 25 times in 20 seconds at 95 ° C, 20 seconds temperature
of 67 ° C and 40 seconds at a temperature of 72 degrees was heated. PCR product using 2% agarose gel
containing ethidium bromide were evaluated by trans Rpl. Analyze data using SPSS software version of
bioinformatics and population genetics to study the χ2 test was performed with 95% confidence.
The mean age of 39.3 years and the average age of the secular religious people was 41.1 years. Fearing religious
people uprooted in this study, 500 male and 500 were female and 500 male and 500 non-religious were female.
VMAT2 gene nucleotide sequence was obtained as follows:

P a g e | 17
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
>gi|349711|gb|L23205.1|HUMVMAT2 Human vesicle monoamine transporter (VMAT2) mRNA,
complete cds
ACTGCGACCCGGAGCCGCCCGGACTGACGGAGCCCACTGCGGTGCGGGCGTTGGCGCGGG
CACGGAGGAC
CCGGGCAGGCATCGCAAGCGACCCCGAGCGGAGCCCCGGAGCCATGGCCCTGAGCGAGCTG
GCGCTGGTC
CGCTGGCTGCAGGAGAGCCGCCGCTCGCGGAAGCTCATCCTGTTCATCGTGTTCCTGGCGCT
GCTGCTGG
ACAACATGCTGCTCACTGTCGTGGTCCCCATCATCCCAAGTTATCTGTACAGCATTAAGCAT
GAGAAGAA
TGCTACAGAAATCCAGACGGCCAGGCCAGTGCACACTGCCTCCATCTCAGACAGCTTCCAGA
GCATCTTC
TCCTATTATGATAACTCGACTATGGTCACCGGGAATGCTACCAGAGACCTGACACTTCATCA
GACCGCCA
CACAGCACATGGTGACCAACGCGTCCGCTGTTCCTTCCGACTGTCCCAGTGAAGACAAAGAC
CTCCTGAA
TGAAAACGTGCAAGTTGGTCTGTTGTTTGCCTCGAAAGCCACCGTCCAGCTCATCACCAACC
CTTTCATA
GGACTACTGACCAACAGAATTGGCTATCCAATTCCCATATTTGCGGGATTCTGCATCATGTTT
GTCTCAA
CAATTATGTTTGCCTTCTCCAGCAGCTATGCCTTCCTGCTGATTGCCAGGTCGCTGCAGGGC
ATCGGCTC
GTCCTGCTCCTCTGTGGCTGGGATGGGCATGCTTGCCAGTGTCTACACAGATGATGAAGAGA
GAGGCAAC
GTCATGGGAATCGCCTTGGGAGGCCTGGCCATGGGGGTCTTAGTGGGCCCCCCCTTCGGGA
GTGTGCTCT
ATGAGTTTGTGGGGAAGACGGCTCCGTTCCTGGTGCTGGCCGCCCTGGTACTCTTGGATGGA
GCTATTCA
GCTCTTTGTGCTCCAGCCGTCCCGGGTGCAGCCAGAGAGTCAGAAGGGGACACCCCTAACC
ACGCTGCTG
AAGGACCCGTACATCCTCATTGCTGCAGGCTCCATCTGCTTTGCAAACATGGGCATCGCCAT
GCTGGAGC
CAGCCCTGCCCATCTGGATGATGGAGACCATGTGTTCCCGAAAGTGGCAGCTGGGCGTTGC
CTTCTTGCC
AGCTAGTATCTCTTATCTCATTGGAACCAATATTTTTGGGATACTTGCACACAAAATGGGGAG
GTGGCTT
TGTGCTCTTCTGGGAATGATAATTGTTGGAGTCAGCATTTTATGTATTCCATTTGCAAAAAAC
ATTTATG

P a g e | 18
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
GACTCATAGCTCCGAACTTTGGAGTTGGTTTTGCAATTGGAATGGTGGATTCGTCAATGATG
CCTATCAT
GGGCTACCTCGTAGACCTGCGGCACGTGTCCGTCTATGGGAGTGTGTACGCCATTGCGGAT
GTGGCATTT
TGTATGGGGTATGCTATAGGTCCTTCTGCTGGTGGTGCTATTGCAAAGGCAATTGGATTTCC
ATGGCTCA
TGACAATTATTGGGATAATTGATATTCTTTTTGCCCCTCTCTGCTTTTTTCTTCGAAGTCCAC
CTGCCAA
AGAAGAAAAAATGGCTATTCTCATGGATCACAACTGCCCTATTAAAACAAAAATGTACACTC
AGAATAAT
ATCCAGTCATATCCGATAGGTGAAGATGAAGAATCTGAAAGTGACTGAGATGAGATCCTCAA
AAATCATC
AAAGTGTTTAATTGTATAAAACAGTGTTTCCAGTGACACAACTCATCCAGAACTGTCTTAGTC
ATACCAT
CCATCCCTGGTGAAAGAGTAAAACCAAAGGTTATTATTTCCTTTCCATGG

P a g e | 19
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Figure 2: Schematic view of the band pattern on agarose gels for VMAT2 gene in DNA and mRNA
molecules and tubulin.
Results
We evaluate the VMAT2 gene expression in people who were religious were compared to non-religious people,
we have analyzed. pray. But the people who were non-religious or less religious, activity and expression of the
gene that makes them less than the fate of God, have less faith And only in cases where their lives are in crisis
and also pray to God, much less participate in religious rituals such as reciting prayers. Of those who VMAT2
gene was expressed in them, 243 people were more religious and believe in God because this gene was
expressed more in the people than others. But the number of those who are less VMAT2 gene was expressed,

P a g e | 20
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
243 people had the highest expression of this gene In fact, the 243 to 757 people were more religious and more
of those people who believe in God and attend religious services, Yet even they do not participate in religious
ceremonies and they were upset by this behavior.
Figure 3: Figure 2: Schematic view of the mechanism of action of VMAT2 gene along with its variance in
DMSO.

P a g e | 21
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Figure 4: Microscopic view of his genes VMAT2 men participating in the study of the nervous tissue.

P a g e | 22
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access

P a g e | 23
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Figure 5: Schematic view of gene expression and activity diagrams frequency VMAT2 religious and
nonreligious people.

P a g e | 24
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Figure 6: Overview of the field phase contrast microscopy VMAT2 gene.

P a g e | 25
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Figure 7: Microscopic view of genes TH,AADC,VMAT2,D2R,DAT,CCK,NTR-1,Alpha Synuclein.

P a g e | 26
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Figure 8: Schematic view of the banding patterns and single-band Genes VMAT2 and NET.

P a g e | 27
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Figure 9: Schematic view of banding patterns and gang genes VMAT2 and VGLUT2.

P a g e | 28
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Discussions
Using the nucleotide sequence and VMAT2 gene expression among the 2,00 participants of the study, It found
that the more genes to be expressed, as well as the talented people being religious And belief in God and the
hereafter will be even more. But the important thing about this is that, living environment and ecosystem of life
and lifestyle affect the expression of this gene. In other words, with the performance and activity of the gene
VMAT2, being religious in human beings is remarkable, But the lifestyle and living ecosystem can also increase
or decrease the speed performance of these genes play an important role. It is noteworthy that the DNA
molecule also has memory and can be due to environmental conditions And lifestyle in certain time periods, the
expression or activity, and this was very evident in this study. Because most religious people in the study were
religious families and their parents also participated in religious ceremonies ever.

P a g e | 29
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
However, even though this religious family they participated in religious ceremonies, But some of them have
children who do not attend religious ceremonies were never in the same memory or memory is in the DNA
molecule. Belief in God and worship him, a natural need and man's inner state that Adam and Eve Angel, has
been retained to this day. Even decades of Communist Party rule in the world, could this natural need of the
human and spiritual surrender. Most people do when they are experiencing social unrest, environmental damage,
remember God is more obvious for him. And in such situations the natural need of the human and esoteric
activity of several genes, is written. But a gene crucial role to play in this need of God and the name of the gene
VMAT2 is. We worship God in this study was to evaluate the activity of the genes or gene known as VMAT2
God we analyzed Through the measurement of gene expression and activity of man's belief in God and religious
leanings understand them. And the role of this gene in the human being religious, we have evaluated. In this
study of 2,00 people of whom 1,00 religious and 1,00 others were less religious were analyzed.

P a g e | 30
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
Acknowledgments
Thanks to everyone who helped us in this study are very grateful. Certain professors of all universities of
medical sciences and psychology Thank country.

P a g e | 31
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
References
1. Womack, Mari (2005). Symbols and meaning : a concise introduction. Walnut Creek ... [et al.]: Altamira
Press. p. 81. ISBN 0759103224. Retrieved 16 August 2013. Creation myths are symbolic stories describing how
the universe and its inhabitants came to be. Creation myths develop through oral traditions and therefore
typically have multiple versions.
2. Levenson, Jon D. (2004). "Genesis: introduction and annotations". In Berlin, Adele; Brettler, Marc Zvi. The
Jewish Study Bible. Oxford University Press. ISBN 9780195297515.
3. Graves, Robert; Patai, Raphael (1986). Hebrew Myths: The Book of Genesis. Random House. p. 315.

P a g e | 32
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
4. Schwartz, Howard; Loebel-Fried, Caren; Ginsburg, Elliot K. (2007). Tree of Souls: The Mythology of
Judaism. Oxford University Press. p. 704.
5. George, Arthur; George, Elena (2014). The Mythology of Eden. Hamilton Books. p. 458.
6. Azyumardi. Azra. "TRIALOGUE OF ABRAHAMIC FAITHS; Towards the Alliance of Civilizations". Paper
presented at Conference. "Children of Abraham: Trialogue of Civilizations" Weatherhead Center for
International Affairs & Divinity School, Harvard University, Cambridge, Mass., 22–23 October 2007.
7. Judaism’s Rejection Of Original Sin – Kolatch, Alfred J. The Jewish Book of Why/The Second Jewish Book
of Why. NY: Jonathan David Publishers, 1989.
8. Westermann, Claus. Creation. Fortress Press; First English Edition (1974) ISBN 978-0800610722, p.6.
9. De La Torre, Miguel (2007). A Lily Among the Thorns: Imagining a New Christian Sexuality. John Wiley &
Sons. p. 19. ISBN 9780787997977.
10. Morris Eaves, Robert N. Essick, and Joseph Viscomi (ed.). "God Judging Adam, object 1 (Butlin 294) "God
Judging Adam"". William Blake Archive. Retrieved October 27, 2013.
11. Freedman, Meyers, Patrick (1983). Carol L. Meyers, Michael Patrick O'Connor, David Noel Freedman, ed.
The Word of the Lord Shall Go Forth: Essays in Honor of David Noel Freedman. Eisenbrauns. pp. 343–344.
ISBN 9780931464195.
12. Schearing, ed. by Kristen E. Kvam; Linda S.; Ziegler, Valarie H. (1999). Kristen E. Kvam, Linda S.
Schearing, Valarie H. Ziegler, ed. Eve and Adam : Jewish, Christian, and Muslim readings on Genesis and
gender. Bloomington: Indiana University Press. p. 16. ISBN 9780253212719.
13. Reed, A. Y. (September 20, 2004). "Source Criticism, the Documentary Hypothesis, and Genesis 1–3"
(PDF). RS 2DD3 – Five Books of Moses.
14. Weinstein, Brian (2010). 54 Torah Talks: From Layperson to Layperson. iUniverse. p. 4.
ISBN 9781440192555.
15. The Empowerment of Women in the Book of Jubilees – Page 17, Betsy Halpern Amaru – 1999.
16. First translated by August Dillmann (Das christl. Adambuch des Morgenlandes, 1853), and the Ethiopic
book first edited by Trump (Abh. d. Münch. Akad. xv., 1870–1881).

P a g e | 33
Journal of Phylogenetics &
Evolutionary Biology
Asadi et al., J Phylogenetics Evol Biol 2017, 5:3
DOI: 10.4172/2329-9002.1000195
ORIGINAL Research Article
OMICS International
Open Access
17. Die Schatzhöhle translated by Carl Bezold from three Syriac MSS (1883), edited in Syriac (1888).
18. Title = Revelation and Authority: Sinai in Jewish Scripture and Tradition Author = Benjamin D. Sommer
Pub = The Anchor Yale Bible Reference Library Date = June 30, 2015 pg = 20.
19. Howard Schwartz Professor of English University of Missouri (September 2004). "173".
20. Fox, Robin Lane (2006) [1991]. The Unauthorized Version: Truth and Fiction in the Bible. Penguin Books
Limited. pp. 15–27. ISBN 9780141925752.
21. Robinson, B.A. "Salvation: Teachings by Southern Baptists and other conservative Protestant
denominations". Ontario Consultants on Religious Tolerance, 2010. Accessed 2 Feb 2013.
22. Quran 4:1:O mankind! Be dutiful to your Lord, Who created you from a single person (Adam), and from
him (Adam) He created his wife Hawwa (Eve), and from them both He created many men and women.
23. Sours, Michael (2001). The Tablet of the Holy Mariner: An Illustrated Guide to Baha'u'llah's Mystical Work
in the Sufi Tradition. Los Angeles: Kalimát Press. p. 86. ISBN 1-890688-19-3.
24. Momen, Wendy (1989). A Basic Bahá'í Dictionary. Oxford, UK: George Ronald. p. 8. ISBN 0-85398-231-7.
25. Smith, Peter (2000). "Adam". A concise encyclopedia of the Bahá'í Faith. Oxford: Oneworld Publications.
p. 23. ISBN 1-85168-184-1.
26. Dilley, Stephen C. (2013). Darwinian Evolution and Classical Liberalism: Theories in Tension. Lexington
Books. pp. 224–225. ISBN 0739181068.
27. Cruciani, F; Trombetta, B; Massaia, A; Destro-Bisol, G; Sellitto, D; Scozzari, R (June 10, 2011), "A Revised
Root for the Human Y Chromosomal Phylogenetic Tree: The Origin of Patrilineal Diversity in Africa", The
American Journal of Human Genetics 88 (6): 814–818.
28. Poznik, G. David; Henn, Brenna M.; Yee, Muh-Ching; Sliwerska, Elzbieta; Euskirchen, Ghia M.; Lin, Alice
A.; Snyder, Michael; Quintana-Murci,, Lluis; Kidd first10= Peter A., Jeffrey M.; Underhill; Bustamante, Carlos
D. (2 August 2013). "Sequencing Y Chromosomes Resolves Discrepancy in Time to Common Ancestor of
Males Versus Females". Science 341 (6145): 562–565.