Identification of regenerative roadblocks via repeat deployment of limb regeneration in axolotls

Abstract

Axolotl salamanders are powerful models for understanding how regeneration of complex body parts can be achieved, whereas mammals are severely limited in this ability. Factors that promote normal axolotl regeneration can be examined in mammals to determine if they exhibit altered activity in this context. Furthermore, factors prohibiting axolotl regeneration can offer key insight into the mechanisms present in regeneration-incompetent species. We sought to determine if we could experimentally compromise the axolotl’s ability to regenerate limbs and, if so, discover the molecular changes that might underlie their inability to regenerate. We found that repeated limb amputation severely compromised axolotls’ ability to initiate limb regeneration. Using RNA-seq, we observed that a majority of differentially expressed transcripts were hyperactivated in limbs compromised by repeated amputation, suggesting that mis-regulation of these genes antagonizes regeneration. To confirm our findings, we additionally assayed the role of amphiregulin, an EGF-like ligand, which is aberrantly upregulated in compromised animals. During normal limb regeneration, amphiregulin is expressed by the early wound epidermis, and mis-expressing this factor lead to thickened wound epithelium, delayed initiation of regeneration, and severe regenerative defects. Collectively, our results suggest that repeatedly amputated limbs may undergo a persistent wound healing response, which interferes with their ability to initiate the regenerative program. These findings have important implications for human regenerative medicine.

Full text

ARTICLE OPEN
Identification of regenerative roadblocks via repeat
deployment of limb regeneration in axolotls
Donald M. Bryant
1
, Konstantinos Sousounis
1,2
, Duygu Payzin-Dogru
1
, Sevara Bryant
1
, Aaron Gabriel W. Sandoval
1
,
Jose Martinez Fernandez
1
, Rachelle Mariano
1
, Rachel Oshiro
1
, Alan Y. Wong
1
, Nicholas D. Leigh
1
, Kimberly Johnson
1
and
Jessica L. Whited
1,2
Axolotl salamanders are powerful models for understanding how regeneration of complex body parts can be achieved, whereas
mammals are severely limited in this ability. Factors that promote normal axolotl regeneration can be examined in mammals to
determine if they exhibit altered activity in this context. Furthermore, factors prohibiting axolotl regeneration can offer key insight
into the mechanisms present in regeneration-incompetent species. We sought to determine if we could experimentally
compromise the axolotl’s ability to regenerate limbs and, if so, discover the molecular changes that might underlie their inability to
regenerate. We found that repeated limb amputation severely compromised axolotls’ability to initiate limb regeneration. Using
RNA-seq, we observed that a majority of differentially expressed transcripts were hyperactivated in limbs compromised by repeated
amputation, suggesting that mis-regulation of these genes antagonizes regeneration. To confirm our findings, we additionally
assayed the role of amphiregulin, an EGF-like ligand, which is aberrantly upregulated in compromised animals. During normal limb
regeneration, amphiregulin is expressed by the early wound epidermis, and mis-expressing this factor lead to thickened wound
epithelium, delayed initiation of regeneration, and severe regenerative defects. Collectively, our results suggest that repeatedly
amputated limbs may undergo a persistent wound healing response, which interferes with their ability to initiate the regenerative
program. These findings have important implications for human regenerative medicine.
npj Regenerative Medicine (2017) 2:30 ; doi:10.1038/s41536-017-0034-z
INTRODUCTION
Humans are capable of a limited degree of regeneration such as
liver regeneration, and there is solid evidence that humans can
regenerate amputated digit tips during childhood.
1,2
In contrast,
the axolotl is a highly regenerative organism and is capable of
faithfully replacing an entire appendage following amputation
throughout its lifetime. This regenerative process consists of
several steps and involves the interplay of many different tissues.
3
Following limb amputation, the wound is quickly sealed by a
blood clot. Within a day, a specialized sheet of epithelium referred
to as the wound epidermis encompasses the amputation plane.
Following innervation of the wound epidermis, cells within the
underlying stump tissue are cued to activate and proliferate to
form a critical structure known as the blastema. The molecular and
cellular factors driving these actions remain poorly understood.
The blastema is a pool of activated progenitor cells that eventually
gives rise to new limb tissues; progenitors are thought to largely
be fate-restricted over this process.
4
The anatomical similarities of
the axolotl limb with the human limb and well-defined landmarks
of the regenerative process make the axolotl an ideal model
organism for understanding the mechanisms of limb regeneration
and gaining insights into why mammals lack this ability.
Understanding contexts in which axolotl limb regeneration
does not proceed normally may provide insight into factors that
impact successful regeneration. A classic example of such a
context is the reliance of limb regeneration on nerves. Nearly two
centuries of research have demonstrated that destruction of the
nerves supplying the salamander limb prior to amputation
imposes a regenerative block on the limb.
5,6
When denervated
prior to amputation salamander limbs do not form blastemas, and
the amputation surface typically heals with an accompanying
deposition of fibrotic tissue.
7,8
More recently, a study showed that
depletion of macrophages prior to, or during the early stages of
regeneration, also results in regenerative failure with some
evidence of internal fibrosis, highlighting a requirement for
macrophages in limb regeneration and hinting at a possible
connection to wound healing.
9
Similar to denervation and
macrophage depletion, failure to form a proper wound epithelium
following amputation antagonizes regeneration. Insertion of an
amputated limb immediately into the coelom to prevent the
formation of a proper wound epithelium or suturing a full
thickness skin flap over the amputation site impairs limb
regeneration in newts.
10,11
Interestingly, allowing a proper wound
epidermis to form prior to the insertion of the limb into the
coelom results in markedly better regenerative outcomes.
12
Collectively, these studies underscore the functional importance
of nerves, macrophages, and wound epithelium for limb
regeneration.
The experiments described above demonstrate that manipulat-
ing specific systems can block limb regeneration. However, can
salamanders perfectly regenerate anatomical structures an unlim-
ited amount of times if no experimental manipulations are made
Received: 14 April 2017 Revised: 22 September 2017 Accepted: 26 September 2017
1
Harvard Medical School, the Harvard Stem Cell Institute, and the Department of Orthopedic Surgery, Brigham and Women’s Hospital, 60 Fenwood Rd., 7016D, Boston, MA 02115,
USA and
2
The Allen Discovery Center at Tufts University, 200 Boston Ave., Suite 4600, Medford, MA 02155, USA
Correspondence: Jessica L. Whited (jwhited@bwh.harvard.edu)
www.nature.com/npjregenmed
Published in partnership with the Australian Regenerative Medicine Institute

outside of injury? Of course, the answer to this question appears
to vary quite dramatically depending on a range of variables
including species, type of regenerative process (e.g., lens, limb,
heart, etc.), metamorphic state, age, and type of injury (e.g.,
amputation, bite injury, etc.).
13–17
Extensive regenerative capacity
is well demonstrated in studies of newt lenses, as serial removal of
the lens within Cynops pyrrhogaster resulted in regeneration of the
lens following as many as 18 removals over the course of 16
years.
14
In contrast, repeat amputation of the limbs of the newt
Notophthalmus viridescens resulted in severe defects,
18
though
some evidence of successful repeated regeneration in very young
newts exists from Spallanzani’s work.
19
In a recent study, we
challenged limb buds to repeated removal and asked if animals
could generate normal limbs much later in life than when they are
programmed to originally develop.
20
Intriguingly, this protocol
revealed a limitation to first limb development, and animals
tasked with developing the limb around 10 months of age
(compared to the normal couple of weeks), either did not grow
any limb, or they grew a morphologically-normal, miniature
limb.
20
These miniaturized limbs were permanently altered insofar
as they regenerated as miniature limbs following amputation,
demonstrating that the experiment effectively decoupled appen-
dage size from body size.
20
Beyond salamanders, the concept of
repeated regeneration has been explored in a variety of other
contexts. Zebrafish caudal fins have been demonstrated to
regenerate over nine amputation-regeneration cycles with the
same rate of blastemal growth and final fin size as controls.
21
However, structural defects within non-regenerate, stump bone
were observed,
22
and repeated amputations were later shown to
alter aspects of the proximo-distal patterning along the length of
the fin, essentially decoupling tissue growth from pattern in this
context.
23
Regenerative process in many invertebrates is more
substantial, and several organisms examined, for example hydra
24
and planaria,
25,26
show no evidence of regenerative failure even
after many insults. Although the answer to the question of
whether regeneration can be repeatedly deployed in a perfect
fashion varies between species and organ or appendage, these
studies show that pushing the limits of highly-regenerative
organisms can greatly advance our understanding of fundamental
regenerative principles.
Herein, we tested the extent of the axolotl limb regenerative
program by repeatedly amputating their forelimbs and allowing
them to complete several regenerative cycles. We found that
regenerative fidelity declined, and an increasing number of limbs
failed to regenerate beyond the amputation plane when forelimbs
were challenged with an increasing number of amputations at the
same plane. Moreover, those limbs that failed to regenerate after
repeated amputation showed signs indicative of fibrosis. RNA-seq
profiling of regeneration-incompetent limbs compared to
normally-regenerating limbs highlighted an abnormally high
expression of amphiregulin during the wound healing stage of
limb regeneration, suggesting that persistently high levels of
Amphiregulin may antagonize limb regeneration. Consistent with
this hypothesis, we found that overexpression of amphiregulin in
axolotl limbs undergoing one regenerative cycle regenerated
more slowly and exhibited significantly poorer regenerative
outcomes relative to control limbs. Overall, our study suggests
that the decline in regenerative ability of the axolotl limb after
repeated amputation can be leveraged to identify novel gene
expression patterns that are disruptive to regeneration.
RESULTS
Axolotl limbs exhibit a decline in regenerative capabilities when
repeatedly amputated at the same plane
To determine whether axolotl limbs are limited in their ability to
continually regenerate limbs, we performed proximal amputations
on both forelimbs of individually-housed, naïve axolotls (Fig. 1a)
that had never experienced bite injury through communal living
or experimental amputation. Our first amputation was performed
on axolotls ~2 months post-hatching (~3-4 cm snout-to-tail in
length), and we allowed limbs to fully regenerate (on average,
13 weeks between each amputation) before amputating limbs in
the same plane again (details on how the plane of amputation
was identified are provided in Supplementary Fig. 1a–b). We used
“digits stage”as a marker of full regeneration. As expected, all of
the limbs from this cohort of animals were able to regenerate to
the digits stage following a single amputation (Fig. 1bn=32
limbs/16 animals). However, the percentage of limbs that were
able to regenerate completely progressively decreased upon
repeated amputation to the point where only 25% of limbs
challenged with five amputations were able to regenerate digits
(Fig. 1bn= 28 limbs/14 animals for each time point).
After each round of amputation, we additionally quantified the
proportion of limbs that were not able to regenerate beyond the
plane of amputation. We found that more than half of the limbs in
our study failed to regenerate when challenged with five rounds
of amputation (Fig. 1c, d, n= 16/28 limbs). These limbs appeared
to have no visible external regeneration with no observable
blastema, and they exhibited a stump-like morphology. Taken
together, these data indicate that axolotl limbs may be finite in
their ability to undergo repeated regeneration cycles.
A shift in the amputation plane leads to less severe regenerative
decline in limbs challenged with repeated amputations
We speculated that our observed decline in regenerative capacity
could potentially be due to the regenerative process itself being
exhaustive such that numerous resources (e.g., progenitor cells)
are being continuously drawn upon following each successive
amputation that are not readily replenished. Alternatively, it is
possible that repeatedly challenging the same population of cells
within the limb could lead to the accrual of damaged tissue (e.g.,
fibrosis), which could interfere with successive rounds of
regeneration. While these two possibilities are not mutually-
exclusive, we decided to test if repeatedly amputating through
the same anatomical plane leads to evidence of internal tissue
scaring that might not happen if successive amputations occurred
at different locations. We performed a repeated amputation study
where we shifted the plane of amputation distally after each
round of regeneration (Fig. 2a). By changing the plane of
amputation distally we were able to challenge the tissues of the
axolotl limb to undergo repeated rounds of regeneration, but
each amputation involved the injury of tissue that had not been
directly cut previously. For example, the fourth serially distal
amputation would involve injuring tissue that is derived from
three rounds of amputation (i.e., three regenerative cycles), but
this newly regenerated tissue itself would be receiving an
amputation (i.e., injury) for the first time.
After five amputation rounds, limbs challenged with serially-
distal amputations exhibited notably better regenerative out-
comes than limbs that were repeatedly amputated in the same
region (Fig. 2b). Perturbations in the regenerated limbs following
serial distal amputations were not as dramatic as siblings receiving
repeat amputations at the same plane, and a significantly higher
proportion of these limbs were able to regenerate to the digits
stage after 3 or more rounds of amputation (Fig. 2c, p< 0.05, n=
32 serially amputated limbs vs. 14 limbs amputated at the same
plane, Fisher’s exact test). Moreover, limbs that regenerated to the
digits stage after serial distal amputations often exhibited better
regenerative outcomes than those limbs amputated in the same
plane (e.g., more digits; Supplementary Fig. 1c–d). Collectively,
these data indicate that problems with regenerative fidelity
following repeated challenge may be due to localized events at
the amputation plane.
Limb regeneration in axolotls
DM Bryant et al.
2
npj Regenerative Medicine (2017) 30 Published in partnership with the Australian Regenerative Medicine Institute
1234567890

Limbs that fail to regenerate following repeated amputation
exhibit signs of persistent fibrosis
In other experimental systems (e.g., denervation, macrophage
depletion, etc.), aborted limb regeneration is often accompanied
by the deposition of fibrotic tissue.
8,9
To determine whether loss
of regenerative capacity following repeated amputation in the
same plane results in fibrotic tissue deposition, we performed one
last round of amputation and performed histological analyses on
the stumps that failed to regenerate at any point during our study
and on intact control limbs (Fig. 3a–c). Within several limbs that
failed to outgrow following repeated amputation, we found the
presence of extensive scar tissue as evidenced by collagen
deposition proximal to the plane of amputation (Fig. 3b, n=12
limbs examined). We also examined the few failed regenerates
that resulted from serial distal amputations and found that they
also exhibited extensive collagen deposition (Fig. 3c, n= 4 limbs
examined). In addition to scar tissue, we also observed the
presence of epidermal tongues that extended down to the
substratum compactum in failed regenerates (Fig. 3c). To
specifically consider possible aberrant collagen deposition in
failed regenerates, we stained tissue sections with α-Collagen I
and α-Collagen IV (Supplementaty Fig. 2). We found that both of
these proteins appear dysregulated in the failed regenerates. For
example, Collagen I is normally largely localized to the dermis,
Fig. 1 Regenerative decline after repeated amputation. Both forelimbs were amputated and allowed to fully regenerate. aExperimental
overview. bSkeletal preparations of limbs following successive rounds of amputation. The limb in bottom right panel failed to regenerate
beyond the plane of amputation (dashed line). cRepresentative examples of sibling control limb (top left panel) and limb that failed to
regenerate after repeated amputation (bottom left panel). dCumulative distribution plot of loss in ability to regenerate beyond the plane of
amputation (right graph). Scale bars in bare 1 mm
Limb regeneration in axolotls
DM Bryant et al.
3
Published in partnership with the Australian Regenerative Medicine Institute npj Regenerative Medicine (2017) 30

within the stratum compactum layer; however, in the failed
regenerates, Collagen I is more diffuse in the dermis, and it is
clearly visible in internal areas of the limb (Supplementary
Fig. 2a–a’). Collagen IV is considerably more apparent in failed
regenerates than in controls, specifically in the area between the
muscle and epidermis (Supplementary Fig. 2b–b’). Taken together,
these data suggest that limbs that failed to regenerate following
repeated amputation implemented a scarring response in place of
the full regenerative program.
Transcriptional analyses of failed regenerates and identification of
amphiregulin as a candidate antagonistic factor
Motivated by our findings with repeated amputation, we asked
whether we could use the failed regenerates in our study to
uncover novel insights into mechanisms that may antagonize
natural regeneration. Starting with the failed regenerates from
animals that had already been through five amputation-
regeneration events, we performed a single (sixth) amputation
on these stumpy, failed regenerates. This sixth amputation plane
was positioned slightly proximal to the previous amputation
plane, essentially setting the amputation point within the region
of demonstrated failed regeneration. At 3 days post-amputation,
we performed RNA-sequencing analysis of the local tissue (i.e.,
wound healing stage, n= 4 failed regenerates) to identify factors
that may be involved with regenerative decline (Fig. 4a). As a
control, we also amputated and sequenced the limbs of sibling
animals (that had not been previously injured) at 3 days post-
amputation (n= 4 control limbs) (Fig. 4a). Using previously defined
methods,
27
we generated a de novo transcriptome and performed
differential expression analysis. We uncovered 912 transcripts that
Fig. 2 Regenerative decline after repeated amputation is less severe if the plane of amputation is shifted distally along the axis of the limb.
Both forelimbs were amputated for each animal and allowed to fully regenerate. aExperimental overview. bRepresentative images of axolotl
limbs after 5 rounds of amputation at the same plane (left panels) or with serially distal planes of amputation (right panels). cQuantification of
the number of limbs able to regenerate digits after each amputation round following repeated amputation in the same plane or repeated,
progressively distal amputations. Asterisk (*) indicates p<0.05 (Fisher’s Exact Test). All scale bars equal to 1 mm
Limb regeneration in axolotls
DM Bryant et al.
4
npj Regenerative Medicine (2017) 30 Published in partnership with the Australian Regenerative Medicine Institute

were differentially expressed (FDR < 0.05) between normally-
regenerating control limbs and limbs compromised by repeat
amputation that are not engaged in the normal early regeneration
response (Fig. 4b, each condition shown is the average of four
biological replicates; genes are listed in Supplementary Table 1).
Of note, we observed that far more transcripts were aberrantly
upregulated (724 transcripts) than downregulated (188 tran-
scripts) in the compromised limbs vs. the controls. We surmised
that upregulation of a given transcript may reflect an expression
pattern that is antagonistic to regeneration, while downregulation
of a given transcript might reflect failure to adequately activate
transcripts necessary to initiate regeneration (Fig. 4a). Given that
nearly 80% of the transcripts in our dataset were upregulated in
limbs that had been previously amputated five times, it is possible
that the emergence of regenerative roadblocks could be the
major driving force behind the regenerative decline of repeatedly
challenged limbs.
Among the differentially expressed genes, we found several
genes with known functional roles in regeneration in either other
systems or in axolotl. Among genes downregulated in the
repeatedly amputated limbs, we identified eyes absent homolog
2(eya2), upregulated during lens regeneration in young axolotls
28
and required for eye regeneration in planaria.
29
The genes
upregulated in repeatedly amputated limbs included several
types of collagen (col2a1,col9a1,col9a2,col9a3, and col23a1),
Dickkopf-related protein 1 (dkk1), thrombospondin 4 (thbs4), and
semaphorin-3a (sema3a). Dkk1, a Wnt-signaling inhibitor, and
thbs4 have separately been shown to antagonize axolotl limb
regeneration,
30,31
while sema3aa, has been shown to inhibit
zebrafish heart regeneration.
32
Intriguingly, we observed that both
connective tissue growth factor (ctgf) and amphiregulin (areg),
which have been both shown sufficient to cause fibrosis in
mammalian contexts, were aberrantly upregulated in the limbs
challenged by repeated amputation.
33–38
We also performed Gene Ontology (GO) analyses on our RNA-
seq data and found significant enrichment (FDR < 0.05) for GO
terms such as “complement activation”and “regulation of cellular
defense response”in the set of genes that are downregulated in
repeatedly amputated limbs (Fig. 4c, Supplementary Table 2).
Such enrichment may reflect a dampened immune response in
repeatedly amputated limbs. GO terms such as “muscle contrac-
tion”,“actomyosin structure organization”, and “muscle structure
development”were significantly enriched (FDR < 0.05) for genes
that were upregulated in our dataset (Fig. 4d, Supplementary
Table 2). It is possible that this may reflect an impaired ability of
repeatedly amputated limbs to break down muscle during limb
regeneration. Similarly, the “cellular response to caffeine”GO term
was enriched in our upregulated set of transcripts, suggesting that
related pathways could promote regenerative decline (Fig. 4d,
Supplementary Table 2). Indeed, previous studies have shown that
caffeine can interfere with wound healing, lending support to this
hypothesis.
39
Motivated by our ability to uncover known gene expression
patterns that impair regeneration using failed regenerates, we
asked whether we could use our dataset to identify a previously
unknown gene expression relationship that could limit limb
regeneration. We further sought to identify relationships that
could antagonize limb regeneration during its initial stages (i.e.,
wound healing). To this end, we chose to focus our attention on
the amphiregulin (areg) gene. We performed two separate qRT-
PCR experiments (Fig. 4e, f). We first validated that areg expression
is significantly higher at 3 dpa in limbs having undergone a sixth
amputation vs. a first amputation (2.84-fold upregulated, p< 0.05,
eight biological replicates per group, Fig. 4e). We separately
Fig. 3 Aborted limb stumps exhibit persistent collagen deposition. A Masson’s trichrome stain was performed on limbs that failed to
regenerate (“stumps”) following repeated amputation and on intact control limbs. aColumn a (leftmost) depicts an intact specimen (no
amputations). bColumn b (middle) depicts a specimen following same-plane, repeated amputation. cColumn c (right) depicts a specimen
following serial-plane, repeated amputation. Top panels show representative images of intact control aand failed regenerates from limbs
amputated in the same plane band limbs amputated serially distally c. Middle and lower horizontal panels are higher magnification views of
images in the top panels. Brackets delineate epidermis, arrowheads indicate substratum compactum (dermis), double arrowheads indicate
connection between substratum compactum and epidermis, and arrows indicate epidermal tongues. Scale bars in top rows are 500 µm, and
scale bars in middle and bottom rows are 100 µm
Limb regeneration in axolotls
DM Bryant et al.
5
Published in partnership with the Australian Regenerative Medicine Institute npj Regenerative Medicine (2017) 30

derived a cohort of size/age-matched animals and compared areg
expression at 3 dpa following one, two, or three amputation-
regeneration cycles (Fig. 4f, 4-5 biological replicates per group).
We found no significant difference in areg expression between
one and two amputation-regeneration events, but a significant
increase in areg expression between three and one events, as well
as between three and two (7.5-fold higher in third vs.first, p < 0.01,
one-way ANOVA with Bonferroni post-hoc correction; 6.5-fold in third
vs. second, p < 0.05, one-way ANOVA with Bonferroni post-hoc
correction). Notably, the upregulation in areg expression upon the
third amputation-regeneration event parallels the timeline for
when limb loss is first observed in our original experiment (in a
fraction of the population, between the second and third
amputation-regeneration events). We also took advantage of a
previously-published RNA-seq time course of axolotl limb
regeneration,
40
and we confirmed that in this independent study,
areg expression was enriched early in limb regeneration. This
expression was markedly higher than that of any other gene at
that time in this pre-existing dataset (Fig. 4g, Supplementary
Fig. 3). Together, these data show that areg expression is higher in
Limb regeneration in axolotls
DM Bryant et al.
6
npj Regenerative Medicine (2017) 30 Published in partnership with the Australian Regenerative Medicine Institute

limbs that have undergone repeated amputation and they
suggest that aberrantly high areg expression could disrupt axolotl
limb regeneration by antagonizing its progression past the earliest
stages of the regenerative program.
The expression of amphiregulin is restricted to the early wound
epithelium during axolotl limb regeneration
Amphiregulin is a member of the epidermal growth factor (EGF)
family that has been shown to play a role in a wide range of
biological processes, including liver and intestinal epithelium
regeneration, psoriasis, and liver fibrosis.
36,41–44
In mammals,
amphiregulin is expressed at low levels in the epidermis, rapidly
induced following injury to the skin, and upregulated in
pathological skin conditions such as psoriasis.
44,45
Moreover,
transgenic expression of human areg in the basal or suprabasal
epidermal regions of mice results in hyperproliferation of the
epidermis and a psoriatic-like skin condition.
46
Collectively, these
data suggest that areg plays a functional role in integumentary
homeostasis.
Analysis of areg expression by in situ hybridization revealed that
it is rapidly induced in the wound epithelium within the first few
hours of limb regeneration (Fig. 5a, b). Sections treated with
control (sense) areg in situ probe did not show any staining in the
wound epithelium (Fig. 5c). While areg expression could still be
observed at 12 h post-amputation (Fig. 5d), its expression
becomes virtually undetectable by 3 days post-amputation and
was not observed in the wound epidermis of medium bud stage
blastema (Fig. 5e, f). Notably, amphiregulin expression appeared to
be enriched in the leading edge of the wound epidermis at 3 h
post-amputation (Fig. 5a, b), suggesting that it may play a role in
wound closure following amputation. Interestingly, amphiregulin’s
rapid induction in axolotl wound epidermis is reminiscent of its
quick induction in injured mammalian skin, suggesting that it may
play a conserved role in epithelial biology. To address whether
areg expression in the epidermis is specific to wound epidermis
forming across amputated limbs or if it might be a more general
hallmark of skin wound healing, we performed skin punch
biopsies. By RNA in situ hybridization, we observed robust staining
for areg transcript in epidermis, at the edges of the healing skin
wound (Fig. 5g, h).
We also assessed amphiregulin’s expression in the stumpy limbs
of repeatedly amputated limbs (several months after regenerative
failure) and found that several stump specimens expressed areg in
the epidermis whereas areg expression appeared to be absent in
the epidermis of intact control limbs (Supplementary Fig. 4a, d).
Furthermore, we amputated limbs that failed to regenerate after
prior injury and examined areg expression at 12 h post-
amputation and 3 days post-amputation via in situ hybridization
and found that areg appeared to be expressed by similar cell
populations in amputated stump and control limbs (Supplemen-
tary Fig. 4c, f). Thus, within the limits of in situ hybridization, we
conclude that areg is not ectopically expressed by a different
population of cells following amputation of failed regenerates;
rather, its upregulation may reflect an increase in production by
epidermal cells.
Persistently high amphiregulin expression impairs axolotl limb
regeneration
Our earlier transcriptional analyses suggested that persistent
expression of areg could antagonize limb regeneration and
disrupt its ability to progress to later stages in the regenerative
cycle. To test this hypothesis, we overexpressed amphiregulin in
the intact limbs of juvenile axolotls via the electroporation of a
plasmid encoding the axolotl AREG protein driven by a
constitutive promoter (pCAG-areg); to monitor electroporation
efficiency, we co-delivered a similar plasmid encoding enhanced
GFP (pCAG-egfp) (Fig. 6a, Supplementary Fig. 5). Control limbs
were electroporated with only pCAG-egfp (Fig. 6a, Supplementary
Fig. 5). We confirmed the expression of AREG protein specifically in
limbs electroporated with pCAG-areg using antibodies against
AREG (Supplementary Fig. 5). After allowing the animals to recover
for 5 days, we amputated the limbs and monitored blastema
formation and development, as well as overall regenerative fidelity
(Fig. 6a).
We observed that overexpression of amphiregulin in axolotl
limbs delayed regeneration and progression to the blastema stage
(Fig. 6b, c”). At 8 dpa, 100% of control limbs showed clear signs of
blastema formation (n= 48 limbs). However, only 67% of areg-
overexpressing limbs (n= 31/46 limbs), a significantly smaller
fraction (p< 0.001, Fisher’s exact test), were able to form a
blastema by 8 dpa. Furthermore, we quantified blastema lengths
from 8 dpa to 23 dpa and found that areg-overexpressing limbs
had shorter blastema (>2-fold smaller at 8 dpa) at every time point
relative to controls (p< 0.001; n= 24 control animals, n=23
animals with areg-overexpressing limbs) (Fig. 6d).
In addition to delayed regeneration, several limbs that over-
expressed areg exhibited abnormal regenerative outcomes ran-
ging from complete or near-complete regenerative failure to the
loss of several major skeletal elements at the end of the
regenerative cycle (~8 weeks post-amputation) (Fig. 6e–g’). Next,
we quantified the number of regenerated limbs from each group
that exhibited normal skeletal morphology, mild skeletal defects
(e.g., digit truncation, carpal fusions, digit outgrowths, etc.), or
severe defects (e.g., complete failure to regenerate, loss of major
skeletal elements such as radius/ulna and whole digits, etc.)
(Supplementary Table 3). We found that areg overexpression led
to significantly poorer regenerative outcomes relative to controls
(Fig. 6h, p< 0.01). Thus, our data indicate that areg dysregulation
antagonizes the ability of axolotl limbs to progress past the early
stages of limb regeneration.
Fig. 4 Transcriptomic analyses suggest an antagonistic expression pattern for amphiregulin. Failed regenerates that had undergone 5
amputations and sibling control limbs that had never been injured were amputated proximally and harvested at 3 days post-amputation. a
Overview of RNA-sequencing strategy. bHeatmap showing the results of k-means clustering (k=2) of significantly differentially expressed
genes between repeatedly amputated limbs and control limbs. Several genes with known roles in regenerative processes are shown. cGene
Ontology analyses of genes that are downregulated in the repeated amputation condition. Panel on the left shows the top 10 most
significantly enriched Biological Processes. Panel on the right is a treemap of all significantly enriched Biological Processes. dGene Ontology
analyses of genes that are upregulated in the repeated amputation condition. Panel on the left shows the top 10 most significantly enriched
Biological Processes. Panel on the right is a treemap of all significantly enriched Biological Processes. “A”: forward locomotion; “B”: multicellular
organismal process; “C”: directional locomotion; “D”: developmental process. A full list of significantly enriched Biological Processes can be
found in Supplementary Table 2.eqRT-PCR showing normalized areg expression at 3 dpa in normally-regenerating control limbs (first
amputation) and in limbs compromised by repeat amputation (sixth amputation). Error bars are SEM. N=8 limbs per condition. Asterisks (**)
denotes p<0.01. fqRT-PCR showing normalized areg expression at 3 dpa in normally-regenerating control limbs (first amputation) and in
limbs amputated twice and thrice. Error bars are SEM. N=4-5 limbs per condition. Asterisks (**) denotes p<0.01; Asterisk (*) denotes p<0.05;
n.s. denotes not significant. gPlot showing the 11 genes with the highest initiation ratio (ratio of early expression to late expression).
Expression data for panel gwere obtained from [32]
Limb regeneration in axolotls
DM Bryant et al.
7
Published in partnership with the Australian Regenerative Medicine Institute npj Regenerative Medicine (2017) 30

Amphiregulin mis-expression promotes abnormal epithelial
thickening and impairs internal proliferation during limb
regeneration
After 5 days post-electroporation, we noticed that the stylopodium
of limbs that overexpressed areg were considerably larger than
their control counterparts (Supplementary Fig. 5). We quantified
the stylopodial width of electroporated limbs and found that they
were significantly thicker in limbs that overexpressed areg. This
finding held true even when normalized to their non-treated
hindlimb stylopodium (Supplementary Fig. 5). When investigated
further, histological examination of intact limbs that overexpress
amphiregulin revealed that they had significantly thicker epidermis
than control limbs (Fig. 7ap< 0.05, n= 5 limbs per condition,
Supplementary Fig. 6a, b), which is consistent with previous studies
showing that areg promotes epidermal growth in mammals.
44,46–49
Furthermore, the observed enlargement of limbs that misexpress
areg appeared to be primarily due to epidermal thickening
(Supplementary Fig. 6a–d). The internal portion of areg-misexpres-
sing limbs was not significantly thicker than their control counter-
parts while their total epithelial thickness (sum of both epithelial
layers in longitudinal section) was more than 3 times that of
control limbs (Supplementary Fig. 6c, d).
Upon amputation, limbs that misexpressed areg formed a
wound epithelium that was thicker than that of their control
counterparts at several stages of regeneration, including the
blastema stage (~8 dpa, Fig. 7a, p< 0.001). These data suggest that
formation of an abnormal wound epithelium could be one
contributing factor to the regenerative defects that we observed
in limbs that overexpress areg. We considered whether the
thickened wound epidermis in areg-overexpressing limbs might
not be molecularly similar to normal, functional wound epidermis.
To test this possibility, we stained areg-overexpressing limbs at 8
dpa with the most widely-used wound epidermis marker in
salamanders, WE3.
50
We found that wound epidermis in areg-
overexpressing limbs is still reactive to this antibody (Supplmen-
tary Fig. 7), indicating that by this measure, the nature of the
wound epidermis may be similar to normal wound epidermis
despite being thickened.
We observed that the wound epidermis of amphiregulin mis-
expressing limbs had significantly more cells than the wound
epidermis of control limbs (~1.6 fold more nuclei at 8 dpa, p<
0.01, Fig. 7b, c, f, g). These data suggested that increased
proliferation of wound epidermal cells may be a major factor in
the epidermal thickening that we observed. To test this, we
performed proliferative studies on limbs that mis-expressed areg
using the mitosis marker phospho-Histone H3 (ser10) (pH3). We
observed an increase in the percentage of pH3 + nuclei in the
wound epidermis of limbs treated with areg (Fig. 7b–d, p< 0.05),
which is consistent with our observation that these limbs have
thickened wound epidermis and more wound epidermal cells. In
Fig. 5 Amphiregulin is expressed during the wound healing stage of limb regeneration. In situ hybridization analyses of areg expression in
wild-type juvenile axolotls; a–fare regenerating limb samples; g–hare flank skin wound samples. aExpression of areg at 3 h post-amputation.
Arrowheads indicate expression of areg in the leading edge of the wound epidermis. Epi epidermis. bHigher magnification view of panel a. c
Section stained with sense control probe at 3 h post-amputation. dExpression of amphiregulin at 12 h post-amputation. Arrowheads indicate
expression of areg in the wound epidermis (we). eTissue section stained with areg anti-sense in situ probe at 72 h post-amputation. fTissue
section stained with areg anti-sense in situ probe at 14 days post-amputation (medium bud blastema). gIn situ hybridization showing areg
expression in leading edge of wound epidermis at 6 h post-biopsy. hHigher magnification view of panel g.We wound epidermis, bl blastema.
Images are representative of four biological replicates per time point. Scale bars are 100 µm
Limb regeneration in axolotls
DM Bryant et al.
8
npj Regenerative Medicine (2017) 30 Published in partnership with the Australian Regenerative Medicine Institute

contrast, we found that the non-wound epidermal tissues of areg-
treated limbs had a significantly lower percentage of pH3 + nuclei
relative to controls (Fig. 7b, c, e, p< 0.01). Interestingly, we did not
detect a significant difference in the percentage of pH3 + nuclei in
internal and epidermal tissues in intact limbs that misexpress areg
(Supplementary Fig. 6e, f), suggesting that areg misexpression
may have distinct biological effects in regenerative and homeo-
static contexts. Together, these data suggest that the formation of
an abnormal wound epidermis and diminished proliferative
capacity of non-wound epidermal tissues may contribute to the
antagonistic effects of areg mis-expression on limb regeneration.
Amphiregulin mis-expression increases mTOR signaling in the
wound epidermis
We next aimed to identify potential downstream effectors that
could be mediating the antagonistic effects of areg on limb
regeneration. Mammalian Amphiregulin is known to bind the EGF
Receptor (EGFR).
51
A recent study in axolotls has shown that
pharmacological inhibition of EGFR can lead to soft tissue
regression at the amputation site; this effect is accompanied by
a decrease in proliferative epidermal cells compared to controls.
52
Thus, some aspects of blocking EGFR in limb regeneration are
opposite of what we observe when we misexpress a putative
activating ligand. It is therefore possible that EGFR may transduce
the effect of Amphiregulin misexpression. However, many
mediator pathways operate downstream of EGFR activation to
elicit a variety of biological effects. We sought to investigate what
intracellular mediator system might transduce the Amphiregulin
signal in our experiment. Previous studies have shown that EGFR
signaling can activate the mTOR pathway, and hyperactivation of
PI3K/mTOR signaling has been shown to promote accelerated
epithelial wound healing.
53,54
Given the distinct effects of
amphiregulin on the wound epidermis in limb regeneration, we
focused our attention on the mTOR signaling pathway.
Phosphorylated ribosomal protein S6 (pS6) is a well-studied
readout of active mTOR signaling.
55
To determine whether areg
mis-expression leads to perturbed mTOR signaling during limb
regeneration, we examined the presence of pS6 in regenerating
limbs. We found that mis-expression of amphiregulin did not result
in a significant change in the percentage of non-wound epidermal
cells that had active mTOR signaling (pS6 positive at 8 dpa)
(Fig. 7f–h). In contrast, we observed a significant increase in mTOR
signaling in the wound epidermis (Fig. 7i), suggesting that mTOR
Fig. 6 Overexpression of amphiregulin disrupts limb regeneration. Axolotl limbs with no prior injuries were electroporated with either plasmid
encoding GFP (control) or plasmids encoding GFP plus AREG. aOverview of experimental strategy. b-b”) Representative images of EGFP
control limbs from 8 to 16 days post-amputation (dpa). Arrowheads denote amputation planes. c-c”) Representative images of areg mis-
expressing limbs from 8 to 16 days post-amputation (dpa). Arrowheads denote amputation planes. dQuantification of blastema lengths in b–
b”and c–c”.N=24 animals for control and N=23 animals for areg overexpression. e-g Representative images of control limbs and limbs
exhibiting severe regenerative defects or no regeneration beyond the stylopodium following areg overexpression. e’–g’) Representative
skeletal preparations of control limbs and limbs exhibiting severe regenerative defects or no regeneration beyond the stylopodium following
areg overexpression. hQuantification of defects after control egfp and areg overexpression. The two groups exhibit significantly different
morphologies (p<0.01, Fisher’s exact test). N=48 limbs for control and N=46 limbs for areg overexpression
Limb regeneration in axolotls
DM Bryant et al.
9
Published in partnership with the Australian Regenerative Medicine Institute npj Regenerative Medicine (2017) 30

signaling may mediate the downstream effects of amphiregulin
overexpression on the wound epidermis during limb regeneration.
DISCUSSION
The lack of regenerative capabilities in adult mammals under-
scores the importance of understanding how highly-regenerative
organisms such as axolotls replace lost appendages. One effective
approach to tackling this problem is by pushing regenerative
programs in organisms such as axolotls to a non-regenerative
state and identifying factors that may be related/altered in
nonregenerative species. Gaining a greater understanding of the
regenerative limitations of axolotls may provide insights critical for
uncovering regenerative limitations in mammals.
Here, we probed the limits of axolotl limb regeneration by
challenging them with repeated amputation. We observed both a
decline in regenerative fidelity as well as ability to regenerate
beyond the plane of amputation (Fig. 1). These findings suggest
Limb regeneration in axolotls
DM Bryant et al.
10
npj Regenerative Medicine (2017) 30 Published in partnership with the Australian Regenerative Medicine Institute

that there is indeed a limit to the ability of axolotl limbs to
continue to regenerate with near perfection. Furthermore, our
studies with repeated, serially distal amputations suggest that the
decline may be due in part to recurrently injuring the same tissue
instead of globally exhausting the regenerative cycle (Fig. 2). One
longstanding hypothesis in the field of regenerative biology is that
there is a “tug of war”between the scarring process and
regenerative process, and humans may possess limited capabil-
ities because the molecular programs that drive the former
process win this competition following injury.
56,57
In support of
this, we found evidence of extensive collagen deposition in limbs
that failed to regenerate after repeated amputation (Fig. 3,
Supplementary Fig. 2). It is possible that the accumulation of
fibrotic tissue could play a role in the failure of axolotl limbs to
regenerate when subjected to repeated amputation, but future
studies are needed to fully test this hypothesis. Future studies
examining the consequences of repeated amputation in the
completely adult context, starting when the animals are fully
mature (~1 year old), may provide fruitful avenues for discovering
additional limitations to the regeneration program. Another
question worth exploring is whether any possible “recharging”
effect following very lengthy periods between regeneration and
re-amputation might allow for the program to recover. This will be
an important future experiment that could reveal different
outcomes from our existing findings. Our existing findings have
proven fruitful for discovering molecular constraints on limb
regeneration. However, if axolotls can engage in perfect repeated
regeneration if they are given extended recovery times, contrast-
ing that finding with our data could be important for under-
standing limitations. The opposite experiment, examining the
consequences of shorter amputation-regeneration cycles, may
also provide important clues for understanding what cellular and/
or molecular factors may underlie success or failure. Future
experiments may also focus more pointedly on individual tissue
types—nerve, muscle, skin, et cetera—to determine how each
might be impacted with successive amputations, and how specific
tissues might contribute to regenerative outcomes.
We surmised that the failed regenerates generated in this study
could provide valuable clues about roadblocks that could arise to
limb regeneration. In line with this, our transcriptomic analyses of
failed regenerates at an early stage in regeneration uncovered
gene expression patterns that are known to disrupt regeneration
(Fig. 4). Our data also suggested that dysregulation of the EGF
family member amphiregulin could be antagonistic to limb
regeneration, as increasing the expression of this gene during
limb regeneration severely disrupted this process (Figs. 6,7).
Previous studies have implicated a role for amphiregulin in
psoriasis, an autoimmune disease characterized by hyperprolifera-
tive epidermis.
47–49,58
Our work with amphiregulin in axolotl limbs
is in line with these findings as it is sufficient to promote
epidermal thickening in intact limbs (Fig. 7a and Supplementary
Fig. 6a–d) and promotes increased cell proliferation in wound
epidermis (Fig. 7b–e). Intriguingly, while we detected a significant
decrease in proliferation of internal tissues in regenerating limbs
that misexpress areg (Fig. 7), we did not observe a decrease in
proliferation of internal tissues in the intact state (Supplementary
Figure 6a, b, e). These data suggest that amphiregulin could have
different functions in homeostasis and regeneration. Future
investigation of amphiregulin’s differential effects in homeostatic
and regenerative contexts will yield valuable insight into the role
that this factor plays in limb regeneration.
Given the linkage between amphiregulin and psoriasis, it is
tempting to speculate that dysregulation of amphiregulin expres-
sion could promote a hyperactive wounding response. Previous
research suggests that humans with psoriasis have an increased
healing rate; in particular, this study found that individuals with
psoriasis healed wounds created by skin biopsy more rapidly than
individuals with normal skin.
59
Our observations that amphiregulin
mis-expression leads to increased mTOR signaling in the wound
epidermis are also consistent with this hypothesis, as higher levels
of PI3K/mTOR signaling promote a swifter healing response in
mammals (Fig. 7f–h).
53
Our data also suggest the possibility that
the wound healing stage serves as a regenerative checkpoint
following limb amputation and that resolution of this phase may
be necessary to progress to later stages of regeneration. If this is
the case, then failure to downregulate wound healing signals
would be expected to slow or halt regeneration altogether. Thus, if
Amphiregulin serves as a wound-healing signal during limb
regeneration, then the prolonged presence of this molecule could
potentially interfere with the progression to later regenerative
stages, such as blastema formation. Although this is an exciting
possibility with important implications for mammalian regenera-
tion, further work is needed to test such a model.
Several studies involving skin suturing and intracoelomic
insertion of limbs immediately after amputation have demon-
strated that failure to form a wound epidermis is inhibitory to limb
regeneration.
10–12
Our studies with amphiregulin hint at the
possibility that driving wound epidermis in the opposite direction
(i.e., having too much wound epidermis) can also impede
regeneration. Interestingly, the thickened skin in our study is
reminiscent of previous research showing that frog limbs that fail
to regenerate are covered by a thickened layer of skin.
60
Future
studies involving the transplantation of thickened skin to naïve
limbs may shed additional insight on the possibility that thickened
wound epidermis can impede limb regeneration. Future studies
will also be important for addressing the molecular nature of
wound epidermis in repeatedly-amputated limbs and in limbs
overexpressing areg beyond the single WE3 marker we report
here. Dysregulation of critical wound epidermis molecules remains
an important possibility worth considering in either of these
contexts.
Roles for amphiregulin in both fibrosis and regeneration in
mammalian liver have been discovered. Mice with loss-of-function
mutations in areg show decreased cellular proliferation following
partial hepatectomy.
43
In samples from both cirrhotic human livers
and a rat model of liver cirrhosis, amphiregulin levels are
Fig. 7 Overexpression of amphiregulin results in abnormally thick wound epidermis, alterations in cellular proliferation, and increased mTOR
signaling in the wound epidermis during limb regeneration. Axolotl limbs with no prior injuries were electroporated with either plasmid
encoding GFP or plasmids encoding GFP and AREG. aMulti-timepoint Masson’s trichrome staining of tissue sections from egfp control or areg
overexpressing limbs. For 0 dpa, 12 hpa, 1 dpa, and 3 dpa, N=5 limbs per group per timepoint. For 8 dpa, N=5 limbs for control and N=6
limbs for areg overexpression. bRepresentative immunofluorescent staining of phospho-Histone H3 (pH3) on tissue sections from egfp control
limbs at 8 dpa. cRepresentative immunofluorescent staining of phospho-Histone H3 (pH3) on tissue sections from areg overexpressing limbs
at 8 dpa. dQuantification of the percentage of pH3-positive nuclei in the wound epidermis. Asterisk (*) indicates p<0.05. N=5 limbs for
control, and N=6 limbs for areg overexpression. eQuantification of the percentage of pH3-positive nuclei in non-wound epidermal tissues. f
Representative immunofluorescent staining of phospho-rpS6 (pS6) on tissue sections from egfp control limbs at 8 dpa. gRepresentative
immunofluorescent staining of pS6 on tissue sections from areg overexpressing limbs at 8 dpa. hQuantification of the percentage of pS6
positive cells in non-wound epidermal tissues. n.s. not significant. N=5 limbs for control, and N=6 limbs for areg overexpression. i
Quantification of the percentage of pS6 positive cells in the wound epidermis. Asterisk (*) indicates p<0.05. N=5 limbs for control, and N=6
limbs for areg overexpression. Scale bars are 100 µm
Limb regeneration in axolotls
DM Bryant et al.
11
Published in partnership with the Australian Regenerative Medicine Institute npj Regenerative Medicine (2017) 30

elevated.
43
Together, these data suggest that a balance between
the need for amphiregulin in early healing and the pathological
consequences of too much amphiregulin may exist across many
species and organs. AREG has also been shown to mediate the
fibrotic effects of TGF-β1 expression in mouse lungs.
36
In the time
frames examined to date, we have not yet observed mis-
expression of areg to be sufficient to cause hallmarks of fibrosis
in limbs; future work, perhaps aimed at extending the temporal
window of areg expression, will be required to examine this
possibility.
Recently, a report has found that newts are capable of
efficiently clearing senescent cells after multiple rounds of limb
amputation.
61
Axolotls were examined after a single amputation
and found to also successfully clear senescent cells through
macrophage engulfment.
61
While this study did not report on the
patterning outcomes following full regeneration-amputation
cycles, as we present here, it does provide a useful starting point
for considering mechanisms at play following repeated injury. For
instance, a simple model with accumulation of senescent cells
over repeated deployment is not likely to be responsible for the
severe regenerative outcomes following repeated regeneration-
amputation cycles.
Our findings presented here indicate that even the highly-
regenerative axolotl has limitations to its regenerative capabilities.
We also show that these limits can be leveraged to discover
factors that present obstacles to the regenerative process. While
providing the right regenerative stimuli may be critical for
promoting regeneration in humans, it may be just as important
to remove or reduce antagonistic signals to improve the outcomes
of regenerative therapies. The analyses and data that we provide
will serve as a valuable foundation for identifying and studying
processes that impede mammalian regeneration. Further explora-
tion of the insights and gene expression relationships that we
uncovered in this study have high potential for advancing our
understanding of the regenerative roadblocks that mammals face
after injury.
METHODS
Animal experimentation
All animal experimentation was performed in accordance with Harvard
Medical School’s Institutional Animal Care and Use Committee regulations
and approved under animal experimentation protocol #04160. Leucistic
axolotls were used for all animal experimentation and maintained as
previously described.
27
Due to the cannibalistic nature of axolotls, we
began our study by separating a cohort of axolotls prior to hatching and
placing them into individual containers. Because prior research has shown
that bite injury can lead to poor regenerative outcomes, this early
separation was crucial for avoiding confounding variables.
62
The indivi-
dualized housing also had the added benefit of allowing us to monitor the
regenerative outcomes of each animal after successive rounds of
amputation. Starting sample sizes were based on prior studies in our
laboratory with survival requiring up to 1 year. Only animals with perfectly-
formed limbs were included in the study. Animals were randomly assigned
to experimental groups. Blinding was not performed when assigning
animal groups, but blinding was performed for subsequent data analyses
when possible.
For amputations and electroporations, axolotls were first anesthetized in
0.1% tricaine. After completion of the surgical procedure, axolotls were
allowed to recover overnight in 0.5% sulfamerazine. For repeated
amputations in the same plane, both forelimbs of axolotls were amputated
at the mid-point between the girdle and mid-stylopodium (diagrammed in
Fig. 1a). Following amputation, the bone was trimmed back to allow for
efficient wound epidermis formation. Amputations were conducted in a
similar manner for both forelimbs of animals undergoing repeated, serially
distal amputations (amputation planes diagrammed in Fig. 2a). The first
amputation (both same plane and serially distal planes) were performed
on axolotls at approximately 2 months post-hatching (~3–4 cm in length).
Limbs were allowed to fully regenerate before the next round of
amputation (on average, every 13 weeks).
Microscopy
A Leica M165 FC stereomicroscope was used to capture all whole mount
images e.g., skeletal preparations). Skeletal preparations in Fig. 1b and
Fig. 6e’–g’were imaged in a 1:1 glycerol to 1% potassium hydroxide
solution. For imaging of blastema in Fig. 6b, c”, animals were anesthetized
in 0.1% tricaine and imaged ventrally. Tissue sections were imaged with a
Nikon Eclipse Ni microscope using NIS-Elements software. ImageJ
63
and
Leica Application Suite software were used to make specimen
measurements.
Library preparation and RNA-sequencing
Limbs that failed to regenerate were amputated 1 mm proximal to the
previous plane of amputation, and control limbs were amputated at the
same anatomical location (Fig. 4a). At 3 dpa, the tissue 2 mm proximal to
the amputation was harvested, and total RNA was purified from the tissue
using the TRIzol reagent (Life Technologies, #15596018). Four biological
specimens, from separate animals, were used to generate RNA and were
separately processed as biological replicates for each of the two
conditions. For each sample, 1 µg of total RNA was processed via the
Illumina TruSeq v2 protocol to generate barcoded sequencing libraries.
Paired-end, 50-bp sequencing was performed on an Illumina HiSeq
2500 sequencer at Harvard Medical School’s Biopolymers facility.
RNA-sequencing analyses
Transcriptome assembly, annotation, and differential gene expression
analyses were performed by Stirplate (http://stirplate.io/). Genes and
transcripts were assembled from the RNA-sequencing data with Trinity
64,65
and annotated with Trinotate (blastp and blastx were run against the
SwissProt datablase, and Hmmer was run against the Pfam database)
66–68
(http://hmmer.org/). RSEM software
69
was used to quantify raw counts of
RNA-Seq fragments mapping to transcripts for each sample, and an FPKM
(Fragments Per Kilobase of transcript per Million mapped reads) threshold
of two was applied to the initial assembly in order to generate the final
transcriptome. The counts produced by RSEM were analyzed with edgeR
70
to identify differentially expressed transcripts. A false discovery rate
threshold of 0.05 was used to determine significance.
A pseudocount of “1”was applied to all TMM-normalized FPKMs of
significantly differentially expressed transcripts. Transcripts were then log-
transformed and median centered in Cluster 3.0.
71
Cluster 3.0 was then
used to perform k-means clustering on both genes (i.e., transcripts, k=2)
and arrays (i.e., samples, k= 2), using 1000 iterations and the Spearman
Rank Correlation similarity metric for both. Clustering results were
visualized using Java Treeview.
72
The significantly upregulated and downregulated gene lists were tested
for enrichment in relevant GO categories using BiNGO.
73
Custom GO
annotation reference libraries for “Biological Process”,“Cellular Compo-
nent”, and “Molecular Function”were built using the GO terms provided by
Trinotate. Enrichment in each reference ontology library was tested via a
corrected hypergeometric test (Benjamini & Hochberg FDR correction) at
the p= 0.05 level. Significantly enriched “Biological Process”GO terms were
visualized using REViGO,
74
with obsolete GO terms being removed prior to
visualization.
For the analyses in Fig. 4g, data were obtained from a previously
published transcriptomic study on axolotl limb regeneration (https://
axolomics.org/sites/default/files/Stewart_Gene_Expression_Across_Time-
courseTPMs_0.txt).
40
A pseudocount of “1”was added to all TPMs
(Transcripts per Kilobase Million) for each time point for all genes.
Transformed TPMs from 3 h post-amputation to 3 days post-amputation
were then averaged and then divided by average gene expression across
all other time points (i.e., 0 dpa and 5–28 dpa) to generate a ratio of each
gene’s early expression values to all other time points.
Histology and immunohistochemistry
Tissues were fixed in 4% paraformaldehyde, taken through a series of
sucrose solutions for cryopreservation (beginning with 5% sucrose in PBS
and ending with 30% sucrose in PBS), and embedded in optimal cutting
temperature compound (O.C.T). Samples were sectioned at a thickness of
16 µm and stored at −80 °C. For Masson’s Trichrome staining, samples were
brought to room temperature, rehydrated in PBS, and then fixed for 10 min
in 4% paraformaldehyde prepared in PBS. Following fixation, slides were
rinsed in PBS and distilled water and then stained with Polysciences, Inc’s
Masson’s Trichrome Stain kit (#25088-1).
Limb regeneration in axolotls
DM Bryant et al.
12
npj Regenerative Medicine (2017) 30 Published in partnership with the Australian Regenerative Medicine Institute

For immunohistochemistry, slides were brought to room temperature,
rehydrated in PBS, and then incubated with blocking solution (1X PBS with
0.1% Triton X-100 and 2% Bovine Serum Albumin) for 1 h at room
temperature. Slides were incubated with rabbit anti-phospho Histone H3
(Ser10) (1:400, Millipore #06-570) overnight at 4 °C. Samples were washed
and then incubated with Cy3-conjugated goat anti-rabbit IgG (H + L)
(1:100, Jackson Immunoresearch # 111-165-003) for 1 h at room
temperature. DAPI (1.4 µmol/L) in PBS was applied to slides for 10 min,
and slides were mounted with Hydromount (National Diagnostics #HS-
106). For detecting Collagen I, we used SC-59772 (Santa Cruz Biotech),
1:100. For detecting Collagen IV, we used ab6586 (Abcam), 1:100. For
detecting AREG expression in fixed tissue following plasmid mis-
expression, we used MAB262 (R&D Systems), 1:100. For wound epidemis,
we used WE3 (DSHB), 1:10.
For areg overexpression studies, harvested tissues were sectioned
through completely (Fig. 7a, cryosections, 16 μm). Sections from the
middle of the specimens, as indicated by presence of bone, were used for
further analyses (i.e., epidermal and wound epidermal thickening studies,
proliferative studies, etc).
For mTOR signaling analyses, sections from regenerating limbs at 8 dpa
(medium-bud-stage blastemas) were fixed with 4% paraformaldehyde for
20 min. Following post-fix, sections were rinsed with PBS and permeabi-
lized with 0.5% Triton-X100 for 20 min. Following permeabilization,
sections were rinsed in PBS and boiled in 0.1 M sodium citrate prior to
blocking (2% BSA for 30 min at room temperature). Sections were
incubated with rabbit anti-phospho-ribosomal protein S6 (Ser235/236,
1:200; Cell Signaling) followed by incubation with Cy3-conjugated
secondary antibodies. Sections were then stained with DAPI (Roche) for
5 min before mounting. The percentage of cells exhibiting positive
pS6 staining (defined as nuclei encompassed by pS6 staining in Fig. 7f–i)
wound epidermis and internal tissues was quantified by a blinded
observer.
qRT-PCR
Tissue was extracted at 3 dpa and placed in TRIzol Reagent where it was
homogenized using sterile pestles. RNA was extracted following the
recommended TRIzol protocol or a combined TRIzol/RNeasy MinElute
cleanup (Qiagen). One microgram RNA was used as input to generate
cDNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher
Scientific). cDNA was diluted 1:20. qPCR was performed using iTaq
Universal SYBR Green Supermix (Bio-Rad) in 20 μl total volume with 1 μl
cDNA input following the recommended protocol in a CFX384 C1000
Touch Real-Time machine (Bio-Rad). qPCR settings for ef1α: 95 °C 30 s, and
40 cycles of 95 °C 10 s, 60 °C 40 s. qPCR settings for areg: 95 °C 30 s, and 40
cycles of 95 °C 10 s, 55.4 °C 10 s, 72 °C 20 s. Specificity was accessed using a
melt curve analysis. Samples were run in technical triplicates; each group
had 4–8 biological replicates. Expression was calculated by comparing C
t
values to a standard curve. Technical replicates were averaged and areg
expression per biological sample was corrected based on ef1αexpression.
One sample was excluded based on the Grubbs outlier test. Significance
was determined by a homoscedastic two-tail t-test (Fig. 4e) and a one-way
Analysis of Variance with Bonferroni’s multiple comparison post-hoc test
(Fig. 4f) performed by GraphPad Prism 7 software. P-value less than 0.05
was considered significant. Primers used:
areg F: 5′–CTCCTCTTCCTCCGTCTTGC–3′
areg R: 5′–GCTGTGGTTTGCTGGGCTAG–3′
ef1αF: 5′–AACATCGTGGTCATCGGCCAT–3′
ef1αR: 5′–GGAGGTGCCAGTGATCATGTT–3′
In situ hybridization
Sequences were amplified from cDNA and cloned into pGEM-T-easy vector
and sequenced. The specific primers used for amphiregulin were
5′–GAAGGTGACAGTTTAAGATCG–3′and 5′–CCACTTCAAAAATATAAGTG
CTTGC–3′. Depending upon orientation in pGEM, T7 or Sp6 polymerase
was used to perform in-vitro transcription of the probe. In situ
hybridization was performed as previously described
75
on stylopodial
tissue sections collected from juvenile axolotls (approximately 9.5–11.5 c.
m. in length) at the time points indicated in Fig. 5a–f. For the analyses in
Fig. 5g, h, in situ hybridization was performed on sections of tissue
harvested at 6 h following a 4 mm biopsy punch into the flank skin of
axolotls. In situ hybridization was performed on tissue sections from adult
axolotls at the time points indicated in Supplementary Fig. 4.
Vector design and delivery
The amphiregulin ORF was amplified from cDNA using primers
5′–GGAGAATTCACCGGTGCCACCATGGCTTCTGCCCACTACTCC–3′and 5′–GCC
TGCGGCCGCTCACGCATAAACGTCTCC–3′(underlined nucleotides bind
areg’s open reading frame) and cloned into pCAG with EcoRI and NotI to
create pCAG-areg. The CAG-GFP plasmid was a kind gift from Connie
Cepko (Addgene plasmid #11150).
76
For the areg-overexpression vector
solution, both pCAG-areg and pCAG-egfp were diluted to a final
concentration of 200 ng/µL in sterile PBS prior to injection (Fast Green
dye was added to aid with visualization). The control vector solution
consisted of pCAG-egfp (200 ng/µL) in sterile PBS (with Fast Green dye
added for visualization). Approximately 1.5–2.0 µL of vector solution was
injected into each forelimb of juvenile axolotls (4–6 cm in length). Both
forelimbs of each axolotl were injected with either control vector solution
or areg-overexpression solution. Animals were then submerged in 1x PBS,
and limbs were electroporated using a NepaGene Super Electroporator
NEPA21 Type II electroporator. The poring pulse of our electroporation
consisted of 3 pulses at 150 Volts (5 ms pulse length per pulse), a 10 ms
pulse interval, a 0% decay rate, and had a positive ( + ) polarity. Our
transfer pulse consisted of 5 pulses at 50 Volts (50 ms pulse length per
pulse), a 950 ms pulse interval, a 0% decay rate, and had a positive ( + )
polarity. The distance between electrodes was 3 mm for all electropora-
tions. After 5 days of recovery, both forelimbs were amputated at the
distal-most region of the stylopodium (just proximal to the elbow) as
described above.
Measuring blastemal length and epidermal/wound epidermal
thickness
Animals were anesthetized in 0.1% tricaine and imaged with the ventral
aspect of the body upwards. All photos were acquired at the same
magnification. Images were quantified using Leica application suite
software or ImageJ. Blastemas were measured from the center of the
plane of amputation to their distal-most tip. To quantify wound epidermal
thickness (Fig. 7a), we measured the width of the central-most part of a
section’s wound epidermis using ImageJ. To facilitate comparisons
between epidermal thickness in intact limbs (appears as two regions in
longitudinal sections) to wound epidermal thickness (one region), we first
averaged (mean) the two epidermal layers of longitudinal sections of intact
limbs. In the context of limb thickening (Supplementary Fig. 6a–d), we
calculated the sum of the two epidermal layers that appear in longitudinal
section as both of these layers contribute to the overall width of the limb
quantified in Supplementary Fig. 5.
Skeletal preparations
Alcian blue/alizarin red staining was performed as described previously.
77
Statistical analyses
All data are presented as either mean ± sem (Fig. 6, Supplementary Fig. 4,
Supplementary Fig. 6) or mean ± standard deviation (Fig. 7). A Fisher’s
exact test was used to assess the statistical significance of categorical
outcomes between two experiments. For the morphological phenotypic
analysis of limbs mis-expressing areg (Fig. 6), Fisher’s exact test was
performed on a 2 × 5 contingency table. All other analyses involving
Fisher’s exact test were performed on 2 × 2 contingency tables. For Fig. 6d,
the blastema lengths of the left and right forelimbs were averaged
(statistical mean) for each animal at each time point. A two-way, repeated
measures ANOVA was performed on the time course blastema data in
Fig. 6d, followed by post-hoc pairwise t-tests with a Holm correction to
adjust for multiple hypothesis testing (used for all pairwise comparisons in
Fig. 6d). A two-way ANOVA was performed on the time course epidermal/
wound epidermal thickness data in Fig. 7, followed by post-hoc pairwise t-
tests with a Holm correction to adjust for multiple hypothesis testing. A
two-tailed homoscedastic Student’st-test was used to determine whether
differences in the percentage of phospho-Histone H3 (ser10) positive
nuclei in Fig. 7d, e, percentage of phospho-rpS6 cells in Fig. 7h, i,
stylopodium thickness measurements in Supplementary Fig. 5, and
measurements in Supplementary Fig. 6c–f were statistically significant.
Statistical analyses involving Fisher’s Exact tests, two-way ANOVAs
(including repeated measures), and post-hoc pairwise t-tests were
performed using R; Student’st-tests were performed using Microsoft Excel
and Graphpad Prism 7.03. A p-value less than 0.05 was considered to be
statistically significant.
Limb regeneration in axolotls
DM Bryant et al.
13
Published in partnership with the Australian Regenerative Medicine Institute npj Regenerative Medicine (2017) 30

Data availability
All expression analysis data has been deposited at GEO, under the
identifier GSE103087, for release on September 30, 2017.
ACKNOWLEDGEMENTS
This work was supported by the NIH/NICHD (1DP2HD087953, J.L.W.; 1R03HD083434,
J.L.W.), NIH/NIAMS (1R03AR068126, J.L.W.), Brigham and Women’s Hospital (J.L.W.),
and the Paul G. Allen Family Foundation (J.L.W.). The content is solely the
responsibility of the authors and does not necessarily represent the official views
of the National Institutes of Health. Research fellows were supported by the Howard
Hughes Medical Institute Gilliam Fellowship (D.M.B.), the National Science Foundation
Graduate Research Fellowship (R.M.) under Grant No. DGE1144152, the American
Academy of Neurology Medical Student Summer Research Scholarship (S.B.), the
Harvard Stem Cell Institute (J.M.F.), the Brigham Research Institute (A.G.S.), the
Harvard College Program for Research in Science and Engineering (R.O.), and the
Harvard College Research Program (A.Y.W.). We thank the Ambystoma Genetic Stock
Center for breeding adults used to generate progeny for these studies and the
Developmental Studies Hybridoma Bank for the WE3 antibody. We thank Mike Levin
and Cliff Tabin for insightful discussion. We thank Rebecca Soto for aid with data
analysis. We thank William Ye, Rui Qun Miao, Adam Gramy, Anna Guzikowski, Athylia
Paremski, Janine Kopeski, Colleen Carmody, Samantha Furgason, and Soyisha Sylvain
for animal care and Harvard Biopolymers for sequencing.
AUTHOR CONTRIBUTIONS
J.L.W. and D.M.B. conceived of the project; D.M.B., S.B., K.S., D. P.-D, and J.L.W.
designed the experiments; D.M.B. and J.L.W. wrote the paper; D.M.B. and R.M.
performed computational analyses; D.M.B., S.B., J.M.F., A.G.W.S., D.P.-D., K.S., R. O., A.
W., N.L., and K.J. performed sample preparation, experiments, and experimental data
analyses. All authors contributed to manuscript editing.
ADDITIONAL INFORMATION
Supplementary information accompanies the paper on the npj Regenerative
Medicine website (https://doi.org/10.1038/s41536-017-0034-z).
Competing interests: The authors declare no competing financial interests.
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims
in published maps and institutional affiliations.
REFERENCES
1. Michalopoulos, G. K. Liver regeneration. J. Cell. Physiol. 213, 286–300 (2007).
2. Illingworth, C. M. Trapped fingers and amputated finger tips in children. J. Pediatr.
Surg. 9, 853–858 (1974).
3. Tanaka, E. M. The molecular and cellular choreography of appendage regen-
eration. Cell 165, 1598–1608 (2016).
4. Kragl, M. et al. Cells keep a memory of their tissue origin during axolotl limb
regeneration. Nature 460,60–65 (2009).
5. Todd, J. T. On the process of reproduction of the members of the aquatic sala-
mander. Quart. J. Sci. Literature Arts 16,84–96 (1823).
6. Kumar, A. & Brockes, J. P. Nerve dependence in tissue, organ, and appendage
regeneration. Trends Neurosci. 35, 691–699 (2012).
7. Liversage, R. A. & McLaughlin, D. S. Effects of delayed amputation on denervated
forelimbs of adult newt. J. Embryol. Exp. Morphol. 75,1–10 (1983).
8. Salley, J. D. & Tassava, R. A. Responses of denervated adult newt limb stumps to
reinnervation and reinjury. J. Exp. Zool. 215, 183–189 (1981).
9. Godwin, J. W., Pinto, A. R. & Rosenthal, N. A. Macrophages are required for
adult salamander limb regeneration. Proc. Natl Acad. Sci. USA 110, 9415–9420
(2013).
10. Goss, R. J. Regenerative inhibition following limb amputation and immediate
insertion into the body cavity. Anat. Rec. 126,15–27 (1956).
11. Mescher, A. L. Effects on adult newt limb regeneration of partial and complete
skin flaps over the amputation surface. J. Exp. Zool. 195, 117–128 (1976).
12. Goss, R. J. The regenerative responses of amputated limbs to delayed insertion
into the body cavity. Anat. Rec. 126, 283–297 (1956).
13. Suetsugu-Maki, R. et al. Lens regeneration in axolotl: new evidence of develop-
mental plasticity. BMC Biol. 10, 103 (2012).
14. Eguchi, G. et al. Regenerative capacity in newts is not altered by repeated
regeneration and ageing. Nat. Commun.2, 384 (2011).
15. Monaghan, J. R. et al. Experimentally induced metamorphosis in axolotls reduces
regenerative rate and fidelity. Regeneration 1,2–14 (2014).
16. Yun, M. H. Changes in regenerative capacity through lifespan. Int. J. Mol. Sci. 16,
25392–25432, (2015).
17. Uygur, A. & Lee, R. T. Mechanisms of cardiac regeneration. Dev. Cell. 36, 362–374
(2016).
18. Dearlove, G. E. & Dresden, M. H. Regenerative abnormalities in Notophthalmus
viridescens induced by repeated amputations. J. Exp. Zool. 196, 251–262 (1976).
19. Spallanzani, L. in An Essay on Animal Reproductions [Prodromo di un opera da
imprimersi sopra la riproduzioni anamali] 68–72 (Becket and de Hondt, London,
1769 [Italian: 1768]).
20. Bryant, D. M. et al. Repeated removal of developing limb buds permanently
reduces appendage size in the highly-regenerative axolotl. Dev. Biol. 424,1–9
(2017).
21. Azevedo, A. S., Grotek, B., Jacinto, A., Weidinger, G. & Saude, L. The regenerative
capacity of the zebrafish caudal fin is not affected by repeated amputations. PLoS
ONE 6, e22820 (2011).
22. Gonzalez-Estevez, C. et al. SMG-1 and mTORC1 act antagonistically to regulate
response to injury and growth in planarians. PLoS Genet. 8, e1002619 (2012).
23. Azevedo, A. S., Sousa, S., Jacinto, A. & Saude, L. An amputation resets positional
information to a proximal identity in the regenerating zebrafish caudal fin. BMC
Dev. Biol. 12, 24 (2012).
24. Morgan, T. H. Regeneration. (The Macmillan Company, New York, 1901).
25. Dalyell, J. G. Observations on Planariae. (Archibald Constab le, Edinburgh, 1814).
26. Johnson, J. R. Further observations on the genus Planaria. (Royal Society, London,
1825).
27. Bryant, D. M. et al. A tissue-mapped axolotl de novo transcriptome enables
identification of limb regeneration factors. Cell Rep 18, 762–776 (2017).
28. Sousounis, K., Athippozhy, A. T., Voss, S. R. & Tsonis, P. A. Plasticity for axolotl lens
regeneration is associated with age-related changes in gene expression. Regen-
eration (Oxf) 1,47–57 (2014).
29. Mannini, L. et al. Djeyes absent (Djeya) controls prototypic planarian eye
regeneration by cooperating with the transcription factor Djsix-1. Dev. Biol. 269,
346–359 (2004).
30. Kawakami, Y. et al. Wnt/beta-catenin signaling regulates vertebrate limb regen-
eration. Genes Dev. 20, 3232–3237 (2006).
31. Whited, J. L., Lehoczky, J. A. & Tabin, C. J. Inducible genetic system for the axolotl.
Proc. Natl Acad. Sci. USA 109, 13662–13667 (2012).
32. Mahmoud, A. I. et al. Nerves regulate cardiomyocyte proliferation and heart
regeneration. Dev. Cell. 34, 387–399 (2015).
33. Lipson, K. E., Wong, C., Teng, Y. & Spong, S. CTGF is a central mediator of tissue
remodeling and fibrosis and its inhibition can reverse the process of fibrosis.
Fibrogenesis Tissue Repair 5, S24 (2012).
34. Gressner, O. A. & Gressner, A. M. Connective tissue growth factor: a fibrogenic
master switch in fibrotic liver diseases. Liver. Int. 28, 1065–1079 (2008).
35. Ihn, H. Pathogenesis of fibrosis: role of TGF-beta and CTGF. Curr. Opin. Rheumatol.
14, 681–685 (2002).
36. Zhou, Y. et al. Amphiregulin, an epidermal growth factor receptor ligand, plays an
essential role in the pathogenesis of transforming growth factor-beta-induced
pulmonary fibrosis. J. Biol. Chem. 287, 41991–42000 (2012).
37. Ding, L. et al. Bone marrow CD11c+cell-derived Amphiregulin promotes pul-
monary fibrosis. J. Immunol. 197, 303–312 (2016).
38. Perugorria, M. J. et al. The epidermal growth factor receptor ligand amphiregulin
participates in the development of mouse liver fibrosis. Hepatology. 48,
1251–1261 (2008).
39. Ojeh, N. et al. The effects of caffeine on wound healing. Int. Wound J. 13, 605–613
(2016).
40. Stewart, R. et al. Comparative RNA-seq analysis in the unsequenced axolotl: the
oncogene burst highlights early gene expression in the blastema. PLoS Comput.
Biol. 9, e1002936 (2013).
41. Dreux, A. C., Lamb, D. J., Modjtahedi, H. & Ferns, G. A. The epidermal growth
factor receptors and their family of ligands: their putative role in atherogenesis.
Atherosclerosis 186,38
–53 (2006).
42. Shao, J. & Sheng, H. Amphiregulin promotes intestinal epithelial regeneration: roles
of intestinal subepithelial myofibroblasts. Endocrinology 151,3728–3737 (2010).
43. Berasain, C. et al. Amphiregulin: an early trigger of liver regeneration in mice.
Gastroenterology 128, 424–432 (2005).
44. Schneider, M. R., Werner, S., Paus, R. & Wolf, E. Beyond wavy hairs: the epidermal
growth factor receptor and its ligands in skin biology and pathology. Am. J.
Pathol. 173,14–24 (2008).
45. Liou, A., Elias, P. M., Grunfeld, C., Feingold, K. R. & Wood, L. C. Amphiregulin and
nerve growth factor expression are regulated by barrier status in murine epi-
dermis. J. Invest. Dermatol. 108,73–77 (1997).
46. Cook, P. W., Brown, J. R., Cornell, K. A. & Pittelkow, M. R. Suprabasal expression of
human amphiregulin in the epidermis of transgenic mice induces a severe, early-
Limb regeneration in axolotls
DM Bryant et al.
14
npj Regenerative Medicine (2017) 30 Published in partnership with the Australian Regenerative Medicine Institute

onset, psoriasis-like skin pathology: expression of amphiregulin in the basal
epidermis is also associated with synovitis. Exp. Dermatol. 13, 347–356 (2004).
47. Bhagavathula, N. et al. Amphiregulin and epidermal hyperplasia: amphiregulin is
required to maintain the psoriatic phenotype of human skin grafts on severe
combined immunodeficient mice. Am. J. Pathol. 166, 1009–1016 (2005).
48. Li, Y. et al. Transgenic expression of human amphiregulin in mouse skin:
inflammatory epidermal hyperplasia and enlarged sebaceous glands. Exp. Der-
matol. 25, 187–193 (2016).
49. Cook, P. W. et al. Transge nic expression of the human amphiregulin gene induces
a psoriasis-like phenotype. J. Clin. Invest. 100, 2286–2294 (1997).
50. Tassava, R. A., Johnson-Wint, B. & Gross, J. Regenerate epithelium and skin glands
of the adult newt react to the same monoclonal antibody. J. Exp. Zool. 239,
229–240 (1986).
51. Shoyab , M., Plowman, G. D., McDonald, V. L., Bradley, J. G. & Todaro, G. J. Structure
and function of human amphiregulin: a member of the epidermal growth factor
family. Science 243, 1074–1076 (1989).
52. Farkas, J. E., Freitas, P. D., Bryant, D. M., Whited, J. L. & Monaghan, J. R. Neuregulin-
1 signaling is essential for nerve-dependent axolotl limb regeneration. Develop-
ment 143, 2724–2731 (2016).
53. Castilho, R. M., Squarize, C. H. & Gutkind, J. S. Exploiting PI3K/mTOR signaling to
accelerate epithelial wound healing. Oral Dis. 19, 551–558 (2013).
54. Zarogoulidis, P. et al. mTOR pathway: a current, up-to-date mini-review (Review).
Oncol. Lett. 8, 2367–2370 (2014).
55. Hirose, K., Shiomi, T., Hozumi, S. & Kikuchi, Y. Mechanistic target of rapamycin
complex 1 signaling regulates cell proliferation, cell survival, and differentiation
in regenerating zebrafish fins. BMC Dev. Biol. 14, 42 (2014).
56. Jazwinska, A. & Sallin, P. Regeneration versus scarring in vertebrate appendages
and heart. J. Pathol. 238, 233–246 (2016).
57. Gurtner, G. C., Werner, S., Barrandon, Y. & Longaker, M. T. Wound repair and
regeneration. Nature 453, 314–321 (2008).
58. Chung, E. et al. Amphiregulin causes functional downregulation of adherens
junctions in psoriasis. J. Invest. Dermatol. 124, 1134–1140 (2005).
59. Morhenn, V. B., Nelson, T. E. & Gruol, D. L. The rate of wound healing is increased
in psoriasis. J. Dermatol. Sci. 72,87–92 (2013).
60. Skowron, S. & Komala, Z. Limb regeneration in postmetamorphic Xenopus laevis.
Folia Biol Krakow 5,53–72 (1957).
61. Yun, M. H., Davaapil, H. & Brockes, J. P. Recurrent turnover of senescent cells
during regeneration of a complex structure. Elife 4,https://doi.org/10.7554/
eLife.05505 (2015).
62. Thompson, S., Muzinic, L., Muzinic, C., Niemiller, M. L. & Voss, S. R. Probability of
regenerating a normal limb after bite Injury in the Mexican Axolotl (Ambystoma
mexicanum). Regeneration 1,27–32 (2014).
63. Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of
image analysis. Nat. Methods 9, 671–675 (2012).
64. Grabherr, M. G. et al. Full-length transcriptome assembly from RNA-Seq data
without a reference genome. Nat. Biotechnol. 29, 644–652 (2011).
65. Haas, B. J. et al. De novo transcript sequence reconstruction from RNA-seq using
the Trinity platform for reference generation and analysis. Nat. Protoc. 8,
1494–1512 (2013).
66. Camacho, C. et al. BLAST+: architecture and applications. BMC Bioinformatics 10,
421 (2009).
67. Boeckmann, B. et al. Protein variety and functional diversity: Swiss-Prot annota-
tion in its biological context. C. R. Biol. 328, 882–899 (2005).
68. Finn, R. D. et al. Pfam: the protein families database. Nucleic Acids Res. 42,
D222–D230 (2014).
69. Li, B. & Dewey, C. N. RSEM: accurate transcript quantification from RNA-Seq data
with or without a reference genome. BMC Bioinform 12, 323 (2011).
70. Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics 26,
139–140 (2010).
71. de Hoon, M. J., Imoto, S., Nolan, J. & Miyano, S. Open source clustering software.
Bioinformatics 20, 1453–1454 (2004).
72. Saldanha, A. J. Java Treeview–extensible visualization of microarray data. Bioin-
formatics 20, 3246–3248 (2004).
73. Maere, S., Heymans, K. & Kuiper, M. BiNGO: a Cytoscape plugin to assess over-
representation of gene ontology categories in biological networks. Bioinforma tics
21, 3448–3449 (2005).
74. Supek, F., Bosnjak, M., Skunca, N. & Smuc, T. REVIGO summarizes and visualizes
long lists of gene ontology terms. PLoS ONE 6, e21800 (2011).
75. Whited, J. L., Lehoczky, J. A., Austin, C. A. & Tabin, C. J. Dynamic expression of two
thrombospondins during axolotl limb regeneration. Dev. Dyn. 240, 1249–1258
(2011).
76. Matsuda, T. & Cepko, C. L. Electroporation and RNA interference in the rodent
retina in vivo and in vitro. Proc. Natl Acad. Sci. USA 101,16–22 (2004).
77. Whited, J. L. et al. Pseudotyped retroviruses for infecting axolotl in vivo and
in vitro. Development 140, 1137–1146 (2013).
Open Access This article is licensed under a Creative Commons
Attribution 4.0 International License, which permits use, sharing,
adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative
Commons license, and indicate if changes were made. The images or other third party
material in this article are included in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material. If material is not included in the
article’s Creative Commons license and your intended use is not permitted by statutory
regulation or exceeds the permitted use, you will need to obtain permission directly
from the copyright holder. To view a copy of this license, visit http://creativecommons.
org/licenses/by/4.0/.
© The Author(s) 2017
Limb regeneration in axolotls
DM Bryant et al.
15
Published in partnership with the Australian Regenerative Medicine Institute npj Regenerative Medicine (2017) 30