Characterization of extracellular protease from Bacillus licheniformis

Full text

228
Afzal et al.
Int. J. Biosci.
2017
RESEARCH PAPER OPEN ACCESS
Characterization of extracellular protease from
Bacillus licheniformis
Asifa Afzal1,2, Tawaf Ali Shah1,2, Mahjabeen Saleem3, Romana Tabassum*1,2
1,2Industrial Biotechnology Division, National Institute for Biotechnology and Genetic Engineering
(NIBGE), Jhang Road, Faisalabad, Pakistan
2Pakistan Institute of Engineering and Applied Science (PIEAS), Islamabad, Pakistan
3Institute of Biochemistry & Biotechnology, Quaid-E.Azam Campus, University of the Punjab,
Lahore, Pakistan
Key words: Protease, Bacillus licheniformis, Thermostable, Clone
http://dx.doi.org/10.12692/ijb/11.4.228-236
Article published on October 27, 2017
Abstract
Extracellular proteases have a fundamental position with respect to their physiological roles as well as their
commercial applications. Bacillus licheniformis RT7P1, was evaluated in this study for production of
extracellular protease activity. The culture was maintained on 1% w/v casein plates. In this study, the strain was
found to produce maximum enzyme at pH 7 and temperature 37°C after 72 h. The optimum assay pH and the
temperature was 10 and 50°C, respectively. The enzyme was stable between pH 9-11and thermal stability data
showed that enzyme was stable at 100°C. For cloning of protease gene from Bacillus licheniformis, primers were
designed to pick their full-length sequences from the genomic DNA obtained from different Bacillus species.
Genomic DNA was isolated from Bacillus licheniformis strain RT7P1 and then the protease gene was amplified
from it by using RT7P1 specific primers. This amplified product (1725bp) was then cloned in PTZ57R/T vector.
The clone was confirmed by restriction analysis with EcoR1 and BamH1, which showed two fragments of (2886
bp) and (1725 bp), which showed that insert was cloned in the right orientation. The study indicates that Bacillus
licheniformis RT7P1 is a good source of commercial thermostable alkaline extracellular protease.
* Corresponding Author: Romana Tabassum  romanatabassum@yahoo.com
International Journal of Biosciences | IJB |
ISSN: 2220-6655 (Print), 2222-5234 (Online)
http://www.innspub.net
Vol. 11, No. 4, p. 228-236, 2017

229
Afzal et al.
Int. J. Biosci.
2017
Introduction
Alkaline proteases from extremophilic
microorganisms are able to withstand harsh
conditions in industrial processes. Heat-stable and
solvent-tolerant biocatalysts are valuable tools for
processes in which hardly decomposable polymers
need to be liquefied and degraded, while cold-active
enzymes are of relevance for food and detergent
industries. Extremophilic microorganisms are a rich
source of naturally tailored enzymes, which are more
superior to their mesophilic counterparts for
applications at extreme conditions. Bacterial alkaline
proteases show high activity due to their alkaline pH,
and their high substrate specificity. That is the reason
that bacterial alkaline proteases are used for
industrial purposes. Approximately 300 enzymes are
used for industrial and biotechnological applications
(Singhal et al., 2012). Protease is produced
commercially about 60%. They are produced from the
plant, animal and microbial sources (Boominadhan et
al., 2009). They constitute a complex and large group
of enzymes which vary in properties like catalytic
mechanism, active site, and pH, temperature, and
substrate-specific (Morya and Yadav, 2009). In the
worldwide synthesis of enzymes, approximately 45%
proteases are obtained from microbial sources
(Lagzian and Asoodeh, 2012). The studies showed
that nutritional factors (carbon and nitrogen) and
physical factors (pH, incubation time, temperature
and inoculum concentration) also effect on the
production of protease (Boominadhan et al., 2009).
Alkaline proteases are used in mostly leather,
detergent, medical purposes, chemical industry, food
processing and silver recovery (Cotarleţ et al., 2009).
For new promising strains, isolation and
characterization of protease enzyme by using cheap
nitrogen and carbon sources are continuing process
for industrial uses (Suganthi et al., 2013). A new
trend is developed in which wastes are converted into
useful biomass by using microorganisms (Pant et al.,
2014). Alkaline proteases show slow activity and
stability in the detergent industry so new alkalophilic
microorganisms are isolated and screened which have
potential in detergent industries (Mathew and
Gunathilaka, 2015).
The isolation of environmental DNA Libraries for
beneficial activities can provide a new tool of new
molecules and enzymes. Protease is studied in protein
engineering and protein chemistry as well as in food
additives, dehairing and cleansing agent (Wilson and
Remigio, 2012). In modern science, enzymes with
high stability at elevated temperature in the wide
range of pH and resistance to detergents, chelators,
organic solvents are of great importance. This study
focused on the Bacillus licheniformis RT7P1, for the
rmostable alkaline protease production, optimization
of culture conditions, protease characterization and
cloning of protease gene.
Materials and methods
Culture and Growth Conditions
The indigenous Bacillus licheniformis RT7P1 strain
supplied by the molecular biology Lab., Industrial
Biotechnology Division, NIBGE, Faisalabad was used
in this study, which had previously been isolated from
a peat sample. The culture was maintained on casein
(1%w/v) plates containing composition of medium, 1
g/L K2HPO4, 1 g/L (NH4)2HPO4, 0.5 g/L MgCl2, 10
g/L Yeast extract, 10 g/L Casein and 3%agar. The pH
of the medium was adjusted to 7 with 1N HCl/NaOH
and then autoclaved. Plates were incubated at 37ºC
for 24h and observed for zones of clearance, which
indicate proteolytic activity.
Optimization of Protease Production and Assay for
Protease Activity
For the production of crude enzyme, effect of time
course, temperature effect, pH effect and effect of
different substrate concentration was studied at 37 ºC
in10 mM K2HPO4 solution (pH 10) after regular time
intervals of (24, 48, 72, 96 and120 h), temperature
ranges (30, 35, 37, 40, 45 and 50ºC), pH ranges 4-9
and varying concentrations of casein (0.5, 1, 1.5, 2, 2.5
and 3%) respectively.
Protease activity assay was performed by some Lowry
method using tyrosine as a standard. The activity of
protease was measured on the basis of liberated
tyrosine residues. One unit of protease activity will be
defined as the amount of enzyme that liberated 1 µg of
tyrosine residues under assay conditions.

230
Afzal et al.
Int. J. Biosci.
2017
Characterization of Protease and Zymography
The optimum temperature for protease activity was
carried out at a temperature (20 - 90°C) for 20 min.
The thermostability of protease was examined by
incubating the enzyme in 10mM potassium phosphate
solution (pH 10) at 100°C. The enzyme samples were
taken after (1-10) min of incubation for the assay of
enzyme activity. The crude enzyme was incubated
with 10mM potassium phosphate solutions of varying
pH (8-12) at 50°C for 20 min. The pH stability was
measured by incubating the enzyme at pH 6 to 12 in
different buffers (0.1M) such as KH2PO4-K2HPO4
(6.0-7.5), Tris–HCl (8.0-9.0), 10mM potassium
phosphate buffer (pH 10.0) ,Glycine-NaOH (9.0 –
13.0) and Na2HPO4-NaOH (11.0-12.0) at 50°C for 20
min. Zymography is a technique in which substrate
copolymerized with the polyacrylamide gel, for the
detection of enzyme activity as well as molecular
weight (Talebi et al., 2013). Samples were prepared in
the standard SDS-PAGE treatment buffer (5%
sodium dodecyl sulfate [SDS], 2% sucrose, 0.005%
bromphenol blue in 0.5 M Tris-HCl, pH 6.8,
containing 0.4% SDS stacking gel buffer). The sample
was subjected to electrophoresis in Tris-glycine
buffer, pH 8.3, at 12.5 mA per gel. Following
electrophoresis, the SDS was removed by incubation
with 2.5% Triton X-100 for 2 h at 25°C, and the gel
was then incubated in neutral buffer (0.1 M Tris-HCl,
pH 7.8 containing 1 mM CaCl2) at 37°C for 24 h. The
zymogram was subsequently stained Coomassie
Brilliant Blue and areas of digestion appear as clear
bands against a darkly stained background where the
substrate has been degraded by the enzyme. Gelatin is
the most commonly used substrate and is useful for
demonstrating the activity of gelatin-degrading
proteases.
Polymerase Chain Reaction and Cloning
The DNA isolated from the strain was used as
template in PCR amplification of protease gene
(Gärtner, et al., 1988). The sequence of protease gene
was retrieved from the gene bank. Primers were
designed to pick their full-length sequences. Specific
primers of Bacillus licheniformis RT7P1 forward
primer of the following sequence
5′ATGGCCAACAGACAGAAGATC3′ and RT7P1
reverse primer 5 TCAGGGGCTGGTTCTTCTGTT3′
were used in this study for the amplification of
protease gene from Bacillus licheniformis.
Fresh PCR amplified products were used for cloning
into Fermentas (pTZ57R) cloning vector (2886bp).
The cloned plasmids were confirmed through
restriction with BamHI and EcoRI.
Results and discussion
Protease is one of the most important groups of
industrial enzymes which occupy a pivotal position
with respect to their physiological roles as well as
commercial applications.
Fig. 1. Effect of time course on enzyme production.

231
Afzal et al.
Int. J. Biosci.
2017
The study of time course revealed that Bacillus
licheniformis RT7PI gradually show an increase in
enzyme production, and its activity was found (24.3
U/mL) after 24h, (31.2 U/mL) after 48h and maximum
level of protease activity 41.2 U/mL after 72h (Fig.1).
whereas in contrast to alkaline protease production
which was enhanced after 39 h in B. licheniformis
(Sayem et al., 2006). These findings were in association
with the observations of (Bernlohr and Clark, 1971 ).
The decline in protease activity after 96 and 120 h in
the present investigation indicated less reproduction
and highest death rate of B. licheniformis (Fig. 1).
Temperature is an important environmental factor
affecting the growth and production of metabolites by
microorganisms. The optimum temperature for
protease production was observed at 37°C and
protease activity was 44.2U/mL (Fig. 2).
Fig. 2. Effect of Temperature on enzyme production.
These findings were in association with the
observation of (Sayem, et al., 2006). The study
conducted on protease production from Bacillus
horikoshii showed maximum growth at 37°C (Joo and
Choi, 2012). The effect of initial pH of the medium on
crude enzyme production was examined by varying
the pH of the culture medium and a maximum
activity of the enzymes was found on pH7 as shown in
(Fig.3). Similar results were recorded by (Rozs et al.,
20010. Study on the substrate concentration
indicated that increasing concentration of casein
enhanced the enzyme production (Fig. 4). Ferro et al,
observed that casein was the best source for
production of alkaline protease (Ferrero et al., 1996).
Fig. 3. Effect of pH on enzyme production.

232
Afzal et al.
Int. J. Biosci.
2017
Fig. 4. Effect of Substrate Concentration.
Bacillus licheniformis RT7PI produce a thermostable
alkaline extracellular protease
The optimum temperature for protease activity was
found to be 50°C (Fig.5).
The enzyme was stable at 100°C for 3 min afterward a
gradual decrease in activity was observed after 6
minutes at 100ºC (Fig. 6). These results explained
thermostability of protease. It was reported that the
thermophilic neutral protease from thermophilic
Bacillus strain showed that protease remained stable
at 50°C during 1 h incubation (Guangrong et al.,
2006). Stability study indicated that this enzyme
retained about 95% and 74% of its maximum activity
after 1h at 60°C.
Fig. 5. Effect of Temperature on Protease Activity.
The protease retained more than 80% and 65% of its
activity after 30 min of incubation at 60°C
(Nascimento and Martin, 2006). Maximum enzyme
activity 43.1 U/mL was at pH10 (Fig.7). Enzyme
activity was found to be stable at pH range of (9 -11).
The study implicated alkaline nature of protease.
Thermostable alkaline protease showed maximum
activity at pH 10 and it was found to be stable
between pH 8-10 (Adinarayana et al., 2003).

233
Afzal et al.
Int. J. Biosci.
2017
Zymographic demonstration of protease, clear bands
represented protease that has degraded the substrate
in the gel (Talebi et al., 2013). The molecular weight
of protease was found to be 33 kDa (Fig: 8).
PCR Amplification and Cloning
Gene cloning is a rapidly progressing technology that
has been improving understanding of the structure-
function relationship of genetic systems. The genomic
DNA of Bacillus licheniformis strain RT7P1 was used
as a template in PCR.
Fig. 6. Thermal stability on enzyme activity.
Fig. 7. Effect of pH on enzyme activity.
The PCR products were run on 1 % agarose gel along
with 1Kb Fermentas DNA ladder to estimate the size
of amplicon showed the amplification of (1725bp)
gene fragment of protease from Bacillus licheniformis
(Fig.9). PCR amplified fragment (1725bp) was cloned
into a cloning vector (pTZ57R/T) and the
development of white colonies represented
recombinant colonies.
The plasmid was isolated and the clone was
confirmed through restriction with EcoRI and
BamHI. The two fragments of 2886bp and 1725bp
appeared on the gel which showed that the insert was
cloned in right orientation (Fig. 10).
The TA cloning method is especially suitable for
cloning of PCR fragments amplified with primers.

234
Afzal et al.
Int. J. Biosci.
2017
Fig. 8. Zymogram: Lane M Fermentas proteinase
marker of size (18-118 kDa), Lane A and sample of B.
licheniformis R7P1
The high efficiency of this method is based on the use
of a specifically designed cloning vector, pTZ57R/T.
The vector has been pre-cleaved with Eco32 and
treated with terminal deoxynucleotidyl transferase to
create 3”-ddt overhang at both ends. PCR fragment is
ligated into the vector, a circular molecule with two
nicks, the product can be used directly to transform E.
coli cells with high efficiency, An additional advantage
of this approach is that the T-overhang prevent
recirculization of the vector during the ligation
procedure.
Fig. 9. Lane M, 1kb Fermentas DNA ladder #
SM1303. Lane 1 represents negative control; Lane 2
positive control of another B. licheniformis strain
Lanes 3 and 4; PCR amplification of RT7P1 gene
(1725bp).
As a result, the yield of the recombinants as high as
90%. Amplified gene product used in cloning is more
sensitive and reliable method as compared to random
cloning method. In Random cloning undesired gene
can also be cloned and their expression can also
interfere with the expression of the desired gene.
Bacillus lentus and Bacillus subtilis 168 alkaline
protease genes have been cloned and sequence
(Johnston et al., 2009). Subtilisin gene 1.5 kb has
been cloned in pTZ57R/T that have three ORFs
(Tk1689, Tk1675 and Tk0076) in encoding three
subtilisin-like serine protease precursors (Rasool et
al., 2011).
Fig. 10. Restriction digestion of pTZ57R/T with
EcoR1 and Bam HI to excise the cloned fragment,
Lane M, 1kb Fermentas ladder, SM#0313, Lanes 1
and 2 represent RT7P1 gene (1725 bp), Vector cloned
into pTZ57R/T vector, Lane 3 control.
Conclusion
Bacillus licheniformis RT7P1 has shown to produce
thermostable extracellular protease. This protease
displayed high activity in a broad range of pH and
revealed high substrate specificity. The enzyme showed
optimum activity at pH 10 and temperature 50°C,
respectively. The culture was stable between pH 9-11and
thermal stability data showed that enzyme was stable up
to 100°C. The study indicates that Bacillus licheniformis
RT7P1 is a good source of commercially thermostable
alkaline extracellular protease.
References
Singhal P, Nigam VK, Vidyarthi AS. 2012.
Studies on production, characterization, and
application of microbial alkaline proteases. Nature, 3,
653-669.

235
Afzal et al.
Int. J. Biosci.
2017
Boominadhan U, Rajakumar R, Karpaga P,
Sivakumaar V, Joe MM. 2009. Optimization of
protease enzyme production using Bacillus Sp.
isolated from different wastes. International
Journal of Botany and Research 2, 83-87 p.
Morya V, Yadav D. 2009. Production and partial
characterization of neutral protease by an
indigenously isolated strain of Aspergillus
tubingensis NIICC-08155. International Journal of
Microbiology 8, 1-6.
Lagzian M, Asoodeh A. 2012. An extremely
thermotolerant, alkaliphilic subtilisin-like protease
from hyperthermophilic Bacillus sp. MLA64.
International Journal of Biological Macromolecules
51, 960–967 p.
Cotarleţ M, Negoita T, Bahrim G, Stougaard P.
2009. Cold adapted amylase and protease from new
streptomyces 4 alga antarctic strain. Journal of
Innovative Food Science and Emerging Technologies,
5, 23-30 p
Suganthi C, Mageswari A, Karthikeyan, S,
Anbaagan M, Sivakumar A, Gothandam KM.
2013. Screening and optimization of protease
production from a halotolerant Bacillus licheniformis
isolated from saltern sediments. Journal of Genetic
Engineering and Biotechnology 11, p 47-52.
Pant G, Prakash O, Chandra M, Sethi S,
Punetha1 H, Dixit S, Pant AK. 2014. Biochemical
analysis, pharmacological activity, antifungal activity
and mineral analysis in methanolic extracts of Myrica
esculenta and Syzygium cumini: the Indian
traditional fruits growing in Uttarakh and Himalaya.
Indian Journal of Pharmaceutical and Biological
Research, 2(1), 26-34 p.
Mathew CD, Gunathilaka RMS. 2015. Production
purification and characterization of thermostable
alkaline serine protease from Bacillus licheniformis
NMS-1. International Journal of Biotechnology and
Molecular Biology Research, 6(3), 19-27 p.
Wilson P, Remigio Z. 2012. Production and
characterization of protease enzyme produced by a
novel moderate thermophilic bacterium (EP1001)
isolated from an alkaline hot spring, Zimbabwe.
African Journal of Microbiology Research, 6(27),
5542-5551 p.
Talebi M, Emtiazi G, Sepahy AA, Zaghian, S.
2013. Zymogram analysis of alkaline keratinase
produced by nitrogen fixing Bacillus pumilus ZED17
exhibiting multiprotease enzyme activities. The
journal of Microbiology 6(10), 1-6 p.
Gärtner D, Geissendörfer M, Hillen W. 1988.
Expression of Bacillus subtilis xyl operon is repressed
at the level of transcription and is induced by xylose.
Journal of Bacteriology, 170 (7), 3102–3109 p.
Sayem SMA, Alam MJ, Hoq MM. 2006. Effect of
temperature, pH and metal ions on the activity and
stability of alkaline protease from novel Bacillus
licheniformis MZK03. Proceedings of the Pakistan
Academy of Sciences 43(4), 257-262 p.
Bernlohr RW, Clark V. 1971. Characterization
and regulation of protease synthesis and sctivity in
Bacillus licheniformis. Journal of Bacteriology, vol
105(1), 276–283 p.
Joo HS, Choi JW. 2012. Purification and
characterization of a novel alkaline protease from
Bacillus horikoshii”, Journal of Microbiology and
Biotechnology 22 (1), 58-68 p.
Rozs M, Manczinger L, Vagvolgyi LC, Kevei,
2001. Secretion of a trypsin-like thiol protease by a
new keratinolytic strain of Bacillus licheniformis.
FEMS Microbiology Letter, 205(2), 221-4 p.
Ferrero MA, Castro GR, Abate CM, Bagori MD,
Sinerizf. 1996. Isolation, production and
characterization of thermostable alkaline protease of
Bacillus licheniformis MIR29. Journal of Applied
Microbialogy and Biotechnology 45, 327-332 p.
Guangrong H, Tiejing Y, Jiaxing HPO. 2006.
Purification and characterization of a protease from
thermophilic Bacillus strain HS08. African Journal
of Biotechnology 5, 2433-2438 p.

236
Afzal et al.
Int. J. Biosci.
2017
Nascimento CAD, Martin MLL. 2006. Studies on
the stability of protease from Bacillus sp. and its
compatibility with commercial detergents. Brazillian
Journal of Microbiology37, 307-311 p.
Adinarayana K, Ellaiah P, Pra sad DS. 2003.
Purification and partial characterization of
thermostable serine alkaline protease from a
newly isolated Bacillus subtilis PE-11”, AAPS.
Pharmaceutical Science and Technology 4, 440-
448 p.
Johnston J, Pippen X, Pivot M., Lichinitser S,
Sadeghi V, Dieras HL, Gomez G, Romieu A,
Manikhas, Kennedy MJ. 2009. Lapatinib
combined with letrozole versus letrozole and placebo
as first line therapy for postmenopausal hormone
receptor positive metastatic breast cancer. Journal of
Clinical Oncology 27, 5538-5546 p.
Rasool N, Rashid N, Javed MA, Haider MS.
2011. Requirement of pro-peptide in proper folding of
Subtilisin-like serine protease TK0076. Pakistan
Journal of Botany 43, 2059-2065.