The reduced osteogenic potential of Nf1 -deficient osteoprogenitors is EGFR-independent

Abstract

Neurofibromatosis type 1 (NF1) is a common genetic disorder caused by mutations in the NF1 gene. Recalcitrant bone healing following fracture (i.e. pseudarthrosis) is one of the most problematic skeletal complications associated with NF1. The etiology of this condition is still unclear; thus, pharmacological options for clinical management are limited. Multiple studies have shown the reduced osteogenic potential of Nf1-deficient osteoprogenitors. A recent transcriptome profiling investigation revealed that EREG and EGFR, encoding epiregulin and its receptor Epidermal Growth Factor Receptor 1, respectively, were among the top over-expressed genes in cells of the NF1 pseudarthrosis site. Because EGFR stimulation is known to inhibit osteogenic differentiation, we hypothesized that increased EREG and EGFR expression in NF1-deficient skeletal progenitors may contribute to their reduced osteogenic differentiation potential. In this study, we first confirmed via single-cell mRNA sequencing that EREG over-expression was associated with NF1 second hit somatic mutations in human bone cells, whereas Transforming Growth Factor beta 1 (TGFβ1) expression was unchanged. Second, using ex-vivo recombined Nf1-deficient mouse bone marrow stromal cells (mBMSCs), we show that this molecular signature is conserved between mice and humans, and that epiregulin generated by these cells is overexpressed and active, whereas soluble TGFβ1 expression and activity are not affected. However, blocking either epiregulin function or EGFR signaling by EGFR1 or pan EGFR inhibition (using AG-1478 and Poziotinib respectively) did not correct the differentiation defect of Nf1-deficient mBMSCs, as measured by the expression of Alpl, Ibsp and alkaline phosphatase activity. These results suggest that clinically available pharmacological strategies aimed at inhibiting EGFR signaling are unlikely to have a significant benefit for the management of bone non-union in children with NF1 PA.

Full text

The reduced osteogenic potential of Nf1-deficient
osteoprogenitors is EGFR-independent
S.E. Tahaei1,2, G. Couasnay2, Y. Ma2, N. Paria3, J. Gu4, B. F. Lemoine4, X. Wang4, J.J.
Rios3,5, and F. Elefteriou2,6
1Department of Pharmacology, Vanderbilt University, Nashville, TN
2Department of Orthopedic Surgery, Baylor College of Medicine, Houston, TX
3Seay Center for Musculoskeletal Research, Texas Scottish Rite Hospital for Children, Dallas, TX
4Baylor Institute for Immunology Research, Dallas, TX
5Department of Pediatrics, McDermott Center for Human Growth and Development, and
Department of Orthopaedic Surgery, UT Southwestern Medical Center, Dallas, TX
6Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX
Abstract
Neurofibromatosis type 1 (NF1) is a common genetic disorder caused by mutations in the
NF1
gene. Recalcitrant bone healing following fracture (i.e. pseudarthrosis) is one of the most
problematic skeletal complications associated with NF1. The etiology of this condition is still
unclear; thus, pharmacological options for clinical management are limited. Multiple studies have
shown the reduced osteogenic potential of
Nf1
-deficient osteoprogenitors. A recent transcriptome
profiling investigation revealed that
EREG
and
EGFR,
encoding epiregulin and its receptor
Epidermal Growth Factor Receptor 1, respectively, were among the top over-expressed genes in
cells of the NF1 pseudarthrosis site. Because EGFR stimulation is known to inhibit osteogenic
differentiation, we hypothesized that increased EREG and EGFR expression in
NF1
-deficient
skeletal progenitors may contribute to their reduced osteogenic differentiation potential. In this
study, we first confirmed via single-cell mRNA sequencing that
EREG
over-expression was
associated with
NF1
second hit somatic mutations in human bone cells, whereas
Transforming
Growth Factor beta 1
(
TGFβ1
) expression was unchanged. Second, using
ex-vivo
recombined
Nf1
-deficient mouse bone marrow stromal cells (mBMSCs), we show that this molecular signature
is conserved between mice and humans, and that epiregulin generated by these cells is
overexpressed and active, whereas soluble TGFβ1 expression and activity are not affected.
However, blocking either epiregulin function or EGFR signaling by EGFR1 or pan EGFR
inhibition (using AG-1478 and Poziotinib respectively) did not correct the differentiation defect of
Nf1
-deficient mBMSCs, as measured by the expression of
Alpl, Ibsp
and alkaline phosphatase
activity. These results suggest that clinically available pharmacological strategies aimed at
Correspondence to: F. Elefteriou.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our
customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of
the resulting proof before it is published in its final citable form. Please note that during the production process errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
HHS Public Access
Author manuscript
Bone
. Author manuscript; available in PMC 2019 January 01.
Published in final edited form as:
Bone
. 2018 January ; 106: 103–111. doi:10.1016/j.bone.2017.10.012.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

inhibiting EGFR signaling are unlikely to have a significant benefit for the management of bone
non-union in children with NF1 PA.
Keywords
Neurofibromatosis type 1; epiregulin; EGFR; bone marrow stromal cells; osteoblasts;
differentiation; RAS-MAPK signaling
Introduction
Neurofibromatosis type 1 (NF1) is a common genetic disorder that occurs in 1 of 3500 live
births [1,2]. It is a pleiotropic condition that affect various organs, including the skin, eyes,
nervous system and skeleton [3,4]. In bone, complications include osteopenia, short stature,
chest wall deformities, sphenoid wing dysplasia, dystrophic scoliosis and tibia bowing that
progresses to fracture and pseudarthrosis (PA, i.e. recalcitrant bone healing/non-union) [2,5].
Patients with NF1 are heterozygous for inherited
NF1
mutations, and approximately half of
all cases of NF1 occur from spontaneous
de novo
mutations of the
NF1
gene [6]. Second-hit
somatic
NF1
mutations have been observed in cells from 75% of the NF1 PA biopsies
analyzed [7,8]. In other words, one inactivating
NF1
variant can be inherited from a parent
(or
de novo
) and the other allele subsequently acquires a somatic inactivating variant in cells
of the tibia, leading to loss of
NF1
function.
Nf1
is expressed in bone cells, including
osteoprogenitors [9], differentiated osteoblasts [10], chondrocytes [11,12] and osteoclasts
[13]. Evidence from mouse models suggest that
NF1
loss of heterozygosity occurs in
skeletal progenitor cells of the tibia [10,14,15].
In contrast to most cases of fracture in children, which usually progress to bone union within
weeks, 2–5% of children with NF1 present with recalcitrant bone healing despite multiple
attempts with surgical stabilization. The condition starts in early childhood with an initial
and unilateral bowing of the tibia that often progresses to fracture and non-union. It has the
highest morbidity among other NF1 skeletal complications, with little clinical management
options [16–18], and often leads to amputation of the affected limb [19]. Bone Morphogenic
Proteins (BMPs) are currently used Off-label with variable success, and under clinical
investigation for efficacy [20–22], although BMP2 did not show a beneficial effect on its
own in preclinical models [10,23]. Hence, finding new therapeutic options for the
management of this condition is a significant clinical need.
NF1
encodes neurofibromin, a 280 KDa cytosolic multi-domain protein. The central
GTPase-related domain (GRD) of neurofibromin facilitates the conversion of RAS-GTP
(active form of RAS) to RAS-GDP (inactive form of RAS) and hence acts as a brake on
RAS downstream signaling [24], including the MAPK pathways [11,25,26].
In vitro
studies
using bony biopsies from children with NF1 PA have shown that periosteal cells from the
pseudartrotic site have a blunted response to osteogenic differentiation signals compared to
cells from unaffected sites [27,28]. Studies based on the use of murine osteoprogenitor cells
have provided further evidence that
Nf1
is necessary for proper osteogenic differentiation
[10,29]. Bone mesenchymal cells deficient for
Nf1
, including chondrocytes and osteoblasts,
are characterized by high RAS and ERK1/2 activation compared to WT controls
Tahaei et al. Page 2
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

[10,11,14,30]. Although this molecular signature was expected to contribute to the impaired
differentiation of
Nf1
-deficient osteoprogenitor cells, two independent studies indicated that
MEK blockade was unable to rescue the differentiation phenotype of these cells or to
improve bone healing in two mouse models of NF1 PA [10,23]. The exact underlying
mechanism of this differentiation phenotype thus remains not well understood, although
Rhodes
et al
reported that excess
Tgfβ1
expression in
Nf1
-deficient mouse osteoblasts might
be involved [31]. However, a recent transcriptome analysis using RNA-sequencing of cells
cultured from rare biopsies collected from the PA site of children with NF1 did not reveal a
change in
TGFβ1
expression (Dr. Rios, unpublished data) compared to iliac crest-derived
bone cell (herein referred to as
NF1
+/−). Rather, this study identified a significant
upregulation of
EGFR
and
EREG
[7]. Epiregulin, encoded by
EREG
, is one of the seven
Epithelial Growth Factor (EGF) family members that preferentially binds to and activates
EGFR1 and Erb-B4 forms among the four cloned EGFRs [32–34]. These findings sparked
great interest because 1) increased EGFR signaling is known to inhibit osteoprogenitor cell
differentiation [35–43]; 2) drugs are clinically available to block EGFR signaling, thus
raising the possibility of rapidly repurposing EGFR inhibitors to promote the differentiation
of
NF1
-deficient osteoprogenitors and potentially bone healing in cases of NF1 bone non-
union, and 3) the beneficial impact of RAS [44], TGFβ [31] or β-catenin [45] inhibition on
bone healing in preclinical models of NF1 PA is expected to take additional effort and time
to translate to the clinic. Based on these observations, we hypothesized that sustained EGFR
signaling in
Nf1
-deficient osteoprogenitors contributes to their differentiation defect.
Results
EREG expression is increased in human bone cells characterized by NF1 double hit
mutations
Consistent with previously published data, single-cell sequencing confirmed highly
significant upregulation of
EREG
in
NF1
−/− clonal cells that harbor a germline p.R461X
variant and a somatic p.Asn510_Lys2333del large deletion, compared to patient-matched
NF1
+/− cells (Figure 1A).
EGFR
expression was slightly, though not significantly, higher in
the
NF1
-deficient clonal cell line (Figure 1B). No significant differences in gene expression
were observed for genes encoding
TGFβ
ligands nor
TGFβ
receptors (Figure 1C–H), in
contrast to a previous report using
Nf1
-deficient osteoblasts extracted from the
Col1
2.3kb-
cre;
Nf1
f/f mouse model [31].
These observations led us to assess the expression of
Tgfb1
in WT and
Nf1
-deficient mouse
bone marrow stromal cells (mBMSCs). For this purpose,
Nf1
f/f mBMSCs were cultured and
infected with a cre-expressing adenovirus (herein referred to as
Nf1
-deficient) or a GFP-
expressing adenovirus (herein referred to as WT control). Loss of
Nf1
gene expression
following cre-expressing adenovirus transduction was confirmed by a significant reduction
(>90%) in
Nf1
gene expression by qRT-PCR compared to Ad-GFP control (Figure 1I). No
difference in
Tgfb1
expression was found in
Nf1
-deficient mBMSCs (Figure 1J).
Tgfb1
was
also expressed at similar levels in WT and
Nf1-
deficient mouse embryonic fibroblasts
(MEFs) isolated from WT and
Nf1
−/− embryos, considered to be more immature
mesenchymal progenitor cells than mBMSCs (Figure 1K) and in WT and
Nf1
-deficient
Tahaei et al. Page 3
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

calvaria-derived cells that are considered more committed to the osteoblast lineage (Figure
1L). No detectable difference in the amount of soluble total TGFβ1 (measured by ELISA,
Figure 1M) nor secreted active TGFβ1 (measured by Western Blot, Figure 1N) was observed
between the conditioned medium (CM) from WT and
Nf1
-deficient mBMSCs. Finally, the
CM from WT and
Nf1
-deficient mBMSCs resulted in similar levels of activation of a
sensitive SMAD-responsive luciferase reporter MDA231 cell line (limit of detection:
1ng/ml, Supplementary Figure 1A and Figure 1O) [46], and to similar level of p-SMAD2
activation in treated WT BMSCs (Figure 1P). Collectively, these data strongly suggest that
increased TGFβ1 production by
Nf1
-deficient osteoprogenitors is not the main cause of the
impaired osteogenic potential of these cells.
Epiregulin is ectopically expressed and active in Nf1-deficient mBMSCs
Because single-cell sequencing confirmed that
NF1
deficiency in human bone cells was
associated with
EREG
over-expression, we sought to determine whether this phenotype was
conserved in mBMSCs. Using the same strategy of
ex vivo Nf1
ablation as indicated above,
we found
Ereg
to be expressed in
Nf1
-deficient mBMSCs at three times the level of WT
mBMSCs (Figure 2A). This increase was confirmed at the protein level (Figure 2B). In
contrast, expression of
Egfr
was not altered in
Nf1
-deficient mBMSCs (Figure 2C), though
EGFR protein abundance was higher in these cells (Figure 2D). A similar increase in
Ereg
expression was also detected in rib primary
Nf1
f/f chondrocytes infected with Ad-cre
compared to Ad-GFP viruses (Supplementary Fig. 1B). The expression of other EGFR
ligands, including
Betacellulin
(
Btc
),
Epidermal Growth Factor
(
Egf
),
Transforming Growth
Factor a
(
Tgfa
) and
Amphiregulin
(
Areg
), was undetectable in both WT and
Nf1
-deficient
mBMSCs (data not shown). These results suggest that neurofibromin signaling represses
Ereg
expression in both human and mouse BMSCs and that EGFR protein synthesis or
stability is regulated by mechanisms that are neurofibromin-dependent and post-
transcriptional.
Epiregulin is synthesized as a precursor membrane-bound protein that must be cleaved for
biological activity and activation of EGFR [33]. To determine if
Nf1
-deficient mBMSCs
generate higher amount of active epiregulin than WT mBMSCs, a cell line highly sensitive
to EGFR ligands (A431 cells) [47] was treated with the CM from WT and
Nf1
-deficient
mBMSCs. Both CMs led to EGFR activation (phosphorylation), but the CM from
Nf1
-
deficient mBMSCs was three times more potent than the one from WT mBMSCs (Figure
2E). In addition, EGFR activity following treatment with the
Nf1
-deficient CM was blocked
following addition of an epiregulin-neutralizing antibody (Figure 2E). These results suggest
that the CM of
Nf1
-deficient mBMSCs contains higher amount of active epiregulin
compared to WT mBMSCs.
Inhibition of EGFR signaling fails to rescue the osteogenic differentiation of Nf1-deficient
mBMSCs
Because chronic activation of EGFR leads to inhibition of osteogenic differentiation (32–
33,36–40,42) and
Nf1
-deficient mBMSCs overexpress both EGFR and its ligand epiregulin,
we sought to block EGFR signaling to determine if excessive EGFR signaling contributed to
the reduced osteogenic potential of these cells. WT and
Nf1
-deficient mBMSCs were
Tahaei et al. Page 4
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

prepared as described above and treated from the start of differentiation (Day 0) with
AG-1478 (0.5 and 1 μM), a potent and selective EGFR kinase inhibitor (IC50=3nM in a cell-
free system [48]), for 7 days in osteogenic medium, and early osteogenic differentiation was
assessed by measuring
Alkaline phosphatase
(
Alpl
) and
Integrin binding sialoprotein
(
Ibsp
)
expression. As expected, the expression of
Alpl
and
Ibsp
in
Nf1-
deficient mBMSCs was
reduced to 10–20% of WT controls (Vehicle in Figure 3A–B). Surprisingly however,
inhibition of EGFR signaling with AG-1478 failed to rescue the reduced expression of these
genes in
Nf1
-deficient mBMSCs (Figure 3A, B), which was confirmed by measuring ALP
activity (Figure 3C). Poziotinib, an irreversible pan-EGFR inhibitor (IC50=3.2nM for
HER1, 5.3nM for HER2 and 23.5nM for HER4 [49]) tested at two concentrations (100nM
or 400nM) also failed to increase the expression of
Alpl
and
Ibsp
(Figure 3D, E) and ALP
activity (Figure 3F) in
Nf1
-deficient mBMSCs following osteogenic induction. Both
AG-1478 and Poziotinib inhibited EGFR activation in A341 reporter cells (Supplementary
Figure 1C, D), confirming potent biological activity of these two drugs.
It remained possible that epiregulin signals via receptors other than EGFR or ERB-B4. To
address this hypothesis, WT and
Nf1
-deficient mBMSCs were grown in osteogenic
conditions for 7 days in the presence of an epiregulin-neutralizing antibody (0.4 ug/ml).
Although this neutralizing antibody was added to the medium in large excess and
successfully blocked EGFR activation in human A341 cells (see Figure 2E), it failed to
rescue the osteogenic differentiation of
Nf1
-deficient mBMSCs (Figure 3G–I).
Together, these results suggest that the increase in epiregulin and EGFR expression in
Nf1
-
deficient osteoprogenitors does not contribute to their defective differentiation potential.
Discussion
Transcriptome profiling of bone cells cultured from a case of NF1 tibial PA indicated that
NF1
-deficiency was associated with over-expression of
EREG
, encoding the EGFR ligand
Epiregulin [7]. This observation and the known inhibitory effect of EGFR signaling on
osteoblast differentiation raised the prospect that clinically available EGFR inhibitors may
promote bone union in challenging surgical cases of NF1 PA. Further progress in this
direction required pre-clinical studies to determine whether such molecular findings were
functionally relevant to the impaired differentiation of
NF1
-deficient osteoprogenitors and
eventually to the recalcitrant bone healing observed in NF1. We show here that
Ereg
is
ectopically overexpressed in
Nf1-
deficient mouse BMSCs, as observed in human cells with
NF1
biallelic mutations. Although evidence for increased epiregulin protein production by
Nf1
-deficient mBMSCs and EGFR signaling activity were observed, both pharmacological
EGFR inhibition and epiregulin ligand blockade failed to correct the differentiation defect of
these cells. These results led us to conclude that the upregulation of epiregulin expression
and EGFR activation induced by
Nf1
deficiency in osteoprogenitor cells is not causal for
their impaired osteogenic potential, and indicate that pathways other than EGFR signaling
contribute to this phenotype.
The lack of effect of EGFR inhibition in
Nf1
-deficient BMSCs might appear expected since
EGFR signals via the RAS/ERK pathway, whose activity downstream of EGFR is
Tahaei et al. Page 5
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

chronically increased in absence of
Nf1
. However, one should keep in mind that signaling
pathways activated by EGFR also include PI3K-Akt, p38, JNK, JAK-Stat, Src, small
GTPases such as Rho and Rac, PLC-gamma/Ca2+/PKC and PKD [50]. Hence EGFR
blockade could still be pro-osteogenic in
Nf1
-deficient cells by inhibiting one of these
downstream ERK-independent pathways. This is further supported by the lack of effect of
MEK inhibitors on the differentiation of these cells [10,23], which suggest the existence of
MEK/ERK-independent mechanisms underlying their differentiation defect.
New candidate genes involved in the defective differentiation of
Nf1
-deficient
osteoprogenitors were recently identified, including
Tgfb1
[31] and
Ctnnb1
(encoding β-
catenin) [45]. The finding that the level of TGFβ1 was increased in the culture medium of
BMSCs isolated from the
Col2.3kb
-cre;
Nf1
flox/− mice is in line with the phenotypic overlap
between the cellular abnormalities in NF1 PA and other conditions characterized by
excessive TGFβ signaling, including Camurati-Engelmann, Marfan and Loeys-Dietz
syndromes [51–53]. It is also in line with the known pro-proliferative and anti-osteogenic
differentiation activities of TGFβ [54–59], which mimic the
in vitro
behavior of
Nf1
-
deficient osteoprogenitors. However, our analyses did not allow us to confirm increased
levels of TGFβ1 expression in
Nf1
-deficient bone cells, including MEFs, BMSCs and
calvaria primary cells, and the reason for this may stem in a number of differences between
the two studies. One of them is the different cells used between these two studies. Rhodes
et
al.
prepared
Nf1
−/− MSCs from the bone marrow of
periostin
-cre;
Nf1
flox/− mice, and
differentiated them after 5–10 passages in osteogenic medium. This is in contrast with our
cultures, that were prepared from undifferentiated mBMSCs extracted from
Nf1
flox/flox
mice, infected
ex vivo
with a GFP- or CRE-adenovirus, and not passaged after infection.
Although the adenovirus infection may impact to some extent the behavior of the cultures,
this approach has the advantage of comparing clearly-defined genotypes and cultures, whose
behavior starts to differ after
ex vivo
infection, whereas the approach from Rhodes
et al.
relies on extensively passaged primary cells, whose differentiation and behavior may be
impacted
in vivo
before extraction and plating, and
ex vivo
because of multiple passages. A
consequence from these different experimental conditions is that the two studies may have
compared osteoblasts at different differentiation stages, with the Rhodes study based on
more differentiated osteoblast cultures than our study, which used undifferentiated, plastic-
adherent bone marrow osteoprogenitors and
Nf1
ablation induced shortly thereafter before
induction of differentiation by confluency and addition of osteogenic medium. This is
important to notice because the progressive and long-term nature of tibia bowing and non-
union in NF1, and data from genetic mouse models related to this condition, all support the
idea that the cell of origin for this condition is a proliferating, undifferentiated mesenchymal
progenitor, prior to the expression of
Col2
and
Osx
[10,11]. Hence, the traits and behavior of
Nf1
-deficient undifferentiated osteoprogenitors are likely to be more clinically relevant than
the characteristics of
Nf1
-deficient mature osteoblasts or osteocytes for instance [60], that
are unlikely to be ever generated based on the defective differentiation of
Nf1
-deficient
osteoprogenitors.
It is still important to recognize the beneficial effect of TGFβ blockade on bone mass and
fracture healing reported by Rhodes
et al.
, and the clinical relevance of these findings. A
similar comment applies to the findings by Ghadakzadeh
et al.,
showing improved bone
Tahaei et al. Page 6
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

healing upon use of Nefopam treatment to block the increase in β-catenin expression they
detected in
Nf1
-deficient mBMSCs [45,61]. An important note related to these published
studies is that they all use
Nf1
conditional floxed cells to achieve gene ablation following cre
activity. A caveat with this approach is that gene recombination is rarely complete.
Therefore, a detectable increase in osteogenic differentiation in these cultures following
treatment can reflect an osteogenic response of non-recombined cells to osteogenic
treatments like BMP2, nefopam or blockade of TGFβR. This is supported by the observation
that SD-208, a TGFβR inhibitor, increases
Alpl
expression in both
Nf1
-deficient and WT
mBMSCs (Supplementary Figure 1E) and bone mass in both WT and
Col2.3kb
-cre;
Nf1
flox/− mice [31]. Interpretation of results must account for this effect of treatment on non-
KO cells, and the extent of this confounding factor should be assessed by the use of
appropriate controls, which include treatment of the WT cells. Taking this comment into
consideration, we conclude that TGFβ and β-catenin blockade has preclinical value as
pharmacological approach to improve bone union in children with NF1 PA, but the
stimulatory effect of SD-208 treatment on WT cells and our inability to detect an increase in
TGFβ expression in
Nf1
-deficient bone cells question the contribution of increased TGFβ1
levels to the impaired osteogenic potential of
Nf1
-deficient BMSCs. Our results also do not
support increased
Ereg
expression and signaling as a major component of the defective
differentiation potential of
Nf1
-deficient osteoprogenitors. The quest for the molecular basis
of this phenotype is thus still open in order to identify specific NF1 signaling-related
molecular targets/nodes amenable to pharmacological treatment.
Materials and methods
BMSC cultures
The institutional animal care and use committee Baylor College of Medicine approved all
the mouse procedures. Mice were housed 2–5 per cage. Mouse BMSCs were extracted from
long bones of 2–3 month-old
Nf1
f/f mice [62] by centrifugation at 3000 g for 3 minutes, as
previously described [63]. Extracted marrow was plated in 10 cm dishes in α-MEM medium
(without ascorbic acid) supplemented with 10% fetal bovine serum and 100 U/ml Penicillin/
Streptomycin (15140-122, ThermoFisher) for three days. At that time, non-adherent cells
were discarded by changing the medium. Cells were trypsinized after reaching 80%
confluence and were seeded in 6-well plates at 10,000 cells/cm2 for adenovirus transduction.
After reaching 60% confluence, cells were incubated with the adenovirus solutions (Ad-GFP
or Ad-CRE recombinase, Baylor College of Medicine vector development lab) in the
presence of Gene Jammer reagent (Agilent technologies; Cat# 204132), as described
previously [64]. Briefly, Gene Jammer was added at a final concentration of 1% to FBS- and
antibiotic-free α-MEM medium. The solution was vortexed briefly and incubated for 10
minutes at room temperature before adding the virus at a MOI of 400 and incubating for
further 10 minutes. Final mixture was added to each well and cells were incubated with the
virus solutions for 24 hours. The media was then changed to fresh complete α-MEM
medium containing 10% FBS and Pen/Strep (Thermofisher Cat# 15140122). Mouse BMSCs
were differentiated in osteogenic medium containing ascorbic acid (50 μg/ml) and β-
glycerophosphate (5mM) in α-MEM medium for 7 days. Medium was changed every other
day.
Tahaei et al. Page 7
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

For conditioned medium (CM) collection, mBMSCs infected with either Ad-GFP or Ad-
CRE were washed with PBS two times and were grown with FBS-free α-MEM medium for
1 day. The CMs were centrifuged at 1000 g for 5 minutes to remove debris, and the
supernatant was collected and were kept at −80°C until use.
A431 cells were grown in DMEM supplemented with 10% FBS and 100 U/ml Penicillin/
Streptomycin (15140-122, ThermoFisher). After reaching 80% confluence, cells were
starved in serum-free DMEM overnight. Cells were then treated with the conditioned media
plus normal goat IgG control (AB-108-C, R&D Systems) or Epiregulin neutralizing
antibody (AF1068-SP, R&D Systems) at the final concentration of 0.4 μg/ml. Cell lysates
were extracted after ten minutes and the amount of p-EGFR, EGFR (Cat. # 3777S and
4267S from Cell signaling Technology, respectively) and β-actin (A5316 from Sigma) were
measured by Western blotting.
To measure Smad2 activation, mBMSC were grown in α-MEM until they reached 80%
confluence and were then starved overnight in FBS free medium before treatment with either
recombinant activated TGFβ-1 (R&D systems, Cat# 766-MB-005) or the conditioned
medium from
Nf1
WT and KO BMSCs for 30 minutes. Cells were then scraped in RIPA
buffer and after protein extraction, the amount of Smad2,3 (Cat. # 3102, CST) and p-Samd2
(3108, CST) levels were measured.
Chondrocyte cultures
The cartilaginous ribs from 6 day-old pups were extracted and digested overnight by
collagenase (Sigma, Cat# C6885) dissolved in DMEM at a final concentration of 3 mg/ml.
On the next day, the digestion medium was centrifuged and pellets were re-suspended in
DMEM and filtered through 50 micrometer filters. Resuspended cells were plated in 6 well
plates in DMEM supplemented with FBS and supplemented with 10% FBS and 100 U/ml
Penicillin/Streptomycin (Cat# 15140-122, ThermoFisher). Cells were infected when they
reached 50% confluence with GFP or CRE adenoviruses as indicated above.
Calvaria cultures
The calvariae from 4 day-old
Nf1
f/f pups were extracted and digested consecutively three
times in digestion medium, prepared by dissolving collagenase P at a final concentration of
0.1 mg/ml (Sigma, Cat# 11213865001) in 0.25% Trypsin (ThemoSisher, Cat# 25200-056).
After the last digestion, bone fragments were plated in 10 cm dish in α-MEM medium
(without ascorbic acid) supplemented with 10% FBS and 100 U/ml Penicillin/Streptomycin
(Cat# 15140-122, ThermoFisher). Medium was changed after 4–5 days. Cells were
trypsinized after reaching 80% confluence and were replated in 6 well plates before
infection with a GFP- or CRE adenovirus as indicated above.
Human primary cell culture and sorting
Human BMSCs isolated from tibial PA of one NF1 patient with an inherited mutation c.
1381C>T (p.R461X) and a somatic deletion (c.1642_6999del; p.Asn510_Lys2333del) in the
NF1
gene [7] were cultured in α-MEM (without ascorbic acid) supplemented with 10% FBS
and 1% PS. Cells were trypsinized and resuspended in 500ul of PBS containing 10% FBS
Tahaei et al. Page 8
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

and 2.5mM EDTA. The 7AAD live cell marker dye was added to the cell suspension and
live single cells were sorted using an Aria Cell Sorter (BD Biosciences) into 96-well plates
containing 100ul of α-MEM media with 20% FBS. 100ul of conditioned media from the
original “bulk” culture was added to help with the growth of single cell clones. After
reaching confluence, cells were expanded into 6-well plates and cultured again with fresh
medium complemented with 50% of bulk culture conditioned media. DNA from clonal lines
was extracted using the QiaAmp DNA mini kit (Qiagen) and sequenced for the presence or
absence of the deleted allele.
Luciferase assay for TGFβ1 activity measurements
The conditioned medium from mBMSCs was harvested as described above, and the TGFβ1
reporter cell line MDA-scp28 was used to quantify active TGFβ1 in this CM [46]. Briefly,
50,000 MDA-scp28 cells/well were plated in a 96-mutliwell culture plate in high glucose
DMEM supplemented with 10% FBS and 100 U/ml Penicillin/Streptomycin. The MDA-
scp28 were then starved for 24hr in FBS-free DMEM high glucose medium and were treated
with the CM of mBMSCs or recombinant TGFβ1 for 8hr. Luciferase activity was detected
by the Dual Luciferase kit (Promega, E1960), following the manufacturer instructions.
Firefly luciferase activity was normalized by the Renilla luciferase activity (ratio F-Luc/R-
Luc).
TGFβ1 ELISA
Total TGFβ1 in supernatants of WT and
Nf1
-deficient mBMSCs was quantified by ELISA
(R&D, DY1679). Briefly 100 μl of supernatant were acidified with 20 μl of 1N HCl and
incubated 10 min at room temperature. Acidity was then neutralized by the addition of 20 μl
of 1.2N NaOH/0.5M HEPES. Total TGFβ1 concentrations of prepared samples were
measured according to the manufacturer’s instructions.
Single-cell mRNA sequencing and analysis
Single cells were isolated and cDNAs were generated using the Fuidigm C1 instrument and
SMARTer Ultra Low RNA Kit (Clontech Cat#634834). Sequencing libraries were generated
using the Nextera XT Library Preparation Kit (Illumina ref#15032354) and sequenced using
the Illumina HiSeq 2500 generating paired-end 100bp reads. A single bulk sample of 100–
200 clonal
NF1
−/− cells were isolated and processed in the same manner, except that the
BioRad Thermal Cycler was used in place of the C1.
FASTQ sequence reads were trimmed using Flexbar read trimmer (PMID=24832523) and
mapped to the human reference genome (GRCh38) using HISAT2 (PMID=25751142).
Mapped reads were compared to the GENCODE transcriptome (version 24) and counted
using HTSeq [65]. Following filtering, 78 cells (N=50 iliac crest
NF1
+/− and N=28 clonal
NF1
−/−) were used for differential gene expression analysis using DESeq2 [66]. One bulk
sample of clonal
NF1
−/− cells were also included for comparison. Log counts per million
(CPM) mapped reads was calculated and visualized using the R package
beeswarm
.
Significance values (p-value) are adjusted for multiple comparisons.
Tahaei et al. Page 9
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

Drugs
AG-1478 (Selleckchem Cat# S2728), Poziotinib (Selleckchem, Cat# S7358) SD208 (Sigma,
Cat# S7071) and U0126 (Cell Signaling Technology, Cat. # 9903) were reconstituted in
DMSO (Vehicle).
ALP activity
Cells were washed with PBS, harvested and lysed in 250 μl of 0.05% Triton plus two cycles
of freezing/thawing at −80°C/37°C. Cell lysate were then centrifuged for 20 minutes at
16,000g at 4°C and supernatants were used for protein (BCA method; Life Technologies,
Cat# 23225) and ALP activity measurements. ALP activity was measured using a
colorimetric assay. Briefly, a PNPP ((4-nitrophenyl phosphate disodium salt hexahydrate,
Sigma Cat# P4744) solution was prepared in water and was mixed with AMP (2-amino-2-
methyl-1-propanol, Sigma Cat # A65182) buffer. Cells lysate were added to the mix (1:5)
and incubated at 37°C for 30 minutes. Absorbance was read at 405 nm and normalized to
protein content.
Gene expression assays
Total RNA was extracted using TRIzol (Thermofisher, Cat# 15596026), and contaminating
genomic DNA was digested by treatment with DNAse I (Promega, Cat# M6101). cDNAs
were synthesized from 1ug RNAs using the high capacity cDNA reverse transcription kit
(Thermofisher, Cat# 4368814),). Quantitative qRT-PCR was performed using the following
TaqMan primers/probes:
Ccnd1
(Mm00432359_m1),
Ibsp
(Mm00492555_m1),
Egfr1
(Mm01187858_m1),
Alpl
(Mm00475834_m1),
Tgfb1
(Mm03024053_m1) and the
normalizer
Hprt
(Mm03024075_m1) from Thermofisher, or SYBR green primers:
Nf1
(forward: GTATTGAATTGAAGCACCTTTGTTTGG; reverse:
CTGCCCAAGGCTCCCCCAG);
Ereg
(forward: TTGTGCTGATAACTGCCTGTAGAA;
reverse: CACCGAGAAAGAAGGATGGAGAC). SYBR qPCR specificity of amplification
was verified by the presence of a single peak on the dissociation curve.
Western blot
Proteins were extracted from cell cultures using RIPA buffer. Protein concentration was
measured using BCA assay (Thermo-Fisher). Ten μg of total protein was run on SDS gel
before transfer to a nitrocellulose membrane. Membranes were blocked using 5% non-fat
powder milk in TBST buffer. Epiregulin antibody (AF1068-SP, R&D Systems), β-actin:
(A5316, Sigma), and Cell Signaling Technologies antibodies Smad2,3 (3102), p-Samd2
(3108), EGFR (4267S) and p-EGFR (3777S) were diluted in blocking buffer at 1:1000 to
1:2000 dilution and incubated with the membranes overnight at 4°C. Following washing,
membranes were then incubated with an HRP-conjugated secondary antibody (goat anti
mouse Santa Cruz Cat # sc-2005, goat anti-rabbit Santa Cruz Cat# sc-2030) diluted in
blocking buffer at room temperature for one hour. Membranes were washed and incubated
with ECL solution for 2 minutes and exposed to photographic film.
Tahaei et al. Page 10
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

Statistical analyses
For comparison between WT and KO cells, a student t-test was performed. For multiple
treatments, a two-way analysis of variance (ANOVA) was used to determine whether there
was a statistically significant difference in treated vs. non-treated cells between genotypes.
P-value less than 0.05 was considered significant. Statistical analysis was performed using
Graph Pad PRISM (v6.0a, La Jolla, CA, USA). Data are provided as mean +/− SD.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
Funding: Research reported in this publication was supported by the National Institute of Arthritis and
Musculoskeletal and Skin Diseases of the National Institutes of Health under Award Number R56AR055966 (FE),
by the Texas Scottish Rite Hospital for Children and the Pediatric Orthopaedic Society of North America (JR),
Children Tumor Foundation Young Investigator Award Number 2015-01-015 (SET). The content is solely the
responsibility of the authors and does not necessarily represent the official views of the National Institutes of
Health.
We wish to thank Dr. Bhuminder Singh for providing the A431 cell line and his expert guidance, Dr. Harry Kim,
Dr. Nibuhiro Kamiya and the Texas Scottish Rite Hospital for Children Tissue Bank Repository.
Authors’ role: Study design: SET, GC, FE. Study conduct, data analysis and collection: SET, CG, NP, JG, FL, XW,
JJR, FE. Data interpretation: SET, JJR, FE. Drafting and revision manuscript: SET, JJR, FE. Approval final version
of the manuscript: SET, CG, NP, JG, FL, XW, JJR, FE.
References
1. Huson SM, Compston DA, Clark P, Harper PS. A genetic study of von Recklinghausen
neurofibromatosis in south east Wales. I. Prevalence, fitness, mutation rate, and effect of parental
transmission on severity. J Med Genet. 1989; 26:704–11. [PubMed: 2511318]
2. Elefteriou F, Kolanczyk M, Schindeler A, Viskochil DH, Hock JM, Schorry EK, Crawford AH,
Friedman JM, Little D, Peltonen J, Carey JC, Feldman D, Yu X, Armstrong L, Birch P, Kendler DL,
Mundlos S, Yang FC, Agiostratidou G, Hunter-Schaedle K, Stevenson DA. Skeletal abnormalities in
neurofibromatosis type 1: approaches to therapeutic options. Am J Med Genet A. 2009; 149A:
2327–38. DOI: 10.1002/ajmg.a.33045 [PubMed: 19764036]
3. Stumph D. Neurofibromatosis. Conference statement. National Institutes of Health Consensus
Development Conference. Arch Neurol. 1988; 45:575–8. [PubMed: 3128965]
4. Jacks T, Shih TS, Schmitt EM, Bronson RT, Bernards A, Weinberg RA. Tumour predisposition in
mice heterozygous for a targeted mutation in Nf1. Nat Genet. 1994; 7:353–61. DOI: 10.1038/
ng0794-353 [PubMed: 7920653]
5. Vitale MG, Guha A, Skaggs DL. Orthopaedic manifestations of neurofibromatosis in children: an
update. Clin Orthop Relat Res. 2002:107–18.
6. Upadhyaya M, Osborn M, Maynard J, Harper P. Characterization of six mutations in exon 37 of
neurofibromatosis type 1 gene. Am J Med Genet. 1996; 67:421–3. DOI: 10.1002/
(SICI)1096-8628(19960726)67:4<421::AID-AJMG20>3.0.CO;2-K [PubMed: 8837715]
7. Paria N, Cho TJ, Choi IH, Kamiya N, Kayembe K, Mao R, Margraf RL, Obermosser G, Oxendine I,
Sant DW, Song MH, Stevenson DA, Viskochil DH, Wise CA, Kim HKW, Rios JJ. Neurofibromin
deficiency-associated transcriptional dysregulation suggests a novel therapy for tibial
pseudoarthrosis in NF1. J Bone Miner Res. 2014; 29:2636–42. DOI: 10.1002/jbmr.2298 [PubMed:
24932921]
Tahaei et al. Page 11
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

8. Stevenson DA, Zhou H, Ashrafi S, Messiaen LM, Carey JC, D’Astous JL, Santora SD, Viskochil
DH. Double inactivation of NF1 in tibial pseudarthrosis. Am J Hum Genet. 2006; 79:143–8. DOI:
10.1086/504441 [PubMed: 16773574]
9. Wang W, Nyman JS, Ono K, Stevenson DA, Yang X, Elefteriou F. Mice lacking Nf1 in
osteochondroprogenitor cells display skeletal dysplasia similar to patients with neurofibromatosis
type I. Hum Mol Genet. 2011; 20:3910–3924. DOI: 10.1093/hmg/ddr310 [PubMed: 21757497]
10. de la Ndong JC, Stevens DM, Vignaux G, Uppuganti S, Perrien DS, Yang X, Nyman JS, Harth E,
Elefteriou F. Combined MEK inhibition and BMP2 treatment promotes osteoblast differentiation
and bone healing in Nf1OSX (−/−) mice. J Bone Miner Res. 2014; doi: 10.1002/jbmr.2316
11. Ono K, Karolak MR, de la J, Ndong C, Wang W, Yang X, Elefteriou F. The ras-GTPase activity of
neurofibromin restrains ERK-dependent FGFR signaling during endochondral bone formation.
Hum Mol Genet. 2013; 22:3048–62. DOI: 10.1093/hmg/ddt162 [PubMed: 23571107]
12. Karolak MR, Yang X, Elefteriou F. FGFR1 signaling in hypertrophic chondrocytes is attenuated by
the Ras-GAP neurofibromin during endochondral bone formation. Hum Mol Genet. 2015;
24:2552–64. DOI: 10.1093/hmg/ddv019 [PubMed: 25616962]
13. Yang FC, Chen S, Robling AG, Yu X, Nebesio TD, Yan J, Morgan T, Li X, Yuan J, Hock J, Ingram
DA, Clapp DW. Hyperactivation of p21ras and PI3K cooperate to alter murine and human
neurofibromatosis type 1-haploinsufficient osteoclast functions. J Clin Invest. 2006; 116:2880–91.
DOI: 10.1172/JCI29092 [PubMed: 17053831]
14. Wang W, Nyman JS, Ono K, Stevenson DA, Yang X, Elefteriou F. Mice lacking Nf1 in
osteochondroprogenitor cells display skeletal dysplasia similar to patients with neurofibromatosis
type I. Hum Mol Genet. 2011; 20:3910–24. DOI: 10.1093/hmg/ddr310 [PubMed: 21757497]
15. de la Croix Ndong J, Makowski AJ, Uppuganti S, Vignaux G, Ono K, Perrien DS, Joubert S,
Baglio SR, Granchi D, Stevenson DA, Rios JJ, Nyman JS, Elefteriou F. Asfotase-α improves bone
growth, mineralization and strength in mouse models of neurofibromatosis type-1. Nat Med. 2014;
20:904–10. DOI: 10.1038/nm.3583 [PubMed: 24997609]
16. Stevenson DA, Little D, Armstrong L, Crawford AH, Eastwood D, Friedman JM, Greggi T,
Gutierrez G, Hunter-Schaedle K, Kendler DL, Kolanczyk M, Monsell F, Oetgen M, Richards BS,
Schindeler A, Schorry EK, Wilkes D, Viskochil DH, Yang F-C, Elefteriou F. Approaches to
treating NF1 tibial pseudarthrosis: consensus from the Children’s Tumor Foundation NF1 Bone
Abnormalities Consortium. J Pediatr Orthop. 2013; 33:269–75. DOI: 10.1097/BPO.
0b013e31828121b8 [PubMed: 23482262]
17. Stevenson DA, Birch PH, Friedman JM, Viskochil DH, Balestrazzi P, Boni S, Buske A, Korf BR,
Niimura M, Pivnick EK, Schorry EK, Short MP, Tenconi R, Tonsgard JH, Carey JC. Descriptive
analysis of tibial pseudarthrosis in patients with neurofibromatosis 1. Am J Med Genet. 1999;
84:413–9. [PubMed: 10360395]
18. Ippolito E, Corsi A, Grill F, Wientroub S, Bianco P. Pathology of bone lesions associated with
congenital pseudarthrosis of the leg. J Pediatr Orthop B. 2000; 9:3–10. [PubMed: 10647102]
19. Richards BS, Anderson TD. rhBMP-2 and Intramedullary Fixation in Congenital Pseudarthrosis of
the Tibia. J Pediatr Orthop. 2016; doi: 10.1097/BPO.0000000000000789
20. Anticevic D, Jelic M, Vukicevic S. Treatment of a congenital pseudarthrosis of the tibia by
osteogenic protein-1 (bone morphogenetic protein-7): a case report. J Pediatr Orthop B. 2006;
15:220–221. DOI: 10.1097/01.bpb.0000194439.75378.ac [PubMed: 16601593]
21. Lee FY-I, Sinicropi SM, Lee FS, Vitale MG, Roye DP, Choi IH. Treatment of Congenital
Pseudarthrosis of the Tibia with Recombinant Human Bone Morphogenetic Protein-7 (rhBMP-7):
A Report of Five Cases. JBJS Case Connect. 2006; os-88:627–633. DOI: 10.2106/JBJS.D.02201
22. Fabeck L, Ghafil D, Gerroudj M, Baillon R, Delincé P. Bone morphogenetic protein 7 in the
treatment of congenital pseudarthrosis of the tibia. J Bone Jt Surg - Br. 2006; 88-B:116–118. DOI:
10.1302/0301-620X.88B1.16619
23. El-Hoss J, Cheng T, Carpenter EC, Sullivan K, Deo N, Mikulec K, Little DG, Schindeler A. A
Combination of rhBMP-2 (Recombinant Human Bone Morphogenetic Protein-2) and MEK (MAP
Kinase/ERK Kinase) Inhibitor PD0325901 Increases Bone Formation in a Murine Model of
Neurofibromatosis Type I Pseudarthrosis. J Bone Joint Surg Am. 2014; 96:e117.doi: 10.2106/
JBJS.M.00862 [PubMed: 25031379]
Tahaei et al. Page 12
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

24. Cichowski K, Jacks T. NF1 tumor suppressor gene function: narrowing the GAP. Cell. 2001;
104:593–604. [PubMed: 11239415]
25. Sharma R, Wu X, Rhodes SD, Chen S, He Y, Yuan J, Li J, Yang X, Li X, Jiang L, Kim ET,
Stevenson DA, Viskochil D, Xu M, Yang FC. Hyperactive Ras/MAPK signaling is critical for
tibial nonunion fracture in neurofibromin-deficient mice. Hum Mol Genet. 2013; 22:4818–28.
DOI: 10.1093/hmg/ddt333 [PubMed: 23863460]
26. Chen YH, Gianino SM, Gutmann DH. Neurofibromatosis-1 regulation of neural stem cell
proliferation and multilineage differentiation operates through distinct RAS effector pathways.
Genes Dev. 2015; 29:1677–82. DOI: 10.1101/gad.261677.115 [PubMed: 26272820]
27. Cho TJ, Seo JB, Lee HR, Yoo WJ, Chung CY, Choi IH. Biologic characteristics of fibrous
hamartoma from congenital pseudarthrosis of the tibia associated with neurofibromatosis type 1. J
Bone Joint Surg Am. 2008; 90:2735–44. DOI: 10.2106/JBJS.H.00014 [PubMed: 19047720]
28. Lee DY, Cho TJ, Lee HR, Lee K, Moon HJ, Park MS, Yoo WJ, Chung CY, Choi IH. Disturbed
osteoblastic differentiation of fibrous hamartoma cell from congenital pseudarthrosis of the tibia
associated with neurofibromatosis type I. Clin Orthop Surg. 2011; 3:230–7. DOI: 10.4055/cios.
2011.3.3.230 [PubMed: 21909471]
29. Wu X, Estwick SA, Chen S, Yu M, Ming W, Nebesio TD, Li Y, Yuan J, Kapur R, Ingram D, Yoder
MC, Yang FC. Neurofibromin plays a critical role in modulating osteoblast differentiation of
mesenchymal stem/progenitor cells. Hum Mol Genet. 2006; 15:2837–45. DOI: 10.1093/hmg/
ddl208 [PubMed: 16893911]
30. Zhou Y, He Y, Sharma R, Xing W, Estwick SA, Wu X, Rhodes SD, Xu M, Yang FC. Hyperactive
RAS/PI3-K/MAPK Signaling Cascade in Migration and Adhesion of Nf1 Haploinsufficient
Mesenchymal Stem/Progenitor Cells. Int J Mol Sci. 2015; 16:12345–59. DOI: 10.3390/
ijms160612345 [PubMed: 26039236]
31. Rhodes SD, Wu X, He Y, Chen S, Yang H, Staser KW, Wang J, Zhang P, Jiang C, Yokota H, Dong
R, Peng X, Yang X, Murthy S, Azhar M, Mohammad KS, Xu M, Guise TA, Yang FC. Hyperactive
transforming growth factor-β1 signaling potentiates skeletal defects in a neurofibromatosis type 1
mouse model. J Bone Miner Res. 2013; 28:2476–89. DOI: 10.1002/jbmr.1992 [PubMed:
23703870]
32. Riese DJ, Cullum RL. Epiregulin: roles in normal physiology and cancer. Semin Cell Dev Biol.
2014; 28:49–56. DOI: 10.1016/j.semcdb.2014.03.005 [PubMed: 24631357]
33. Shirakata Y, Komurasaki T, Toyoda H, Hanakawa Y, Yamasaki K, Tokumaru S, Sayama K,
Hashimoto K. Epiregulin, a novel member of the epidermal growth factor family, is an autocrine
growth factor in normal human keratinocytes. J Biol Chem. 2000; 275:5748–53. [PubMed:
10681561]
34. Toyoda H, Komurasaki T, Uchida D, Takayama Y, Isobe T, Okuyama T, Hanada K. Epiregulin. A
novel epidermal growth factor with mitogenic activity for rat primary hepatocytes. J Biol Chem.
1995; 270:7495–500. [PubMed: 7706296]
35. Zhu J, Shimizu E, Zhang X, Partridge NC, Qin L. EGFR signaling suppresses osteoblast
differentiation and inhibits expression of master osteoblastic transcription factors Runx2 and
Osterix. J Cell Biochem. 2011; 112:1749–60. DOI: 10.1002/jcb.23094 [PubMed: 21381079]
36. Chien HH, Lin WL, Cho MI. Down-regulation of osteoblastic cell differentiation by epidermal
growth factor receptor. Calcif Tissue Int. 2000; 67:141–50. [PubMed: 10920219]
37. Qin L, Tamasi J, Raggatt L, Li X, Feyen JHM, Lee DC, Dicicco-Bloom E, Partridge NC.
Amphiregulin is a novel growth factor involved in normal bone development and in the cellular
response to parathyroid hormone stimulation. J Biol Chem. 2005; 280:3974–81. DOI: 10.1074/
jbc.M409807200 [PubMed: 15509566]
38. Yu S, Geng Q, Ma J, Sun F, Yu Y, Pan Q, Hong A. Heparin-binding EGF-like growth factor and
miR-1192 exert opposite effect on Runx2-induced osteogenic differentiation. Cell Death Dis.
2013; 4:e868.doi: 10.1038/cddis.2013.363 [PubMed: 24136232]
39. Krampera M, Pasini A, Rigo A, Scupoli MT, Tecchio C, Malpeli G, Scarpa A, Dazzi F, Pizzolo G,
Vinante F. HB-EGF/HER-1 signaling in bone marrow mesenchymal stem cells: inducing cell
expansion and reversibly preventing multilineage differentiation. Blood. 2005; 106:59–66. DOI:
10.1182/blood-2004-09-3645 [PubMed: 15755902]
Tahaei et al. Page 13
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

40. Antosz ME, Bellows CG, Aubin JE. Biphasic effects of epidermal growth factor on bone nodule
formation by isolated rat calvaria cells in vitro. J Bone Miner Res. 1987; 2:385–93. DOI: 10.1002/
jbmr.5650020505 [PubMed: 3502681]
41. Nicolas V, Nefussi JR, Collin P, Forest N. Effects of acidic fibroblast growth factor and epidermal
growth factor on subconfluent fetal rat calvaria cell cultures: DNA synthesis and alkaline
phosphatase activity. Bone Miner. 1990; 8:145–56. [PubMed: 2306559]
42. Genetos DC, Rao RR, Vidal MA. Betacellulin inhibits osteogenic differentiation and stimulates
proliferation through HIF-1alpha. Cell Tissue Res. 2010; 340:81–9. DOI: 10.1007/
s00441-010-0929-0 [PubMed: 20165885]
43. Nakamura T, Toita H, Yoshimoto A, Nishimura D, Takagi T, Ogawa T, Takeya T, Ishida-Kitagawa
N. Potential Involvement of Twist2 and Erk in the Regulation of Osteoblastogenesis by HB-EGF-
EGFR Signaling. Cell Struct Funct. 2010; 35:53–61. DOI: 10.1247/csf.10001 [PubMed:
20448405]
44. Wang W, Nyman JS, Moss HE, Gutierrez G, Mundy GR, Yang X, Elefteriou F. Local low-dose
lovastatin delivery improves the bone-healing defect caused by Nf1 loss of function in osteoblasts.
J Bone Miner Res. 2010; 25:1658–67. DOI: 10.1002/jbmr.42 [PubMed: 20200958]
45. Ghadakzadeh S, Kannu P, Whetstone H, Howard A, Alman BA. β-Catenin modulation in
neurofibromatosis type 1 bone repair: therapeutic implications. FASEB J. 2016; doi: 10.1096/fj.
201500190RR
46. Korpal M, Yan J, Lu X, Xu S, Lerit DA, Kang Y. Imaging transforming growth factor-beta
signaling dynamics and therapeutic response in breast cancer bone metastasis. Nat Med. 2009;
15:960–6. DOI: 10.1038/nm.1943 [PubMed: 19597504]
47. Hunter T, Cooper JA. Epidermal growth factor induces rapid tyrosine phosphorylation of proteins
in A431 human tumor cells. Cell. 1981; 24:741–52. [PubMed: 6166387]
48. Fry DW, Kraker AJ, McMichael A, Ambroso LA, Nelson JM, Leopold WR, Connors RW, Bridges
AJ. A specific inhibitor of the epidermal growth factor receptor tyrosine kinase. Science. 1994;
265:1093–5. [PubMed: 8066447]
49. Nam HJ, Kim HP, Yoon YK, Hur HS, Song SH, Kim MS, Lee GS, Han SW, Im SA, Kim TY, Oh
DY, Bang YJ. Antitumor activity of HM781-36B, an irreversible Pan-HER inhibitor, alone or in
combination with cytotoxic chemotherapeutic agents in gastric cancer. Cancer Lett. 2011;
302:155–165. DOI: 10.1016/j.canlet.2011.01.010 [PubMed: 21306821]
50. Chen J, Zeng F, Forrester SJ, Eguchi S, Zhang MZ, Harris RC. Expression and Function of the
Epidermal Growth Factor Receptor in Physiology and Disease. Physiol Rev. 2016; 96:1025–1069.
DOI: 10.1152/physrev.00030.2015
51. Janssens K, Vanhoenacker F, Bonduelle M, Verbruggen L, Van Maldergem L, Ralston S,
Guañabens N, Migone N, Wientroub S, Divizia MT, Bergmann C, Bennett C, Simsek S, Melançon
S, Cundy T, Van Hul W. Camurati-Engelmann disease: review of the clinical, radiological, and
molecular data of 24 families and implications for diagnosis and treatment. J Med Genet. 2005;
43:1–11. DOI: 10.1136/jmg.2005.033522 [PubMed: 15894597]
52. WILNER HI, FINBY N. SKELETAL MANIFESTATIONS IN THE MARFAN SYNDROME.
JAMA. 1964; 187:490–5. [PubMed: 14084820]
53. Kirmani S, Tebben PJ, Lteif AN, Gordon D, Clarke BL, Hefferan TE, Yaszemski MJ, McGrann
PS, Lindor NM, Ellison JW. Germline TGF-? receptor mutations and skeletal fragility: A report on
two patients with Loeys-Dietz syndrome. Am J Med Genet Part A. 2010; 152A:1016–1019. DOI:
10.1002/ajmg.a.33356 [PubMed: 20358619]
54. Ottmann OG, Pelus LM. Differential proliferative effects of transforming growth factor-beta on
human hematopoietic progenitor cells. J Immunol. 1988; 140
55. Fine A, Goldstein RH. The effect of transforming growth factor-beta on cell proliferation and
collagen formation by lung fibroblasts. J Biol Chem. 1987; 262:3897–902. [PubMed: 3493244]
56. Alliston T, Choy L, Ducy P, Karsenty G, Derynck R. TGF-beta-induced repression of CBFA1 by
Smad3 decreases cbfa1 and osteocalcin expression and inhibits osteoblast differentiation. EMBO
J. 2001; 20:2254–72. DOI: 10.1093/emboj/20.9.2254 [PubMed: 11331591]
Tahaei et al. Page 14
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

57. Kang JS, Alliston T, Delston R, Derynck R. Repression of Runx2 function by TGF-β through
recruitment of class II histone deacetylases by Smad3. EMBO J. 2005; 24:2543–2555. DOI:
10.1038/sj.emboj.7600729 [PubMed: 15990875]
58. Lian N, Lin T, Liu W, Wang W, Li L, Sun S, Nyman JS, Yang X. Transforming growth factor β
suppresses osteoblast differentiation via the vimentin activating transcription factor 4 (ATF4) axis.
J Biol Chem. 2012; 287:35975–84. DOI: 10.1074/jbc.M112.372458 [PubMed: 22952236]
59. Samarakoon R, Dobberfuhl AD, Cooley C, Overstreet JM, Patel S, Goldschmeding R, Meldrum
KK, Higgins PJ. Induction of renal fibrotic genes by TGF-β1 requires EGFR activation, p53 and
reactive oxygen species. Cell Signal. 2013; 25:2198–209. DOI: 10.1016/j.cellsig.2013.07.007
[PubMed: 23872073]
60. Kamiya N, Yamaguchi R, Aruwajoye O, Kim AJ, Kuroyanagi G, Phipps M, Adapala NS, Feng JQ,
Kim HK. Targeted Disruption of NF1 in Osteocytes Increases FGF23 and Osteoid With
Osteomalacia-like Bone Phenotype. J Bone Miner Res. 2017; doi: 10.1002/jbmr.3155
61. Baht GS, Nadesan P, Silkstone D, Alman BA. Pharmacologically targeting beta-catenin for NF1
associated deficiencies in fracture repair. Bone. 2017; 98:31–36. DOI: 10.1016/j.bone.2017.02.012
[PubMed: 28254468]
62. Zhu Y, Romero MI, Ghosh P, Ye Z, Charnay P, Rushing EJ, Marth JD, Parada LF. Ablation of NF1
function in neurons induces abnormal development of cerebral cortex and reactive gliosis in the
brain. Genes Dev. 2001; 15:859–76. DOI: 10.1101/gad.862101 [PubMed: 11297510]
63. Mulcrone PL, Campbell JP, Clément-Demange L, Anbinder AL, Merkel AR, Brekken RA, Sterling
JA, Elefteriou F. Skeletal Colonization by Breast Cancer Cells Is Stimulated by an Osteoblast and
β2AR-Dependent Neo-angiogenic Switch. J Bone Miner Res. 2017; doi: 10.1002/jbmr.3133
64. Fouletier-Dilling CM, Bosch P, Davis AR, Shafer JA, Stice SL, Gugala Z, Gannon FH, Olmsted-
Davis EA. Novel compound enables high-level adenovirus transduction in the absence of an
adenovirus-specific receptor. Hum Gene Ther. 2005; 16:1287–97. DOI: 10.1089/hum.
2005.16.1287 [PubMed: 16259562]
65. Anders S, Pyl PT, Huber W. HTSeq--a Python framework to work with high-throughput
sequencing data. Bioinformatics. 2015; 31:166–169. DOI: 10.1093/bioinformatics/btu638
[PubMed: 25260700]
66. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq
data with DESeq2. Genome Biol. 2014; 15:550.doi: 10.1186/s13059-014-0550-8 [PubMed:
25516281]
Tahaei et al. Page 15
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

Highlights
•The increase in
EREG
expression previously observed in human bone cells
characterized by double hit mutations in
NF1
is conserved between mice and
humans.
•Mouse
Nf1
-deficient osteoprogenitors produce higher level of epiregulin and
EGFR than WT cell, but normal level of TGFβ1.
•EGFR inhibition does not correct the impaired osteogenic potential of
Nf1
-
deficient osteoprogenitors.
•Therefore, excessive EGFR signaling is not the major mechanism underlying
the reduced differentiation potential of
Nf1
-deficient osteoprogenitors.
Tahaei et al. Page 16
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

Figure 1.
A–H: Gene expression profiling from cells of the NF1 PA site. Bulk: mixed cells of the NF1
PA site; Clonal −/−: Single cells from the NF1 PA site; Clonal +/−: single cells from the iliac
crest cultures from the same patient. I:
Nf1
expression in WT (
Nf1
f/f +Ad-GFP) and
Nf1
-
deficient (KO,
Nf1
f/f +Ad-CRE) mBMSCs (qPCR, n=3). J–L:
Tgfb1
expression in murine
WT and
Nf1
-deficient mBMSCs (J), MEF cells (K) and calvaria cells (L)(qPCR, n=3). M–
O: TGFβ1 protein expression in WT and
Nf1
KO BMSCs using ELISA (M, n=3) and
Western blotting (N, n=3). O–P: Measurement of TGFβ-1/SMAD signaling activity in the
conditioned medium collected from cultures of WT and -deficient mBMSCs (n=3) using
Luciferase assay (O, n=3) and p-SMAd2 level (P, n=3, TGFβ1 positive control: 5ng/ml).
n.s: non-significant, *:
p
< 0.05 between genotypes, qPCR gene expression is normalized by
Hprt
expression.
Tahaei et al. Page 17
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

Figure 2.
A:
Ereg
expression in WT and
Nf1-
deficient mBMSCs (qPCR, n=3). B: Epiregulin protein
expression in WT and
Nf1
-deficient mBMSCs (Western blot, n=3, Right graph:
densitometric analysis). C:
Egfr
expression in WT and
Nf1
-deficient mBMSCs (qPCR,
n=3). D: EGFR protein expression in WT and
Nf1
deficient mBMSCs (Western blot, n=3,
Right graph: densitometric analysis). E: Level of phosphorylated EGFR (p-EGFR), EGFR
and β-actin in A431 cells treated with the conditioned medium (CM) from WT (grey bar)
and
Nf1
-deficient (KO, black bar) mBMSCs in the presence of IgG control or an epiregulin
neutralizing antibody (Western blot, n=3, Right graph: densitometric analysis). * and #:
p<0.05 between genotypes and treatments, respectively. qPCR gene expression is
normalized by
Hprt
expression.
Tahaei et al. Page 18
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript

Figure 3.
A–B, D–E and G, H: Expression of early osteoblast marker genes (
Alpl, Ibsp
) in response to
EGFR or Epiregulin inhibition during osteogenic differentiation (A–B: AG-1478, D–E:
Poziotinib and G, H: epiregulin-neutralizing antibody) in WT and
Nf1
-deficient (KO)
mBMSCs (qPCR, n=3, * and #: p<0.05 between genotypes and treatments, respectively). C,
F and I: ALP activity in response to AG-1478, Poziotinib and Anti-Ereg neutralizing
antibodies, respectively (n=3, * and #: p<0.05 between genotypes and treatments,
respectively). qPCR gene expression is normalized by
Hprt
expression.
Tahaei et al. Page 19
Bone
. Author manuscript; available in PMC 2019 January 01.
Author Manuscript Author Manuscript Author Manuscript Author Manuscript