Interaction between the Long-Tailed Macaque and the Dung Beetle in Langkawi

Abstract

The interaction between dung beetles and primates was studied at Telaga Tujuh, Langkawi Island, Malaysia using such as observation and sampling method. The dung beetles were caught, and their dung balls collected. The beetles were identifed as Paragymnopleurus maurus, and their dung balls were identifed as originating from Macaca fascicularis, using a molecular approach involving the cytochrome b (Cytb) marker. This is the frst record of Paragymnopleurus maurus from the study site in the Langkawi Islands and from this part of Malaysia. Paragymnopleurus maurus is attracted to the omnivorous dung of M. fascicularis, because it is a preferred food source for the beetle. Daytime is the active period for P. maurus and this study shows that the foraging area of P. maurus is restricted to the forest, even though the beetle’s food source (M. fascicularis’s dung) can be found outside the forest.

Full text

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
ISSN: 1511-3701 © Universiti Putra Malaysia Press
TROPICAL AGRICULTURAL SCIENCE
Journal homepage: http://www.pertanika.upm.edu.my/
ARTICLE INFO
Article history:
Received: 23 February 2016
Accepted: 06 June 2017
E-mail addresses:
abdullahmuhaimin1990@gmail.com (Muhaimin, A. M. D.),
aifat89@gmail.com (Aifat, N. R.),
abdullatiff12@yahoo.com (Abdul-Latiff, M. A. B.),
abgbadd@ukm.edu.my (Md. Zain, B. M.),
salmah78@ukm.edu.my (Yaakop, S.)
* Corresponding author
Interaction between the Long-Tailed Macaque and the Dung
Beetle in Langkawi
Muhaimin, A. M. D.1, Aifat, N. R.2, Abdul-Latiff, M. A. B.3, Md. Zain, B. M.2 and
Yaakop, S.1*
1Centre for Insect Systematics, School of Environmental and Natural Resource Sciences,
Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM, Bangi, Selangor,
Malaysia
2School of Environmental and Natural Resource Sciences, Faculty of Science and Technology,
Universiti Kebangsaan Malaysia, 43600 UKM, Bangi, Selangor, Malaysia
3Centre of Research for Sustainable Uses of Natural Resources,
Faculty of Science Technology and Human Development, Universiti Tun Hussein Onn Malaysia,
86400 UTHM, Parit Raja, Batu Pahat, Johor, Malaysia
ABSTRACT
The interaction between dung beetles and primates was studied at Telaga Tujuh, Langkawi
Island, Malaysia using such as observation and sampling method. The dung beetles were
caught, and their dung balls collected. The beetles were identied as Paragymnopleurus
maurus, and their dung balls were identied as originating from Macaca fascicularis,
using a molecular approach involving the cytochrome b (Cytb) marker. This is the rst
record of Paragymnopleurus maurus from the study site in the Langkawi Islands and from
this part of Malaysia. Paragymnopleurus maurus is attracted to the omnivorous dung of
M. fascicularis, because it is a preferred food source for the beetle. Daytime is the active
period for P. maurus and this study shows that the foraging area of P. maurus is restricted
to the forest, even though the beetle’s food source (M. fascicularis’s dung) can be found
outside the forest.
Keywords: Primate, new record, dung beetle, species
interactions, Langkawi Island
INTRODUCTION
Dung beetles (Coleoptera: Scarabaeidae:
Scarabaeinae) perform many crucial
roles in the ecosystem, including soil
enrichment, nutrient cycling, seed dispersal
(Willson et al., 1990; Jordano, 1992), y

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
Muhaimin, A. M. D., Aifat, N. R., Abdul-Latiff, M. A. B., Md. Zain, B. M. and Yaakop, S.
544
control (Haufe, 1989; Guglielmone et al.,
1999; Nichols et al., 2008). The most
important characteristic of dung beetles is
their preference for animal faces as a food
source and breeding medium. In addition
to faces, dung beetles also use decaying
matter as food during their adult and
larval stages (Halffter & Matthews, 1966;
Halffter & Edmonds, 1982).
The survival of dung beetles are highly
dependent on other animals, especially
mammals Some species of dung beetles
are specic with regard to habitat selection
(Hanski & Camberfort, 1991) and may
not be able to survive in open vegetation
where the number of small- or medium-
sized mammals producing faces is lower. A
study conducted by Davis (2000) in Borneo
reported that the dung beetle diversity was
lower in logged forests than in undisturbed
forest areas.
The relationship between dung beetles
and mammals are likely to be more specic
than previously expected; for example, as
documented by Hanski and Camberfort
(1991), herbivorous, omnivorous, and
carnivorous mammals will attract different
species of dung beetles.
Three primate families are found on
Langkawi Island: Hylobatidae, Lorisidae,
and Cercopithecoidea. Likewise,
the superfamily Cercopithecoidea
can be divided into two subfamilies:
Cercopithecinae and Colobinae. The
genus Macaca, a representative of the
omnivorous Cercopithecinae subfamily,
has three species that are found in Malaysia:
M. fascicularis (long-tailed macaques), M.
nemestrina (pig-tailed macaques), and M.
arctoides (stump-tailed macaques). Of the
Cercopithecinae, only M. fascicularis and
M. nemestrina are found on Langkawi.
The genera Trachypithecus, Presbytis,
and Nasalis represent colobines, or
the leaf-eating group (Bennett, 1991);
Presbytis and Trachypithecus are specic
to the Langkawi Islands. Different primate
species tend to have different lifestyles
(i.e., arboreal or terrestrial) and different
diets (Fam & Nijman, 2011). Therefore,
different species of dung beetles are
associated with primate species that have
different diets. The objective of this study
was to record the interactions between the
dung beetles and the primates inhabiting
this island ecosystem.
METHOD
Study Site
The sampling site selected for this study
is the Telaga Tujuh Waterfalls, near the
Mat Chinchang forest, a tropical mixed
dipterocarp rainforest. The forest is on the
island of Langkawi, located on the west
coast of Peninsular Malaysia (6° 22.162′
N, 99° 40.827′ E).
Sampling of Dung Beetles and Faeces
Field observations were conducted to search
for any interactions between primates and
dung beetles that specialise in rolling dung.
The observation of macaque troops was
conducted from 21–23 August 2015, from
10am to 1pm each day, with 45-minute
observation period and 15-minute interval.

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
Primate and Dung Beetle Interaction in Langkawi Island
545
The conditions were bright and sunny
throughout the sampling period. Only
diurnal species was observed because it
coincided with the specic active period of
the dung beetles under study (Davis, 1999;
Niino et al., 2014). No passive trapping
or bait trapping was used to collect the
dung beetles. However, when any rolling
dung balls were observed, both the dung
beetle and the dung ball were collected.
The collected dung beetles were preserved
and identied in Universiti Kebangsaan
Malaysia (UKM) laboratory using available
taxonomic keys (Ochi et al., 1996; Ek-
Amnuay, 2008); the diagnostic characters
were elongated legs and two frontal lobes
on the clypeus. Photographs of the dung
beetles were taken using a Canon EOS
6D camera attached to a stereomicroscope
(Zeiss Stemi SV11). Faeces from M.
fascicularis and from beetles’ dung balls
were taken to the UKM laboratory to
identify the associated macaque species
using a molecular approach. To avoid
cross-contamination, only a single faecal
sample was collected per session and was
carefully stored in a 15-ml vial with 99%
ethanol, to preserve the traces of DNA in
the faces.
The faecal samples were visually
examined to identify the target
species; usually, the genus Macaca has
brown-coloured faces, while that of
Trachypithecus is greenish. The colours are
different because of the omnivorous and
frugivorous diets of the macaques and the
strictly herbivorous and folivorous diets of
the langurs (called “lutung” locally). Fresh
samples of the faces were easily found by
looking for ies or by observing the dung
beetles rolling the faces into dung balls.
DNA Extraction
The DNA was extracted from 0.2–0.4-g
samples of the faces (2 replicates) using the
innuPREP Stool DNA Kit (Analytik, Jena,
Germany), following the manufacturer’s
protocol.
Polymerase Chain Reaction (PCR)
To conrm the identity of the macaque
species, PCR was conducted using the
mitochondrial DNA Cytochrome b (Cytb)
as a primer (Table 1). This primer was
designed specically to avoid species
cross-contamination. A sequence of M.
fascicularis was retrieved from GenBank
to be used as template in designing primer.
The Primer-BLAST program was used
to generate species-specic primer (Ye
et al., 2012). The Needleman-Wunsch
global alignment algorithm (Needleman &
Wunsch, 1970) is used by Primer-BLAST to
check the specicity of the primer pairs to
the template sequences. To choose the best
primer pair, the physical characteristics
such as length (mer), guanine-cytosine
(GC) content (%), molecular weight (g/
mole), extinction coefcient at 260nm,
dimer and complementary sequences
of the primer pairs were analysed using
Oligo Analyzer 3.1. By using the Phusion
Flash-High-Fidelity PCR Master Mix
(Thermosher scientic) which contains
Phusion Flash II DNA Polymerase, 2x

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
Muhaimin, A. M. D., Aifat, N. R., Abdul-Latiff, M. A. B., Md. Zain, B. M. and Yaakop, S.
546
reaction buffer, dNTPs and MgCl2 as PCR
reagent, a three-step PCR process was
employed, including an initial denaturation
at 98°C held for 10 seconds, followed by 30
cycles of denaturation at 98°C for 1 second,
50°C of annealing for 30 seconds, 72°C
for 15 seconds of extension, and a nal
extension at 72°C for 1 minute (see Table 2).
Table 1
The designed primer sequences for PCR
Primer name Sequence (5’-3’) Locus Annealing
Temperature (°C) Species
Latiff1018_F CAATACACTACTCACCAGAC
Cyt b50.0 M. fascicularis
Latiff1069_R TAGGTTGTTTTCGATTAGGG
Table 2
PCR components in DNA amplication
Chemical Volume (x1) (µl)
Phusion Flash High Fedelity (Mastermix) 10.0
100 µM Primer Forward 1.0
100 µM Primer Reverse 1.0
Template DNA 1.0
dd 7.0
TOTAL 20.0
RESULTS
Dung Beetle Species
Field observations showed that only a
single species of dung beetle had a strong
preference for primate faces. Dung-rolling
beetles of the species Paragymnopleurus
maurus (Figure 1 & Figure 2) consumed
primate faces as their main food source
from this area.
Figure 1. Dung beetle Paragymnopleurus maurus making a dung ball and ready to roll it to other places

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
Primate and Dung Beetle Interaction in Langkawi Island
547
Figure 2. Paragymnopleurus maurus
Primate Species
Faeces rolled by P. maurus were collected
to determine their host DNA because, aside
from hair follicles, faces are the best non-
invasive source of DNA from primates
(Inoue et al., 2007; Marangi et al., 2015).
The entire mitochondrial DNA (mtDNA)
sample from the faeces were successfully
extracted using the standardised method
described in the manufacturer’s protocol.
The PCR products with the most visible
bands on the agarose gel (Figure 3) were
sequenced to analyse the effectiveness of
the primer and the PCR optimisation.
Figure 3. Result of PCR process on 1.5% agarose gel. Well A=100bp molecular marker

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
Muhaimin, A. M. D., Aifat, N. R., Abdul-Latiff, M. A. B., Md. Zain, B. M. and Yaakop, S.
548
The sequences obtained were analysed
using the GenBank BLAST to ensure that
the targeted loci of the selected species
were amplied. The parameters used to
ensure the specicity of the DNA sequences
included the percentage of queries covered
by alignment to the database sequence,
the best expected value (E-Value) of the
alignments from the database sequence, and
the highest percent identity (Max Identity)
of all the query-subject alignments. The
sequence obtained from the PCR product
had 98% specicity to the database
sequence of M. fascicularis, agreeing with
the Max Identity and an E-Value ≤0. The
specically designed primer successfully
amplied the targeted loci, and the overall
molecular approach conrmed that the
faces rolled by P. maurus on Langkawi
Island belonged to a single species, M.
fascicularis (Figure 4).
Figure 4. Macaca fascicularis (Long-tailed macaque) enjoying food in Langkawi Island, Kedah, Malaysia
DISCUSSION
Three genera of dung-rolling beetles
have been recorded in Malaysia:
Paragymnopleurus, Ochicanthon, and
Sisyphus. Among these, Paragymnopleurus
is the largest (2–4 cm in length) and was the
only species found in this study. P. maurus,
a large-bodied species, is associated with
the long-tailed macaque, M. fascicularis.
The existence of the interaction has been
documented based on molecular data and
live observations in the eld. Though P.
maurus is classied as large dung beetle,
it is not the largest dung beetle that can be
found in Malaysia (Muhaimin et al., 2015).
Species such as Heliocopris tyrannus (Goh
et al., 2014), Catharsius renaudpauliani,
and C. molossus are much larger than P.
maurus and have been previously recorded
in Singapore (Ong et al., 2013). However,

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
Primate and Dung Beetle Interaction in Langkawi Island
549
in this study, which was conducted during
the daytime, we focused only on diurnal
species of dung beetles. Niino et al. (2014)
reported that P. maurus is active during
the day, while a closely related species, P.
striatus, is active at night. It is likely that if
we had conducted our sampling activities
at night, the presence of P. striatus might
have been detected.
The interactions between a primate
species and a dung beetle species were
recorded for the rst time at the Telaga
Tujuh Waterfalls, a site adjacent to the
Mat Chinchang forest on the main island
of Langkawi. This dung beetle species is
common, due to its wide distribution in
Peninsular Malaysia (Doll et al., 2014;
Niino et al., 2014), Borneo (Davis, 2000;
Davis et al., 2001), and the Oriental region
(Davis et al., 2002). Unlike the genus
Ochicanthon, which prefers to consume
carrion (Krikken & Huijbergts, 2007),
Paragymnopleurus is similar to the genus
Sisyphus in terms of food preference.
According to Lee et al. (2009), large-
bodied dung beetle species are more
sensitive to forest disturbances than
smaller species. This is because large dung
beetles require big forest areas inhabited
by large population of mammals. As the
mammals provide food and a breeding
medium for the dung beetles, declining
population of mammals directly affect the
survival of dung beetles. This relationship
was documented by Schefer (2005)
and Gardner et al. (2008), who observed
the same direct correlations between the
mammal and dung beetle populations in
the tropical forests of Brazil. However,
a different circumstance was observed
for P. maurus, which seems to be more
resistant to habitat disturbance and can
thrive in smaller forest patches. According
to Qie et al. (2011), P. maurus can also be
found in the small fragmented and isolated
recreational forest patches of Kenyir Lake,
Terengganu. Lee et al. (2009) discovered
the same dung beetle species in small forest
patches in Singapore, a case similar to that
of Langkawi Island, in which island effects
and similar abiotic factors prevail.
Regarding the dung preference of P.
maurus, Hanski and Camberfort (1991)
claimed that P. maurus is closely associated
with the dung of omnivorous animals.
However, this species is also found on
carrion (Sakai & Inoue, 1999), human dung
(Davis et al., 2000), cattle dung (Muhaimin
et al., 2015), and pig dung (Slade et al.,
2007). P. maurus specimens have also
been collected from elephant dung (Doll
et al., 2014; Goh et al., 2014), which is
their food source and breeding medium.
In this study, P. maurus preferred the dung
of the omnivorous primate M. fascicularis.
This indicates that either P. maurus is
a generalist or that it has expanded its
food preferences due to the scarcity of its
preferred food source. Further research
should be conducted to show the actual diet
preference of this species.
The long-tailed macaque M.
fascicularis is a mutualist edge species,
resilient and well-adapted to interaction
with humans (Abdul-Latiff et al., 2014a,
2014b). Garbage dump sites provide

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
Muhaimin, A. M. D., Aifat, N. R., Abdul-Latiff, M. A. B., Md. Zain, B. M. and Yaakop, S.
550
the macaques with ample food sources.
However, the dung beetle P. maurus is
incapable of venturing far out into human
areas because its ying ability and mobility
is limited (Niino et al., 2014) and specic
requirements such as the forest oor
and vegetation types that only the forest
can provide (Doube, 1983; Andresen,
2005). Understanding the interactions and
preferences of dung beetles, both tunnellers
and rollers, with regard to primate dung is
crucial for understanding the dynamics
of the surrounding ecosystems (Nichols
et al., 2007). This study has reported the
interactions between the dung beetle P.
maurus and the macaque M. fascicularis.
Future works should include the
identication of the components that attract
this dung beetle to the faces of the long-
tailed macaque, as well as the mode of
seed dispersal involved in this interaction.
Further and more specic studies on the
rich biodiversity of the Langkawi Islands
should be conducted for developing
community-level conservation strategies
for this invaluable UNESCO Geopark site.
CONCLUSION
This study has shown Paragymnopleurus
maurus has direct interactions with the
long-tailed macaque (M. fascicularis); this
dung beetle evidently prefers omnivorous
faces, a main diet of this primate. This study
can contribute to knowledge by showing
interactions among species, utilising
practical methodologies and eld samples
such as the dung or faces of primates and
other vertebrate hosts.
ACKNOWLEDGEMENT
The authors thank Mr. Danny Haelewaters
and Mr. Tristan Wang from Harvard
University in Cambridge, Massachusetts,
USA for the original photographs taken
during the mini-expedition to Langkawi
Island. Thanks also to Prof. Dr. Maimon
Abdullah for her critical comments and
in editing the manuscript. We are grateful
to the Langkawi Research Centre (PPL),
UKM for their kind hospitality during our
eld study. This research was funded by
the following grants: FRGS/1/2014/SG03/
UKM/02/1 and GUP-2016-022.
REFERENCES
Andresen, E. (2005). Effects of season and vegetation
type on community organization of dung beetles
in a tropical dry forest. Biotropica, 37(2), 291-300.
Bennett, E. L. (1991). Diurnal primates. In R.
Kiew (Ed.), The State of Nature Conservation
in Malaysia (pp. 150-172). Kuala Lumpur:
Malaysia Nature Society.
Davis, A. J. (1999). Species packing in tropical
forests: diel ight activity of rainforest dung-
feeding beetles (Coleoptera: Aphodiidae,
Scarabaeidae, Hybosoridae) in Borneo. The
Rafes Bulletin of Zoology, 47(2), 473-486.
Davis, A. J. (2000). Does reduced-impact logging
help preserve biodiversity in tropical rainforests?
A case study from Borneo using dung beetles
(Coleoptera: Scarabaeoidea) as indicators.
Community and Ecosystem Ecology, 29(3), 467-
475.
Davis, A. J., Holloway, J. D., Huijbregts, H.,
Krikken, J., Kirk-Springgs, A. H., & Sutton, S.
L. (2001). Dung beetles as indicators of change
in the forest of northern Borneo. Journal of
Applied Ecology, 38(3), 593-616.

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
Primate and Dung Beetle Interaction in Langkawi Island
551
Davis, A. J., Huijbregts, H., & Krikken, J. (2000).
The role of local and regional processes in
shaping dung beetle communities in tropical
forest plantations in Borneo. Global Ecology
and Biogeography, 9(4), 281–292.
Davis, A. L., Scholtz, C. H., & Philips, T. K. (2002).
Historical biogeography of scarabaeine dung
beetles. Journal of Biogeography, 29(9), 1217-
1256.
Doll, H. M., Butod, E., Harrison, R. D., Fletcher,
C., Kassim, A. R., Ibrahim, S., & Potts, M. D.
(2014). Environmental and geographic factors
driving dung beetle (Coleoptera: Scarabaeidae:
Scarabaeinae) diversity in the dipterocarp
forests of Peninsular Malaysia. Rafes Bulletin
of Zoology, 62, 549-560.
Doube, B. M. (1983). The habitat preference of some
bovine dung beetles (Coleoptera: Scarabaeinae)
in Hluhluwe Game Reserve, South Africa.
Bulletin of Entomological Research, 73(3),
357–371.
Ek-Amnuay, P. (2008). Beetles of Thailand. Bangkok:
Amarin Printing and Publishing Co., Ltd.
Fam, S. D., & Nijman, V. (2011). Spizaetus hawk-
eagles as predators of arboreal colobines.
Primates, 52(2), 105-110.
Gardner, T. A., Barlow, J., Araujo, I. S., Avila-Pires,
T. C., Bonaldo, A. B., Costa, J. E., … & Mestre,
L. A. M. (2008). The cost-effectiveness of
biodiversity surveys in tropical forest. Ecology
Letters, 11(2), 139–150.
Goh, T. G., Huijbregts, J., Ning, H., & Campos-
Arceiz, A. (2014). Bettles recorded to visit
elephant dung in Temenggor Forest, Malaysia.
Journal of Wildlife and Parks, 29, 45-48.
Guglielmone, A. A., Gimeno, E., Idiart, J., Fisher, W.
F., Volpogni, M. M., Quaino, O., … & Warnke,
O. (1999). Skin lesions and cattle hide damage
from Haematobia irritans infestations in cattle.
Medical and Veterinary Entomology, 13(3),
323–328.
Halffter, G., & Edmonds, W. (1982). The nesting
behavior of dung beetles (Scarabaeinae): an
ecological and evolutive approach. Mexico, D.
F.: Instituto de Ecologıa.
Halffter, G., & Matthews, E. (1966). The natural
history of dung beetles of the subfamily
Scarabaeinae (Coleoptera, Scarabaeidae). Folia
Entomologica Mexicana, 12-14, 1–312.
Hanski, I., & Camberfort, Y. (1991). Dung Beetle
Ecology. Princeton: Princeton University Press.
Haufe, W. (1989). Host–parasite interaction of blood
feeding dipterans in health and productivity of
mammals. International Journal of Parasitology,
17(2), 607–614.
Inoue, T., Hiratsuka, M., Osaki, M., & Oshimura, M.
(2007). The molecular biology of mammalian
SIRT proteins: SIRT2 in cell cecle regulation.
Cell Cycle, 6(9), 1011-1018.
Jordano, P. (1992). Fruits and frugivory. In M.
Fenner (Ed.), Seeds: the ecology of regeneration
in plant communities (p. 127). Wallingford, UK:
CAB International.
Krikken, J., & Huijbregts, J. (2007). Taxonomic
diversity of the genus Ochicanthon in Sundaland
(Coleoptera: Scarabaeidae: Scarabaeinae).
Tijdschrift voor Entomologie, 150(2), 421-479.
Lee, J. S., Lee, I. Q., Lim, S. L., Huijbregts, J., &
Sodhi, N. S. (2009). Changes in dung beetle
communities along a gradient of tropical forest
disturbance in South-East Asia. Journal of
Tropical Ecology, 25(6), 677–680.
Marangi, M., Koehler, V. A., Zanzani, S. A.,
Manfredi, M. T., Brianti, E., Giangaspero, A., &
Gasser, R. B. (2015). Detection of Cyclospora
in captive chimpanzees and macaques by a
quantitative PCR-based mutation scanning
approach. Parasites and Vectors, 8(1), 274-278.

Pertanika J. Trop. Agric. Sci. 40 (4): 543 – 552 (2017)
Muhaimin, A. M. D., Aifat, N. R., Abdul-Latiff, M. A. B., Md. Zain, B. M. and Yaakop, S.
552
Muhaimin, A. M. D., Hazmi, I. R., & Yaakop,
S. (2015). Colonization of dung beetles
(Coleoptera: Scarabaeidae) of smaller body in
the Bangi Forest Reserve, Selangor, Malaysia: A
model sampling site for a secondary forest area.
Pertanika Journal of Tropical and Agricultural
Sciences, 38(4), 519 - 532.
Needleman, S. B., & Wunsch, C. D. (1970). A
general method applicable to the search for
similarities in the amino acis sequence of two
proteins. Journal of Molecular Biology, 48(3),
443-453.
Nichols, E., Larsen, T., Spector, S., Davis, A. L.,
Escobar, F., Favila, M., & Vulinec, K. (2007).
Global dung beetle response to tropical forest
modication and fragmentation: A quantitative
literature review and meta-analysis. Biological
Conservation, 137(1), 1-19.
Nichols, E., Spector, S., Louzada, J., Larsen, T.,
Amezquita, S., Favila, M. E., & Vulinec, K.
(2008). Ecological functions and ecosystem
services provided by Scarabaeinae dung beetles.
Biological Conservation, 141(6), 1461-1474.
Niino, M., Hosaka, T., Kon, M., Ochi, T., Yamada,
T., & Okuda, T. (2014). Diel ight activity and
habitat preference of dung beetles (Coleoptera:
Scarabaeidae) in Peninsular Malaysia. Rafes
Bulletin of Zoology, 62, 795–804.
Ochi, T., Kon, M., & Kikuta, T. (1996). Studies
on the family Scarabaeidae (Coleoptera) from
Borneo. I. Identication keys to subfamilies,
tribes and genera. Giornale Italia Entomologia,
8, 37-54.
Ong, X. R., Chua, S. C., & Potts, M. D. (2013). Recent
records of the dung beetle Catharsius molossus
(Coleoptera: Scarabaeidae) in Singapore. Nature
in Singapore, 6, 1-6.
Owczarzy, R., Tataurov, A. V., & Wu, Y. (2008).
IDT SciTools: a suite for analysis and design of
nucleic acid oligomers. Nucleic Acids Research,
36(suppl_2), 163-169.
Qie, L., Lee, T. M., Sodhi, N. S., & Lim, S. L.
(2011). Dung beetle assemblages on tropical
land-bridge islands: small island effect and
vulnarable species. Journal of Biogeography,
38(4), 792-804.
Sakai, S., & Inoue, T. (1999). A new pollination
system: Dung-beetle pollination discovered in
Orchindantha inouei (Lowiaceae, Zingiberales)
in Sarawak, Malaysia. American Journalof
Botany, 86(1), 56-61.
Schefer, P. (2005). Dung beetle (Coleoptera:
Scarabaeidae) diversity and community
structure across three disturbance regimes in
eastern Amazonia. Journal of Tropical Ecology,
21(1), 9-19.
Slade, E. M., Mann, D. J., Villanueva, J. F., &
Lewis, O. T. (2007). Experimental evidence
for the effects of dung beetle functional group
richness and composition on ecosystem function
in a tropical forest. Journal of Animal Ecology,
76(6), 1094–1104.
Willson, M., Rice, B., & Westoby, M. (1990). Seed
dispersal spectra - a comparison of temperate
plant communities. Journal of Vegetation
Science, 1(4), 547–562.
Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache,
I., Rozen, S., & Madden, T. L. (2012). Primer-
BLAST: a tool to design target-specic
primers for polymerase chain reaction. BMC
Bioinformatics, 13(1), 134.