![FIGURE . Strophocactus. A) S. wittii, flowering specimen (Schmidt s.n., cultivated at the Botanic Garden Bonn). B) Strophocactus wittii (left) and Strophocactus (Pseudoacanthocereus) sicariguensis (right), both forming flattened stems [photos by W. Barthlott, LotusSalvinia.de].](https://www.researchgate.net/profile/Salvador-Arias/publication/320829990/figure/fig2/AS:849105102319616@1579453840495/FIGURE-Strophocactus-A-S-wittii-flowering-specimen-Schmidt-sn-cultivated-at-the_Q320.jpg)
Content uploaded by Salvador Arias
Author content
All content in this area was uploaded by Salvador Arias on Jan 19, 2020
Content may be subject to copyright.
Phytotaxa 327 (1): 001–046
http://www.mapress.com/j/pt/
Copyright © 2017 Magnolia Press Article PHYTOTAXA
ISSN 1179-3155 (print edition)
ISSN 1179-3163 (online edition)
Accepted by Duilio Iamonico: 20 Jul. 2017; published: 3 Nov. 2017
https://doi.org/10.11646/phytotaxa.327.1.1
1
A phylogenetic framework for the Hylocereeae (Cactaceae) and implications for
the circumscription of the genera
NADJA KOROTKOVA1, THOMAS BORSCH1 & SALVADOR ARIAS2
1Botanic Garden and Botanical Museum Berlin, Freie Universität Berlin, Königin-Luise-Str. 6-8, 14195 Berlin, Germany,
n.korotkova@bgbm.org, t.borsch@bgbm.org
2Jardín Botánico, Instituto de Biología, Universidad Nacional Autónomo de México (UNAM), Circuito exterior s.n., Ciudad Universi-
taria, Ap. postal 70-614, México D.F. 04510, Mexico, sarias@ib.unam.mx
Abstract
The tribe Hylocereeae are represented by mainly Central American-Mexican epiphytic, hemi-epiphytic and climbing cacti.
They are popular due to their spectacular nocturnal flowers and have some importance as crops grown for their edible fruits.
We present the first comprehensive phylogenetic study of the Hylocereeae sampling 60 out of the 63 currently accepted spe-
cies and 17 out of 19 infraspecific taxa. Based on four plastid regions (trnK/matK, the rpl16 intron, rps3-rpl16, and trnL-F)
we find a highly supported core Hylocereeae clade that also includes Acanthocereus and Peniocereus p.p., while Strophocac-
tus is depicted as polyphyletic and is resolved outside of the Hylocereeae tribe. The clades found within Hylocereeae agree,
in general terms, with the currently accepted genera but none of the genera are entirely monophyletic in their current cir-
cumscription. A new concept for the Hylocereeae is presented to include the genera Acanthocereus (incl. Peniocereus p.p.),
Aporocactus, Disocactus, Epiphyllum, Selenicereus (incl. Hylocereus and Weberocereus p.p.), Pseudorhipsalis, Kimnachia
gen. nov., and Weberocereus. New nomenclatural combinations are provided to make these genera monophyletic. The genus
Deamia is reinstated for Strophocactus testudo and S. chontalensis, while Strophocactus is newly circumscribed to include
S. wittii, Pseudoacanthocereus brasiliensis, and P. sicariguensis. Both genera are excluded from Hylocereeae. A taxonomic
synopsis of Hylocereeae is provided.
Key words: Caryophyllales, Deamia, epiphytes, generic concept, Hylocereus, Kimnachia gen. nov., Pseudorhipsalis, Selen-
icereus, Strophocactus, taxonomy, Weberocereus
Introduction
The family Cactaceae Juss. constitutes a well-defined lineage within the angiosperm order Caryophyllales Berchtold
& J. Presl (see e.g., Brockington et al. 2015, Cuénoud et al. 2002, Schäferhoff et al. 2009). The general understanding
of evolutionary relationships in Cactaceae has improved in recent years as a result of molecular phylogenetic studies
(Hernández-Hernández et al. 2011, Korotkova et al. 2011, Korotkova et al. 2010, Nyffeler 2002, Nyffeler & Eggli
2010, Schlumpberger & Renner 2012, Vázquez-Sánchez et al. 2013). Nevertheless, parts of the Cactaceae phylogenetic
tree remain to be resolved, in particular concerning the relationships of major clades and relationships at the species
level. Many genera have been recognized as para- or polyphyletic but limitations in taxon sampling, lack of statistical
confidence of relevant nodes, or missing morphological analyses have so far prevented a consistent implementation of
a phylogeny-based classification system. For the tribal and subtribal level, a revised classification for the whole family
was proposed by Nyffeler and Eggli (2010), which entails a more natural circumscription of taxa compared to previous
classifications, albeit being not yet fully substantiated by phylogenetic data.
Cactaceae show complex patterns of convergent evolution in life forms, pollination syndromes and other traits (e.g.
Gibson & Nobel 1986, Hernández-Hernández et al. 2011, Schlumpberger & Renner 2012). The obvious morphological
characters and their states associated with these traits have frequently been used for diagnosing genera but they are
often homoplastic and genera based on those characters are therefore often shown as not monophyletic.
KOROTKOVA ET AL.
2 • Phytotaxa 327 (1) © 2017 Magnolia Press
FIGURE 1. Stem and flower morphology of the Hylocereeae. A) Acanthocereus chiapensis (Arias 1021); B) A. tetragonus (Arias 2166);
C) Disocactus quezaltecus (Veliz 42515); D) D. phyllanthoides (Arias 1432); E) Aporocactus flagelliformis (Arias 1236); F) Epiphyllum
cartagense (Hammel 19793); G) E. chrysocardium (cultivated, Botanical Garden UNAM); H) E. hookeri subsp. hookeri (Arias 1560);
I) E. thomasianum (Hammel 22020); J) Pseudorhipsalis himantoclada (Hammel 20806); K) P. ramulosa (Ferrufino 718); L) Hylocereus
monacanthus (Hammel 26600); M) H. undatus (cultivated, Botanical Garden UNAM); N) Selenicereus anthonyanus (Hammel, cultivated);
O) S. dorschianus (Arias 2221); P) S. pteranthus (Garcia 874); Q) Weberocereus glaber (Bravo s.n.) [photos by S. Arias (A–H, K, M,
O–Q), and B. Hammel (I, J, L, N)].
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 3
The most recent taxonomic backbone of Caryophyllales that summarizes the current understanding of genus
concepts in this order still had to accept several poly-or paraphyletic genera in Cactaceae (Hernández-Ledesma et
al. 2015). Striking examples are Echinopsis Zuccarini (Anceschi & Magli 2013, Schlumpberger & Renner 2012) or
Ferocactus Britton & Rose (Vázquez-Sánchez et al. 2013).
A network of institutions and researchers has developed an integrated approach of research and biodiversity
informatics with the goal to provide an up-to-date synthesis on the Caryophyllales, including an online taxonomic
information source (Borsch et al. 2015). This approach takes into account that we are currently in a transition phase
from predominantly alpha-taxonomic species treatments to the evolutionary analysis of species limits with a subsequent
independent classification step. Knowledge generation and classification thereby advance in a stepwise process, and
are fuelled by new methods such as next generation sequencing and computational advances, as well as structured data
and reproducible work flows (Borsch et al. 2015, Kilian et al. 2015).
In the present study, we focus on the Hylocereeae Buxbaum as one of the major groups of Cactaceae that have
not yet been analysed with phylogenetic methods using an overall representative sampling of species. They are a
predominantly Mesoamerican and Caribbean (most diverse in southern Mexico, Guatemala, and Costa Rica) group
of epiphytic or climbing cacti. Many species are popular ornamentals, especially Disocactus Lindley and Epiphyllum
Haworth, while Hylocereus (A. Berger) Britton & Rose and Selenicereus (A. Berger) Britton & Rose are widely
cultivated for their edible fruits (known as pitahaya or dragon fruit). Selected species are showed in Figure 1.
The composition of the Hylocereeae has been changing constantly. Past treatments have either separated sub-
lineages (Barthlott & Hunt 1993, Britton & Rose 1923) or merged all epiphytic cacti under the name Hylocereeae
(Backeberg 1959, Buxbaum 1958, 1962), Table 1). There are also no clear synapomorphies of the Hylocereeae,
regardless of their circumscription. They have mostly been delimited as a Mexican/Mesoamerican group of hemi-
or holo-epiphytes with large flowers and adventitious roots. The epiphytic growth form was used as main uniting
characteristic while their distribution was the main rationale for separating the Hylocereeae from the likewise epiphytic,
but small-flowered and predominantly South American tribe Rhipsalideae (Barthlott & Hunt 1993).
The current Hylocereeae classification and recognized genera date back to the treatment by Barthlott & Hunt
(1993) and include: Hylocereus, Selenicereus, Weberocereus Britton & Rose, Disocactus, Pseudorhipsalis Britton
& Rose and Epiphyllum. Two nomenclatural changes were recently proposed: three species of Selenicereus were
transferred to Strophocactus Britton & Rose by Bauer (2003a) and Aporocactus Lemaire was reinstated by Cruz et al.
(2016).
The phylogenetic position of the Hylocereeae as part of Cactoideae, close to Echinocereeae, could be well
established in previous studies, as well as their separation from the other epiphytic lineages, the tribes Rhipsalideae
DC. and Lymanbensonieae N. Korotkova & Barthlott (see Hernández-Hernández et al. 2011, Korotkova et al. 2010).
However, the monophyly of Hylocereeae still remains to be tested. So far, clades containing Hylocereeae species were
either weakly supported (Arias et al. 2005, 67% BS, 57% JK, Hernández-Hernández et al. 2011, 75% MLBS) or not
supported at all (Bárcenas et al. 2011). Acanthocereus (Englemann ex A. Berger) Britton & Rose and Peniocereus
Britton & Rose subgen. Pseudoacanthocereus Sánchez-Mejorada were resolved in a clade together with the “core
Hylocereeae” (Arias et al. 2005, 94% BS/91% JK, Nyffeler 2002, 84% BS). This was a notable finding since these
genera are terrestrial rather than epiphytic and they used to be assigned to the Echinocereeae (Britton & Rose) Buxbaum
(Barthlott & Hunt 1993). On the other hand, Nyffeler and Eggli (2010) suggested that Strophocactus may not be part
of the Hylocereeae, but that was based on hitherto unpublished sequence data.
The Hylocereeae offer a good example for unstable generic limits and excessive splitting. In fact, 23 generic names
have been published, many of them monotypic segregates (Table 1). Nevertheless, most of the genera in Hylocereeae
are not well defined. So far, only three of them have been evaluated in a phylogenetic context. A study using plastid
(rpl32-trnL, trnQ-rps16, psbB-trnT) and nuclear sequences (ITS, phyC, Vatp1) showed Hylocereus to be nested within
a paraphyletic Selenicereus (Plume et al. 2013). Cruz et al. (2016) carried out a comprehensive sampling of Disocactus,
redefined the genus, and provided a species-level synopsis that can serve as taxonomic backbone for it.
One of the specific objectives of the present study is to provide a comprehensive phylogenetic framework for the
entire Hylocereeae based on plastid data and a dense taxon sampling covering more than 90% of the currently accepted
species. For this purpose, we have selected four plastid regions: trnK/matK, the rps3-rpl16 intergenic spacer and the
rpl16 intron as well as the trnL-F region. The rationale for this selection was twofold: first, we wanted to represent
the Cactoideae as well as possible to be able to test the monophyly of the Hylocereeae and the positions of species
that might go outside. These three plastid regions have been sequenced for Cactaceae in a family-level phylogenetic
study (Hernández-Hernández et al. 2011) thus many sequences are available in GenBank that can be used as outgroups
since the monophyly of the Hylocereeae needs to be evaluated. Second, the high phylogenetic utility of these regions,
KOROTKOVA ET AL.
4 • Phytotaxa 327 (1) © 2017 Magnolia Press
especially the rpl16 intron, for reconstructing species-level trees in Cactaceae has been demonstrated (Korotkova et
al. 2011, Korotkova et al. 2010). Another objective is to evaluate the currently used generic concepts in light of the
obtained phylogenetic hypothesis. Based on this phylogenetic study we provide an updated taxonomic synopsis of the
Hylocereeae with all species that should be currently included.
TABLE 1. Historical background of Hylocereeae in monographic Cactaceae treatments.
Schumann (1899) Britton & Rose (1920, 1923) Buxbaum (1958) Backeberg (1959) Barthlott & Hunt (1993)
Tribe Echinocacteae Tribe Cereeae3Tribe Hylocereae Tribe Hylocereeae Tribe Hylocereeae
Phyllocactus Link
Epiphyllum sensu Haworth p.p.
Disocactus
Disisocactus
Phyllocereus
Subtribe Epiphyllanae
Chiapasia
Disocactus
Eccremocactus
Epiphyllanthus
Epiphyllum
Nopalxochia
Schlumbergera
Wittia
Subtribe 3. Epiphyllinae
Epiphyllum
Marniera
______________________
Subtribe Disocactinae
Bonifazia
Chiapasia
Disocactus
Lobeira
Nopalxochia
Pseudorhipsalis
Wittia
Subtribe Phyllocactinae
Bonifazia
Chiapasia.
Cryptocereus
Disocactus
Eccremocactus
Epiphyllum.
Lobeira
Marniera
Nopalxochia
Pseudonopalxochia
Wittia
Disocactus
Aporocactus
Wittia
Heliocereus
Chiapasia
Nopalxochia
Bonifazia
Lobeira
Pseudonopalxochia
Wittiocactus
Epiphyllum
Hylocereus (incl.Wilmattea)
Selenicereus (incl. Marniera)
Strophocactus
Deamia
Mediocactus
Cryptocereus
Pseudorhipsalis
Weberocereus (incl. Werckleocereus)
Eccremocactus
Epiphyllum sensu Pfeiffer
Epiphyllum p.p.
Zygocactus
Zygocactus - -
Cereus Miller
Reihe Triangulares
Subtribe Hylocereanae
Aporocactus
Deamia
Hylocereus
Mediocactus
Selenicereus
Strophocactus
Weberocereus
Werckleocereus
Wilmattea
Subtribe Hylocereinae
Aporocactus
Cryptocereus
Deamia
Eccremocactus
Hylocereus
Mediocactus
Selenicereus
Strophocactus
Weberocereus
Werckleocereus
Wilmattea
Subtribe Hylocereinae
Aporocactus
Deamia
Hylocereus
Mediocactus
Selenicereus
Strophocactus
Weberocereus
Werckleocereus
Wilmattea
Tribe Rhipsalideae Tribe Rhipsalideae Subtribe Rhipsalinae Subtribe Rhipsalidinae Tribe Rhipsalideae
Hariota
Pfeiffera
Rhipsalis
Lepismium
Acanthorhipsalis
Erythrorhipsalis
Hatiora
Lepismium
Pfeiffera
Pseudorhipsalis
Rhipsalidopsis
Rhipsalis
Acanthorhipsalis
Erythrorhipsalis
Hatiora
Pseudozygocactus
Lepismium
Pfeiffera
Rhipsalidopsis
Epiphyllopsis
Rhipsalis
Schlumbergera
Zygocactus
Epiphyllanthus
Acanthorhipsalis
Epiphyllanthus
Epiphyllopsis
Erythrorhipsalis
Hatiora
Lepismium
Pseudorhipsalis
Pseudozygocactus
Rhipsalidopsis
Rhipsalis
Schlumbergera
Zygocactus
Hatiora
Rhipsalidopsis
Epiphyllopsis
Pseudozygocactus
Lepismium
Pfeiffera
Acanthorhipsalis
Lymanbensonia
Rhipsalis
Erythrorhipsalis
Schlumbergera
Zygocactus
Epiphyllanthus
Material and methods
Plant material and taxon sampling
The plant material used was obtained from the living collections of the Botanical Garden Berlin and the Botanical
Gardens of the University of Bonn, Germany. The taxonomic synopsis of the Hylocereeae, including verification
of types and an extensive synonymy provided by Bauer (2003a) was taken as name source and to guide the taxon
sampling. We have sampled 60 species including 17 infraspecific taxa. Taxa missing in the sampling are Disocactus
aurantiacus (Kimnach) Barthlott, D. salvadorensis Cerén, J. Menjívar & S. Arias, Epiphyllum grandilobum Britton
& Rose, E. hookeri subsp. pittieri (F.A.C. Weber) Ralf Bauer, E. laui Kimnach, Hylocereus escuintlensis Kimnach,
H. guatemalensis (Eichlam ex Weingart) Britton & Rose, H. purpusii (Weingart) Britton & Rose, H. trigonus Safford,
Weberocereus bradei (Britton & Rose) G.D. Rowley, and W. alliodorus Gómez-Hinostrosa & H.M. Hernández. If
possible, we included several accessions from the same species from different localities. To verify the monophyly of
the Hylocereeae, the clade that includes the Hylocereeae, the Pachycereeae Buxbaum and Echinocereeae (Hernández-
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 5
Hernández et al. 2011) was represented with its major sublineages as part of the ingroup. Calymmanthium substerile F.
Ritter, Copiapoa coquimbana (Karwinsky ex Rümpler) Britton & Rose, Frailea pumila Britton & Rose and Blossfeldia
liliputana Werdermann were used as outgroup taxa. All sampled taxa with their origins and voucher information are
listed in Appendix 1.
Isolation of genomic DNA
For isolation of total genomic DNA, most of the water-storing tissue was removed from the stems and the remaining
cortex tissue was dried over silica-gel in a drying chamber for two days at 50°C. This treatment significantly lessened
the amount of mucilage during extraction. The dried plant material was homogenized using a mixer mill (Retsch
MM200, Haan, Germany) and extracted using a CTAB protocol as described in Korotkova et al. (2011). Concentration
and purity of the DNA (A260/A280 and A260/A230 ratios) were measured using a spectrophotometer (NanoDrop,
peqLab, Erlangen, Germany). The original genomic DNA was stored at -30°C and working dilutions with a standard
concentration of 10ng/µl were made for use in PCR.
Amplification and sequencing
The trnK/matK region was amplified in overlapping halves using the primer pair trnK-F (Wicke & Quandt 2009)
and ROSmatK655R (Worberg et al. 2009) for the 3′ fragment and ACmatK500F (Müller & Borsch 2005) trnK-2R
(Johnson & Soltis 1995) or psbA5’R (Shaw et al. 2005) for the 5′ fragment. The use of the reverse primer psbA5′R that
anneals to the psbA gene allows to obtain the full sequence at the 5′ end of the trnK intron, and additionally covers the
trnK-psbA intergenic spacer. Amplification conditions were: an initial denaturation step 1 min 30 sec at 96°C followed
by 30 sec at 95°C, 1 min at 50°C, 1 min 30 sec at 72°C, for 34 cycles and a final extension step of 20 min at 72°C.
The rps3-rpl16 intergenic spacer and the rpl16 intron were co-amplified using the primers CArps3F, which anneals to
the rps3 exon, and CArpl16R (Korotkova et al. 2010), which anneals to the rpl16 3′ exon. Amplifying from the rps3
exon allows obtaining reads covering the rpl16 intron in full. Amplification conditions were: an initial denaturation
step 2 min at 95°C, followed by 35 cycles of 30 sec at 95°C, 1 min at 55°C, 1 min 30 sec at 72°C and a final extension
step of 15 min at 72°C. The trnL-F region was amplified using the universal primers C and F (Taberlet et al. 1991).
Amplification conditions were the same as for rpl16, except that the annealing temperature was set to 52°C. The
amplification primers were also used for sequencing. The trnL-F region could mostly be completely covered by just
the read of primer F and an additional read of primer C was only necessary when pherograms were not readable after
large polyA/Ts in the 3′ end of the trnL intron. Amplification reactions for all regions contained 4 μl DNA template
with a concentration of 10 ng/μl, 5 μl Taq buffer S (PeqLab, Erlangen, Germany), 2 μl of each primer (20 pm/μl), 10 μl
dNTPs (each 1.25 mM), and 1.5 units of Hot Taq DNA Polymerase (PeqLab). Ultrapure H2O was added to obtain a total
volume of 50 μl. While the other PCR fragments were purified directly using the Geneaid Gel/PCR DNA Fragments
Extraction Kit before sequencing, the trnL-F products were electrophoresed for 2 hours on a 2% agarose gel and then
excised. This was necessary because of frequent non-specific bands. Sequencing was performed by Macrogen Europe
(Amsterdam, The Netherlands). Pherograms were examined for sequencing errors by eye and the reads corrected if
necessary, sequences were assembled using the program PhyDE v. 0995 (Müller et al. 2005+).
Sequence alignment, coding of length mutational events
Sequences were initially aligned using MUSCLE (Edgar 2004) and manually adjusted using PhyDE v. 0995 (Müller
et al. 2005+) following a motif alignment approach and the rules laid out by Kelchner (2000) and Löhne & Borsch
(2005). Seventeen sequence parts of uncertain homology (online supplement Table S1) had to be excluded; otherwise
sequences could be aligned unambiguously. Indels were coded according to the Simple Indel Coding method (Simmons
& Ochoterena 2000) using the Indel Coder option in SeqState v. 1.40 (Müller 2005b). Inversions were placed separately
during alignment and reverse-complemented prior to subjecting the matrices for phylogenetic analysis. They were not
coded as previous datasets have shown inversions within Cactaceae plastid regions to be homoplastic (Korotkova et al.
2011). The alignments are available in TreeBase (http://www.treebase.org, study ID S21224) or from the authors.
Phylogenetic analyses and topological tests
The search for the most parsimonious tree was carried out in PAUP* v. 4.0b10 (Swofford 1998) using the parsimony
ratchet (Nixon 1999). A command file for PAUP* containing the ratchet commands was generated using PRAP (Müller
2004). Ratchet settings were 200 iterations with 25% of the positions randomly upweighted (weight = 2) during each
replicate and 10 random addition cycles. Tree lengths and homoplasy indices (CI, RI, and RC) were calculated in PAUP.
Support for the nodes found by the parsimony ratchet was calculated by jackknifing (JK, (Farris et al. 1996)) using the
KOROTKOVA ET AL.
6 • Phytotaxa 327 (1) © 2017 Magnolia Press
settings based on the optimal parameters (Müller 2005a), with 10.000 replicates, tree-bisection-reconnection (TBR)
branch swapping, 36.788% of characters being deleted in each replicate, and one tree held during each replicate.
The best-fitting nucleotide substitution models were evaluated with jModeltest 2.1.7 (Darriba et al. 2012) with 11
substitution schemes and an ML optimized base tree. Each intron and intergenic spacer as well as the matK CDS were
analysed separately. Model fit was evaluated using the Akaike Information Criterion as implemented in jModeltest.
The models selected were: trnK intron and matK: TVM+I+G, rps3-rpl16 spacer: TIM2, rpl16 intron: TIM1+I+G, trnL
intron: TVM+I+G, trnL-F spacer: TVM+G. The model was set for each of the partitions individually, including the
base frequencies, substitution rates, proportions of invariable positions and the shape parameters were set as priors
for each partition as well. Bayesian MCMC Inference was performed using MrBayes 3.2.2 (Ronquist & Huelsenbeck
2003). Analyses were performed in combination with coded indels, then applying the restriction site (binary) model for
the indel partition. Four simultaneous runs of Metropolis-coupled Markov Chain Monte Carlo (MCMCMC) analyses,
each with four parallel chains, were performed for 20 million generations, saving one tree every 1000th generation,
starting with a random tree. The burn-in was determined using Tracer v1.6 (Rambaut et al. 2014) and set after the first
two million generations, the remaining trees were summarized in a majority rule consensus tree. Maximum Likelihood
(ML) analyses were performed with RAxML (Stamatakis 2014) using RAxML GUI v. 1.3. (Silvestro & Michalak
2012), using the GTR+G +I model of sequence evolution and the “ML + thorough bootstrap” option with 10.000
bootstrap replicates (Stamatakis et al. 2008). Tree annotation and layout of the BI and ML trees were done using
TreeGraph2 (Stöver & Müller 2010).
Alternative topologies regarding the placement of Pseudorhipsalis ramulosa (Salm-Dyck) Barthlott were
evaluated using topological tests. As the exact position species was unresolved, we wanted to exclude the possibility
that the dataset may still contain signal for this taxon to be sister to any of the subclades. The Bayesian topology with
P. ramulosa unresolved was taken as reference and three alternative topologies to be tested were manually constructed
using TreeGraph2: 1) P. ramulosa sister to the rest of the Pseudorhipsalis clade, 2) P. ramulosa sister to the Epiphyllum
clade, 3) P. ramulosa unresolved within the Disocactus clade. Alternative topologies were evaluated under the parsimony
and likelihood criteria in PAUP*. A Templeton test (Templeton 1983) was performed under parsimony in PAUP* with
the combined nucleotide matrix. A Kishino-Hasegawa (KH) test (Kishino & Hasegawa 1989) was performed with the
combined matrix under the likelihood criterion in PAUP* and TIM1+I+G model settings as obtained using jModeltest
2.1.7 as described above for the combined dataset.
Results
Sequence characteristics
The final alignment contained 5367 characters. After exclusion of parts of uncertain homology (see Appendix 2) and
trimming the uneven beginning and end, the resulting sequence matrix comprised 4915 nucleotide characters of which
3931 characters were constant, 511 variable but not informative and 437 characters were parsimony-informative. Of
the 229 coded indels, three were constant, 141 were uninformative and 85 coded indels were parsimony-informative.
The rps3-rpl16 spacer and the rpl16 intron provided the highest percentage of variable characters (13 %, Table 2) as
a single locus.
Five inversions were detected in the dataset, one in the matK CDS and four in the rpl16 intron (Table 2, 3).
TABLE 2. Sequence characteristics of the individual partitions in the dataset.
trnK intron matK rps3-rpl16 rpl16 intron trnL intron trnL-F spacer
Dataset including hotspots
Position in the alignment 1–754, 2295–2601 755–2294 2602–2762 2772–4088 4089–4848 4899–5341
Aligned length 1061 1540 161 1317 760 443
Mean length (SD) 881 (178) 1471 (293) 113 (65) 888 (280) 500 (131) 337 (79)
% GC 32,893 32,623 27,993 29,868 28,085 31,735
Number of inversions 0 1 0 4 0 0
Dataset excluding hotspots
Position in the alignment 1–687, 2224–2442 688–2223 2443–2595 2605–3815 3816–4443 4494–4915
Aligned length 906 1536 153 1219 627 453
Mean length (SD) 794 (157) 1530 (1,46) 107 (62) 933 (153,4) 479,6 (56) 343,3 (5,6)
% variable characters 14,2 13,6 23,5 28,5 25,7 21,1
% informative characters 7 5,4 16,3 13,7 12,9 11,4
Number of coded indels 21 5 8 83 58 42
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 7
FIGURE 2A. Majority-rule consensus tree from Bayesian inference. Values above branches are Posterior Probabilities (left) and Bootstrap
support values from Maximum Likelihood (10.000 replicates) calculated with RAxML GUI using the “ML + thorough bootstrap” option,
values below branches are Jackknife support values (10.000) calculated in PAUP. (-- denotes ML BS support below 50, n.f.: node not
found). Taxon names in the cladogram reflect hitherto accepted names (Bauer 2003a, Hunt 2006), with the exception of new names in
Disocactus published by Cruz et al. (2016). The new/updated generic concepts presented here are annotated with brackets.
KOROTKOVA ET AL.
8 • Phytotaxa 327 (1) © 2017 Magnolia Press
FIGURE 2B. The hylocereoid clade.
TABLE 3. Inversions found in the dataset.
Position in
alignment
region length Motif—original state/inverted state Occurrence
1531–1534 matK 4 nt MAAA / TTTK throughout the dataset
3097–3102 rpl16 intron 6 nt TAGAAA / TTTCTA Aporocactus flagelliformis isolate CA389
3441–3444 rpl16 intron 6 nt TTCA / TGAA Aporocactus flagelliformis isolate CA389
3561–3570 rp16 intron 10 nt GCATTGCTAA / TTAGCAATGC Hylocereus, Selenicereus and Weberocereus glaber
3581–3604 rpl16 intron 24 nt GCATTGCTAAAATAAAATAAGAGC
/ GCTCTTATTTTATTTTAGCAATGC
Weberocereus (not W. glaber), Aporocactus, outgroup
except Blossfeldia, Calymmanthium, Copiapoa
Phylogenetic inference
The trees obtained from Maximum Parsimony (MP, not shown), Bayesian Inference (BI) and Maximum Likelihood
(ML) are congruent regarding the major clades found. Figure 2 shows the Bayesian majority-rule consensus tree. The
phylogram from the ML analysis is shown in the online supplement. The support from BI and ML differs notably—
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 9
many nodes that receive high (>0.95 PP) or maximum support from BI are only moderately supported by MLBS and
some terminal nodes are not found.
The Hylocereeae clade and its major subclades
A Hylocereeae clade is highly supported in all analyses (1 PP, 95% MLBS, 98% JK), but the Hylocereeae as currently
circumscribed are polyphyletic (Fig. 2). They would become monophyletic if Acanthocereus (Engelmann ex A. Berger)
Britton & Rose were to be included and Strophocactus was excluded.
The well supported clade of the Hylocereeae as depicted here includes four main lineages: first, the Acanthocereus
(incl. Peniocereus subg. Pseudoacanthocereus) clade, Acanthocereus with three species included is found as a highly
supported lineage (1 PP, 81 % MLBS, 90 % JK), second, the two species of Aporocactus (represented by several
samples) are depicted in an only weakly supported lineage, and two larger subclades that we refer to as the hylocereoid
clade and the phyllocactoid clade.
The hylocereoid clade (1 PP, 65% MLBS, 68% JK) contains the genera Hylocereus, Selenicereus, and Weberocereus.
Hylocereus and Selenicereus together form a highly supported clade (1 PP, 98% MLBS, 99% JK). Selenicereus is
polyphyletic and for the most part forms a grade with a highly supported (1 PP, 91% MLBS, 94% JK) monophyletic
genus Hylocereus nested in it. Five species of Weberocereus (including the type species, W. tunilla Britton & Rose)
are recovered as a monophyletic group (1 PP, 82 % MLBS, 80 % JK) and are sister to the Selenicereus/Hylocereus
clade. However the remaining two species [W. tonduzii (F.A.C. Weber) G.D. Rowley and W. glaber (Eichlam) G.D.
Rowley, including subsp. glaber and subsp. mirandae (Bravo) U. Guzmán] appear within the Selenicereus grade. The
phyllocactoid clade is maximally supported by Bayesian Inference but not recovered by Maximum Likelihood and
only supported with 53% JK. It contains four subclades corresponding largely to the genera Epiphyllum, Disocactus
and Pseudorhipsalis, yet Pseudorhipsalis is found polyphyletic with P. ramulosa (Salm-Dyck) Barthlott resolved
separately from Pseudorhipsalis in a tritomy with Epiphyllum and Disocactus.
Strophocactus falls entirely outside the Hylocereeae clade and is itself polyphyletic. Its three species are resolved
at two different positions with high to maximal support. The first clade (1 PP, 82% MLBS, 82% JK) contains S. witti
(K. Schumann) Britton & Rose, Pseudoacanthocereus sicariguensis (Croizat & Tamayo) N.P. Taylor, P. brasiliensis
(Britton & Rose) F. Ritter and Neoraimondia herzogiana (Backeberg) Buxbaum & Krainz. The second clade (1 PP, 98%
MLBS, 99% JK) is resolved within the Echinocereeae and contains Strophocactus testudo (Karwinsky ex Zuccarini)
Ralf Bauer and S. chontalensis (Alexander) Ralf Bauer.
Discussion
The Hylocereeae clade
The main characteristic of the Hylocereeae is their predominantly hemi-or holoepiphytic habit; no clear morphological
synapomorphies can be reported for this group. The members of Hylocereeae are highly variable in morphology and
the inclusion of Acanthocereus makes them even more heterogeneous. As depicted here, the Hylocereeae contain
terrestrial, scandent, hemiepiphytic and holoepiphytic species. Many of the species form aerial roots. The stems can
be ribbed and spiny and succulent to various degrees, or flattened and leaf-like. Flowers and floral syndromes are very
diverse: there are very large, nocturnal flowers as well as bright red flowers, presumably bird-pollinated, and small,
white flowers. The two major Hylocereeae subclades are also distinguishable morphologically as pointed out by Cruz
et al. (2016). The hylocereoid clade (1.0 PP, 65% MLBS, 68% JK) contains predominantly scandent or epiphytic
species with spiny and ribbed stems, and nocturnal flowers. In contrast, the phyllocactoid clade (1.0 PP, 62% MLBS,
55% JK) contains mainly the epiphytic species with flattened, spineless leaf-like stems.
Internal relationships within Hylocereeae and clades corresponding to genera
The Acanthocereus (including Peniocereus subgen. Pseudoacanthocereus) clade
We find a clade of Acanthocereus tetragonus (Linnaeus) Hummelinck as sister to A. castellae (Sánchez-Mejorada)
Lodé and A. chiapensis Bravo supported by 1 PP, 81% MLBS, 90% JK.
Acanthocereus had been included in Hylocereeae by previous authors (e.g., Gibson & Nobel 1986), but was later
placed in Echinocereeae (Barthlott & Hunt 1993), Pachycereeae (Anderson 2001), and most recently in Phyllocacteae-
Corryocactinae (Nyffeler & Eggli 2010). The sister relationship of Peniocereus subg. Pseudoacanthocereus and
KOROTKOVA ET AL.
10 • Phytotaxa 327 (1) © 2017 Magnolia Press
Acanthocereus has also been shown before (Arias et al. 2005, Nyffeler 2002). Nevertheless, only recently the species
included in Peniocereus subg. Pseudoacanthocereus were transferred to Acanthocereus (Lödé 2013) but without any
proper analysis of further data.
Our results confirm the results by Arias et al. (2005) that Acanthocereus is only monophyletic if it includes
Peniocereus subgen. Pseudoacanthocereus. Peniocereus was studied in detail by Arias et al. (2005) who found
Peniocereus subg. Pseudoacanthocereus intermixed with species of Acanthocereus, albeit hardly any support
for the clade (55% JK, based on trnL-F). Acanthocereus previously included one to six species (Anderson 2001),
and it was characterized by long infundibuliform flowers, and pericarpels with few spines. Peniocereus subgen.
Pseudoacanthocereus includes nine species (Bravo-Hollis 1978) and the recently described Peniocereus canoensis P.R.
House, Gómez-Hinostrosa & H.M. Hernández from Honduras (House et al. 2013) all of which possessing dimorphic
stems. The current circumscription of Acanthocereus (see the taxonomic synopsis provided herein) includes all of
these species. Young stems have 3–10 ribs, and adult stems have 3 or fewer ribs, or are cylindrical. Flowers are long
or medium-sized, infundibuliform or tubular-infundibuliform, and areoles have flexible spines on pericarpels. Two
species, namely P. canoensis and A. hesperius D.R. Hunt were not included in our molecular phylogenetic analyses.
However, the mentioned morphological characters are synapomorphic. As these phylogenetically unsampled species
also possess the same morphological characters, we assume that they are part of the Acanthocereus clade. The species
grow in the tropical deciduous forests between Mexico and Costa Rica, in coastal regions up to 1000 m a.s.l.
The Aporocactus clade
Aporocactus is weakly supported as monophyletic (0.6 PP, --MLBS, 54% JK). Its position within the Hylocereeae
remains unresolved. Nevertheless, our results are congruent with those of Cruz et al. (2016) who likewise found
Aporocactus distant from Disocactus. Aporocactus was originally established as a genus by Lemaire (1860) but it was
not generally accepted afterwards and was included in Cereus [a more detailed classification history of Aporocactus
was given by Hunt (1989)]. Only Britton & Rose (1920) reinstated the genus Aporocactus. Later authors followed the
latter proposal (see e.g. Backeberg 1959, Bravo-Hollis 1978) until Barthlott (1991) included Aporocactus in Disocactus
because all the species form hybrids with other Disocactus taxa (W. Barthlott, pers. comm. to N. K.).
Cruz et al. (2016) argued for reinstating Aporocactus as a separate genus and we follow this view (see Taxonomic
synopsis). Aporocactus is endemic to Mexico, where it preferably inhabits tropical montane cloud forests. Apart from
a further clarification of relationships of Aporocactus within the Hylocereeae, work is needed to more reliably delimit
species within the genus, since only two species are accepted (Bauer 2003a) while the morphological variation among
populations is significant and still needs to be evaluated to support species recognition.
The Hylocereus / Selenicereus clade
Hylocereus is confirmed as monophyletic while Selenicereus forms a grade in which Hylocereus is nested (Fig. 2B).
Within Hylocereus, there are two highly supported clades that largely correspond to the two current sections,
but neither of them is monophyletic. The clade of Hylocereus sect. Hylocereus (Fig. 2B) contains the type species H.
triangularis Britton & Rose and corresponds to Hylocereus in its traditional circumscription, e.g. sensu Britton & Rose
(1920). This clade includes the earlier-proposed monotypic genus Wilmattea Britton & Rose [W. minutiflora (Britton
& Rose) Britton & Rose], that was originally separated from Hylocereus due to its smaller flowers and the lack of a
floral tube.
The second clade (Salmdyckia clade, Fig. 2B) contains most of Hylocereus sect. Salmdyckia D.R. Hunt. It was
transferred from Selenicereus to Hylocereus only recently by Bauer (2003a). This section was based on the genus
Mediocactus Britton & Rose that was characterized by having characters of both Hylocereus and Selenicereus [see
Hunt (1989) for a detailed classification history and notes on typification]. Buxbaum (1962) regarded Mediocactus to
be close to Hylocereus, while Hunt (1989) suggested including it in Selenicereus and this was followed in subsequent
treatments (e.g., Anderson 2001, Barthlott & Hunt 1993). The transfer of Selenicereus sect. Salmdyckia D.R. Hunt to
Hylocereus was based on unpublished DNA sequence data of Robert Wallace presented at an IOS congress in 1996
and was adopted by Bauer (2003a), Taylor & Zappi (2004), and Hunt (2006). Most species comprising the Salmdyckia
clade are native to South America, except H. ocamponis, which occurs in Mexico.
The Selenicereus grade is formed by three lineages and several accessions of S. inermis (Otto) Britton & Rose
that do not form a clade and remain unresolved (Fig. 2B). They are also not found closely related to the Salmdyckia
clade, contrary to the classification according to Bauer (2003a). The monotypic genus Cryptocereus Alexander
[C. anthonyanus Alexander ≡ Selenicereus anthonyanus (Alexander) D.R. Hunt] is resolved within Selenicereus.
Backeberg (1959) additionally included Werckleocereus imitans Kimnach & Hutchison in Cryptocereus and suggested
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 11
a close relationship to phyllocactoid genera, i.e. the Epiphyllum alliance. These species differ from typical members of
Selenicereus having flat-stemmed epiphytes with stems resembling fernleaves (Fig. 3). Our data confirm the proposal
by Hunt (1989) who pointed out a possible affinity with Werckleocereus Britton & Rose, as well as its inclusion in
Selenicereus because it shares the spiny pericarpel.
The genera Hylocereus and Selenicereus are morphologically similar as both contain scrambling or climbing
cacti with large, usually white nocturnal flowers. Britton & Rose (1920) originally defined Hylocereus to possess
pericarpels covered by scales while the pericarpels in Selenicereus have hairs or spines. The transfer of Selenicereus
sect. Salmdyckia to Hylocereus (Bauer 2003a) included species with spines on the pericarpel in Hylocereus so that
the original concept of Britton & Rose did not apply anymore. Bauer (2003a) had justified this transfer only by
unpublished sequence data of Wallace, referred to in Taylor and Zappi (2004) and did not mention any morphological
characters to substantiate his new concept of Hylocereus.
Our results confirm the finding of earlier molecular phylogenetic studies, using either plastid or nuclear DNA
sequences. All of them have shown that there is no separation between Hylocereus and Selenicereus, although only
few species were sampled (Arias et al. 2005, Bárcenas et al. 2011, Cruz et al. 2016, Hernández-Hernández et al. 2011,
Plume et al. 2013). The most extensive dataset generated so far (plastid rpl32-trnL, trnQ-rps16 and psbD-trnT and
nuclear ITS) also found Hylocereus nested in a paraphyletic Selenicereus (Plume et al. 2013). The same conclusion
was reached using a morphological and anatomical comparison of Hylocereus and Selenicereus (Gómez-Hinostrosa et
al. 2014). Therefore, we merge both genera under the name Selenicereus and provide the necessary new combinations
(see Taxonomic synopsis). A next level of study is required in Selenicereus concerning the delimitation of several
species which remain insufficiently known, e.g. Selenicereus ocamponis/S. purpusii, S. triangularis/S. trigonus, S.
vagans/S. murrillii, and S. costaricensis/S.monacanthus. These taxa require insights from extensive field studies and a
combination of molecular, morphological and ecological data.
The Weberocereus clade
Weberocereus is depicted as polyphyletic. A clade containing five species, including W. tunilla (F.A.C. Weber) Britton
& Rose—the type species—is supported with 1 PP, 82% MLBS, 80% JK, but W. glaber and W. tonduzii are resolved at
different positions within Selenicereus. The Weberocereus clade has two subclades: W. tunilla and W. trichophorus are
resolved as sisters with maximum support. These two species are morphologically similar, with thin (less than 15 mm
in diameter), pendent stems, campanulate flowers, and purple fruit pulp. The second subclade contains Weberocereus
frohningiorum Ralf Bauer, W. imitans and W. rosei (Kimnach) Buxbaum, but is supported by only 0.5 PP, 54% MLBS
and is not found by the MP analysis, although W. rosei and W. imitans are highly supported as sister species. These three
species constitute the Eccremocactus group sensu Bauer (2003a) and are morphologically characterized by flattened or
3-ribbed stems, and white fruit pulp. Among the hylocereoid clade, W. imitans and W. rosei share the flat stems with
Selenicereus anthonyanus, and together the three species were included in Cryptocereus (Backeberg 1959). However,
our results show that Weberocereus species are not related to S. anthonyanus. The flat stem character state is convergent
between clades within Hylocereeae and also occurs in Disocactus, Epiphyllum and Pseudorhipsalis. Weberocereus
is morphologically heterogeneous in the current circumscription and is not well separated from Hylocereus or
Selenicereus. The main difference is that the flowers of Weberocereus are smaller (less than 7 cm in length) compared
to those of Hylocereus/Selenicereus. Weberocereus glaber and W. tonduzii (type species of Werckleocereus) represent
the Werckleocereus group (sensu Bauer 2003a) and are resolved within the Hylocereus/Selenicereus assemblage, with
which they share 3-ribbed stems and white nocturnal flowers with dark spiny pericarpels. So, morphologically, they do
fit well within the Hylocereus/Selenicereus assemblage.
The Epiphyllum clade
A clade corresponding to Epiphyllum and including the type E. phyllanthus (Linnaeus) Haworth is supported with 1 PP,
94% MLBS, 98% JK, while three former species [E. crenatum (Lindley) G. Don, E. anguliger (Lemaire) H.P. Kelsey
& Dayton and E. lepidocarpum Britton & Rose are part of Disocactus. Our results are thus consistent with those
obtained by Cruz et al. (2016) to exclude these three species. Epiphyllum chrysocardium Alexander is resolved as sister
to the rest of Epiphyllum. It is a remarkable species with large white flowers and broad stems resembling fern leaves,
known only from few collections from Chiapas and Tabasco, Mexico (Figs. 1G, 3A). It was originally described as
a member of Epiphyllum, subsequently Backeberg (1959) placed it in his genus Marniera Backeberg, emphasizing
that Marniera has hairy or bristly pericarpels while Epiphyllum has naked pericarpels. Marniera as a genus was later
no longer accepted because its type M. macroptera (Lemaire) Backeberg cannot be satisfactorily identified (Kimnach
1991), although the generic name as such was never formally rejected. Until recently E. chrysocardium was treated
KOROTKOVA ET AL.
12 • Phytotaxa 327 (1) © 2017 Magnolia Press
under Selenicereus because it has spiny fruits, which is untypical for Epiphyllum (Bauer 2003a, Kimnach 1991). Our
data and those obtained by (Cruz et al. 2016) confirm this species to be part of Epiphyllum.
The rest of Epiphyllum consists of two well supported clades. The Oxypetalum clade (1 PP, 77% MLBS, 79%
JK) is characterized by stamens in two series. The Phyllanthus clade (1 PP, 68% MLBS, 72% JK) includes E. baueri
R. Dorsch and E. cartagense (F.A.C. Weber) Britton & Rose and a subclade (1 PP, 85% MLBS, 62% JK) of species
that have been regarded as taxonomically difficult within Epiphyllum. Numerous subspecies were described within
this complex, but in the other extreme, they have been all treated under the name E. phyllanthus (Dodson & Gentry
1977, Kimnach 1964). Currently two species are recognized within this complex (Bauer 2003a): E. hookeri Haworth
with three subspecies [subsp. columbiense (F.A.C. Weber) Ralf Bauer, subsp. guatemalense (Britton & Rose) Ralf
Bauer and subsp. pittieri], and E. phyllanthus with one subspecies [subsp. rubrocoronatum (Kimnach) Ralf Bauer].
Our data show all E. phyllanthus accessions forming a clade (1 PP, 63% MLBS, 62% JK) while E. phyllanthus subsp.
rubrocoronatum is not part of that clade but resolved as sister to E. hookeri (1 PP, 89% MLBS, 88% JK). The two
subspecies of E. hookeri that were sampled are found as sisters to each other, but do not cluster with the third E.
hookeri accession. Therefore, a more comprehensive evolutionary analysis including morphological and molecular
characters and all known taxa related to the E. phyllanthus/E. hookeri complex is required to understand species limits
(our study did not include E. grandilobum, E. hookeri subsp. pittieri or E. laui).
Epiphyllum, as it is currently circumscribed, is a morphologically distinct genus and easily recognisable by
flattened stems with often crenate or lobed stem margins and large, white nocturnal flowers with a well-developed
floral tube. Its confusing classification history has been reviewed several times (Backeberg 1959, Britton & Rose 1923,
Buxbaum 1969).
FIGURE 3. Convergent fern-like flattened stems in A) Epiphyllum chrysocardium, B) Weberocereus imitans, C) Epiphyllum anguliger,
D) Selenicereus (Cryptocereus) anthonyanus (photos by W. Barthlott, Lotus-Salvinia.de).
The Disocactus clade
The clade that includes the nomenclatural type D. biformis (Lindley) Lindley is supported with 1 PP, 78% MLBS, 86 %
JK. This confirms the results of Cruz et al. (2016), who recovered a Disocactus clade with the same composition with
higher support from 96% BS and 96% JK, and 1 PP from Bayesian Inference (ML not calculated therein). Resolution
and node support within Disocactus are generally low.
Disocactus was originally described by Lindley (1845) for D. biformis and was characterized by dimorphic stems
and small flowers. The widely-used concept of Disocactus was established by Barthlott (1991), who amplified the
genus by including the genera Aporocactus, Nopalxochia Britton & Rose, and Heliocereus (A. Berger) Britton &
Rose, all with diurnal, large, bright red or pink flowers, to Disocactus. In this sense, Disocactus is polyphyletic, since
Aporocactus is resolved outside and three Epiphyllum species (see above) are resolved within Disocactus with high
confidence. This is also consistent with the results obtained by Cruz et al. (2016), who also already published the
necessary new combinations for these Epiphyllum species under Disocactus. Disocactus crenatus (Lindley) M.Á.
Cruz & S. Arias (2016: 157) has diurnal flowers, what had always appeared as unusual within the exclusively night-
flowering Epiphyllum. Flowers of D. crenatus and D. anguliger (Lemaire) M.A. Cruz & S. Arias (2016: 157) have
in fact stamens inserted in two series, a character that is common in Disocactus such as the flowers that open in the
evening and last for several days. Furthermore, both species can hybridize with other species of Disocactus, but not of
Epiphyllum (Bauer 2009).
The Pseudorhipsalis clade and the position of P. ramulosa
All species and subspecies were sampled in our study and Pseudorhipsalis is found as polyphyletic. A Pseudorhipsalis
clade including the nomenclatural type P. alata (Swartz) Britton & Rose receives maximum support in all analyses, but P.
ramulosa is not part of that clade, its exact position within the phyllocactoid clade remains unresolved. Pseudorhipsalis
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 13
amazonica (K. Schumann) Ralf Bauer is resolved as part of the Pseudorhipsalis clade with maximal support. This
species is unusual as it is the only cactus to have blue tepals. Schumann regarded this as so unique that he placed it in an
own monotypic genus Wittia K. Schumann (Schumann 1903). A new generic name Wittiocactus Rauschert (1982: 558)
was published later to replace Schumann’s illegitimate name Wittia because Wittia Pantocsek (1889: 110) is a genus
of Bacillariophyta. Wittiocactus was then included in Disocactus (Hunt & Taylor 1990), yet still unresolved. Bauer
(2002) moved it to Pseudorhipsalis because of many common characters, e.g. seedling morphology. The clade of P.
lankesteri (Kimnach) Barthlott, P. himantoclada (Roland-Gosselin) Britton & Rose and P. alata (Swartz) Britton &
Rose is supported by 1 PP but not found by the MP analysis. These three species are unique by forming pollen tetrads,
a character found in no other Cactaceae species (Barthlott 1975, Leuenberger 1976).
Pseudorhipsalis was first described by Britton & Rose (1923: 213) with P. alata and P. himantoclada, two species
that had been previously placed in Rhipsalis, and remained in this circumscription until the 1990ies. Subsequently two
different generic concepts were suggested: Kimnach (1993) included Pseudorhipsalis in Disocactus, while Barthlott
(1991) treated Pseudorhipsalis as distinct genus and expanded it to include six further Central American species
showing small flowers. Barthlott’s concept is largely confirmed by the plastid tree obtained here, while our data show
no indication for merging Pseudorhipsalis into Disocactus.
Pseudorhipsalis ramulosa is resolved outside the Pseudorhipsalis clade and found in a polytomy with Disocactus
and Epiphyllum. We tested alternative topologies for P. ramulosa being sister to either Epiphyllum, Disocactus or the
rest of Pseudorhipsalis. The tree with P. ramulosa unresolved was significantly favoured over the alternative topologies
tested (online supplement S3). The affinities of P. ramulosa were unclear for a long time. It was originally described as
Cereus ramulosus Salm-Dyck (1834: 340), then treated as Rhipsalis ramulosa (Salm-Dyck) Pfeiffer, and still included
in Rhipsalis by Britton & Rose (1920) after they had established the genus Pseudorhipsalis. They mentioned its
similarity with Pseudorhipsalis but did not include it therein (Britton & Rose 1920). Kimnach (1961) included P.
ramulosa in Disocactus whereas Barthlott (1991) combined it into Pseudorhipsalis. This taxon is generally similar to
other Pseudorhipsalis species in vegetative and floral morphology, but there are also some differences. The floral tube
is less pronounced in contrast to the other Pseudorhipsalis species. P. ramulosa sets fruits without pollination, while
pollination is necessary in the other species of Pseudorhipsalis (Kimnach 1961). It is also widely distributed in tropical
America, from Mexico and Central America to western South America and Antilles (Haiti, Jamaica) while the other
Pseudorhipsalis species are much more restricted in their distribution, most are found only in Costa Rica and Panama
(Barthlott et al. 2015). It has been suggested that the self-fertility, and also the berry-like sticky fruits adapted for bird-
dispersal could explain the large distribution of P. ramulosa (Kimnach 1961). It could be a lineage within Hylocereeae
that was especially successful in colonizing a comparatively large area by adapting to selfing and bird-dispersal. This
is very similar to R. baccifera (Solander) Stearn, an epiphytic cactus with likewise small white flowers, self-pollination
and sticky, bird-dispersed fruits that has the largest distribution of all cacti (Barthlott 1983, Barthlott et al. 2015). This
independently evolved evolutionary strategy of R. baccifera and P. ramulosa would be another example for marked
convergences in cacti.
To continue in recognizing Pseudorhipsalis ramulosa under Pseudorhipsalis and thus accepting a polyphyletic
Pseudorhipsalis is not a good option in our opinion. We therefore propose to establish a new monotypic genus
Kimnachia gen. nov. for P. ramulosa (see the Taxonomic synopsis).
The phylogenetic position of the Strophocactus species
Our results show that the epiphytic genus Strophocactus is not closely related to the core Hylocereeae but is in fact
represented by two independent epiphytic lineages within Cactaceae. This is a very similar case to the earlier finding
of Lymanbensonia Kimnach to constitute an epiphytic lineage independent from Pfeiffera Salm-Dyck and Lepismium
Pfeiffer (Korotkova et al. 2010), in which it used to be included. Our finding of Strophocactus and Deamia as separate
lineages shows that epiphytism in Cactaceae evolved up to six times independently.
Strophocactus sensu Bauer (2003a) is polyphyletic. Its nomenclatural type S. wittii is found nested within
Pseudoacanthocereus F. Ritter, as sister to P. sicariguensis. Strophocactus wittii is an epiphyte from the inundation
forests in the Amazonian Igapó region. It has flattened stems that adhere to the trunks of trees through numerous aerial
roots and it is unique in Cactaceae in having water-dispersed seeds (Barthlott et al. 1997). Barthlott and Hunt (1993)
included it in Selenicereus because of the large, white flowers with spines and bristles on the receptacle it shares with the
other Selenicereus species. The two Pseudoacanthocereus species are scrambling or decumbent shrubs, with thin stems
(up to 4.5 cm in diameter), variable number of ribs (2–7) and tuberous roots; the flowers are tubular-infundibuliform,
with ribbed podaria, and areoles with bristles, and yellow to brown fruits, bearing podaria and deciduous areoles, and
white pulpe (Taylor & Zappi 2004, Taylor et al. 1992). The genus Pseudoacanthocereus and S. wittii share the flower
KOROTKOVA ET AL.
14 • Phytotaxa 327 (1) © 2017 Magnolia Press
shape, areoles with bristles, and fruit colour. Notably, P. sicariguensis occasionally forms flattened stem-segments
which are highly similar to those of S. wittii (Fig. 4). This could be regarded as a morphological character supporting
their close relationship. Furthermore, the distribution of these three species seems more gradual, because S. wittii is
Amazonian (Brazil, Colombia, Peru), P. sicariguensis is native to the Maracaibo region (Colombia, Venezuela), and
P. brasiliensis is native to the Eastern Caatinga-agreste (Brazil) (Barthlott et al. 2015). Therefore, we suggest a single
genus for these three species and merge them under the oldest name Strophocactus. The necessary new combinations
are provided in the Taxonomic synopsis.
FIGURE 4. Strophocactus. A) S. wittii, flowering specimen (Schmidt s.n., cultivated at the Botanic Garden Bonn). B) Strophocactus
wittii (left) and Strophocactus (Pseudoacanthocereus) sicariguensis (right), both forming flattened stems [photos by W. Barthlott, Lotus-
Salvinia.de].
Strophocactus testudo and S. chontalensis (Fig. 5) form a highly-supported clade (1 PP, 98% MLBS, 99% JK),
which is found as sister to the subtribe Pachycereinae. Strophocactus testudo [≡ Deamia testudo (Karwinsky) Britton
& Rose] is the nomenclatural type of Deamia, a monotypic genus originally established by Britton & Rose (1920:
212) and maintained as such until Buxbaum (1965) placed it in Selenicereus because of its flowers. Barthlott and
Hunt (1993) maintained the species within Selenicereus because of the flower shape, spines and bristles on the stems
and flowers, and spines persistent in fruit. Strophocactus chontalensis has originally been described as Nyctocereus
chontalensis Alexander (1950: 131), for sharing the thin, cylindrical stems and ribs, although the roots are fibrous and
the flowers shorter. Then it was moved to Selenicereus by Kimnach (1991) considering the presence of aerial roots
and spines on the flowers. Most recently it was transferred to Deamia by Doweld (2002a) because it shares the micro-
morphology of the seeds with D. testudo.
Strophocactus was originally established as a monotypic genus (Britton & Rose 1913: 262) and remained in this
circumscription (Table 1), based on the flattened stems, the epiphytic habit, and very close areoles on the margin of
the ribs, with flexible spines. In fact Berger (1905) and Britton & Rose (1920) pointed out a similarity to Epiphyllum
by the 2-winged stems, and to Selenicereus by large flowers with hairs and bristles. Taking these characters into
account, Hunt (1989) transferred Strophocactus to Selenicereus. The reinstatement of Strophocactus with three species
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 15
previously placed in Selenicereus was suggested by Bauer (2003a) and was based on unpublished sequence data of
Robert Wallace reported by Hunt (2000), which is also clearly mentioned in Bauer’s text. Hunt (2006) adapted this
newly circumscribed Strophocactus, even though R. Wallace never published his data. Nyffeler and Eggli (2010)
additionally included Cryptocereus anthonyanus Alexander in Strophocactus, yet again based on unpublished data of
R. Nyffeler and coworkers.
FIGURE 5. Deamia. A) D. chontalensis in habitat (M. Yañez 04); B) D. chontalensis, stem (M. Yañez 05); C) D. testudo, flower (M.
Yañez 02) (photos by S. Arias).
Authors of all earlier treatments that accepted Strophocactus and Deamia as separate genera placed them together
with the other Hylocereeae (or the equivalent group). Nevertheless, Bauer (2003a) excluded Strophocactus from
Hylocereeae and suggested it might be closely related to Acanthocereus and Peniocereus. At the same time, there was
also some evidence that these two genera might as well be part of the Hylocereeae (Arias et al. 2005, Nyffeler 2002),
so the affinities of Strophocactus remained unclear. Nyffeler & Eggli (2010) then placed Strophocactus within their
Phyllocacteae-Echinocereinae (= Pachycereeae). So, although there were these hints that Strophocactus is certainly not
part of Selenicereus and possibly not part of the Hylocereeae, our study is the first to show this with high confidence.
We consider it reasonable to reinstate Deamia to include D. chontalensis (Alexander) Doweld and D. testudo, as
member of Echinocereeae. Both species are clambering or pendent shrubs, with determinate growth, wax deposits
on young stems, with hairs and spines on the flowers, red fruit and clear pulps. They are native to the Mesoamerican
region, from central Mexico (Veracruz) to Costa Rica (Heredia) (Barthlott et al. 2015, Bravo-Hollis 1978).
Inversions in the plastid regions used here
Inversions are a common kind of microstructural mutations in plastid regions used for phylogeny inference. If an
inversion is overlooked, the multiple sequence alignment will contain non-homologous, variable nucleotide characters
(Ochoterena 2009), that will result in false phylogenetic signal. We therefore point out the very common presence of
inversions in Cactaceae datasets, as several inversions have been found in the present study (Table 3).
The inversion in the matK CDS was reported earlier from Cactaceae (Korotkova et al. 2011) and is highly
homoplastic. The inferred secondary structure (Fig. 6) shows this inversion to affect only the terminal loop of a hairpin
and such hairpin-associated inversions have been shown to easily switch between closely related species and even
at population level (Quandt et al. 2003, Quandt & Stech 2004). A translation of the matK CDS shows that only one
amino acid is changed by the inversion (state “A” = lysine, state “T” = phenylalanine, asparagine or leucine) (Fig. 6).
MatK is one of the fastest evolving genes in the plastid genome (Hilu & Liang 1997, Johnson & Soltis 1995), with a
high proportion of substitutions even at the 1st and 2nd codon positions, so that it can be assumed that the amino acid
substitution caused by this inversion does not affect the gene and therefore occurs repeatedly.
The inversions in the rpl16 intron found here have not yet been reported from other Cactaceae datasets that use
this region, although we would not exclude the possibility that they do occur therein. There are two inverted motifs
directly adjacent to each other and that makes them particularly difficult to spot. Therefore, high attention needs to
be paid when aligning plastid datasets for Cactaceae, as it is obvious that small inversions are extremely frequent
in Cactaceae plastid genomes and pose a potential source of homoplasy when overlooked. This will be especially
problematic when just automated alignment algorithms are used.
KOROTKOVA ET AL.
16 • Phytotaxa 327 (1) © 2017 Magnolia Press
D. chontalensis (CA374) CTAGTAAAAGT TTTT---- ACTTTTACTA
D. chontalensis (CA218) CTAGTAAAAGT ----AAAA ACTTTTACTA
stem stemloop
D. chontalensis (CA374) CTAGTAAAAGT TTTT ACTTTTACTA
D. chontalensis (CA218) CTAGTAAAAGT AAAA ACTTTTACTA
D. chontalensis (CA374) CTAGTAAAAGT TTTT ACTTTTACTA
D. chontalensis (CA218) CTAGTAAAAGT tttt ACTTTTACTA
A) B)
C)
L V K V FT F T
D. chontalensis (CA374) CTA GTA AAA GT T TTT ACT TTT ACT A
D. chontalensis (CA218) CTA GTA AAA GT A AAA ACT TTT ACT A
L V K V KT F T
D)
E)
T
A
G
T
A
A
A
A
G
T
T
T T
G
A
C
T
T
T
T
A
C
T
A
dG = -10.1
T
A
G
T
A
A
A
A
G
T
C
A A
A
A
C
T
T
T
T
A
C
T
A
dG = -8.1
FIGURE 6. Inversion in the matK gene. A) Four independent substitutions will be assumed if the inversion is overlooked in the alignment.
B) The inverted motif corresponds to the terminal loop of a hairpin and can easily switch from one state to another. If aligned in different
columns, two independent substitution events will be assumed. C) The inverted motif reverse-complemented prior to phylogenetic analysis
represents the most accurate homology assessment. D) The motif re-inverted prior to phylogenetic analysis. E) Only one amino acid is
substituted by the inversion.
Conclusions and outlook
We have provided a first phylogenetic framework for the Hylocereeae and identified clades with high confidence that
allow a reliable re-circumscription of the Hylocereeae genera. The dense taxon sampling in the presented phylogenetic
trees can also be used to support a species-level synopsis. We are aware that relationships hypothesized on the base of
plastid data still need to be corroborated using nuclear sequences, as taxa within Hylocereeae are known to hybridize.
However, ITS, the most commonly used nuclear region for phylogeny inference, is not concerted in Cactaceae and
therefore phylogenetically misleading (Harpke & Peterson 2006, Ritz et al. 2012). Other single-locus nuclear markers
used, e.g. phyC and ppc (Hernández-Hernández et al. 2011, Ritz et al. 2012), do not significantly improve tree
resolution and support over plastid markers and in general, there are so far hardly any nuclear datasets for Cactaceae.
Therefore, a more in-depth approach to develop nuclear markers is needed and future work towards this aim will
include phylogenomic approaches and next-generation-sequencing. Further sampling of sequence characters is still
needed to improve our understanding of the relationships between the major clades of the Hylocereeae which so far
could only be resolved in part. At the same time, a phylogenetically informed checklist at species-level will be a useful
reference.
Taxonomy
Synopsis of the Hylocereeae
Our main criterion for suggesting taxonomic and nomenclatural adjustments here is the well-supported monophyly
of the respective genera. We also believe that relationships found with molecular characters should be generally
supported, or at least not be contradicted by the morphology of the plants (see discussion above). Narrow or wide
circumscription of monophyletic entities as genera will therefore depend on the consistency of morphological variation
and the possibility to recognise genera as easily as possible.
We suggest to re-define Hylocereeae to include eight genera in total: Acanthocereus, Aporocactus, Disocactus,
Epiphyllum, Kimnachia gen. nov., Pseudorhipsalis, Selenicereus, and Weberocereus. Deamia and Strophocactus are
excluded from the Hylocereeae and assigned to the Echinocereeae. A few changes on generic level compared to the
generic checklist of the Caryophyllales (Hernández-Ledesma et al. 2015) are proposed. First, we suggest amplifying
Selenicereus to include Hylocereus and Weberocereus glaber and W. tonduzii, the type species of Werckleocereus.
Therefore, Werckleocereus needs to become a new synonym of Selenicereus, not Weberocereus. Furthermore, we
establish a new genus Kimnachia for Pseudorhipsalis ramulosa. We reinstate Deamia to include two species. The
combination Deamia chontalensis (Alexander) Doweld is available while D. testudo is the type species of the genus.
Finally, we newly circumscribe Strophocactus to include Pseudoacanthocereus.
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 17
To achieve the often-desired nomenclatural stability and practicability, we have attempted to retain the generic
names that have been used for many decades as far as. Our data support reinstating earlier-proposed small segregate
genera (Deamia, Aporocactus, Strophocactus). At the same time, we find also strong support for amplifying genera,
especially Selenicereus that is twice its previous size in our new circumscription. Other clades at the generic level
remain with their moderate species numbers between 10–20 (Disocactus, Epiphyllum). Of all the Hylocereeae genera
as they were circumscribed by Barthlott and Hunt (1993), Selenicereus is least congruent with the results as found
here.
We provide a complete synonymy and information on the types. This synopsis will be also available online
through the online Caryophyllales checklist (caryophyllales.org) in the near future.
FIGURE 7. Kimnachia ramulosa f. ramulosa (left) and f. angustissima (right) (photo by W. Barthlott, Lotus-Salvinia.de). The specimen of f.
angustissima pictured here originates from the collections of Marnier-Lapostolle at Lés Cedrés, and was very likely a clonotype from the plant
Weber had described as Rhipsalis angustissima. A specimen is preserved at the Herbarium Berolinense (B-810013745, in spirit).
KOROTKOVA ET AL.
18 • Phytotaxa 327 (1) © 2017 Magnolia Press
Hylocereeae Buxbaum (1958: 179).
1. Acanthocereus (Engelmann ex A. Berger) Britton & Rose (1909: 432) ≡ Cereus subsect. Acanthocereus Engelmann
ex A. Berger (1905: 77).
Type:—Acanthocereus baxaniensis (Karwinsky 1837: 109) Borg (1937: 132).
= Monvillea Britton & Rose (1920: 21).
Type:—Monvillea cavendishii (Monville 1840: 219) Britton & Rose (1920: 21).
= Peniocereus subg. Pseudoacanthocereus Sánchez-Mejorada (1974: 38)
Type:—Cereus maculatus Weingart (1933: 14).
Accepted species:―13.
1.1 Acanthocereus canoensis (P.R. House, Gómez-Hinostrosa & H.M. Hernández) S. Arias & N. Korotkova, comb.
nov. ≡ Peniocereus canoensis P.R. House, Gómez-Hinostrosa & H.M. Hernández (2013: 1077).
Type:—HONDURAS. Francisco Morazán: 1 km O de la comunidad de Río Hondo, 07 July 2009, House, Vega & Rivera 5110 (holotype
TEFH!, isotype MEXU-1369109!).
1.2 Acanthocereus castellae (Sánchez-Mejorada) Lodé (2013: 2) ≡ Peniocereus castellae Sánchez-Mejorada (1974:
12).
Type:—MEXICO. Michoacan: 30 km N Playa Azul, 550 m, May 1971, Sánchez-Mejorada 71–0506 (holotype MEXU-159005!).
1.3 Acanthocereus chiapensis Bravo (1972: 117) ≡ Peniocereus chiapensis (Bravo) Gómez-Hinostrosa & H.M.
Hernández (2005: 131).
Type:—MEXICO. Chiapas: entre Soyaló y Bochil, 23 March 1967, Bravo 5584 (holotype MEXU-118868!).
– Acanthocereus griseus Backeberg (1965: 103–106), nom. inval. (Art. 37.1).
1.4 Acanthocereus cuixmalensis (Sánchez-Mejorada) Lodé (2013: 2) ≡ Peniocereus cuixmalensis Sánchez-Mejorada
(1973: 91).
Type:—MEXICO. Jalisco: La Huerta, playa Blanca de Careyitos, 30 m, November 1969, Sánchez-Mejorada 69–1102 (holotype MEXU-
159003!).
1.5 Acanthocereus fosterianus (Cutak) Lodé (2013: 2) ≡ Peniocereus fosterianus Cutak (1946: 19).
Type:—MEXICO. Guerrero: Tierra Colorada, 1500 ft, 1935, Foster s.n. (holotype MO-054010!).
= Peniocereus fosterianus var. nizandensis Sánchez-Mejorada (1974: 49)
Lectotype (designated here):—[illustration] fig. 27 “Flor de Peniocereus fosterianus var. nizandensis” in Sánchez-Mejorada (1974).
= Peniocereus fosterianus var. multitepalum Sánchez-Mejorada (1974: 50).
Lectotype (designated here):—[illustration] fig. 28 “Flor de Peniocereus fosterianus var. multitepalum” in Sánchez-Mejorada (1974).
Notes:―Peniocereus fosterianus var. nizandensis was based on a specimen collected by Thomas MacDougall (A-56,
Mexico, Oaxaca, Nizanda), and dispatched to Hernando Sánchez-Mejorada (72-4066) who described it and deposited
the specimen in MEXU. At present there is no herbarium specimen in MEXU (missing), nor in NY and US where
MacDougall also deposited cacti samples. We therefore designate a lectotype (Art. 9.2), based on the unique drawing
that accompanies the protologue and associated with this taxon.
As in the previous case, Peniocereus fosterianus var. multitepalum was associated with a specimen collected by T.
MacDougall (A-56, Mexico, Oaxaca, San Pedro) and refers to H. Sánchez-Mejorada (72-4067). The protologue clearly
states that it was deposited in MEXU, however the specimen was not found in that herbarium (missing), nor in NY and
US. Consequently, we designate as lectotype the only illustration that accompanies the publication (Art. 9.2).
1.6 Acanthocereus hesperius D.R. Hunt (2016: 9) ≡ Peniocereus occidentalis Bravo (1963: 80)
Type:—MEXICO. Oaxaca: San Pedro Pochutla, cerca de 20 km de Pochutla camino a río Copalito, 27 March 1963, Bravo s.n. [reg. 91]
(holotype MEXU-072916!).
1.7 Acanthocereus hirschtianus (K. Schumann) Lodé (2013: 2) ≡ Cereus hirschtianus K. Schumann (1897: 130) ≡
Nyctocereus hirschtianus (K. Schumann) Britton & Rose (1909: 424) ≡ Peniocereus hirschtianus (K. Schumann) D.R.
Hunt (1991: 90).
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 19
Type:—NICARAGUA. Ringgold & Rodgers Expedition, 1853-1856, Wright s.n. (holotype GOET-000502!, isotypes MO-313100!, US-
177028!).
= Nyctocereus guatemalensis Britton & Rose (1913: 240) ≡ Cereus guatemalensis (Britton & Rose) Vaupel (1913: 86) ≡ Peniocereus
guatemalensis (Britton & Rose) D.R. Hunt (2006: 14).
Type:—Guatemala. El Progreso: El Rancho, 4 April 1905, Maxon 8510 [3767] (holotype US-535977).
= Cereus neumannii K. Schumann ex Loesener (1900: 99) ≡ Nyctocereus neumannii (K. Schumann) Brittton & Rose (1909: 424)
Neotype (designated here):—NICARAGUA. Matagalpa: Hwy. 1 at bridge over Río Grande de Matagalpa, at ca. Km 83.5, ca. 3.6 km N
of Las Calabazas, 31 August 1978, Stevens & Krukoff 10224 (MO-2803392!).
Notes:―The protologue of Cereus hirschtianus is based on a sample collected by C. Wright during the expedition of
Ringgold and Rodgers (1853–1856) to Nicaragua. According to the original publication, the original material used for
the description is to be found in the Göttingen herbarium (Schumann 1897: 131). Therefore the herbarium specimen in
GOET is the holotype (Art. 9.1). Two additional specimens (MO, US) include the same printed label and information,
and represent isotypes. The sample in MO includes an additional hand-written distribution data: Island of Omotepe
[Department of Rivas].
Schumann in Loesener (1900: 99–100) described Cereus neumannii, from a specimen collected by Rothschuh
(558 Nicaragua, Matagalpa, Chiquitillo). We have not found original material for this name. Therefore a neotype
is designated (Art. 9.7), considering the closest to the locality and representing stem and flower as described in the
protologue.
1.8 Acanthocereus macdougallii (Cutak) Lodé (2013: 2) ≡ Peniocereus macdougallii Cutak (1947: 87)
Type:—MEXICO. Oaxaca: on Cerro Arenal west of Tehuantepec, 550–800 m, 26 February 1947, Cutak s.n. (holotype MO-054009!).
– Peniocereus macdougallii var. centrispinus Backeberg (1962: 3843) nom. inval. (Art. 37.1).
1.9 Acanthocereus maculatus Weingart ex Bravo (1933: 398) ≡ Cereus maculatus Weingart ex Bravo (1933: 14) ≡
Acanthocereus maculatus (Weingart ex Bravo) F.M. Knuth (1935: 303) ≡ Peniocereus maculatus (Weingart ex Bravo)
Cutak (1951: 76)
Lectotype (designated by Hunt & Taylor 2006: 10):—[illustration] unnumbered figure in Weingart (1933: 14).
1.10 Acanthocereus oaxacensis (Britton & Rose) Lodé (2012: 2) ≡ Nyctocereus oaxacensis Britton & Rose (1920:
120) ≡ Peniocereus oaxacensis (Britton & Rose) D.R. Hunt (1991: 90).
Type:—MEXICO. Oaxaca: about Lagunas, 850 ft, 05 June 1895, Nelson 2643 [non 2543] (holotype US-115770!, isotype NY-385966!).
1.11 Acanthocereus rosei (J.G. Ortega) Lodé (2013: 3) ≡ Peniocereus rosei J.G. Ortega (1926: 189).
Lectotype (designated by Eggli in Anderson 2005: 524):—[illustration] unnumbered figure in González Ortega (1926: 191).
1.12 Acanthocereus tepalcatepecanus (Sánchez-Mejorada) Lodé (2013: 3) ≡ Peniocereus tepalcatepecanus Sánchez-
Mejorada (1974: 14)
Type:—MEXICO. Michoacan: La Huacana, 2 km N. El Infiernillo, 360 m, September 1970, Sánchez-Mejorada 70–0701 (holotype
MEXU-159004!).
1.13 Acanthocereus tetragonus (Linnaeus) Hummelinck (1938: 165) ≡ Cactus tetragonus Linnaeus (1753: 466) ≡
Cereus tetragonus (Linnaeus) Miller (1768: unpaged)
Neotype (designated by Hummelinck 1938):—CURAÇAO. Hummelinck 196, 170 (U).
= Acanthocereus pentagonus (Linnaeus) Britton & Rose (1920: 122) ≡ Cactus pentagonus Linnaeus (1753: 466) ≡ Cereus pentagonus
(Linnaeus) Haworth (1812: 180)
Type:—Not designated.
= Acanhocereus baxaniensis (Karwinsky ex Pfeiffer) Borg (1937: 132) ≡ Cereus baxaniensis Karwinsky ex Pfeiffer (1837: 10)
Type:—Not designated.
= Acanthocereus horridus Britton & Rose (1920: 122)
Type:—GUATEMALA. Without locality, 1909, Eichlam s.n. (holotype NY-00118675!, isotypes US-00115577, US-00115578, U-
0000928!).
= Acanhocereus subinermis Britton & Rose (1920: 125)
Type:—MEXICO. Oaxaca: between Mitla an Oaxaca City, 6 September 1908, Rose 11304 (holotype US-115512!).
= Acanthocereus occidentalis Britton & Rose (1920: 125)
Type:—MEXICO. Sinaloa, vicinity of San blas, near the river in thickets, 4 March 1910, Rose et al. 13431 (holotype US-115513!).
KOROTKOVA ET AL.
20 • Phytotaxa 327 (1) © 2017 Magnolia Press
Notes:―Hummelinck (1938) designated as lectotype of Cereus tetragonus two samples collected by him in Curaçao
[Hummelinck 196 (flower), 170 (fruit) U], but Hunt (1991: 82, 1998: 16) and Eggli (in Anderson 2005: 70) corrected
its designation as neotype. However, this cannot be accepted according to the Art. 9.17. The designation of one of the
specimens as neotype is currently in discussion (Hunt 2006).
Possible typification of Cactus pentagonus is not resolved (Hunt 1991: 83, Hunt 2006: 25). Eventual typification
of Cereus baxaniensis is under discussion, since its identity and provenance is uncertain (Hunt 1998: 15, 2006: 25).
2. Aporocactus Lemaire (1860: 67)
Type:—Aporocactus flagelliformis (Linnaeus) Lemaire.
Accepted species:—2
2.1 Aporocactus flagelliformis (Linnaeus) Lemaire (1860: 68) ≡ Cactus flagelliformis Linnaeus (1753: 467) ≡ Cereus
flagelliformis (Linnaeus) Miller (1768: unpaged) ≡ Disocactus flagelliformis (Linnaeus) Barthlott (1991: 87).
Lectotype (designated by Bauer 2003a: 12):—[illustration] in Plukenet (1692: t. 158, f. 6).
Epitype (designated by Bauer 2003a: 12):—MEXICO. Hidalgo: Along Mex 85, north of Parque Natural de los M[ar]moles, north of
Cuesta Colorada, Lautner L00/241 (ZSS-22701!).
= Aporocactus flagriformis (Zuccarini ex Pfeiffer) Lemaire (1868: 58) ≡ Cereus flagriformis Zuccarini ex Pfeiffer (1837: 111).
Type:—Not designated.
= Aporocactus leptophis (A.P. de Candolle) Britton & Rose (1909: 435) ≡ Cereus leptophis A.P. de Candolle (1828: 117)
Type:—Not designated.
Notes:―Both Cereus flagriformis and C. leptophis are not typified. The description of C. flagriformis was based on
material introduced by Karwinsky collected near San José de l’Oro, Oaxaca, Mexico. Bravo (1978) assumed that A.
flagriformis might be merely a form of A. flagelliformis. Hunt (1989) mentions a plate of Pfeiffer & Otto (1839, t. 12)
that could serve as iconotype, but the plant pictured has no significant differences to A. flagelliformis.
No type specimen or other verifiable material of C. leptophis appears to exist. De Candolle (1828) mentions a
collection of Thomas Coulter No. 32 in the protologue, but does not cite any herbarium vouchers. He reports to have
received a collection of living plants from Mexico from Coulter; the number 32 and other numbers mentioned in the
same work refer to that collection. It is not clear whether herbarium specimens exist, they could not be located so
far—if such a specimen could be located, it would be the type.
Both names require further investigations from the nomenclatural point of view.
2.2 Aporocactus martianus (Zuccarini) Britton & Rose (1920: 220) ≡ Cereus martianus Zuccarini (1832: 66) ≡
Disocactus martianus (Zuccarini) Barthlott (1991: 88) ≡ Eriocereus martianus (Zuccarini) Riccobono (1909: 240)
Neotype (designated by Bauer 2003a: 13):—MEXICO. Oaxaca: San Juan del Estado, 1500 m, Lau 1331 (ZSS-22702!).
= Aporocactus conzattii Britton & Rose (1920: 220) ≡ Cereus conzattii (Britton & Rose) A. Berger (1929: 110).
Type:—MEXICO. Oaxaca: Cerro San Felipe, 1912, Conzattii s.n.[#18] (holotype US-00115579!, isotypes K-000062686!, NY-118684!).
3. Disocactus Lindley (1845: 31)
Type:—D. biformis (Lindley) Lindley
= Cereus subsect. Heliocereus A. Berger (1905: 78) ≡ Heliocereus (A. Berger) Britton & Rose (1909: 433)
= Chiapasia Britton & Rose (1923: 203)
Type:—Chiapasia nelsonii (Britton & Rose) Britton & Rose
= Nopalxochia Britton & Rose (1923: 204)
Type:—Nopalxochia phyllanthoides (A.P. de Candolle) Britton & Rose
= Bonifazia Standley & Steyermark (1944: 66)
Type:—Bonifazia quezalteca Standley & Steyermark
= Pseudonopalxochia Backeberg (1958: 69)
Type:—Pseudonopalxochia conzattiana (T. MacDougal) Backeberg
= Lobeira Alexander (1944: 177)
Type:—Lobeira macdougallii Alexander
= Trochilocactus Lindinger (1942: 383)
Type:—Trochilocactus eichlamii (Weingart) Lindinger
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 21
Notes:―Our results support those obtained by Cruz et al. (2016) to recognize Disocactus as a monophyletic genus,
including three erstwhile Epiphyllum species. Also the inclusion of D. macdougallii (Alexander) Barthlott and D.
ackermannii subsp. conzattianus (T. MacDougal) U. Guzmán in this genus is confirmed. These taxa have not been
included in the aforementioned study. A species-level synopsis of Disocactus has already been provided by Cruz et al.
(2016) and is therefore not presented here.
Accepted species:—15 (7 infraspecific taxa).
4. Epiphyllum Haworth (1812: 197)
Type:—Epiphyllum phyllanthus (Linnaeus) Haworth ≡ Cactus phyllanthus Linnaeus
≡ Phyllocactus Link (1829: 10), nom. illeg. et superfl. (Art. 52.2).
= Marniera Backeberg (1950: 22)
Type:—Marniera macroptera (Lemaire) Backeberg
= Chiapasophyllum Doweld (2002: 32)
Type:—Chiapasophyllum chrysocardium (Alexander) Doweld
Accepted species:—10 (5 infraspecific taxa).
4.1. Epiphyllum baueri Dorsch (2003: 6)
Type:—COLOMBIA. Chocó: Nuquí, between Río Piedra Piedra and Río Terco, below Cerro Corrizalito, 150 m, 7 March 1999, Bauer 32
(holotype ZSS-22456!).
4.2. Epiphyllum cartagense (F.A.C. Weber) Britton & Rose (1913: 256) ≡ Phyllocactus cartagensis F.A.C. Weber
(1902: 462)
Neotype (designated by Bauer 2003a: 19):—COSTA RICA. Alajuela: Río Barranca, near San Juan de San Ramon, 1500–1600 m, 1913,
Tonduz 17850 (G).
= Phyllocactus cartagensis var. refracta F.A.C. Weber (1902: 462)
Type:—Not designated.
4.3. Epiphyllum chrysocardium Alexander (1956: 4) ≡ Marniera chrysocardium (Alexander) Backeberg (1959: 737)
≡ Selenicereus chrysocardium (Alexander) Kimnach (1991: 91) ≡ Chiapasophyllum chrysocardium (Alexander)
Doweld (2002: 32)
Type:—MEXICO. Chiapas: Selva Negra, between Tapalapa and Blanca Rosa near Santa Lucía and Río Napak, 9 February 1951,
MacDougal A 198 (holotype NY-455205).
4.4. Epiphyllum grandilobum (F.A.C. Weber) Britton & Rose (1913: 257) ≡ Phyllocactus grandilobus F.A.C. Weber
(1902: 464)
Lectotype (designated by Bauer 2003a: 27):—COSTA RICA. San José: La Hondura, 800 m, 1900, Wercklé s.n. (P-05003211!).
= Epiphyllum gigas Woodson & Cutak (1958: 87).
Type:—PANAMA. Cerro Trinidad, 800–100 m, 20 October 1946, Allen 3772 [holotype MO-148233! (sheet 1), MO-148232! (sheet 2)].
4.5. Epiphyllum hookeri Haworth (1829: 108)
≡ Cereus hookeri (Haworth) Pfeiffer (1837: 125) ≡ Phyllocactus hookeri (Haworth) Salm-Dyck (1842: 38) ≡ Epiphyllum phyllanthus var.
hookeri (Haworth) Kimnach (1964: 113) ≡ Epiphyllum phyllanthus subsp. hookeri (Haworth) U. Guzmán (2003: 17)
Type:—[illustration] “Cactus phyllanthus” in Sims (1826: t. 2692), holotype, image available at http://www.biodiversitylibrary.org/item/
14337#page/235/mode/1up.
4.5a. Epiphyllum hookeri subsp. hookeri
= Cereus marginatus Salm-Dyck (1834: 340).
Type:—Not designated.
= Phyllocactus stenopetalus C.F. Förster (1846: 441) ≡ Epiphyllum stenopetalum (C.F. Förster) Britton & Rose (1913: 259).
Type:—Not designated.
= Phyllocactus strictus Lemaire (1854: 107) ≡ Epiphyllum strictum (Lemaire) Britton & Rose (1913: 259).
Type:—Not designated.
KOROTKOVA ET AL.
22 • Phytotaxa 327 (1) © 2017 Magnolia Press
4.5b. Epiphyllum hookeri subsp. columbiense (F.A.C. Weber) Ralf Bauer (2003: 26) ≡ Phyllocactus phyllanthus var.
columbiensis F.A.C. Weber (1898: 957) ≡ Epiphyllum phyllanthus var. columbiense (F.A.C. Weber) Backeberg (1959:
746) ≡ Epiphyllum columbiense (F.A.C. Weber) Dodson & A.H. Gentry (1977: 31).
Neotype (designated by Bauer 2003a: 26):—COLOMBIA. Chocó: Nuquí, Coquí, mangrove swamp El Estero, 1 m, 9 March 1999, Bauer
36 (ZSS-19792).
4.5c. Epiphyllum hookeri subsp. guatemalense (Britton & Rose) Ralf Bauer (2003: 25) ≡ Epiphyllum guatemalense
Britton & Rose (1913: 78) ≡ Phyllocactus guatemalensis (Britton & Rose) Vaupel (1913: 116) ≡ Epiphyllum phyllanthus
var. guatemalense (Britton & Rose) Kimnach (1964: 110) ≡ Epiphyllum phyllanthus subsp. guatemalense (Britton &
Rose) U. Guzmán (2003: 17).
Type:—GUATEMALA. Locality unknown, 1910, Eichlam s.n. (holotype US-691401, isotype US-385785!, US-385786!).
4.5d. Epiphyllum hookeri subsp. pittieri (F.A.C. Weber) Ralf Bauer (2003: 26) ≡ Phyllocactus pittieri F.A.C. Weber
(1898: 957) ≡ Epiphyllum pittieri (F.A.C. Weber ) Britton & Rose (1913: 258) ≡ Epiphyllum phyllanthus var. pittieri
(F.A.C. Weber) Kimnach (1964: 115)
Neotype (designated by Bauer 2003a: 26):—COSTA RICA. Limón: Atlantic coast near Cahuita, Horich s.n. (ZSS-19793).
4.6. Epiphyllum laui Kimnach (1990: 194)
Type:—MEXICO. Chiapas: north of Tumbala, 2200 m, December 1979, Lau 1319 (holotype HNT-0000085!).
4.7. Epiphyllum oxypetalum (A.P. de Candolle) Haworth (1829: 109) ≡ Cereus oxypetalus A.P. de Candolle (1828:
470) ≡ Phyllocactus oxypetalus (A.P. de Candolle) Link ex Walpers (1843: 341).
Lectotype (designated by Bauer 2003a: 23):—[illustration] “Cereus oxipetalus” in Candolle (1828: t. 14). image available at
http://www.biodiversitylibrary.org/item/84594#page/161/mode/1up
= Cereus latifrons Pfeiffer (1837: 735) ≡ Epiphyllum latifrons Pfeiffer (1837: 125) ≡ Phyllocactus latifrons (Pfeiffer) Walpers (1843:
341).
Type:—Not designated.
= Epiphyllum acuminatum K. Schumann (in Martius 1890: 222) ≡ Phyllocactus acuminatus (K. Schumann) K. Schumann (1897: 213)
Lectotype (designated here):—[illustration] t. 45 “Epiphyllum acuminatum” in Martius (1890: 222). image available at http://www.
biodiversitylibrary.org/page/138734#page/224/mode/1up.
= Phyllocactus grandis Lemaire (1847: 255) ≡ Epiphyllum grande (Lemaire) Britton & Rose (1913: 257).
Type:—Not designated
= Phyllocactus purpusii Weingart (1907: 34) ≡ Epiphyllum oxypetalum var. purpusii (Weingart) Backeberg (1959: 747).
Lectotype (designated here):—[illustration] “Phyllocactus Purpusii Weing. n. sp. Nach einer von C. A. Purpus aufgenommenen Photographie”
in Weingart (1907: 35 [unpaged]). image available at http://www.biodiversitylibrary.org/item/49873#page/51/mode/1up
Notes:―Both for Epiphyllum acuminatum and for Phyllocactus purpusii there are no holotype indications in the
protologues (Martius 1890: 222, and Weingart 1907: 34, respectively). The illustrations provided are here designated
as lectotypes.
4.8. Epiphyllum phyllanthus (Linnaeus) Haworth (1812: 197) ≡ Cactus phyllanthus Linnaeus (1753: 469)
Lectotype (designated by Leuenberger 1997: 17):—[illustration] “Cereus scolopendrii folio brachiato” in Dillenius (1732: t. 64. fig. 74.
1732).
4.8a. Epiphyllum phyllanthus subsp. phyllanthus ≡ Cereus phyllanthus (Linnaeus) A.P. de Candolle (1828: 469) ≡
Rhipsalis phyllanthus (Linnaeus) K. Schumann (1890: 298) ≡ Phyllocactus phyllanthus (Linnaeus) Link (1831: 11) ≡
Opuntia phyllanthus (Linnaeus) Miller (1768: unpaged).
= Rhipsalis macrocarpa Miquel (1838: 49) ≡ Hariota macrocarpa (Miquel) Kuntze (1891: 263).
Type:—Not designated
= Epiphyllum gaillardae Britton & Rose (1913: 240) ≡ Phyllocactus gaillardae (Britton & Rose) Vaupel (1913: 88).
Type:—PANAMA. Canal zone, 6 August 1909, Gaillard s.n. (holotype US-691240!).
= Phyllocactus phyllanthus var. boliviensis F.A.C. Weber (1898: 957) ≡ Epiphyllum phyllanthus var. boliviense (F.A.C. Weber) Backeberg
(1959: 746).
Type:—Not designated
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 23
= Phyllocactus phyllanthus var. paraguayensis F.A.C. Weber (1898: 957) ≡ Epiphyllum phyllanthus var. paraguayense (F.A.C. Weber)
Backeberg (1959: 756).
Type:—Not designated
= Epiphyllum phyllanthus var. schnetteri Peukert (1991: 255).
Type:—COLOMBIA. Departamento de Cundinamarca: entre Viot y Mesitas del Colegio, December 1970, 900 m, Schnetter s.n. (holotype
COL-256856!, isotype COL-291368!).
4.8b. Epiphyllum phyllanthus subsp. rubrocoronatum (Kimnach) Ralf Bauer (2003: 25) ≡ Epiphyllum phyllanthus
var. rubrocoronatum Kimnach (1964: 110) ≡ Epiphyllum rubrocoronatum (Kimnach) Dodson & A.H. Gentry (1977:
31).
Type:—ECUADOR. Chimborazo: along Rio Chimbo at the station of La Isla on the railroad to Quito, 100 m, 1958, Horich s.n. (holotype
HNT-0000086!, isotypes K-000101442!, US-00173517!, UC-1229076!, UC-1229080!).
= Epiphyllum trimetrale Croizat (1946: 353).
Type:—COLOMBIA. Departamento del Valle: Costa del Pacifico; Río Yurumangu: Veneral, 11 February 1944, Cuatrecasas 15863
(holotype GH-00063119!, isotypes: GH-00063120!, COL-000003016, COL-000003017!, COL-000003018!, GH-00063120).
4.9. Epiphyllum pumilum Britton & Rose (1913: 258) ≡ Phyllocactus pumilus (Britton & Rose) Vaupel (1913: 117)
Type:—GUATEMALA. Locality unknown, 1910, Eichlam s.n. (holotype US-691392!).
= Epiphyllum caudatum Britton & Rose (1913: 256) ≡ Phyllocactus caudatus (Britton & Rose) Vaupel (1913: 116).
Type:—MEXICO. Oaxaca: Near Comaltepec, 30 July 1894, Nelson 919 (holotype US- 00115643!).
4.10. Epiphyllum thomasianum (K. Schumann) Britton & Rose (1913: 259) ≡ Phyllocactus thomasianus K. Schumann
(1895: 6)
Lectotype (designated by Bauer 2003c: 247):—[illustration] “Phyllocactus Thomasianus K. Sch.”, Fig. by B. Esh in Schumann (1895:
unpaged). Image available at http://www.biodiversitylibrary.org/item/49871#page/13/mode/1up
Epitype (designated by Bauer 2003c: 247):—[Illustration] “Fig. A Epiphyllum thomasianum (Schum.) Britt. & Rose var. thomasianum,
Birdsey 314, [cult.] UCBG 53.512”, in Kimnach (1965: 165).
4.10a. Epiphyllum thomasianum subsp. thomasianum ≡ Epiphyllum macropterum var. thomasianum (K. Schumann)
Borg (1937: 359)
= Phyllocactus ruestii Weingart (1914: 123) ≡ Epiphyllum ruestii (Weingart) F.M. Knuth (1936: 163).
Type:—Not designated.
4.10b. Epiphyllum thomasianum subsp. costaricense (F.A.C. Weber) Ralf Bauer (2003: 22) ≡ Phyllocactus
costaricensis F.A.C. Weber (1902: 463) ≡ Epiphyllum costaricense (F.A.C. Weber) Britton & Rose (1913: 256) ≡
Epiphyllum thomasianum var. costaricense (F.A.C. Weber) Kimnach (1965: 168).
Lectotype (designated by Bauer 2003a: 22):—[illustration] “Fig. C. The lectotype of Phyllocactus costaricensis, collected by Biolley in
1898” in Kimnach (1965: 167).
Epitype (designated by Bauer 2003a: 22):—[illustration] “Fig. B Epiphyllum thomasianum var. costaricensis (Web.) Kimn., Horich s.n.,
[cult.] UCBG 57001 (Costa Rica)” in Kimnach (1965: 166).
= Phyllocactus macrocarpus F.A.C. Weber (1902: 464) ≡ Epiphyllum macrocarpum (F.A.C. Weber) Backeberg (1959: 754).
Type:—COSTA RICA. Pedras Negras, 1901, Pittier 12 (holotype P-02273071!).
5. Selenicereus (A. Berger) Britton & Rose (1909: 429)
Type:—S. grandiflorus (Linnaeus) Britton & Rose
≡ Cereus subsect. Selenicereus A. Berger (1905: 76)
= Hylocereus (A. Berger) Britton & Rose (1909: 428) ≡ Cereus subg. Hylocereus A. Berger (1905: 72)
Type:—H. triangularis (Linnaeus) Britton & Rose
= Werckleocereus Britton & Rose (1909: 432)
Type:—Werckleocereus tonduzii (F.A.C. Weber) Britton & Rose
= Wilmattea Britton & Rose (1920: 195).
Type:—Wilmattea minutiflora (Vaupel) Britton & Rose
KOROTKOVA ET AL.
24 • Phytotaxa 327 (1) © 2017 Magnolia Press
= Mediocactus Britton & Rose (1920: 210), excl. the type, see Hunt (1989) for a detailed explanation. Type:—Mediocactus coccineus
(Salm-Dyck ex A.P. de Candolle) Britton & Rose ≡ Selenicereus sect. Salmdyckia D.R. Hunt (1989: 91). Type:—Selenicereus
setaceus (Salm-Dyck ex A.P. de Candolle) Werdermann
= Cryptocereus Alexander (1950: 164).
Type:—Cryptocereus anthonyanus Alexander
Notes:―Our study provides strong evidence that Hylocereus and Selenicereus share a common origin and therefore
suggest they should be merged under one generic name. The support for the clade of Hylocereus and Selenicereus is 1
PP, 98% ML BS, 99 % JK and this clade includes additionally two Weberocereus species. Hylocereus and Selenicereus
were both originally established by Berger (1905), Hylocereus as a subgenus and Selenicereus as a subsection of
Eucereus Engelmann. Both were raised to generic rank by Britton & Rose (1909) and the names Hylocereus and
Selenicereus therefore had equal priority according to the Art. 11.5 of ICN, “When, for any taxon of the rank of family
or below, a choice is possible between legitimate names of equal priority in the corresponding rank ... the first such
choice to be effectively published ... establishes the priority of the chosen name...”. Recently, Hunt (2017) merged
Hylocereus and Selenicereus and published the necessary new combinations in Selenicereus. He thus established
priority of Selenicereus by explicitly citing Hylocereus to synonymy.
There would have been several reasons for maintaining Hylocereus instead of Selenicereus. First, Selenicereus
has always been a genus without a clear concept, and several times became an assemblage of various segregate genera.
Berger (1929) for example treated Selenicereus including Deamia, Weberocereus, Werckleocereus and Wilmattea,
while Hunt (1989) included Mediocactus, Cryptocereus, Deamia and Strophocactus in Selenicereus. Hylocereus, in
contrast has been much more consistent in terms of its circumscription. In addition, from an economic or utility
perspective, Hylocereus has an international market for edible fruits (pitahaya in Latin America, dragon fruit in China),
while Selenicereus does not. Although Selenicereus grandiflorus is better known in Europe as an ornamental than some
species of Hylocereus, this has a regional connotation. Therefore maintaining the name Hylocereus would have also
been relevant for CITES and for trade. Nevertheless, as the new combinations in Selenicereus by Hunt (2017) must be
regarded as effectively published and the name now has priority over Hylocereus, we have to accept Selenicereus. The
recognized species are listed and some further necessary new combinations are provided below.
Accepted species:―31, 3 infraspecific taxa.
5.1. Selenicereus anthonyanus (Alexander) D.R. Hunt (1989: 93) ≡ Cryptocereus anthonyanus Alexander (1950:
165).
Lectotype (designated by Bauer 2003a: 50):—[illustration] “Fig. 64” of Alexander (1950: 166).
5.2. Selenicereus alliodorus (Gómez-Hinostrosa & H.M. Hernández) S. Arias & N. Korotkova, comb. nov. ≡
Weberocereus alliodorus Gómez-Hinostrosa & H.M. Hernández (2014: 250).
Type:—MEXICO. Oaxaca: Distrito Pochutla, Municipio San Miguel del Puerto, ca. 1.5 km al N de Finca Monte Carlo, camino a Las
Lobas. Finca Monte Carlo se encuentra a 11 km al NO de Sta. María Xadani, 16°00´11´´N, 96°06´26´´W, 1238 m, 18 January 2013,
Gómez- Hinostrosa, Hernández & Pascual 2601 (holotype MEXU-01380036!, isotypes ASU, CR, HNT, IEB, MO, NY).
5.3. Selenicereus atropilosus Kimnach (1978: 270)
Type:—MEXICO. Jalisco: on road from Mascota to Puerto Vallarta, 3 miles past turnoff to San Sebastian, ca. 870 m, 8 February 1970,
Boutin & Kimnach 3190 (holotype HNT-1267!).
5.4. Selenicereus calcaratus (F.A.C. Weber) D.R. Hunt (2017: 30) ≡ Cereus calcaratus F.A.C. Weber (1902: 458) ≡
Hylocereus calcaratus (F.A.C. Weber) Britton & Rose (1909: 428)
Neotype (designated by Bauer 2003a: 32):—[illustration] “Hylocereus calcaratus (Web.) Britt. & Rose, Lankaster s.n. [cult.] UCBG
52.1085 (Costa Rica)” in Cact. Succ. J. (Los Angeles) 39(3): 103. 1967.
Notes:―The neotype was designated by Bauer (2003a: 32) because the original Pittier collection can not be located
at the Paris herbarium.
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 25
5.5. Selenicereus costaricensis (F.A.C. Weber) S. Arias & N. Korotkova, comb. nov.
≡ Cereus trigonus var. costaricensis F.A.C. Weber (1902: 457) ≡ Hylocereus costaricensis (F.A.C. Weber) Britton & Rose (1909: 428).
Type:—Not designated.
Notes:―The protologue mentions a photograph by Tonduz (Herborisations au Costa-Rica, Bull. de l’herbier Boissier
3. 1895) that could serve as a lectotype but so far has not been possible to locate; currently under discussion (Bauer
2003a).
5.6. Selenicereus dorschianus Ralf Bauer (2009: 64)
Type:—MEXICO. Jalisco: c. 42 km south of Puerto Vallarta, about half-way (22 km) from El Tuíto eastwards to an abandoned mine
(Cuale-San Sebastián), ca. 1100–1500 m, June 1989, Böhme s.n. (holotype ZSS-22551!).
5.7. Selenicereus escuintlensis (Kimnach) D.R. Hunt (2017: 31)
≡ Hylocereus escuintlensis Kimnach (1984: 177)
Type:—GUATEMALA. Escuintla, just south of Escuintla, near cemetery, 1 July 1953, Birdsey 313, cult. UCBG 53.511 at Huntington Bot.
Gard. 15092 (holotype HNT-0000024!, isotypes F-0052882F!, K-000101238!, MEXU-01283225!, MO-054008!, NY-00803905!,
UC-1229087!, US-00115679!).
5.8. Selenicereus extensus (Salm-Dyck ex A.P. de Candolle) Leuenberger (2001: 56)
≡ Cereus extensus Salm-Dyck ex A.P. de Candolle (1828: 469) ≡ Hylocereus extensus (Salm-Dyck ex A.P. de Candolle) Ralf Bauer (2003:
28) ≡ Mediocactus extensus (Salm-Dyck ex A.P. de Candolle) Doweld (2002: 42).
Neotype (designated by Leuenberger 2001: 56):—FRENCH GUIANA. Gobaya Soula, Bassin du Maroni, Atachi Bacca mountains (Camp
1), Hany river, 100 m, 1 February 1989, Granville et al. 10991 (B!).
5.9. Selenicereus glaber (Eichlam) S. Arias & N. Korotkova, comb. nov. ≡ Cereus glaber Eichlam (1910: 150) ≡
Werckleocereus glaber (Eichlam) Britton & Rose (1917: 13) ≡ Weberocereus glaber (Eichlam) G.D. Rowley (1982: 46)
Lectotype (designated by Bauer 2003a: 50):—GUATEMALA. locality unknown, ‘1910’, Eichlam s.n. (US-68419).
Epitype (designated by Bauer 2003a: 50):—GUATEMALA. Road to Antigua, July 1909, Deam s.n. (US-68420!).
5.9a. Selenicereus glaber subsp. glaber
5.9b. Selenicereus glaber subsp. mirandae (Bravo) S. Arias & N. Korotkova, comb. nov. ≡ Selenicereus mirandae
Bravo (1967: 52) ≡ Werckleocereus glaber var. mirandae (Bravo) Kimnach (1978: 270) ≡ Werckleocereus glaber
subsp. mirandae (Bravo) Doweld (2002: 43).
Type:—MEXICO. Chiapas: EI Sumidero, 22 March 1967, Bravo s.n. (holotype MEXU- 01231772!).
5.10 Selenicereus grandiflorus (Linnaeus) Britton & Rose (1909: 430) ≡ Cactus grandiflorus Linnaeus (1753: 467) ≡
Cereus grandiflorus (Linnaeus) Miller (1768: unpaged)
Lectotype (designated by Lourteig 1991: 406):—Herb. Cliff. 182, Cactus 10 (BM-000628597!).
Epitype (designated by Bauer 2003a: 44):—MEXICO. Veracruz: Palma Sola, 10–50 m, 7 May 1978, Lau 1285 (ZSS-5477!).
5.10a. Selenicereus grandiflorus subsp. grandiflorus
= Cereus coniflorus Weingart (1904: 118) ≡ Selenicereus coniflorus (Weingart) Britton & Rose (1909: 430).
Neotype (designated here):—[illustration] “Flower on branch of Selenicereus coniflorus“ in Britton & Brown (1920: pl 35).
= Cereus jalapaensis Vaupel (1913: 85).
Type:—Not designated
= Cereus paradisiacus Vaupel (1913: 87).
Type:—Not designated
= Cereus roseanus Vaupel (1913: 85).
Type:—Not designated
= Cereus urbanianus Gürke & Weingart (1904: 158) ≡ Selenicereus urbanianus Britton & Rose (1913: 242).
Type:—Not designated
= Selenicereus maxonii Rose (1909: 430).
Type:—CUBA. [Santiago de Cuba]: Province of Oriente, near Berraco, 8 miles east of Daiquiri, 13 April 1907, Maxon 4024 (holotype
US-00313059!, isotypes GH-00063201!, NY-00386183, P-04947361!).
KOROTKOVA ET AL.
26 • Phytotaxa 327 (1) © 2017 Magnolia Press
= Selenicereus pringlei Rose (1909: 431).
Type:—MEXICO. Veracruz: near Jalapa, 3500 ft, 3 April 1899, Pringle 7841 (US-00037467!).
– Selenicereus hallensis Weingart ex Borg (166. 1937), nom. inval. (Art. 36.1).
5.10b. Selenicereus grandiflorus subsp. donkelaarii (Salm-Dyck) Ralf Bauer (2003: 46) ≡ Cereus donkelaarii Salm-
Dyck (1845: 355) ≡ Selenicereus donkelaarii (Salm-Dyck) Britton & Rose (1920: 200).
Neotype (designated by Bauer 2003a: 46):—MEXICO. Yucatan: Chichén ltzá, al the lip of a cenote, Johnson s.n. (US-2830673!).
5.10c. Selenicereus grandiflorus subsp. hondurensis (K. Schumann ex Weingart) Ralf Bauer (2003: 45) ≡ Cereus
hondurensis K. Schumann ex Weingart (1904: 147) ≡ Selenicereus hondurensis (K. Schumann ex Weingart) Britton
& Rose (1909: 430)
Neotype (designated by Doweld 2002a: 43):—HONDURAS. Altlántida: 5 miles east of Tela, 13 August 1934, Yuncker 5019 (MO-
108719).
Epitype (designated by Bauer 2003a: 46):—GUATEMALA. Izabal: Lago de lzabal near Castillo de San Felipe, Bauer 8 (ZSS-21377!).
Notes:―An epitype was designated because Doweld’s (l.c.: 43) neotype is a damaged specimen (c.f. Bauer 2003a).
5.10d. Selenicereus grandiflorus subsp. lautneri Ralf Bauer (2003: 45)
Type:—MEXICO. Oaxaca: San Pedro Huamelula, c. 50 m, 20 February 1990, Lautner L90/55 (holotype ZSS-22536).
5.11. Selenicereus guatemalensis (Eichlam ex Weingart) D.R. Hunt ≡ Cereus trigonus var. guatemalensis Eichlam ex
Weingart (1911: 68) ≡ Cereus guatemalensis (Eichlam ex Weing.) A.Berger (1929: 121) ≡ Hylocereus guatemalensis
(Eichlam ex Weingart) Britton & Rose (1920: 184)
Neotype (designated by Doweld 2002b: 13):—GUATEMALA. Guatemala: Fiscal, ca. 1230 m, 6 June 1909, Deam 6195 (MO-3057468
(sheet 3 of 3), MO-3057469 (sheet 1of 3), MO-3057470 (sheet 2 of 3), isoneotype S-09-28483!).
5.12. Selenicereus hamatus (Scheidweiler) Britton & Rose (1909: 430) ≡ Cereus hamatus Scheidweiler (1837: 371)
Neotype (designated by Bauer 2003a: 50):—MEXICO. Veracruz: south of Palma Sola, 3 km from the coast, Stolzenburg
s.n. (ZSS-21397).
= Cereus rostratus Lemaire (1838: 29).
Type:—Not designated
5.13. Selenicereus inermis (Otto ex Pfeiffer) Britton & Rose (1920: 207) ≡ Cereus inermis Otto ex Pfeiffer (1837: 116)
≡ Mediocactus inermis (Otto ex Pfeiffer) Doweld (2002: 42)
Neotype (designated by Doweld 2002a: 42):—VENEZUELA. Carabobo: carr. Puerto-Cabello-San Esteban, Sitio called “Montero”, 21
May 1985 Trujillo & Pulido 19360 (MO-3905799!).
= Cereus karstenii Salm-Dyck (1849: 218).
Type:—Not designated
= Cereus wercklei F.A.C. Weber (1902: 460) ≡ Selenicereus wercklei (F.A.C. Weber) Britton & Rose (1920: 208) ≡ Mediocactus wercklei
(F.A.C. Weber) Doweld (2002a: 42).
Neotype (designated by Doweld 2002a: 42):—COSTA RICA. Guanacaste, 31 August 1990, Solomon 19104 (MO).
= Selenicereus rubineus Kimnach (1993: 17).
Type:—MEXICO. Oaxaca: Tehuantepec, Santo Domingo Petapa, “Platanillo”, ca 2,000 ft, 1 July 1957, MacDougall A.245 (holotype
HNT-0000016!, isotypes MEXU-01283233!, 01283234!, US-2830720!).
= Epiphyllum steyermarkii Croizat (1974: 19).
Type:—VENEZUELA. Miranda: Selva de Guatopo, Parque Nacional Guatopo, 27 April 1973, Steyermark 108741 (holotype VEN-
95337!).
5.14. Selenicereus megalanthus (K. Schumann ex Vaupel) Moran (1953: 325) ≡ Cereus megalanthus K. Schumann ex
Vaupel (1913: 284) ≡ Mediocactus megalanthus (K. Schumann ex Vaupel) Britton & Rose (1920: 212) ≡ Hylocereus
megalanthus (K. Schumann ex Vaupel) Ralf Bauer (2003: 28)
Lectotype (designated by Bauer 2003a: 28):—[illustration] “Cereus megalanthus auf einer grossen Ficus bei Tarapoto (Peru)“ in Karsten
& Schenck (1904: t. 5).
Epitype (designated by Bauer 2003a: 28):—PERU. Huánuco: Tingo Marfa, valley of Río Huallaga, Johnson s.n. (US-2906780!).
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 27
5.15. Selenicereus minutiflorus (Britton & Rose) D.R. Hunt (2017: 33) ≡ Hylocereus minutiflorus Britton & Rose
(1913: 240) ≡ Cereus minutiflorus (Britton & Rose) Vaupel (1913: 87) ≡ Wilmattea minutiflora Britton & Rose (1920:
195).
Type:—GUATEMALA. Izabal: Lago de Izabal, 1907, Peters s.n. (holotype US-00115680!).
5.16 Selenicereus monacanthus (Lemaire) D.R. Hunt (2017: 33) ≡ Cereus monacanthus Lemaire (1841: 60) ≡
Hylocereus monacanthus (Lemaire) Britton & Rose (1920: 190)
Neotype (designated by Bauer 2003a: 33):—COLOMBIA. Magdalena: Parque Tayrona, Playa Arrecifes, 2 m, 20 March 1999, Bauer 46
(ZSS-22705!).
= Cereus lemairei Hooker (1854: t. 4814) ≡ Hylocereus lemairei (Hooker) Britton & Rose (1909: 428).
Lectotype (designated by Leuenberger 1997: 22):—[illustration] in Hooker (1854: t. 4814).
= Cereus polyrhizus F.A.C. Weber in K. Schumann (1897: 151) ≡ Hylocereus polyrhizus (F.A.C.Weber) Britton & Rose (1920: 185).
Neotype (designated by Bauer 2003a: 41):—VENEZUELA. Cojedes: Hato Piñero, Delascio 14484 (VEN-249248!).
= Cereus scandens Salm-Dyck (1850: 219) ≡ Hylocereus scandens (Salm-Dyck) Backeberg (1959: 817).
Neotype (designated by Bauer 2003a: 40):—SURINAME. Brokopondo district: 12 km south of village Afobaka, forest along Sara Creek,
February 1965, Donselaar 2119 (U-212602).
= Cereus trinitatensis Lemaire & Herment (1859: 642) ≡ Hylocereus trinitatensis (Lemaire & Herment) Berger (1929: 341).
Neotype (designated by Bauer 2003a: 41):—TRINIDAD. Government farm St. Joseph, 21 April 1975, Philcox & Andrews 7710 (K-
000101193!).
= Hylocereus venezuelensis Britton & Rose (1920: 226) ≡ Wilmattea venezuelensis (Britton & Rose) Croizat (1972: 39).
Lectotype (designated by Bauer 2003a: 41):—VENEZUELA. [Carabobo]: Near Valencia, 1917, Rose 21835 (US-1038847!).
= Hylocereus estebanensis Backeberg (1957: 11).
Neotype (designated by Bauer 2003a: 41):—[illustration] “Abb. 730. Hylocereus estebanensis Backbg.” in Backeberg (1959: 814).
= Hylocereus peruvianus Backeberg (1937: [2])
Neotype (designated by Bauer 2003a: 41):—PERU. Tumbes: Prov. Zarumilla, about 0,5 km from Campo Verde along the road, Bosque
Nacional de Tumbes, 17 December 1967, Simpson & Schunke 400 (US-2750703!).
– “Cereus extensus Salm-Dyck ex A.P. de Candolle” sensu Hooker (1844: 4066).
Notes on Cereus polyrhizus:―Bauer (2003a: 41) noted that the the neotype designated by Doweld (2002b: 13):
PANAMA. Panama, 2 m, 4 December 1984, Bravo & Scheinvar 4008 (MO) had to be rejected as it is in strong conflict
with the protologue and apparently there are even two different species on that sheet.
Notes on Cereus scandens:―Bauer l.c. noted that he designated this neotype because Doweld’s neotype [Doweld
2002b: 13: VENEZUELA. Bolivar: 260 m, May 1986, Fernandez 3035 (MO)] could not be found at MO and therefore
had to be rejected as neotype.
5.17. Selenicereus murrillii Britton & Rose (1920: 206) ≡ Mediocactus murrillii (Britton & Rose) Doweld (2002:
42).
Lectotype (designated by Doweld 2002a: 42):—MEXICO. Colima: near Colima, 1910, Murril s.n. (NY-386172!).
5.18. Selenicereus nelsonii (Weingart) Britton & Rose (1923: 283) ≡ Cereus nelsonii Weingart (1923: 33).
Lectotype (designated by Bauer 2003a: 49):—MEXICO. Locality unknown, from material sent by Dr J. L. Slater to C. Z. Nelson, of which
cuttings were sent to Britton & Rose (US-2947536A!).
5.19. Selenicereus ocamponis (Salm-Dyck) D.R. Hunt (2017: 34) ≡ Cereus ocamponis Salm-Dyck (1850: 220) ≡
Hylocereus ocamponis (Salm-Dyck) Britton & Rose (1909: 429)
Neotype (designated by Bauer 2003a: 32):—[illustration] watercolour of Hylocereus ocamponis by Mary Emily Eaton, US.
5.20 Selenicereus pteranthus (Link ex A. Dietrich) Britton & Rose (1909: 431) ≡ Cereus pteranthus Link ex A.
Dietrich (1834: 209–210).
Lectotype (designated by Bauer 2003b: 43):—[illustration] “Cereus nycticaulis” in Dietrich (1834: t. 4).
Image available at http://www.biodiversitylibrary.org/item/106684#page/356/mode/2up
5.20a. Selenicereus pteranthus f. pteranthus
= Cereus boeckmannii Otto ex Salm-Dyck (1850: 217) ≡ Selenicereus boeckmannii (Otto ex Salm-Dyck) Britton & Rose (1909: 429).
KOROTKOVA ET AL.
28 • Phytotaxa 327 (1) © 2017 Magnolia Press
Neotype (designated here):—[illustration] “Flower of Selenicereus boeckmannii” in Britton & Rose (1920: pl. 36, fig. 2).
= Selenicereus brevispinus Britton & Rose (1920: 278).
Type:—CUBA. Camagüey: Cayo Romano, 1909, Shafer 2811 (holotype US-1821063!, isotypes K-000101294!, NY-00386176!).
= Cereus irradians Lemaire (1864: 74) ≡ Selenicereus grandiflorus var. irradians (Lemaire) Borg (1951: 206).
Type:—Not designated.
= Cereus kunthianus Hort. Berol. ex Salm-Dyck (1850: 217) ≡ Selenicereus kunthianus (Hort. Berol. ex Salm-Dyck) Britton & Rose
(1909: 430).
Type:—Not designated.
= Cereus vaupelii Weingart (1912: 106).
Type:—Not designated.
Notes:—Britton & Rose (1909) mentioned a plant sent under this name to J. N. Rose from the Berlin Botanical Garden
in 1909, pictured in their fig. 277. A corresponding specimen could not be located. Also, Britton & Rose note that this
plant does not exactly match the protologue, according to which this species would have 7-angled to 10-angled stems,
whereas the plant from Berlin had 5-angled stems.
5.20b. Selenicereus pteranthus f. macdonaldeae (Hooker) Ralf Bauer (2003: 44) ≡ Cereus macdonaldiae Hooker
(1853: 4707) ≡ Selenicereus macdonaldeae (Hooker) Britton & Rose (1909: 430)
Lectotype (designated by Bauer 2003a: 44):—[illustration] in Hooker (1853: t. 4707). Image available at http://www.biodiversitylibrary.
org/item/14357#page/64/mode/1up
= Cereus grusonianus Weingart (1905: 54).
Type:—Not designated.
= Cereus rothii Weingart (1922: 146).
Type:—Not designated.
5.21. Selenicereus purpusii (Weingart) S. Arias & N. Korotkova, comb. nov. ≡ Cereus purpusii Weingart (1909: 150)
≡ Hylocereus purpusii (Weingart) Britton & Rose (1920: 184).
Neotype (designated by Doweld 2002b: 14):—MEXICO. Nayarit: Tepic, 600 m, 27 August 1948, Dressler 336 (MO-1718059!).
5.22 Selenicereus setaceus (Salm-Dyck ex A.P. de Candolle) Werderman (1933: 87) ≡ Cereus setaceus Salm-Dyck ex
A.P. de Candolle (1828: 469) ≡ Mediocactus setaceus (Salm-Dyck ex A.P. de Candolle) Borg (1951: 213) ≡ Hylocereus
setaceus (Salm-Dyck ex A.P. de Candolle) Ralf Bauer (2003: 29).
Neotype (designated by Bauer 2003a: 29):—[illustration] “Cereus setaceus” in Pfeiffer & Otto (1839: t. 16).
Image available at http://www.biodiversitylibrary.org/item/107302#page/50/mode/1up
= Cereus hassleri K. Schumann (1900: 45) ≡ Mediocactus hassleri (K. Schumann) Backeberg (1959: 798).
Type:—PARAGUAY. Cordillera [de Altos] Inter 200-280 lat. merid. et 590-630 long occ., December 1895, Hassler 1716 (holotype K-
000250212!, syntypes G-00095956!, NY-00120658! P-04947370!, P-04947368!).
= Cereus lindbergianus F.A.C. Weber ex K. Schumann (1897: 151).
Type:—Not designated.
= Cereus lindmanii F.A.C. Weber ex K. Schumann (1897: 163) ≡ Mediocactus lindmanii (F.A.C. Weber ex K. Schumann) Backeberg
(1959: 798).
Type:—Not designated.
= Mediocactus coccineus (Salm-Dyck) Britton & Rose (1920: 211) ≡ Cereus coccineus Salm-Dyck ex DC. (1828: 469).
Type:—Not designated.
= Selenicereus rizzinii Scheinvar (1974: 251).
Type:—BRAZIL. Río de Janeiro: Araruama, 29 January 1974, Rizzini s.n. (holotype RB, isotype MEXU-00166614!).
5.23. Selenicereus spinulosus (A.P. de Candolle) Britton & Rose (1909: 431) ≡ Cereus spinulosus A.P. de Candolle
(1828: 117) ≡ Mediocactus spinulosus (A.P. de Candolle) Doweld (2002: 42).
Neotype (designated by Doweld 2002a: 42):—MEXICO. Tamaulipas: 14 miles east of El Salto, 4 March 1969, Harmon 1347 (UMO-
92557).
= Selenicereus pseudospinulosus Weingart (1931: 255).
Type:—Not designated.
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 29
5.24. Selenicereus stenopterus (F.A.C. Weber) D.R. Hunt (2017: 35) ≡ Cereus stenopterus F.A.C. Weber (1902: 458)
≡ Hylocereus stenopterus (F.A.C. Weber) Britton & Rose (1909: 429).
Lectotype (designated by Bauer 2003a: 32):—COSTA RICA. Sur les trones des forêts de Las Hueltas, Tucunique, May 1899, Tonduz
13053 (US-795790!, isolectotype G-00236582! syntype P-02273103!).
5.25. Selenicereus tonduzii (F.A.C. Weber) S. Arias & N. Korotkova, comb. nov. ≡ Cereus tonduzii F.A.C. Weber
(1902: 459) ≡ Werckleocereus tonduzii (F.A.C. Weber) Britton & Rose (1909: 432) ≡ Weberocereus tonduzii (F.A.C.
Weber) G.D. Rowley (1982: 46).
Neotype (designated by Bauer 2003a: 50):—COSTA RICA. Limón: near base of Rio Chirripó, in Indian territory, 11 February 1957,
Horich s.n. (K-1470).
5.26. Selenicereus triangularis (Linnaeus) D.R. Hunt (2017: 35) ≡ Cactus triangularis Linnaeus (1753: 468) ≡ Cereus
triangularis (Linnaeus) Haworth (1812: 180) ≡ Hylocereus triangularis (Linnaeus) Britton & Rose (1909: 429).
Lectotype (designated by Doweld 2002b: 12):—[illustration] in Plukenet (1691: t. 29. fig. 3).
Epitype (designated by Doweld 2002b: 12):—JAMAICA. Manchester: Marshalls Pen, ca. 2.25 miles due NW of Mandeville, ca. 700 m,
31 August 1979, Proctor 38288 (MO-3433296).
= Cereus compressus Miller (1768: without pagination) ≡ Hylocereus compressus (Miller) Y. Itô (1981: 122), comb. illeg. (Art. 33.3).
Lectotype (designated by Doweld 2002b: 12):—[illustration] in Plukenet (1691: t. 29. fig. 3).
= Hylocereus cubensis Britton & Rose (1920: 188).
Type:—CUBA. La Habana, Jata Hills, near Guanabaca, 14 July 1913, León 3719 (holotype NY-00385836!, isotypes NY-00385835!, NY-
00385834!, NY-00385833!).
Notes on Selenicereus triangularis:—The publication year of Plukenet’s Phytographia containing the lectotype was
incorrectly given by Doweld l.c as 1696. The original image is available at http://bibdigital.rjb.csic.es/ing/Carga.
php?Pagina=A_PLU_Op_Bot_1/PLU_Op_Bot_1_049.pdf
Notes on Cereus compressus:—Miller (1768) described Cereus compressus as different from Cereus triangularis.
Yet in the protologue of C. compressus, he cited Plukenet’s illustration from the “Phytographia” (Plukenet 1691).
Miller apparently confused the figure of Plukenet, that was originally associated with the name Cactus triangularis by
Linnaeus and associated it with his name Cereus compressus. Doweld (2002b) designated Plukenet’s illustration as the
lectotypes of both, Cactus triangularis Linnaeus and Cereus compressus Miller Therefore Cereus compressus Miller
has to be a homotypic synonym of Cactus triangularis Linnaeus.
The name Cereus triangularis (Linnaeus) Miller is therefore not a combination of Cactus triangularis Linnaeus
because it is based on a different type. However it is unclear what exactly Miller based this name on. Therefore Miller’s
name was probably not used or mentioned by later authors and should best be formally rejected.
5.27. Selenicereus tricae D.R. Hunt (1989: 91) ≡ Mediocactus tricae (D.R. Hunt) Doweld (2002: 42) ≡ Hylocereus
tricae (D.R. Hunt) Ralf Bauer (2003: 29) ≡ Selenicereus inermis subsp. tricae (D.R. Hunt) Ralf Bauer (2010: 12).
Type:—BELIZE. Cayo: secondary forest west of Augustine, 500 m, 13 July 1969, Hunt 7076 (holotype K-29047.259).
5.28. Selenicereus trigonus (Haworth) S. Arias & N. Korotkova comb. nov. ≡ Hylocereus trigonus (Haworth) Safford
(1909: 553, 556) ≡ Cereus trigonus Haworth (1812: 181).
Lectotype (designated by Howard 1989: 404):—[illustration] “Tab. CC cactus caule triangulari articulato” of Plumier (1758: pl. 200. fig.
2).
Lectotype (designated by Bauer 2003a: 41):—US VIRGIN ISLANDS: St. Thomas: Magens Bay, 29 August 2000, Acevedo-Rodríguez
11250 (US-3408457!).
= Cereus napoleonis Graham (1836: 3458) ≡ Hylocereus napoleonis Britton & Rose (1909: 429).
Neotype (designated here):—[illustration] in Hooker (1836: t. 3458). Image available at http://www.biodiversitylibrary.org/item/
14342#page/3/mode/1up
= Cereus plumieri Roland-Gosselin (1908: 668) ≡ Hylocereus plumieri (Roland-Gosselin) Lourteig (1991: 406)
Lectotype (designated here):—[illustration] “Tab. CXCIX cactus repens” of Plumier (1758: pl. 199).
= Hylocereus antiguensis Britton & Rose (1920: 193)
Lectotype (designated by Howard 1989: 404):—ANTIGUA AND BARBUDA. Antigua, 4-16 April 1913, Rose, Fitch & Russell 3297
(US-00115678!, isolectotypes GH-00063130!, NY-00385830!).
KOROTKOVA ET AL.
30 • Phytotaxa 327 (1) © 2017 Magnolia Press
5.29. Selenicereus undatus (Haworth) D.R. Hunt (2017: 35) ≡ Cereus undatus Haworth (1830: 110) ≡ Hylocereus
undatus (Haworth) Britton & Rose (1918: 256)
Neotype (designated by Taylor 1995: 119):—[illustration] “Cactus triangularis” in Sims (1817: t. 1884).
= Cereus tricostatus Roland-Gosselin (1908: 664) ≡ Hylocereus tricostatus (Roland-Gosselin) Britton & Rose (1909: 429).
Type:—Not designated.
5.30. Selenicereus vagans (K. Brandegee) Britton & Rose (1913: 242) ≡ Cereus vagans K. Brandegee (1904: 191) ≡
Mediocactus vagans (K. Brandegee) Doweld (2002: 42).
Neotype (designated by Bauer 2003a: 47):—MEXICO. Sinaloa: El Faro, the light-house at Mazatlán, 12 November 1964, Kimnach 532
(HNT-2061!).
= Cereus longicaudatus F.A.C. Weber (1904: 384).
Type:—Not designated.
5.31. Selenicereus validus S. Arias & U. Guzmán (1995: 27–28).
Type:—MEXICO. Michoacán: Mun. Villa Victoria, 7 km south of Villa Victoria, 600 m, 19 October 1987, Sánchez-Mejorada et al. 4254
(holotype MEXU-1304620!).
Kimnachia S. Arias & N. Korotkova gen. nov.
Type:—Kimnachia ramulosa (Salm-Dyck) S. Arias & N. Korotkova, comb. nov.
Diagnosis:—Plants shrubby with pendent stems, differentiated into primary and secondary stems (dimorphic), primary
stems terete, secondary stems flattened and broadened in the apical part, margins of flattened stem segments crenate
or obtusely serrate, stems often suffused purple, especially when exposed to sunlight; areoles inconspicuous, lacking
spines. Flowers actinomorphic, 1–2 per areole, 7–12 mm long and for up to 15 mm in diameter, pericarpel with small
scales, floral tube inconspicuous, ca. 2–4 mm long, green to reddish brown, perianth whitish/yellowish. Fruit globose
to ovoid, 4-8 mm in diameter, whitish, pulp whitish.
Accepted species:—1 (2 infraspecific taxa).
Etymology:—We name this new genus after our dear colleague Myron Kimnach. He is an outstanding expert
on the epiphytic cacti, and in particular on the Hylocereeae and his publications were a significant contribution to our
knowledge on this group of plants. It is therefore our great pleasure to honour his works by dedicating this genus to
him.
6.1 Kimnachia ramulosa (Salm-Dyck) S. Arias & N. Korotkova, comb. nov.
Basionym ≡ Cereus ramulosus (Salm-Dyck) (1834: 340).
Lectotype (designated by Kimnach 1993: 126):—US, photo of destroyed type at herbarium Berolinense (B), collector and locality
unknown, collected before 1834.
6.1a Kimnachia ramulosa subsp. ramulosa ≡ Rhipsalis ramulosa (Salm-Dyck) Pfeiffer (1837: 130) ≡ Hariota ramulosa
(Salm-Dyck) Lemaire (1839: 75) ≡ Disocactus ramulosus (Salm-Dyck) Kimnach (1961: 14) ≡ Pseudorhipsalis
ramulosa (Salm-Dyck) Barthlott (1991: 90).
= Rhipsalis coriacea Polakowski (1877: 562) ≡ Hariota coriacea (Polakowski) Kuntze (1891: 262).
Lectotype (designated here):—COSTA RICA. Cartago: In arboribus prope Cartago, 20 June 1875, Polakowsky 156 (BM-000776843!).
= Rhipsalis purpusii Weingart (1918: 78)
Lectotype (designated here):—MEXICO. Chiapas: [illustration] “Rhipsalis purpusii Weing. spec. nov.” in Weingart (1918: 79).
Image available at http://www.biodiversitylibrary.org/item/110868#page/341/mode/1up
= Rhipsalis leiophloea Vaupel (1923: 20).
Lectotype (designated by Kimnach 1993: 127):—COSTA RICA. San José, 1857, Hoffman 498 (MO-148525!).
Notes on Rhipsalis coriacea:—Polakowski noted that the type was deposited in Berlin, and was destroyed. A second
original copy deposited in BM is here designated as lectotype.
Notes on Rhipsalis purpusii:—The original sample was collected in 1913 by C. A. Purpus, in Cerro de Boqueron
southwest of Chiapas, Mexico. However, Weingart does not refer to a type specimen deposited. An image of Rhipsalis
purpusii included in the protologue is here designated as lectotype.
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 31
6.1b Kimnachia ramulosa f. angustissima (F.A.C. Weber) S. Arias & N. Korotkova, comb. nov. ≡ Rhipsalis
angustissima F.A.C. Weber (1902: 465) ≡ Disocactus ramulosus var. angustissimus (F.A.C. Weber) Kimnach (1987:
67) ≡ Pseudorhipsalis ramulosa f. angustissima (F.A.C. Weber) Barthlott (1991: 90) ≡ Disocactus ramulosus f.
angustissimus (F.A.C. Weber) Kimnach (1993: 127).
Type:—COSTA RICA. [Cartago]: Caché, au S.E. de Cartago, dans la vallée du Reventazon, 1000 m, 1902, Biolley s.n. (holotype P-
04556957!).
6.1c Kimnachia ramulosa subsp. jamaicensis (Briton & Harris) S. Arias & N. Korotkova, comb. nov. ≡ Rhipsalis
jamaicensis Britton & Harris (1909: 159) ≡ Disocactus ramulosus var. jamaicensis (Britton & Harris) Kimnach (1993:
129) ≡ Pseudorhipsalis ramulosa subsp. jamaicensis (Britton & Harris) Doweld (2002: 42).
Type:—JAMAICA. Trelawny: Troy, ca. 730 m, 1906, Britton 551 (holotype NY-886148!).
Distribution:—Belize, Bolivia, Brazil, Colombia, Costa Rica, Ecuador, Guatemala, Honduras, Mexico, Nicaragua,
Peru, Venezuela; subspecies jamaicensis: Haiti, Jamaica.
7. Pseudorhipsalis Britton & Rose (1923: 213)
Type:—P. alata (Swartz) Britton & Rose
= Wittia K. Schumann (1903: 117), nom. illeg. (Art. 53.1)
= Wittiocactus Rauschert (1982: 558)
Type:—Wittiocactus amazonicus (K. Schumann) Rauschert
= Disisorhipsalis Doweld (2002: 40)
Type:—Disisorhipsalis macrantha (Alexander) Doweld, nom. inval. (Art. 73)
Accepted species:―5 (2 infraspecific taxa).
7.1. Pseudorhipsalis acuminata Cufodontis (1933: 196) ≡ Rhipsalis acuminata (Cufodontis) Standley (1938: 1560) ≡
Disocactus acuminatus (Cufodontis) Kimnach (1961: 14).
Type:—COSTA RICA. Limón: Cairo Branch, near La Castilla-Los Negritos, 30 m, 6 May 1930, Cufodontis 494 (holotype W, isotype
F-0052905F!).
= Pseudorhipsalis horichii (Kimnach) Barthlott (1991: 90).
Type:—COSTA RICA. [Alajuela]: Sarapiqui región, laguna del Cerro Congo: 650 m, 1 July 1962, Horich s.n. (holotype HNT-
0000078!).
7.2. Pseudorhipsalis alata (Swartz) Britton & Rose (1923: 213)
≡ Cactus alatus Swartz (1788: 77) ≡ Epiphyllum alatum (Swartz) Haworth (1819: 84) ≡ Cereus alatus (Swartz) A.P. de Candolle (1828:
410) ≡ Rhipsalis alata (Swartz) K. Schumann (1890: 288) ≡ Hariota alata (Swartz) Kuntze (1891: 262) ≡ Disocactus alatus (Swartz)
Kimnach (1961: 14).
Lectotype (designated by Kimnach 1993: 122):—JAMAICA. Locality unknown, Swartz s.n. (S-R-798!, syntype BM-001008538!).
= Rhipsalis swartziana Pfeiffer (1837: 131) ≡ Hariota swartziana (Pfeiffer) Lemaire (1839: 75).
Type:—Not designated.
= Rhipsalis harrisii Gürke (1908: 180) ≡ Pseudorhipsalis harrisii (Gürke) Y. Itô (1952: 160).
Type:—Not designated.
7.3. Pseudorhipsalis amazonica (K. Schumann) Ralf Bauer (2003: 101) ≡ Wittia amazonica K. Schumann (1903: 117),
nom. illeg. ≡ Disocactus amazonicus (K. Schumann) D.R. Hunt (1982: 2) ≡ Wittiocactus amazonicus (K. Schumann)
Rauschert (1982: 559).
Lectotype (designated by Kimnach 1993: 117):—PERU. Loreto: Leticia, July 1902, Ule 6189 (G-00236720!).
7.3a. Pseudorhipsalis amazonica subsp. amazonica
7.3b. Pseudorhipsalis amazonica subsp. chocoensis Ralf Bauer (2002: 108–109)
Type:—COLOMBIA. Chocó: near Nuquí, 6 March 1999, Bauer 29 (holotype ZSS-22545!).
KOROTKOVA ET AL.
32 • Phytotaxa 327 (1) © 2017 Magnolia Press
7.3c. Pseudorhipsalis amazonica subsp. panamensis (Britton & Rose) Ralf Bauer (2003: 106) ≡ Wittia panamensis
Britton & Rose (1913: 241) ≡ Wittiocactus panamensis (Britton & Rose) Rauschert (1982: 559).
Type:—PANAMA. Panamá: above Chepo, 15 October 1911, Pittier 4571 (holotype US-691299!, isotype NY00386208!).
7.4. Pseudorhipsalis himantoclada (Roland-Gosselin) Britton & Rose (1923:213) ≡ Rhipsalis himantoclada Roland-
Gosselin (1908: 694) ≡ Wittia himantoclada (Roland-Gosselin) Woodson (1958: 88) ≡ Disocactus himantocladus
(Roland-Gosselin) Kimnach (1961: 14).
Neotype (designated by Kimnach 1993: 117):—COSTA RICA. Puntarenas: Pozo Azul de Pirrís, ca. 170 m, 1915, Lankester s.n. (US-
2386472!, isoneotype P-04556965!).
= Wittia costaricensis Britton & Rose (1913: 261).
Type:—COSTA RICA. At the west coast, 1907, Wercklé s.n. (holotype US-691402!).
7.5. Pseudorhipsalis lankesteri (Kimnach) Barthlott (1991: 90)
Type:—COSTA RICA. Puntarenas: Valle de El General, ca. 670 m, ca. 1940, Lankester s.n. (holotype HNT-1214!).
8. Weberocereus Britton & Rose (1909: 431).
Type:—W. tunilla (F.A.C.Weber) Britton & Rose.
= Eccremocactus Britton & Rose in Contr. U.S. Natl. Herb. 16: 261. 1913.
Type:—Eccremocactus bradei Britton & Rose.
Accepted species:—6 (1 infraspecific taxon).
8.1. Weberocereus bradei (Britton & Rose) G.D.Rowley (1974: 10).
≡ Eccremocactus bradei Britton & Rose (1913: 262) ≡ Phyllocactus bradei (Britton & Rose) Vaupel (1913: 118) ≡ Epiphyllum bradei
(Britton & Rose) Standl. (1937: 753).
Lectotype (designated by Bauer 2003a: 52):—COSTA RICA. Puntarenas: near Santo Domingo, Turrubares, 200 m, 1905, Brade s.n. (NY-
120685!).
8.2. Weberocereus frohningiorum Ralf Bauer (2001: 228).
Type:—COSTA RICA. locality and collector unknown, cult. Hort. H. & U. Frohning s.n. (holotype ZSS-19806, isotype K-000100018!).
8.3. Weberocereus imitans (Kimnach & Hutchison) Buxbaum (1978: 125) ≡ Werckleocereus imitans Kimnach &
Hutchison (1956: 154) ≡ Cryptocereus imitans (Kimnach & Hutchison) Backeberg (1959: 734) ≡ Eccremocactus
imitans (Kimnach & Hutchison) Kimnach (1962: 82).
Type:—Costa Rica. Puntarenas: Valle de El General, near Cañas, ca. 1940, Lankester s.n. (holotype UC-052593!).
8.4. Weberocereus rosei (Kimnach) Buxbaum (1978: 125) ≡ Eccremocactus rosei Kimnach (1962: 80) ≡ Cryptocereus
rosei (Kimnach) Backeberg (1963: 5).
Type:—ECUADOR. Chimborazo: canyon of Río Chanchan between Naranjapata and Olimpio, 700–1000 m, September 1958, Horich
s.n. (holotype UC-229129!).
8.5. Weberocereus trichophorus H. Johnson & Kimnach (1963: 205).
Type:—COSTA RICA. Limón: Peralta, ca. 330 m, Lankester s.n. (holotype UC-229160!).
8.6. Weberocereus tunilla (F.A.C. Weber) Britton & Rose (1909: 432).
≡ Cereus tunilla F.A.C. Weber (1902: 460).
Neotype (designated by Bauer 2003a: 51):—COSTA RICA. Cartago: canyon of Río Birrís, 1100 m, 7 January 1958, Horich s.n. (ZSS-
000274!).
8.6a. Weberocereus tunilla subsp. tunilla
= Cereus gonzalezii F.A.C. Weber (1902: 460).
Type:—Not designated.
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 33
8.6b. Weberocereus tunilla subsp. biolleyi (F.A.C. Weber) Ralf Bauer (2003: 243) ≡ Rhipsalis biolleyi F.A.C. Weber
(1902: 476) ≡ Cereus biolleyi F.A.C. Weber in K. Schumann (1903: 60).
Neotype (designated by Bauer 2003a: 51):—COSTA RICA. Limón: northern Llanura de Santa Clara, along Río Sucio, 100–150 m, Horich
s.n. (ZSS-21351).
= Weberocereus panamensis Britton & Rose (1920: 215).
Type:—PANAMA. Province of Colon: Rio Fato Valley, above Nombre de Dios, July 1911, Pittier 3903 (holotype US-00117135!, isotypes
NY-00386199!, NY-00386200!, NY-00386198!, K-000101169!, K-000101168!).
A synopsis of Strophocactus
Our results show a highly supported clade containing Strophocactus wittii and Pseudoacanthocereus. The latter genus
is currently accepted including two species P. sicariguensis and P. brasiliensis (Hunt 2006). We argue for combining
both Pseudoacanthocereus species into Strophocactus because all three species share morphological characters
as discussed above. Therefore we suggest a single genus for these three species and merge them under the oldest
name Strophocactus. The necessary new combinations are provided below. Strophocactus is assigned to the tribe
Echinocereeae.
Strophocactus Britton & Rose (1913: 262).
Type:—Strophocactus wittii (K. Schumann) Britton & Rose.
Accepted species:—3
Strophocactus brasiliensis (Britton & Rose) S. Arias & N. Korotkova, comb. nov. ≡ Acanthocereus brasiliensis Britton
& Rose (1920: 125) ≡ Pseudoacanthocereus brasiliensis (Britton & Rose) F. Ritter (1979: 47).
Type:—BRAZIL. Bahia: vicinity of Machado Portella, 1915, Rose 19903 (holotype US-762245!).
Strophocactus sicariguensis (Croizat & Tamayo) S. Arias & N. Korotkova, comb. nov. ≡ Acanthocereus sicariguensis
Croizat & Tamayo (1947: 75) ≡ Pseudoacanthocereus sicariguensis (Croizat & Tamayo) N.P. Taylor (1992: 30).
Type:—VENEZUELA. Lara: Torres, Sicarigua, Tamayo 3296 (holotype VEN-46728!).
Strophocactus wittii (K. Schumann) Britton & Rose (1913: 262) ≡ Cereus wittii K. Schumann (1900: 154) ≡ Selenicereus
wittii (K. Schumann) Rowley (1986: 36).
Type:—BRAZIL. Amazonas: near Manaus, 1900, Witt s.n. (holotype B-810006832!; isotypes: US-535998!, K-000250213!).
Notes:―The specimen at US is annotated as lectotype by Hutchison 1960, assuming the type at B had been destroyed,
which is however not the case.
Synopsis of Deamia
Deamia Britton & Rose (1920: 212).
Type:—Deamia testudo (Karwinsky ex Zuccarini) Britton & Rose (1920: 213).
Accepted species:—2
Deamia chontalensis (Alexander) Doweld (2002: 41) ≡ Nyctocereus chontalensis Alexander (1950: 132) ≡
Strophocactus chontalensis (Alexander) Ralf Bauer (2003: 54).
Lectotype (designated by Bauer 2003a: 55):—[illustration] “Flower of Nyctocereus chontalensis sp. nov., x 0.6” in
Alexander (1950: 129).
Deamia testudo (Karwinsky ex Zuccarini) Britton & Rose (1920: 213).
≡ Cereus testudo Karwinsky ex Zuccarini (1837: 682) ≡ Selenicereus testudo (Karwinsky ex Zuccarini) Buxbaum ex Krainz (1965: C.IIa)
≡ Strophocactus testudo (Karwinsky ex Zuccarini) Ralf Bauer (2003: 55).
Neotype (designated by Bauer 2003a: 55):—MEXICO. Veracruz: near Minatitlán, 1958, King s.n. (HNT-2055).
=Deamia diabólica Clover (1938: 570).
Type:—BELIZE. Corozal, 1931–1932, Gentle 490 (holotype MICH-1003450A!).
KOROTKOVA ET AL.
34 • Phytotaxa 327 (1) © 2017 Magnolia Press
Acknowledgements
This study would not have been possible without the living collections in the Botanic Garden Berlin and the Botanic
Gardens of the University of Bonn. We are therefore most grateful to the garden staff members who have been caring
for these collections during the last years or even decades with great enthusiasm. We first need to thank N. Köster,
curator of the tropical plant collection of the Berlin Botanic Garden, for his care of the cacti collection and his support
for this study. We also greatly acknowledge the efforts of B. E. Leuenberger (deceased 2010) who originally built
up the Hylocereeae living collection in Berlin as a curator. We have especially to thank the horticultural staff of the
Berlin Botanic Garden: S. Gasper, M. Krinelcke, C. Neuenfeldt, A. Moldenhauer, and B. Radtke who care for the
living collection of cacti in Berlin. From Bonn, we thank W. Lobin (curator) and the horticulturalists O. Kriesten and
B. Emde. We also thank R. Bauer (Offenburg) who contributed valuable material from his collection. B. Hammel
(CR) provided photographs and information on Costa Rican species. Several people have provided very helpful tips
on earlier versions of the manuscript and the taxonomic synopsis: we thank E. von Raab-Straube and N. Turland (both
BGBM) for advice on nomenclatural questions, to W. Barthlott (Bonn) for many fruitful discussions, and to K. Jones
and J. Marquardt (BGBM) for proof-reading of the manuscript. We are grateful to the laboratory team at the BGBM,
especially K. Govers, J. Pfitzner, T. Pfalzgraff, D. Weigel, and H. Fleischer-Notter for their support in generating the
data. S. A. thanks for support from DGAPA PAPIIT (IN208315), N. K. and T. B. appreciate financial support from the
Verein der Freunde des Botanischen Gartens und Botanischen Museums Berlin-Dahlem e.V.
References
Alexander, E.J. (1950) A new Nyctocereus from southern Mexico. Cactus and Succulent Journal (Los Angeles) 22: 131–133.
Anceschi, G. & Magli, A. (2013) The new monophyletic macrogenus Echinopsis. No risk of paraphyly, and the most convincing hypothesis
in phylogenetic terms. Cactaceae Systematics Initiatives 31: 24–27.
Anderson, E.F. (2001) The Cactus Family. Timber Press, Portland, 776 pp.
Anderson, E.F. (2005) Das große Kakteen-Lexikon. Eugen Ulmer KG, Stuttgart, 744 pp.
Arias, S., Terrazas, T., Arreola-Nava, H.J., Vazquez-Sanchez, M. & Cameron, K.M. (2005) Phylogenetic relationships in Peniocereus
(Cactaceae) inferred from plastid DNA sequence data. Journal of Plant Research 118: 317–328.
https://doi.org/10.1007/s10265-005-0225-3
Backeberg, C. (1959) Die Cactaceae. Band II. Cereoideae (Hylocereae-Cereae [Austrocereinae]. VEB Gustav Fischer Verlag, Jena, 1360
pp.
Bárcenas, R.T., Yesson, C. & Hawkins, J.A. (2011) Molecular systematics of the Cactaceae. Cladistics 27: 1–20.
https://doi.org/10.1111/j.1096-0031.2011.00350.x
Barthlott, W. (1975) Zur systematischen Stellung von Disocactus himantocladus (Roland-Gosselin) Kimnach. Kakteen und andere
Sukkulenten 26: 246–249, 278–280.
Barthlott, W. (1983) Biogeography and evolution in neo- and palaeotropical Rhipsalinae (Cactaceae). In: Kubitzki, K. (Ed.) Proceedings
of the International Symposium Dispersal and Distribution. Sonderbände des Naturwissenschaftlichen Vereins in Hamburg 7, pp.
241–248.
Barthlott, W. (1991) Disocactus, Lepismium and Pseudorhipsalis. In: Hunt, D. & Taylor, N.P. (Eds.) Notes on miscellaneous genera of
Cactaceae. Bradleya 9: 81–92.
Barthlott, W. & Hunt, D.R. (1993) Cactaceae. In: Kubitzki, K. (Ed.) The families and genera of vascular plants, Vol. II. Springer, Berlin
Heidelberg New York Tokyo, pp. 161–197.
https://doi.org/10.1007/978-3-662-02899-5_17
Barthlott, W., Porembski, S., Kluge, M., Hopke, J. & Schmidt, L. (1997) Selenicereus wittii (Cactaceae): An epiphyte adapted to Amazonian
Igapo inundation forests. Plant Systematics and Evolution 206: 175–185.
https://doi.org/10.1007/BF00987947
Barthlott, W., Burstedde, K., Geffert, J.L., Ibisch, P.L., Korotkova, N., Rafiqpoor, D., Stein, A. & Mutke, J. (2015) Biogeography and
biodiversity of cacti. Schumannia 7. Universitätsverlag Isensee, Oldenburg, 205 pp.
Bauer, R. (2002) The genus Pseudorhipsalis Britton & Rose. Haseltonia: 94–120.
Bauer, R. (2003a) A synopsis of the tribe Hylocereeae F. Buxb. Cactaceae Systematics Initiatives 17: 3–63.
Bauer, R. (2003b) The typification of Cereus pteranthus Link ex A. Dietr. (Selenicereus pteranthus (Link ex A. Dietr.) Britt. & Rose.
Haseltonia 9: 78–79.
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 35
Bauer, R. (2003c) Typisiserung von Phyllocactus thomasianus K. Schumann. Kakteen und andere Sukkulenten 54: 245–247.
Bauer, R. (2009) Epiphyllum anguliger (Lemaire) Don ex Loudon, eine botanische interessante Art aus dem westlichen Mexico. EPIG
63: 5–15.
Berger, A. (1905) A systematic revision of the genus Cereus Mill. Missouri Botanical Garden Annual Report 1905: 57–86.
https://doi.org/10.2307/2400072
Berger, A. (1929) Kakteen. Eugen Ulmer, Stuttgart, 346 pp.
Borsch, T., Hernandez-Ledesma, P., Berendsohn, W.G., Flores-Olvera, H., Ochoterena, H., Zuloaga, F.O., von Mering, S. & Kilian, N.
(2015) An integrative and dynamic approach for monographing species-rich plant groups—Building the global synthesis of the
angiosperm order Caryophyllales. Perspectives in Plant Ecology, Evolution and Systematics 17: 284–300.
https://doi.org/10.1016/j.ppees.2015.05.003
Bravo-Hollis, H. (1978) Las Cactaceas de Mexico, Vol. 1. Universidad Nacional Autonoma de Mexico, Mexico City, 743 pp.
Britton, N.L. & Rose, J.N. (1909) The genus Cereus and its allies in North America. Contributions from the United States National
Herbarium 12: 413–437, 474.
Britton, N.L. & Rose, J.N. (1913) The genus Epiphyllum and its allies. Contributions from the United States National Herbarium 16:
255–262.
Britton, N.L. & Rose, J.N. (1920) The Cactaceae. Descriptions and illustrations of plants of the cactus family, Vol. 2. Carnegie Institute,
Washington, 248 pp.
Britton, N.L. & Rose, J.N. (1923) The Cactaceae. Descriptions and illustrations of plants of the cactus family, Vol. 4. Carnegie Institute,
Washington, 248 pp.
Brockington, S.F., Yang, Y., Gandia-Herrero, F., Covshoff, S., Hibberd, J.M., Sage, R.F., Wong, G.K.S., Moore, M.J. & Smith, S.A. (2015)
Lineage-specific gene radiations underlie the evolution of novel betalain pigmentation in Caryophyllales. New Phytologist 207:
1170–1180.
https://doi.org/10.1111/nph.13441
Buxbaum, F. (1958) The phylogenetic division of the subfamily Cereoideae, Cactaceae. Madroño 14: 177–206.
Buxbaum, F. (1962) Das phylogenetische System den Cactaceae. In: Krainz, H. (Ed.) Die Kakteen. Franckh‘she Verlagshandlung,
Stuttgart, pp. 1–21.
Buxbaum, F. (1965) Gattung Selenicereus. In: Krainz, H. (Ed.) Die Kakteen. Franck‘sche Verlangshandlung, Stuttgart, p. C II a.
Buxbaum, F. (1969) Gattung Epiphyllum. In: Krainz, H. (Ed.) Die Kakteen. Franck‘sche Verlangshandlung, Stuttgart, p. C II b.
Candolle, A.P. de (1828) Revue de la famille des Cactées. Mémoires du Muséum d’histoire naturelle 31: 1–119.
Cruz, M.Á., Arias, S. & Terrazas, T. (2016) Molecular phylogeny and taxonomy of the genus Disocactus (Cactaceae), based on the DNA
sequences of six chloroplast markers. Willdenowia 46: 145–164.
https://doi.org/10.3372/wi.46.46112
Cuénoud, P., Savolainen, V., Chatrou, L.W., Powell, M., Grayer, R.J. & Chase, M.W. (2002) Molecular phylogenetics of Caryophyllales
based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA sequences. American Journal of Botany 89: 132–144.
https://doi.org/10.3732/ajb.89.1.132
Darriba, D., Taboada, G.L., Doallo, R. & Posada, D. (2012) jModelTest 2: more models, new heuristics and parallel computing. Nature
Methods 9: 772–772.
https://doi.org/10.1038/nmeth.2109
Dietrich, A. (1834) Beschreibung des Cereus nycticaulis Link. Verhandlungen des Vereins zur Beförderung des Gartenbaues in den
Königlich Preussischen Staaten 10: 372–375.
Dillenius, J.J. (1732) Hortus Elthamensis (Vol. 1). Sumptibus auctoris, Londini, 204 pp.
Dodson, C.H. & Gentry, A.H. (1977) Epiphyllum phyllanthus and its allies in Ecuador. Selbyana 2: 30–31.
Doweld, A.B. (2002a) Re-classification of Rhipsalideae, a polyphyletic tribe of the Cactaceae. Sukkulenty 1–2: 25–45.
Doweld, A.B. (2002b) A typification of the species of Hylocereus. Turczaninowia 1: 11–16.
Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792–1797.
https://doi.org/10.1093/nar/gkh340
Farris, J.S., Albert, V.A., Källersjö, M., Lipscomb, D. & Kluge, A.G. (1996) Parsimony jackknifing outperforms neighbor-joining.
Cladistics 12: 99–124.
https://doi.org/10.1111/j.1096-0031.1996.tb00196.x
Gibson, A. & Nobel, P.S. (1986) The cactus primer. Harvard University Press, Cambridge, 286 pp.
https://doi.org/10.4159/harvard.9780674281714
Gómez-Hinostrosa, C., Hernández, H.M., Terrazas, T. & Correa-Cano, M.E. (2014) Studies on Mexican Cactaceae. V. Taxonomic notes
on Selenicereus tricae. Brittonia 66: 51–59.
https://doi.org/10.1007/s12228-013-9308-y
KOROTKOVA ET AL.
36 • Phytotaxa 327 (1) © 2017 Magnolia Press
González Ortega, J. (1926) Peniocereus rosei sp. n. Revista Mexicana de Biología 6: 189–191.
Harpke, D. & Peterson, A. (2006) Non-concerted ITS evolution in Mammillaria (Cactaceae). Molecular Phylogenetics and Evolution 41:
579–593.
https://doi.org/10.1016/j.ympev.2006.05.036
Hernández-Hernández, T., Hernández, H.M., De-Nova, J.A., Puente, R., Eguiarte, L.E. & Magallón, S. (2011) Phylogenetic relationships
and evolution of growth form in Cactaceae (Caryophyllales, Eudicotyledoneae). American Journal of Botany 98: 44–61.
https://doi.org/10.3732/ajb.1000129
Hernández-Ledesma, P., Berendsohn, W.G., Borsch, T., von Mering, S., Akhani, H., Arias, S., Castañeda-Noa, I., Eggli, U., Eriksson, R.,
Flores-Olvera, H., Fuentes-Bazán, S., Kadereit, G., Klak, C., Korotkova, N., Nyffeler, R., Ocampo, G., Ochoterena, H., Oxelman,
B., Rabeler, R.K., Sanchez, A., Schlumpberger, B.O. & Uotila, P. (2015) A taxonomic backbone for the global synthesis of species
diversity in the angiosperm order Caryophyllales. Willdenowia 45: 281–383.
https://doi.org/10.3372/wi.45.45301
Hilu, K.W. & Liang, H.P. (1997) The matK gene: Sequence variation and application in plant systematics. American Journal of Botany
84: 830–839.
https://doi.org/10.2307/2445819
Hooker, W.J. (1836) Cereus Napoleonis. Napoleon’s Cereus. Curtis’s Botanical Magazine 63: t. 3458.
Hooker, W.J. (1854) Cereus Lemaireii. Lemaire’s Cereus. Curtis’s Botanical Magazine 80: t. 4814.
Hooker, W.J. (1853) Cereus MacDonaldieae—Mrs. MacDonald’s Great Night-Flowering Cereus. Curtis’s Botanical Magazine 79: t.
4707.
House, P.R., Gómez-Hinostrosa, C. & Hernández, H.M. (2013) Una especie nueva de Peniocereus (Cactaceae) de Honduras. Revista
Mexicana de Biodiversidad 84: 1077–1081.
https://doi.org/10.7550/rmb.32720
Howard, R.A. (1989) Flora of the Lesser Antilles, Vol. 5 (2). Harvard University Jamaica Plain, Massachusetts, 658 pp.
Hummelinck, P.W. (1938) Over Cereus repandus, Cephalocereus lanuginosus, Lemaireocereus griseus en Acanthocereus tetragonus. III.
Succulenta 20: 165–171.
Hunt, D.R. (1984) The Cactaceae of Plumier’s Botanicum Americanum. Bradleya 2: 39–64.
Hunt, D.R. (1989) Notes on Selenicereus (A.Berger) Britton & Rose and Aporocactus Lemaire (Cactaceae-Hylocereinae). Bradleya 7:
89–96.
Hunt, D.R. (1991) Notes on miscellaneous genera of Cactaceae. Bradleya 9: 82–83.
Hunt, D.R. (1998) Further notes on Acanthocereus (Engelmann ex Berger) B. & R. Cactaceae Consensus Initiatives 5: 15–17
Hunt, D.R. (2000) Selenicereus. Cactaceae Systematics Initiatives 9: 18.
Hunt, D.R. (2006) The New Cactus Lexicon. dh books, Milborne Port, 371 pp.
Hunt, D.R. (2017) Selenicereus. Cactaceae Systematics Initiatives 36: 29–36.
Hunt, D.R. & Taylor, N.P. (1990) The genera of the Cactaceae: progress towards consensus. Bradleya 8: 85–107.
Hunt, D.R. & Taylor, N.P. (2006) Notulae Systematicae Lexicon Cactacearum Spectantes VII. Cactaceae Systematics Initiatives 21:
4–10.
Johnson, L.A. & Soltis, D.E. (1995) Phylogenetic inference in Saxifragaceae s.str. and Gilia (Polemoniaceae) using matK sequences.
Annals of the Missouri Botanical Garden 82: 149–175.
https://doi.org/10.2307/2399875
Karsten, G. & Schenck, H. (1905) Vegetationsbilder (Vol. 2. Reihe, Heft 1). Gustav Fischer Verlag, Jena, 218 pp.
Kelchner, S.A. (2000) The evolution of non-coding chloroplast DNA and its application in plant systematics. Annals of the Missouri
Botanical Garden 87: 482–498.
https://doi.org/10.2307/2666142
Kilian, N., Henning, T., Plitzner, P., Müller, A., Güntsch, A., Stöver, B.C., Müller, K.F., Berendsohn, W.G. & Borsch, T. (2015) Sample data
processing in an additive and reproducible taxonomic workflow by using character data persistently linked to preserved individual
specimens. Database 2015: bav094.
https://doi.org/10.1093/database/bav094
Kimnach, M. (1961) Disocactus ramulosus. Cactus and Succulent Journal (Los Angeles) 33: 11–16.
Kimnach, M. (1964) Epiphyllum phyllanthus. Cactus and Succulent Journal (Los Angeles) 36: 105–115.
Kimnach, M. (1965) Epiphyllum thomasianum. Cactus and Succulent Journal (Los Angeles) 37: 162–168.
Kimnach, M. (1967) Hylocereus calcaratus. Cactus and Succulent Journal (Los Angeles) 39: 102–105.
Kimnach, M. (1991) Selenicereus. In: Hunt, D. & Taylor, N.P. (Eds.) Notes on miscellaneous genera of Cactaceae. Bradleya 9: 81–92.
Kimnach, M. (1993) The genus Disocactus. Haseltonia 1: 95–139.
Kishino, H. & Hasegawa, M. (1989) Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 37
sequence data, and the branching order in Hominoidea. Journal of Molecular Evolution 29: 170–179.
https://doi.org/10.1007/BF02100115
Korotkova, N., Zabel, L., Quandt, D. & Barthlott, W. (2010) A phylogenetic analysis of Pfeiffera and the reinstatement of Lymanbensonia
as an independently evolved lineage of epiphytic Cactaceae within a new tribe Lymanbensonieae. Willdenowia 40: 151–172.
https://doi.org/10.3372/wi.40.40201
Korotkova, N., Borsch, T., Quandt, D., Taylor, N.P., Müller, K. & Barthlott, W. (2011) What does it take to resolve relationships and to
identify species with molecular markers? An example from the epiphytic Rhipsalideae (Cactaceae). American Journal of Botany 98:
1549–1572.
https://doi.org/10.3732/ajb.1000502
Lemaire, C. (1860) Des Cacteés. A propos d’un genere nouveau de cette famille. L’illustration horticole 7: 66–68.
Leuenberger, B.E. (1976) Die Pollenmorphologie der Cactaceae und ihre Bedeutung für die Systematik. J. Cramer, Ganter Verlag, Vaduz,
321 pp.
Leuenberger, B.E. (1997) Cactaceae. In: Görts-van Rijn, A.R.A. (Ed.) Flora of the Guianas Ser. A. Koeltz Königstein, pp. 1–60.
Leuenberger, B.E. (2001) Selenicereus extensus (Cactaceae), new combination and taxonomic history. Botanische Jahrbucher fur
Systematik, Pflanzengeschichte und Pflanzengeographie 123: 47–62.
Lindley, J. (1845) Disocactus biformis. Edwards‘s Botanical Register 31: t. 9.
Lödé, J. (2013) New combinations. Cactus Adventures International. Supplement 98: 2–3.
Löhne, C. & Borsch, T. (2005) Molecular evolution and phylogenetic utility of the petD group II intron: A case study in basal angiosperms.
Molecular Biology and Evolution 22: 317–332.
https://doi.org/10.1093/molbev/msi019
Lourteig, A. (1991) Nomenclatura plantarum americanum XVI. Cactaceae. Bradea 5: 400–411.
Miller, P. (1768) The gardeners dictionary (8 ed.). Printed for the author and sold by John and Francis Rivington, London, without
pagination.
Müller, K. (2004) PRAP—computation of Bremer support for large data sets. Molecular Phylogenetics and Evolution 31: 780–782.
https://doi.org/10.1016/j.ympev.2003.12.006
Müller, K. (2005a) The efficiency of different search strategies in estimating parsimony jackknife, bootstrap, and Bremer support. BMC
Evolutionary Biology 5: 58.
https://doi.org/10.1186/1471-2148-5-58
Müller, K. (2005b) SeqState—primer design and sequence statistics for phylogenetic DNA data sets. Applied Bioinformatics 4: 65–69.
Müller, K. & Borsch, T. (2005) Phylogenetics of Amaranthaceae based on matK/trnK sequence data—Evidence from Parsimony, likelihood,
and Bayesian analyses. Annals of the Missouri Botanical Garden 92: 66–102.
Müller, J., Müller, K., Neinhuis, C. & Quandt, D. (2005) [Continuously update] PhyDE: Phylogenetic Data Editor. Available from: www.
phyde.de (accessed 28 September 2011)
Nixon, K.C. (1999) The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics 15: 407–414.
https://doi.org/10.1111/j.1096-0031.1999.tb00277.x
Nyffeler, R. (2002) Phylogenetic relationships in the cactus family (Cactaceae) based on evidence from trnK/matK and trnL-trnF sequences.
American Journal of Botany 89: 312–326.
https://doi.org/10.3732/ajb.89.2.312
Nyffeler, R. & Eggli, U. (2010) A farewell to dated ideas and concepts—molecular phylogenetics and a revised suprageneric classification
of the family Cactaceae. Schumannia 6: 109–151.
Ochoterena, H. (2009) Homology in coding and non-coding DNA sequences: a parsimony perspective. Plant Systematics and Evolution
282: 151–168.
https://doi.org/10.1007/s00606-008-0095-y
Pantocsek, J. (1889) Beiträge zur Kenntnis der Fossilen Bacillarien Ungarns. Teil II. Brackwasser Bacillarien. Anhang: Analyse de marine
Depots von Bory, Bremia, Nagy-Kurtos in Ungarn; Ananio und Kusnetzk in Russland. Buchdruckerei von Julius Platzko, Nagy-
Tapolcsány, 123 pp.
Pfeiffer, L. & Otto, F. (1839) Abbildung und Beschreibung Blühender Cacteen. Theodor Fischer, Cassel, without pagination.
Plukenet, L. (1691) Phytographia, sive stirpium illustriorum & minus cognitarum icones, Vol. 1. Sumptibus Autoris, Londini, without
pagination.
Plukenet, L. (1692) Phytographia, sive stirpium illustriorum & minus cognitarum icones, Vol. 3. Sumptibus Autoris, Londini, without
pagination.
Plume, O., Straub, S. C. K., Tel-Zur, N., Cisneros, A., Schneider, B. & Doyle, J. J. (2013) Testing a hypothesis of intergeneric allopolyploidy
in vine cacti (Cactaceae: Hylocereeae). Systematic Botany 38: 737–751.
https://doi.org/10.1600/036364413X670421
KOROTKOVA ET AL.
38 • Phytotaxa 327 (1) © 2017 Magnolia Press
Plumier, C. & Burman, J. (1758) Plantarum americanarum, Fasc. 8. Amstelaedami: Lugd. Batav.: Sumtibus Auctoris, without
pagination.
Quandt, D. & Stech, M. (2004) Molecular evolution and phylogenetic utility of the chloroplast trnT-trnF region in bryophytes. Plant
Biology 6: 545–554.
https://doi.org/10.1055/s-2004-821144
Quandt, D., Müller, K. & Huttunen, S. (2003) Characterisation of the chloroplast DNA psbT-H region and the influence of dyad symmetrical
elements on phylogenetic reconstructions. Plant Biology 5: 400–410.
https://doi.org/10.1055/s-2003-42715
Rambaut, A., Suchard, M.A. & Drummond, A.J. (2014) Tracer v1.6. Available from: http://beast.bio.ed.ac.uk/ (accessed 18 February
2015)
Rauschert, S. (1982) Nomina nova generica et combinationes novae Spermatophytorum et Pteridophytorum. Taxon 31: 554–563.
https://doi.org/10.2307/1220694
Ritz, C.M., Reiker, J., Charles, G., Hoxey, P., Hunt, D.R., Lowry, M., Stuppy, W. & Taylor, N. (2012) Molecular phylogeny and character
evolution in terete-stemmed Andean opuntias (Cactaceae-Opuntioideae). Molecular Phylogenetics and Evolution 65: 668–681.
https://doi.org/10.1016/j.ympev.2012.07.027
Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–
1574.
https://doi.org/10.1093/bioinformatics/btg180
Sánchez-Mejorada, H. (1974) Dos nuevas variedades de Peniocereus fosterianus. Cactáceas y Suculentas Mexicanas 19:48–55.
Schäferhoff, B., Müller, K.F. & Borsch, T. (2009) Caryophyllales phylogenetics: disentangling Phytolaccaceae and Molluginaceae and
description of Microteaceae as a new isolated family. Willdenowia 39: 209–228.
https://doi.org/10.3372/wi.39.39201
Schlumpberger, B.O. & Renner, S.S. (2012) Molecular phylogenetics of Echinopsis (Cactaceae): Polyphyly at all levels and convergent
evolution of pollination modes and growth forms. American Journal of Botany 99: 1335–1349.
https://doi.org/10.3732/ajb.1100288
Schumann, K.M. (1895) Phyllocactus Thomasianus K. Sch. Monatsschrift für Kakteenkunde 5: 6.
Schumann, K.M. (1897–1899) Gesamtbeschreibung der Kakteen (Monographia Cactacearum). Neumann, Neudamm, 832 pp.
Schumann, K.M. (1900) Cactaceae. In: Loesener, T. (Ed.) Beiträge zur Kenntnis der Flora von Central-Amerika (einschließlich Mexico)
II. Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 29: 99–100.
Schumann, K.M. (1903) Wittia Amazonica K. Sch. n. gen. et spec. Monatsschrift für Kakteenkunde 13: 117–119.
Shaw, J., Lickey, E.B., Beck, J.T., Farmer, S.B., Liu, W., Miller, J., Siripun, K.C., Winder, C.T., Schilling, E.E. & Small, R.L. (2005) The
tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of
Botany 92: 142–166.
https://doi.org/10.3732/ajb.92.1.142
Silvestro, D. & Michalak, I. (2012) raxmlGUI: a graphical front-end for RAxML. Organisms Diversity & Evolution 12: 335–337.
https://doi.org/10.1007/s13127-011-0056-0
Simmons, M.P. & Ochoterena, H. (2000) Gaps as characters in sequence-based phylogenetic analyses. Systematic Biology 49: 369–381.
https://doi.org/10.1093/sysbio/49.2.369
Sims, J. (1817) Cactus triangularis. Triangular creeping Cereus, or Strawberry Pear. Curtis’s Botanical Magazine 44: t. 1884.
Sims, J. (1826) Cactus phyllanthus. Spleenwort-leaved cactus. Curtis’s Botanical Magazine 53: t. 2692.
Stamatakis, A. (2014) RAxML Version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:
1312–1313.
https://doi.org/10.1093/bioinformatics/btu033
Stamatakis, A., Hoover, P. & Rougemont, J. (2008) A rapid bootstrap algorithm for the RAxML web servers. Systematic Biology 57:
758–771.
https://doi.org/10.1080/10635150802429642
Stöver, B. & Müller, K. (2010) TreeGraph 2: Combining and visualizing evidence from different phylogenetic analyses. BMC Bioinformatics
11: 7.
https://doi.org/10.1186/1471-2105-11-7
Swofford, D.L. (1998) PAUP*. Phylogenetic Analysis Using Parsimony (*and other Methods). Sinauer Associates, Sunderland.
Taberlet, P., Gielly, L., Pautou, G. & Bouvet, J. (1991) Universal primers for amplification of three non-coding regions of the chloroplast
DNA. Plant Molecular Biology 17: 1105–1109.
https://doi.org/10.1007/BF00037152
Taylor, N.P. & Zappi, D.C. (2004) Cacti of Eastern Brasil. Kew Publishing, London, 499 pp.
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 39
Taylor, N.P., Zappi, D.C. & Eggli, U. (1992) Pseudoacanthocereus. Bradleya 10: 28.
Templeton, A.R. (1983) Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution
of humans and the apes. Evolution 37: 221–244.
https://doi.org/10.1111/j.1558-5646.1983.tb05533.x
Vázquez-Sánchez, M., Terrazas, T., Arias, S. & Ochoterena, H. (2013) Molecular phylogeny, origin and taxonomic implications of the
tribe Cacteae (Cactaceae). Systematics and Biodiversity 11: 103–116.
https://doi.org/10.1080/14772000.2013.775191
Weingart, W. (1907) Phyllocactus Purpusii Weing. n. sp. Monatsschrift für Kakteenkunde 17: 34–38.
Weingart, W. (1918) Rhipsalis Purpusii spec. nov. Monatsschrift für Kakteenkunde 27–28: 78–82.
Weingart, W. (1933) Cereus maculatus Spec. nov. Kakteenkunde 1: 14–15.
Wicke, S. & Quandt, D. (2009) Universal primers for the amplification of the plastid trnK/matK region in land plants. Anales Del Jardin
Botanico De Madrid 66: 285–288.
https://doi.org/10.3989/ajbm.2231
Worberg, A., Alford, M.H., Quandt, D. & Borsch, T. (2009) Huerteales sister to Brassicales plus Malvales, and newly circumscribed to
include Dipentodon, Gerrardina, Huertea, Perrottetia, and Tapiscia. Taxon 58: 468–478.
Appendix 1. Material and sequences used in this study
Abbreviations: BG B: Botanical Garden Berlin, B: Herbarium Berolinense, B GH: garden herbarium of the Herbarium
Berolinense, ZSS: Züricher Sukkulenten-Sammlung, K: Herbarium of the Royal Botanic Gardens Kew.
Acanthocereus castellae.—trnK/matK DQ100014.1 (Arias et al. 2005), rpl16 DQ099945.1 (Arias et al. 2005).
Acanthocereus chiapensis.—trnK/matK HM041754.1 (Hernandez-Hernandez et al. 2011), rpl16 DQ099985.1 (Arias
et al. 2005), trnL-F HM041335.1 (Hernandez-Hernandez et al. 2011).
Acanthocereus tetragonus.—trnK/matK HM041645.1, rpl16 HM041378.1, trnL-F HM041223.1( all from Hernandez-
Hernandez et al. 2011); isolate AccpenE213 trnK/matK AY015295.1 (Nyffeler 2002), trnL-F AY015386.1 (intron),
AY015345.1 (spacer) (Nyffeler 2002).
Armatocereus procerus.—trnK/matK HM041650.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041384.1
(Hernandez-Hernandez et al. 2011), trnL-F HM041229.1 (Hernandez-Hernandez et al. 2011).
Aporocactus flagelliformis.—isolate CA389: MEXICO. Hidalgo, Schrempf s.n. (B), living BG B 156431230 trnK/
matK LT745632, rpl16 LT745515, trnL-F LT745401; isolate CA241: as “Netherlands Antilles” St. Vincent (probably
cultivated, occurrence outside the natural distribution range) Innes s.n. (B GH 33610), living BG B 001018330, trnK/
matK LT745631, rpl16 --, trnL-F LT745400.
Aporocactus martianus.—isolate CA396: MEXICO. Oaxaca, Lau 1275 (B), living BG B 155371230, trnK/matK
LT745635, rpl16 LT745518, trnL-F LT745404; isolate CA318: MEXICO. Oaxaca, Lautner L05/18 (B), living BG B
156401230, trnK/matK LT745634, rpl16 LT745517, trnL-F LT745403.
Bergerocactus emoryi.—trnK/matK HM041654.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041388.1 (Hernandez-
Hernandez et al. 2011), trnL-F DQ099925.1 (Arias et al. 2005)
Blossfeldia liliputana.—trnK/matK AY015284.1 (Nyffeler 2002) rpl16 HM041389.1 (Hernandez-Hernandez et al.
2011) trnL-F AY064303.1 (Nyffeler 2002).
Calymmanthium substerile.—trnK/matK AY015291.1 (Nyffeler 2002), rpl16 FN673676.1 (Korotkova et al. 2010),
trnL-F DQ099926 (Arias et al. 2005).
KOROTKOVA ET AL.
40 • Phytotaxa 327 (1) © 2017 Magnolia Press
Carnegiea gigantea.—trnK/matK HM041657.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041391.1 (Hernandez-
Hernandez et al. 2011), trnL-F HM041236.1 (Hernandez-Hernandez et al. 2011).
Castellanosia caineana.—trnK/matK AY015298.1 (Nyffeler 2002), rpl16 --, trnL-F AY015389.1 (Nyffeler 2002).
Cephalocereus columna-trajani.—trnK/matK HM041658.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041392.1
(Hernandez-Hernandez et al. 2011), trnL-F HM041237.1 (Hernandez-Hernandez et al. 2011).
Copiapoa coquimbana.—isolate CA126, trnK/matK FN995677 (Korotkova et al. 2010), rpl16 FN673557.1 (Korotkova
et al. 2010), trnL-F --.
Corryocactus aureus.—trnK/matK HM041669.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041404.1 (Hernandez-
Hernandez et al. 2011), trnL-F HM041249.1 (Hernandez-Hernandez et al. 2011).
Corryocactus brevistylus.—trnK/matK AY015302.1 (Nyffeler 2002), rpl16 --, trnL-F AY015393.1 (Nyffeler 2002).
Corryocactus tenuiculus.—trnK/matK AY015303.1 (Nyffeler 2002), rpl16 --, trnL-F AY015394.1 (Nyffeler 2002).
Deamia chontalensis.—isolate CA218: MEXICO. Oaxaca, Lautner LW 85 33 (B), living BG B 266059430 trnK/
matK LT745733, rpl16 LT745616, trnL-F LT745500; isolate CA374: MEXICO. Oaxaca, Lautner s.n. (B) trnK/matK
LT745734, rpl16 LT745617, trnL-F LT745501.
Deamia testudo.—isolate CA207: without locality data (B), living BG B 014857483 trnK/matK LT745735, rpl16
LT745618, trnL-F LT745502.
Dendrocereus nudiflorus.—trnK/matK --, rpl16 DQ099998.1 (Arias et al. 2005), trnL-F DQ099929.1 (Arias et al.
2005).
Disocactus ackermannii.—isolate CA286: MEXICO. Oaxaca, Lautner L98/57 (B) trnK/matK LT745636, rpl16
LT745519, trnL-F LT745405.
Disocactus ackermannii subsp. conzattianus.—isolate CA301: MEXICO. Oaxaca, Lautner L98/49 (B), living BG B
155881230 trnK/matK LT745637, rpl16 LT745520, trnL-F LT745406.
Disocactus anguliger.—isolate CA229: MEXICO. Oaxaca, Lau L1265 (B), living BG B 069111230, trnK/matK
LT745638, rpl16 LT745521, trnL-F LT745421.
Disocactus biformis.—isolate CA281: GUATEMALA. Sololá, Lautner L91/34 (ZSS 21337) trnK/matK LT745639,
rpl16 LT745522, trnL-F LT745407.
Disocactus crenatus.—isolate CA228: COSTA RICA. no further locality data, Lau s.n. (B), living BG B 069051260
as ‘chichicastenango’ trnK/matK LT745640, rpl16 LT745523, trnL-F LT745423
isolate CA275: El Salvador, Santa Ana, Vollmer 1111/85 (B) trnK/matK LT745641, rpl16 LT745524, trnL-F
LT745425.
Disocactus crenatus subsp. kimnachii.—isolate CA248: MEXICO. Chiapas: SW San Cristóbal, Trost s.n. (ZSS-
22539, holotype) trnK/matK LT745643, rpl16 LT745526, trnL-F LT745427; isolate CA230: MEXICO. Chiapas,
Hohmann s.n. (B), living BG B 069081230 trnK/matK LT745642, rpl16 LT745525, trnL-F LT745426.
Disocactus eichlamii.—isolate CA300: GUATEMALA. Escuintla, Lautner L99/4a (ZSS-21371) trnK/matK LT745644,
rpl16 LT745527, trnL-F LT745408.
Disocactus lepidocarpus.—isolate CA345: COSTA RICA. Heredia, Kimnach 2440 (ZSS-22700, neotype Bauer 2003),
living BG B 155451230 ex HBG 49676 trnK/matK LT745664, rpl16 LT745528, trnL-F LT745431.
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 41
Disocactus macdougallii.—isolate CA269: MEXICO. Chiapas, Kimnach, Bauml & Sanchez-Mejorada 622 (ZSS-
21400, ZSS-29520): trnK/matK LT745645, rpl16 LT745529, trnL-F LT745409.
Disocactus macranthus: isolate CA208.—without locality data (B GH 48382), living BG B 264-83-99-83: trnK/matK
LT745646, rpl16 LT745530, trnL-F LT745410; isolate CA298: MEXICO. Oaxaca, MacDougall A 42 (HNT-1213,
isotype, US-2301200, isotype), trnK/matK LT745647, rpl16 LT745531, trnL-F LT745411.
Disocactus nelsonii subsp. hondurensis.—isolate CA297: HONDURAS. Comayagua, Kimnach 394 (HNT, ZSS. B),
living BG B 155751230 trnK/matK LT745650, rpl16 LT745534, trnL-F LT745414.
Disocactus nelsonii subsp. nelsonii.—isolate CA215: without locality data, (B), living BG B 069371280 (ex BG
Bonn 4639): trnK/matK LT745648, rpl16 LT745532, trnL-F LT745412; isolate CA277: Mexico Chiapas, Lautner
L98/40, (B), living BG B 155681230 trnK/matK LT745649, rpl16 LT745533, trnL-F LT745413.
Disocactus phyllanthoides.—isolate CA273: MEXICO. Puebla, Lautner L02/60 I (ZSS-22584, ZSS-29527), living
BG B 155861230 trnK/matK LT745651, rpl16 LT745535, trnL-F LT745415.
Disocactus quezaltecus.—isolate CA284: GUATEMALA. Quezaltenango, Lautner L99/21/3 (ZSS-21369), living BG
B 155661230 trnK/matK LT745652, rpl16 LT745536, trnL-F LT745416.
Disocactus speciosus subsp. blomianus.—isolate CA312: MEXICO. Chiapas, MacDougall A 202 (HNT-1794,
holotype, ZSS-21340, isotype, ZSS-27875, isotype; ex HBG 15865) trnK/matK LT745656, rpl16 LT745540, trnL-F
LT745420.
Disocactus speciosus subsp. cinnabarinus.—isolate CA320: GUATEMALA. San Marcos, Krahn 915-1 (B), living
BG B 156201230 trnK/matK LT745653, rpl16 LT745537, trnL-F LT745417.
Disocactus speciosus subsp. speciosus.—isolate CA387: MEXICO. Estado de México, Bauer 20 (ZSS 27871), living
BG B 155341230 trnK/matK LT745654, rpl16 LT745538, trnL-F LT745418.
Disocactus speciosus subsp. bierianus.—isolate CA304: MEXICO. Guerrero, Köhres 9650-2 (ZSS 27903) trnK/
matK LT745655, rpl16 LT745539, trnL-F LT745419.
Echinocereus cinerascens.—trnK/matK HM041680.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041414.1
(Hernandez-Hernandez et al. 2011), trnL-F HM041260.1 (Hernandez-Hernandez et al. 2011).
Echinocereus pentalophus.—trnK/matK AY015307.1 (Nyffeler 2002), rpl16 KF783558.1 (Arias et al. 2005), trnL-F
AY015396.1 (Nyffeler 2002).
Epiphyllum baueri.—isolate CA206: without locality data (B GH 50240), living BG B 087020970 trnK/matK LT745657,
rpl16 LT745542, trnL-F --; isolate CA305: Colombia Chocó, Bauer 32 (K-000035667 isotype, K-000035668 isotype,
K-000578667 isotype) trnK/matK LT745658, rpl16 LT745543, trnL-F --.
Epiphyllum cartagense.—isolate CA314: PANAMA. Bocas del Toro, Mangelsdorff RMP 4112 (B), living BG B
156341230 trnK/matK --, rpl16 --, trnL-F LT745460.
Epiphyllum chrysocardium.—isolate CA434: without locality data, but the specimen very likely comes from the type
collection (MEXICO. Chiapas, MacDougall A198): type clones had been distributed to several botanical gardens;
voucher (B GH 9420), living BG B 014747483 trnK/matK LT745660, rpl16 LT745545, trnL-F LT745424.
Epiphyllum hookeri.—isolate CA280: PANAMA. Chiriquí, Mangelsdorff RMP 3141 (B), living BG B 156351230
trnK/matK LT745661, rpl16 LT745546, trnL-F LT745428.
KOROTKOVA ET AL.
42 • Phytotaxa 327 (1) © 2017 Magnolia Press
Epiphyllum hookeri subsp. columbiense.—isolate CA279: Colombia, Chocó, Bauer 28 (ZSS-19790) trnK/matK
LT745662, rpl16 LT745547, trnL-F LT745429.
Epiphyllum hookeri subsp. guatemalense.—isolate CA251: GUATEMALA. San Marcos, Vollmer 9951 98 (B) trnK/
matK LT745663, rpl16 LT745548, trnL-F LT745430.
Epiphyllum oxypetalum.—isolate CA283: GUATEMALA. Izabal, Lago de Izabal, Lautner L97/5 (B), living BG B
155731230 trnK/matK LT745665, rpl16 LT745549, trnL-F LT745432.
Epiphyllum phyllanthus.—isolate CA243: SURINAM. without locality data, Brownsberg s.n. (B), living BG B
177191060 trnK/matK LT745666, rpl16 LT745550, trnL-F LT745433; isolate CA262: GUYANA. Georgetown, Bauer
82 (B), living BG B 156061230 trnK/matK LT745667, rpl16 LT745551, trnL-F LT745434; isolate CA213: BOLIVIA.
Santa Cruz, Ibisch 93.197 (BOLV, LPB, FR), living BG B 069011230 trnK/matK --, rpl16 LT745541, trnL-F --; isolate
CA264: COLOMBIA. Magdalena: Sierra Nevada de Santa Marta, Bauer 40 (ZSS 19797) trnK/matK LT745668, rpl16
LT745552, trnL-F LT745435.
Epiphyllum phyllanthus subsp. rubrocoronatum.—isolate CA292: COLOMBIA. Chocó, Bauer 66 (B), living BG B
155851230 trnK/matK LT745669, rpl16 LT745553, trnL-F LT745436.
Epiphyllum pumilum.—isolate CA199: MEXICO. Los Tuxlas, collector unknown (B GH 45760), living BG B
180190163 trnK/matK LT745670, rpl16 LT745554, trnL-F LT745437; isolate CA250: MEXICO. Chiapas, Haugg s.n.
(ZSS 21396) trnK/matK LT745671, rpl16 LT745555, trnL-F LT745438.
Epiphyllum thomasianum.—isolate CA274: MEXICO. Chiapas, Ehlers 031112 (B), living BG B 156451230 trnK/
matK LT745672, rpl16 LT745556, trnL-F LT745439.
Epiphyllum thomasianum subsp. costaricense.—isolate CA285: COLOMBIA. Magdalena, Bauer 39 (B), living BG
B 155551230 trnK/matK --, rpl16 LT745557, trnL-F --.
Escontria chiotilla.—trnK/matK AY015308.1 (Nyffeler 2002), rpl16 AY181608.1 (Arias et al. 2003), trnL-F
AY015397.1 (Nyffeler 2002).
Eulychnia breviflora.—isolate CA137 trnK/matK FN669772 (Korotkova et al. 2010), rpl16 FN673680.1 (Korotkova
et al. 2010), trnL-F --.
Frailea pumila.—trnK/matK HM041698.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041433.1 (Hernandez-
Hernandez et al. 2011), trnL-F HM041279.1 (Hernandez-Hernandez et al. 2011).
Kimnachia ramulosa.—isolate CA203: ECUADOR. no further locality data, collector unknown (B), living BG B
153089243 trnK/matK LT745705, rpl16 LT745588, trnL-F LT745473; isolate CA214: MEXICO. Chiapas, collector
unknown (B), living BG B 055230640 trnK/matK LT745706, rpl16 LT745589, trnL-F LT745474.
Kimnachia ramulosa subsp. jamaicensis.—isolate CA253: JAMAICA. Westmoreland Parish, Fleming s.n. (ZSS
19803), living BG B 155061230 trnK/matK LT745707, rpl16 LT745590, trnL-F LT745475.
Leptocereus leonii.—trnK/matK AY015297.1 (Nyffeler 2002), rpl16 --, trnL-F AY015388.1 (Nyffeler 2002).
Lophocereus schottii.—trnK/matK AY015309.1 (Nyffeler 2002), rpl16 --, trnL-F AY015398.1 (Nyffeler 2002).
Monvillea spegazzinii.—trnK/matK HM041723.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041458.1 (Hernandez-
Hernandez et al. 2011), trnL-F HM041304.1 (Hernandez-Hernandez et al. 2011).
Myrtillocactus schenckii.—isolate T1668 trnK/matK FN997501.1 (Barcenas et al. 2011), rpl16 AY181607.1 (Arias et
al. 2005), trnL-F AY181633.2 (Arias et al. 2005).
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 43
Neobuxbaumia mezcalaensis.—trnK/matK HM041725.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041460.1
(Hernandez-Hernandez et al. 2011), trnL-F HM041306.1 (Hernandez-Hernandez et al. 2011).
Neoraimondia herzogiana.—trnK/matK HM041728.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041463.1
(Hernandez-Hernandez et al. 2011), trnL-F HM041309.1 (Hernandez-Hernandez et al. 2011).
Pachycereus pecten-aboriginum.—trnK/matK HM041750.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041487.1
(Hernandez-Hernandez et al. 2011), trnL-F HM041331.1 (Hernandez-Hernandez et al. 2011).
Peniocereus serpentinus.—trnK/matK HM041756.1 (Hernandez-Hernandez et al. 2011).
Pfeiffera ianthothele.—isolate CA084 trnK/matK FR716764 (Korotkova et al. 2010), rpl16 FR716775.1 (Korotkova
et al. 2010), trnL-F LT745463.
Pfeiffera monacantha spp. kimnachii.—isolate CA406: BOLIVIA. Kessler 13425 (B) trnK/matK LT745696, rpl16
--, trnL-F LT745464.
Polaskia chichipe.—trnK/matK HM041760.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041497.1 (Hernandez-
Hernandez et al. 2011), trnL-F HM041341.1 (Hernandez-Hernandez et al. 2011).
Pseudorhipsalis acuminata.—isolate CA246: COSTA RICA. Limón, Davidson & Donohue 8422 (ZSS-19801, ZSS-
21362), living BG B 155461230 trnK/matK LT745697, rpl16 LT745580, trnL-F LT745465.
Pseudorhipsalis alata.—isolate CA263: JAMAICA. Cockpit Country, Kress s.n. (ZSS-22552), living BG B 155251230
trnK/matK LT745698, rpl16 LT745581, trnL-F LT745466.
Pseudorhipsalis amazonica subsp. amazonica.—isolate CA266: PERU. Ucayali: Chullachaqui, Pino 97-17 (ZSS
22555), living BG B 155771234 trnK/matK LT745699, rpl16 LT745582, trnL-F LT745467.
Pseudorhipsalis amazonica subsp. chocoensis.—isolate CA407: COLOMBIA. Chocó, Nuquí, Bauer 29 (ZZS-22545,
holotype) trnK/matK LT745700, rpl16 LT745583, trnL-F LT745468.
Pseudorhipsalis amazonica subsp. panamensis.—isolate CA202: PANAMA. no locality data, collector unknown
(B), living BG B 082018233 trnK/matK LT745701, rpl16 LT745584, trnL-F LT745469; isolate CA287: Colombia,
Magdalena, Sierra Nevada de Santa Marta, Bauer 43 (ZSS-21381), living BG B 155601230 trnK/matK LT745702,
rpl16 LT745585, trnL-F LT745470.
Pseudorhipsalis himanthoclada.—isolate CA260: COSTA RICA. San José, Horich s.n. (HNT-1488, ZSS-21379),
living BG B 155421230 trnK/matK LT745703, rpl16 LT745586, trnL-F LT745471.
Pseudorhipsalis lankesteri.—isolate CA258: COSTA RICA. San José, Cordillera Brunqueña, Horich s.n. (ZSS-
21365), living BG B 155211230 trnK/matK LT745704, rpl16 LT745587, trnL-F LT745472.
Selenicereus anthonyanus.—isolate CA261: MEXICO. Chiapas, Noller s.n. (B), living BG B 155811230 trnK/matK
LT745708, rpl16 LT745591, trnL-F LT745476.
Selenicereus atropilosus.—isolate CA217: MEXICO. Jalisco, San Sebastian, Boutin & Kimnach 3190 (B GH 15955
holotype), living BG B 001028330 trnK/matK LT745709, rpl16 LT745592, trnL-F LT745477.
Selenicereus calcaratus.—isolate CA223: without locality data (B), living BG B 066048480 trnK/matK LT745673,
rpl16 LT745558, trnL-F LT745440; isolate CA350: COSTA RICA. Limón, Horich s.n. (B), living BG B 155471230
trnK/matK LT745674, rpl16 LT745559, trnL-F LT745441.
KOROTKOVA ET AL.
44 • Phytotaxa 327 (1) © 2017 Magnolia Press
Selenicereus cf. nelsonii.—isolate CA378: MEXICO. Chiapas, Kimnach 3239 (B) trnK/matK LT745711, rpl16
LT745594, trnL-F LT745479.
Selenicereus costaricensis.—isolate CA377: COSTA RICA. Puntarenas, Becksteiner s.n. (B), living BG B 155221230
trnK/matK LT745675, rpl16 LT745560, trnL-F LT745442.
Selenicereus dorschianus.—isolate CA395: MEXICO. Jalisco, Böhme s.n. (MEXU-1248407, isotype), ZSS-22551,
holotype), living BG B 155821230, ex BG Bonn 2302 trnK/matK LT745712, rpl16 LT745595, trnL-F LT745480.
Selenicereus extensus.—isolate CA205: FRENCH GUIANA. Atachi Bacca mountains, Granville et al.10991
(B, neotype), living BG B 039498920 trnK/matK LT745676, rpl16 LT745561, trnL-F LT745443; isolate CA239:
FRENCH GUIANA. Cayenne: Approuague-Kaw, Scharf 101 (B), living BG B 193010630 trnK/matK LT745677,
rpl16 LT745562, trnL-F LT745444.
Selenicereus glaber.—isolate CA308: EL SALVADOR. Ahuachapan, Vollmer 9911 97 (ZSS-21352) trnK/matK
LT745738, rpl16 LT745621, trnL-F LT745505.
Selenicereus glaber subsp. mirandae.—isolate CA307: MEXICO. Chiapas, El Mirador, Dorsch s.n. (B) trnK/matK
LT745739, rpl16 LT745622, trnL-F LT745506.
Selenicereus cf. grandiflorus.—isolate CA327: CUBA. Matanzas: Varadero peninsula, Day s.n. (B), living BG B
156331230 trnK/matK LT745714, rpl16 LT745597, trnL-F LT745482.
Selenicereus grandiflorus.—isolate CA319: MEXICO. Chiapas, Kimnach 3272 (B) trnK/matK LT745710, rpl16
LT745593, trnL-F LT745478; isolate CA371: Cuba, Guantánamo, Mangelsdorff RMC 2177 (B), living BG B 156241230
trnK/matK LT745713, rpl16 LT745596, trnL-F LT745481; isolate CA233: without locality data (B GH 18344), living
BG B 055627480 as “coniflorus” trnK/matK LT745717, rpl16 LT745600, trnL-F LT745485.
Selenicereus grandiflorus subsp. donkelaarii.—isolate CA381: MEXICO. Yucatán, Campos 2579 (B), living BG B
155611230 trnK/matK LT745715, rpl16 LT745598, trnL-F LT745483; isolate CA240: without locality data (B GH
18828), living BG B 043697480 trnK/matK LT745716, rpl16 LT745599, trnL-F LT745484.
Selenicereus grandiflorus subsp. lautneri.—isolate CA367: MEXICO. Oaxaca, Lautner L06/8 (B) trnK/matK
LT745719, rpl16 LT745602, trnL-F LT745487.
Selenicereus grandiflorus subsp. hondurensis.—isolate CA369: GUATEMALA. Izabal, Lago de Izabal, Bauer 8
(ZSS 21377) trnK/matK LT745718, rpl16 LT745601, trnL-F LT745486.
Selenicereus hamatus.—isolate CA384: MEXICO. Veracruz, Lautner L06/4 (B) trnK/matK LT745720, rpl16
LT745603, trnL-F LT745488.
Selenicereus inermis.—isolate CA259: VENEZUELA. Miranda, Steyermark 108741 (HNT-6254) trnK/matK
LT745721, rpl16 LT745604, trnL-F LT745489; isolate CA309: COSTA RICA. Guanacaste, Lewis EPICR#104 (B)
trnK/matK LT745722, rpl16 LT745605, trnL-F LT745491; isolate CA232: COSTA RICA. Atlantic rainforest, Horich
s.n. (B GH 35913), living BG B 112028920 trnK/matK LT745732, rpl16 LT745615, trnL-F LT745499.
Selenicereus megalanthus.—isolate CA347: PERU. Amazonas, Bauer 55 = Bauer & Kimnach 38 (B), living BG B
155781230 trnK/matK LT745678, rpl16 LT745563, trnL-F LT745445.
Selenicereus minutiflorus.—isolate CA221: without locality data (B GH 15053), living BG B 175028180 trnK/matK
LT745680, rpl16 LT745565, trnL-F LT745447.
Selenicereus monacanthus.—isolate CA224: without locality data (B GH 31603), living BG B 052018230 trnK/matK
LT745682, rpl16 LT745567, trnL-F LT745449; isolate CA346: SURINAM. Raleigh Falls, Ingham & Ingham s.n. (B),
A PHYLOGENETIC FRAMEWORK FOR THE HYLOCEREEAE Phytotaxa 327 (1) © 2017 Magnolia Press • 45
living BG B 156011230 ex HBG 33960 trnK/matK trnK/matK LT745685, rpl16 LT745570, trnL-F LT745452; isolate
CA385: ECUADOR. Chimborazo, Krahn 1178 (B), living BG B 156301230 trnK/matK LT745686, rpl16 LT745571,
trnL-F LT745453; isolate CA325: COLOMBIA. Magdalena, Bauer 46 (ZSS-22705 neotype Bauer 2003), living
BG B 155581230 trnK/matK LT745684, rpl16 LT745569, trnL-F LT745451; isolate CA219: ECUADOR. El Oro,
Madson s.n. (B), living BG B 222029830 trnK/matK LT745681, rpl16 LT745566, trnL-F LT745448; isolate CA227:
SURINAM. Raleigh Falls, collector unknown (B GH 28417, 28417a), living BG B 187018830 trnK/matK LT745683,
rpl16 LT745568, trnL-F LT745450.
Selenicereus ocamponis.—isolate CA222: without locality data (B GH 41127), living BG B 258079380 trnK/matK
LT745688, rpl16 LT745573, trnL-F LT745455; isolate CA375: MEXICO. Nayarit, Kimnach 535 (B) trnK/matK
LT745689, rpl16 LT745574, trnL-F LT745456; isolate CA220: without locality data (B GH 12787, 12787a), living
BG B 012187480 trnK/matK LT745687, rpl16 LT745572, trnL-F LT745454.
Selenicereus pteranthus.—isolate CA210: without locality data (B), living BG B 069261280 trnK/matK LT745727,
rpl16 LT745610, trnL-F LT745494; isolate CA391: CUBA. Holguín, Schwerdtfeger s.n. (B) trnK/matK LT745728,
rpl16 LT745611, trnL-F LT745495.
Selenicereus setaceus.—isolate CA358: BOLIVIA. Santa Cruz, Krahn 1006 (B), living BG B 155951230 trnK/matK
LT745692, rpl16 LT745576, trnL-F LT745459; isolate CA209: without locality data (B) BG B 069321218 (ex BG
Bonn 14394) trnK/matK LT745690, rpl16 --, trnL-F LT745457; isolate CA234: PARAGUAY. Cerro Acahay Billiet,
Jadin s.n. (B GH 44115), living BG B 232070230 trnK/matK LT745691, rpl16 LT745575, trnL-F LT745458.
Selenicereus sp..—isolate CA216: BELIZE. without further locality data, Vollmer s.n. (B), living BG B 069131260
(ex BG Bonn 16416) trnK/matK LT745679, rpl16 LT745564, trnL-F LT745446.
Selenicereus spinulosus.—isolate CA238: MEXICO. Oaxaca, Lautner LW 81 /Q (B GH 37937), living BG B
266029430 trnK/matK LT745729, rpl16 LT745612, trnL-F LT745496.
Selenicereus stenopterus.—isolate CA322: COSTA RICA. Limón, Horich s.n. (B GH 49514), living BG B 069221230
(ex BG Bonn 6290) trnK/matK LT745693, rpl16 LT745577, trnL-F --.
Selenicereus triangularis.—isolate CA225: without locality data (B GH 15049, 15049a, 15049b), living BG B
014967480 trnK/matK LT745694, rpl16 LT745578, trnL-F LT745461.
Selenicereus tricae.—isolate CA328: BELIZE. Cayo, Hunt 7076 (K-29047.259 holotype, in spirit), living RBG Kew
1969-3879 trnK/matK LT745724, rpl16 LT745607, trnL-F LT745491; isolate CA366: MEXICO. Veracruz, Hunt 7170
(ZSS 29372), living RBG Kew 1969-4129 trnK/matK LT745723, rpl16 LT745606, trnL-F --.
Selenicereus undatus.—isolate CA226: MEXICO. Veracruz, Leuenberger & Schiers 2500 (B GH 18378, 18378a),
living BG B 003017810 trnK/matK LT745695, rpl16 LT745579, trnL-F LT745462.
Selenicereus vagans.—isolate CA342: MEXICO. Michoacán, Noller s.n. (ZSS-28853), living BG B 155741230
trnK/matK LT745730, rpl16 LT745613, trnL-F LT745497; isolate CA349: ex hort. without locality data collector
unknown (ZSS-29368), probably the type clone of Selenicereus murrilli trnK/matK LT745726, rpl16 LT745609, trnL-
F LT745493; isolate CA392: MEXICO. Michoacán, Hoxey 476.03 (ZSS-28854), living BG B 156121230 trnK/matK
LT745725, rpl16 LT745608, trnL-F LT745492.
Selenicereus validus.—isolate CA397: MEXICO. Michoacán, Lautner L00/13 (B), living BG B 155871230 trnK/
matK LT745731, rpl16 LT745614, trnL-F LT745498.
Stenocereus eruca.—trnK/matK HM041777.1 (Hernandez-Hernandez et al. 2011), rpl16 HM041514.1 (Hernandez-
Hernandez et al. 2011) trnL-F HM041357.1 (Hernandez-Hernandez et al. 2011).
KOROTKOVA ET AL.
46 • Phytotaxa 327 (1) © 2017 Magnolia Press
Stenocereus stellatus.—isolate T1652 trnK/matK FN997498.1 (Barcenas et al. 2011), rpl16 HM041517.1 (Hernandez-
Hernandez et al. 2011), trnL-F --.
Strophocactus wittii.—isolate CA200: BRAZIL, region of the Rio Negro, Loki Schmidt s.n. (B GH 46892), living BG
B 240119930 trnK/matK LT745736, rpl16 LT745619, trnL-F LT745503.
Strophocactus brasiliensis.—rpl16 DQ100036.1 (Arias et al. 2005), trnL-F DQ099967.1 (Arias et al. 2005).
Strophocactus sicariguensis.—rpl16 DQ100037.1 (Arias et al. 2005), trnL-F DQ099968.1 (Arias et al. 2005).
Weberocereus frohningiorum.—isolate CA340: COSTA RICA. no further locality data, ex. Palmengarten, cited as
Frohning 9067. Frohning had obtained the plant 1994 from the Palmengarten Frankfurt (K-000100018 isotype, ZSS-
19806 holotype) trnK/matK LT745737, rpl16 LT745620, trnL-F LT745504.
Weberocereus imitans.—isolate CA276: COSTA RICA. San José, Valle de El General, Kimnach, Horich & Linden
2463 (B) trnK/matK LT745740, rpl16 LT745623, trnL-F LT745507.
Weberocereus rosei.—isolate CA247: ECUADOR. Chimborazo, Madsen 87EC63877 (B) trnK/matK LT745741,
rpl16 LT745624, trnL-F LT745508.
Weberocereus tonduzii.—isolate CA201: COSTA RICA. Cordillera de Talamanca, Horich s.n. (B GH 35652), living
BG B 112058920 trnK/matK LT745742, rpl16 LT745625, trnL-F LT745509.
Weberocereus trichophorus.—isolate CA211: COSTA RICA. Horich s.n. (B), living BG B 069271230 (ex BG Bonn
6530) trnK/matK LT745743, rpl16 LT745626, trnL-F LT745510; isolate CA354: COSTA RICA. Limón, Wrage s.n.
(ZSS 19805, ZSS 21393) trnK/matK LT745744, rpl16 LT745627, trnL-F LT745511.
Weberocereus tunilla.—isolate CA379: ex. Rainbow Gardens 1988, without locality data (B) trnK/matK LT745745,
rpl16 LT745628, trnL-F LT745512.
Weberocereus tunilla subsp. biolleyi.—isolate CA204: COSTA RICA. Horich s.n. (B GH 25043, 25043a), living BG
B 271028220 trnK/matK LT745746, rpl16 LT745629, trnL-F LT745513; isolate CA288: COSTA RICA. Alajuela, Lau
s.n. (ZSS-22550) trnK/matK LT745747, rpl16 LT745630, trnL-F LT745514.
