Content uploaded by Annesha Banerjee
Author content
All content in this area was uploaded by Annesha Banerjee on May 19, 2020
Content may be subject to copyright.
RESEARCH ARTICLE
Effects of Exposure to the Endocrine-Disrupting
Chemical Bisphenol A During Critical Windows
of Murine Pituitary Development
Kirsten S. Eckstrum,
1
Whitney Edwards,
1
Annesha Banerjee,
1
Wei Wang,
2
Jodi A. Flaws,
2
John A. Katzenellenbogen,
3
Sung Hoon Kim,
3
and Lori T. Raetzman
1
1
Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, Urbana,
Illinois 61801;
2
Comparative Biosciences, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801;
and
3
Department of Chemistry, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801
Critical windows of development are often more sensitive to endocrine disruption. The murine
pituitary gland has two critical windows of development: embryonic gland establishment and
neonatal hormone cell expansion. During embryonic development, one environmentally ubiquitous
endocrine-disrupting chemical, bisphenol A (BPA), has been shown to alter pituitary development
by increasing proliferation and gonadotrope number in females but not males. However, the effects
of exposure during the neonatal period have not been examined. Therefore, we dosed pups from
postnatal day (PND)0 to PND7 with 0.05, 0.5, and 50 mg/kg/d BPA, environmentally relevant doses, or
50 mg/kg/d estradiol (E2). Mice were collected after dosing at PND7 and at 5 weeks. Dosing mice
neonatally with BPA caused sex-specific gene expression changes distinct from those observed with
embryonic exposure. At PND7, pituitary Pit1 messenger RNA (mRNA) expression was decreased with
BPA 0.05 and 0.5 mg/kg/d in males only. Expression of Pomc mRNA was decreased at 0.5 mg/kg/d BPA
in males and at 0.5 and 50 mg/kg/d BPA in females. Similarly, E2 decreased Pomc mRNA in both males
and females. However, no noticeable corresponding changes were found in protein expression.
Both E2 and BPA suppressed Pomc mRNA in pituitary organ cultures; this repression appeared to be
mediated by estrogen receptor-aand estrogen receptor-bin females and G protein–coupled es-
trogen receptor in males, as determined by estrogen receptor subtype-selective agonists. These data
demonstrated that BPA exposure during neonatal pituitary development has unique sex-specific
effects on gene expression and that Pomc repression in males and females can occur through
different mechanisms. (Endocrinology 159: 119–131, 2018)
The pituitary is the master gland of the endocrine
system, releasing hormones that control reproduc-
tion, lactation, growth, metabolism, and stress. To re-
lease these hormones, the anterior pituitary gland must
develop five hormone-secreting cell types: gonadotropes,
lactotropes, somatotropes, thyrotropes, and cortico-
tropes. Development of the hormone-secreting cell types
occurs during two key periods in mouse development:
embryonic and neonatal. During embryonic develop-
ment, cell specification is regulated by intrinsic and
paracrine signals from the pituitary and surrounding
tissue (1). However, during the neonatal period, the
capability for communication between the hypothala-
mus, pituitary gland, and target organs develops (2, 3),
suggesting a potential role for axis hormones in
this window of development. Additionally, at birth,
the testosterone surge establishes sex differences in
the hypothalamic–pituitary–gonadal (HPG) and the
hypothalamic–pituitary–adrenal (HPA) axes through
local aromatization of testosterone to estradiol in the
ISSN Online 1945-7170
Copyright © 2018 Endocrine Society
Received 16 June 2017. Accepted 3 October 2017.
First Published Online 6 October 2017
Abbreviations: ACTH, adrenocorticotropic hormone; BPA, bisphenol A; BPA0.05,
0.05 mg/kg/d bisphenol A; BPA0 .5, 0 .5 mg/kg/d bisphenol A; BPA50, 50 mg/kg/d
bisphenol A; CAS, Chemical Abstracts Servi ce; DPN, diarylpropionitrile; E2, estradiol;
EDC, endocrine-disrupting chemical; ESR1, estrogen receptor-a; ESR2, estrogen
receptor-b; GnRH, gonadotropin-releasing hormone; GPER, G protein–coupled
estrogen receptor; HPA, hypothalamic–pituitary–adrenal; HPG, hypothalamic–
pituitary–gonadal; IHC, immunohistochemical; PBS, phosphate-buffered saline;
PND, postnatal day; PPT, pyrazole triol.
doi: 10.1210/en.2017-00565 Endocrinology, January 2018, 159(1):119–131 https://academic.oup.com/endo 119
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
male brain (4, 5). Thus, the endocrine milieu postnatally
can alter pituitary sensitivity to exposure to endocrine-
disrupting chemicals (EDCs).
Bisphenol A (BPA) is an EDC found in several items
such as polycarbonate plastics, epoxy resins, and thermal
paper, leading to ubiquitous exposure (6). Studies have
suggested that the developing organs of fetuses and ne-
onates have heightened sensitivity to EDCs such as di-
ethylstilbestrol and BPA in both rodents and humans
(7–9). BPA is readily detectible in fetal cord serum,
maternal serum, and fetal amniotic fluid in humans (10),
demonstrating exposure to BPA during critical devel-
opmental windows. A possible mechanism by which
BPA is considered to act is by disrupting the actions of
estrogens. The classic estrogen receptors estrogen receptor-
a(ESR1) and estrogen receptor-b(ESR2) and the mem-
brane G protein–coupledestrogenreceptor(GPER)are
found in the hypothalamus and pituitary gland (11–15).
However, the roles of estrogen signaling and the potential
effects of BPA during neonatal pituitary development are
unexplored.
Developmental exposure to environmentally relevant
doses of BPA at or less than the no observed adverse effect
level can affect every axis of the endocrine system reg-
ulated by the pituitary gland, including the reproductive
axis (16–20) in rats and mice and the prolactin levels (21),
growth axis (22), thyroid axis (23), and stress axis (24) in
rats. BPA also alters sex differences of the HPG and HPA
axes established by sex steroids (24–27). Despite the
relatively quick metabolism of BPA (28), changes can
sometimes occur well after exposure has ended. For
example, embryonic exposure to 25 to 250 ng/kg/d BPA
led to reproductive tissue weight changes in adult female
mice and changes in estrogen and progesterone receptor
expression (9). Also, neonatal exposure to 50 mg/kg/d to
50 mg/kg/d BPA had different outcomes on the rat hy-
pothalamus at 2 days after exposure than at 8 days after
exposure (27), indicating the importance of examinations
at multiple points after exposure. Therefore, it is clear
that developmental exposure to BPA can influence sex
differences and the endocrine axes, although regulation
could be time and/or context specific. Despite this evi-
dence, few studies have examined closely the effects of
neonatal BPA exposure on the development and ex-
pression of genes in the pituitary gland itself.
Previously, our laboratory showed that embryonic
exposure of pregnant mice to 0.5 or 50 mg/kg/d BPA
increased pituitary proliferation and gonadotrope cell
numbers in female offspring (29), a response similar to
that of estradiol (E2) (30). However, the effects of neonatal
exposure on the second wave of pituitary development are
unknown. We hypothesized that BPA exposure would
have different effects on the pituitary gland, depending on
sex, the developmental period of exposure, and the timeof
examination after exposure. Additionally, we hypothe-
sized that some of these effects might be similar to that of
E2. To test this hypothesis, two experiments were per-
formed. First, we examined pituitary glands at two time
points after exposure neonatally to three environmentally
relevant doses of BPA and E2 and compared the effects in
males and females. Second, we treated isolated pituitary
glands in culture with E2, BPA, and estrogen receptor
subtype-specific agonists to determine the direct effects on
the pituitary gland and an estrogen receptor pathway
important in gene regulation.
Materials and Methods
Mice
CD-1 mice, obtained from Charles River, were bred in-
house, kept in polysulfone cages containing corn cob bedding
material, and fed Teklad 8664 rodent chow (Envigo) and water
ad libitum through glass bottles. Sex was confirmed by visual
inspection, SRY genotyping as previously described (31), or
gonadal removal. The University of Illinois Urbana-Champaign
institutional animal care and use committee approved all
procedures.
Experiment 1 design: effects of neonatal dosing
In the first experiment, we examined the effects of dosing
male and female mice during the critical neonatal period of
pituitary development. CD-1 litters were culled to 8 to 12 pups
on the day of birth, and the neonatal pups were dosed orally
through consumption from a pipet tip, once daily, from post-
natal day (PND)0 to PND7 with control (0.1% ethyl alcohol),
0.05, 0.5, or 50 mg/kg/d BPA [BPA0.05, BPA0.5, and BPA50,
respectively; Sigma-Aldrich; purity, $99%; Chemical Abstracts
Service (CAS) no. 80-05-7], or 50 mg/kg/d E2 (17b-estradiol;
Tocris; purity, .99%; CAS no. 50-28-2) dissolved in tocopherol-
stripped corn oil (MP Biomedicals). The litters were randomly
assigned to a treatment group. The 0.05- and 0.5-mg/kg/d doses of
BPA were chosen because they are within the range of human
exposure levels (32). The 50-mg/kg/d dose of BPA was chosen
because it is the oral reference dose for BPA (33). The 50-mg/kg/d
dose of E2 was chosen because it was a dose sufficient to induce
expression of estrogen-regulated genes in our system (31). All
pups in a litter were dosed with a single compound, and six
separate litters were dosed with each compound. One male and
one female were taken from each litter at each measurement point
for each assay between 10 and 11 AM.
Part A: on neonatal pituitary development
Part A of the experiment examined the immediate effects of
exposure to BPA and E2 during the neonatal period. The mice
were euthanized on PND7, 1 hour after the final dosing. For
western blot analysis, an additional dosing of each compound
was performed, and all pups were collected at PND7 for western
blot analysis.
Part B: at 5 weeks
Part B of the experiment examined whether neonatal dosing
would influence the pituitary outside the first postnatal rapid
120 Eckstrum et al Bisphenol A Effects on Postnatal Pituitary Gland Endocrinology, January 2018, 159(1):119–131
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
growth phase, which ends at 3 weeks of age (34). The 5-week-old
siblings of the mice examined at PND7 were collected for RNA
analysis. One male and female were analyzed from each litter, if
possible. Because of the sex distribution, it was not always possible
to have the number equal six. The estrous cycles were monitored
beginning at 5 weeks by vaginal smear (35), and the mice were
euthanized when in estrus. Female mice were euthanized in estrus
because neonatal E2 treatment caused persistent estrus.
Measurements, weights, and puberty assessment
At PND7 and 5 weeks, the weights and measurements were
recorded to determine whether any gross systemic effects of BPA or
E2 exposure had occurred.The wet weight for the testes, ovaries,
uteri, and liver were all compared with the body weight. The
anogenital distance was measured using calipers and compared
with the body weight. Puberty measurements were observed,
stratified by the day of vaginal opening for females and preputial
separation for males.
Experiment 2 design: pituitary cultures
PND1 pituitary glands were cultured overnight on Millicell
CM membranes (Millipore), as previously described (31). The
next day, the media were replaced with media containing the
following compounds alone or in combination: 10
28
M pyr-
azole triol (PPT; Tocris; purity, .99%; CAS no. 263717-53-9),
10
28
M diarylpropionitrile (DPN; Tocris; purity, .99%; CAS
no. 1428-67-7), 10
28
M E2 (Tocris; purity, .99%; CAS no. 50-
28-2), 4.4 310
25
M BPA (Sigma-Aldrich; purity, $99%; CAS
no. 80-05-7), 10
26
M G1 (Cayman; purity, .98%; CAS no.
881639-98-1), or vehicle control consisting of 0.1% ethanol for
treatment with a single compound, 0.2% ethanol for cotreat-
ment, or 0.1% dimethyl sulfoxide for G1 treatment. The pi-
tuitary glands were also treated with an estrogen dendrimer
conjugate (10
29
M) or empty dendrimer conjugate (dendrimer
control; 10
29
M) (36, 37). For the cotreatment experiments
with PPT and DPN, 0.2% ethanol vehicle was added to the
dendrimer control. The pituitary glands were treated for
48 hours before collection (n = 6 to 13).
Quantitative reverse transcription polymerase
chain reaction
For RNA analysis, males and females were analyzed separately
(n = 3 to 6). RNA was processed, as previously described (38). The
expression levels of the genes of interest were normalized to Actb
messenger RNA (mRNA) levels, with the primer sequences of
forward 50to 30: GACATGGAGAAGATCTGGCA and reverse
50to 30: GGTCTCAAACATGATCTGGGT (Life Technologies).
Gene expression for Mki67,Lhb,Nr5a1,Tshb,Gh,andPrl was
analyzed using primer sequences previously reported (29) and Pit1
and Tpit previously reported (38). Finally, the Pomc sequences
used were forward 50to 30: GATAGCGGGAGAGAAAGCCG
and reverse 50to 30: GGGACCCCGTCCTGTCCTAT. The data
were analyzed using the standard comparative change in threshold
cycle(DCt) value method, as previously described (39). For in vivo
analysis, individual points were graphed, with the sex indicated
and averages shown as a line. For pituitary cultures, bar graphs
representing the data were prepared.
Immunohistochemistry
Pituitary glands were collected at PND7 from the exposed
mice and fixed in 3.7% paraformaldehyde for 1 hour, cryoprotected
in 30% sucrose/phosphate-buffered saline (PBS) solution, and
frozen in optimal cutting temperature compound (Electron
Microscopy Sciences). The pituitary glands were sectioned into
10-mm slices before being mounted onto Superfrost plus slides
(Fisher Scientific).
Before antibody treatments, frozen sections were thawed for
10 minutes, fixed in 4% paraformaldehyde diluted in PBS, and
blocked using 5% normal donkey serum diluted in an immu-
nohistochemical (IHC) block, which had 3% bovine serum
albumin and 0.5% TritonX-100 diluted in PBS. The slides were
then treated with the following primary antibodies overnight at
4°C: LHb(luteinizing hormone-b; National Hormone and
Peptide Program), phosphorylated histone H3 (Millipore), PIT1
(gift from Simon Rhodes), and POMC (Dako). After a series of
PBS washes, the slides were treated with biotin-conjugated
rabbit secondary antibody (Jackson ImmunoResearch) diluted
1:200 in an IHC block for 60 minutes at room temperature. After
another series of PBS washes, the slides were treated with
streptavidin-conjugated cy3 tertiary antibody (Jackson Immuno-
Research) diluted 1:200 using an IHC block. Control slides were
prepared that did not include the primary antibody.
All slides were counterstained with 40,6-diamidino-2-
phenylindole (1:1000; Sigma-Aldrich) and visualized under a
Leica DM2560 microscope. Photographs were taken using a
Retiga 2000R camera (Q-Imaging) and acquired using Q-
Capture Pro software (Q-Imaging). Images were processed
using Adobe Photoshop CS2.
Cell counting
POMC cell counts were performed using National Institutes
of Health ImageJ. For each dose (0.05, 0.5, and 50 mg/kg/d BPA,
and control) four to five pituitary glands were examined, with
three to four slides per pituitary. The percentage of POMC-
positive cell numbers was determined by comparing the
number of POMC immunoreactive cells per 40,6-diamidino-2-
phenylindole –stained nuclei in a defined area. The sections on
each slide, and all the slides per animal (3), were averaged
together for the mean percentage of positive POMC cells for
each mouse.
Western blot
Three pituitary glands were frozen on dry ice and lysed using
radioimmunoprecipitation assay buffer. Protein fractions were
obtained by centrifugation for 5 minutes at 4°C at 20,817
relative centrifugal force. The total protein concentration
was measured via a BCA protein assay kit (Thermo Fisher)
according to the manufacturer’s instructions. Protein samples
(20 mg) were mixed with radioimmunoprecipitation assay
buffer and 33Laemmli loading dye and then heated for
12 minutes at 57°C. The samples were loaded on a 10% sodium
dodecyl sulfate-polyacrylamide gel electrophoresis gel and
transferred to a nitrocellulose membrane (BioRad). The mem-
brane was blocked for 2 hours in 5% nonfat dried milk in Tris-
buffered saline and incubated with either PIT1 antibody (rabbit;
1:1000; gift from Dr. Simon Rhodes), POMC antibody (rabbit;
1:250; Dako), b-actin antibody (rabbit; 1:1000; Cell Signaling),
or a-tubulin antibody (mouse; 1:5000; Sigma-Aldrich) in 1%
milk with 0.2% Tween, overnight at 4°C. Secondary goat
anti-rabbit (1:500) or goat anti-mouse (1:5000) IgG conjugated
to IRdye 800CW (LiCor) was added at room temperature for
1 hour. The membrane was then imaged with the Odyssey IR
doi: 10.1210/en.2017-00565 https://academic.oup.com/endo 121
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
imaging system (LiCor). The relative protein levels were ana-
lyzed using National Institutes of Health ImageJ.
Statistical analysis
Statistical significance among the controls, three BPA
treatment groups, and E2 was determined using one-way
analysis of variance within sex. Within sex was used because
sex differences were expected in some gene expression levels
between the control males and females (31). Only one pituitary
gland of each sex from each litter was used in the quantitative
polymerase chain reaction (PCR) analysis; thus, litter was not
considered as a covariate. If significance was found, the mean
fold change between groups was compared using the Tukey
honest significant difference test in Microsoft Excel for both
quantitative reverse transcription PCR and cell counting. For
quantitative reverse transcription PCR of pituitary explant
culture experiments, significance was determined using a two-
tailed ttest. Pvalues of #0.05 were considered statistically
significant.
Results
Experiment 1: neonatal dosing caused few changes
in gross appearance of mice
Previous studies have demonstrated that the embryonic
pituitary gland is sensitive to BPA exposure. Therefore, we
sought to examine the effects of BPA exposure specifi-
cally during neonatal development. Organ weights and
measurements were taken to determine whether any
gross effects were present. The testes, ovaries, uteri, and
liver weights are provided as a percentage of body
weight (Table 1). At PND7, the lowest dose of BPA
decreased the ovary weight compared with the control,
and E2 had increased the uterine weight compared with
thecontrol.At5weeks,thesameweightsandmea-
surements were gathered. No statistically significant
differences were found in the body weights or mea-
surements between any of the treatments at the 5-week
point (Table 2).
Experiment 1: neonatal exposure to BPA did not
affect pituitary proliferation
Exposure to BPA or E2 during the neonatal period had
no statistically significant effect on pituitary proliferation
at PND7, as measured by Mki67 mRNA levels, in males
[Fig. 1(a); F
(4, 25)
= 1.82; P= 0.16) and females [Fig. 1(b);
F
(4, 25)
= 0.74; P= 0.57]. Immunohistochemistry for the
mitosis marker phosphorylated histone H3 in the female
[Fig. 1(e)–1(h)] and male [Fig. 1(i)–1(l)] pituitary glands
at PND7 revealed no obvious change in the distribution
of cells stained in response to exposure to BPA. We next
examined the proliferation at 5 weeks to determine
whether an effect of neonatal BPA exposure would be
present at a later time point. The Mki67 mRNA levels
were not significantly altered statistically by BPA or E2 in
the males [Fig. 1(c); F
(4, 17)
= 1.66; P= 0.21] or females
[Fig. 1(d); F
(4, 19)
= 1.61; P= 0.21] at 5 weeks.
Experiment 1: neonatal BPA exposure did not affect
gonadotrope lineage gene expression
To examine whether BPA exposure during the neo-
natal period affected the gonadotrope lineage, the mRNA
expression levels of the gonadotrope lineage transcription
factor Nr5a1 were examined. No statistically significant
effect of exposure on Nr5a1 mRNA levels was found in
males at PND7 [Fig. 2(a); F
(4, 25)
= 0.81; P= 0.53). In
females, a statistically significant effect of exposure was
found on Nr5a1 mRNA levels [Fig. 2(b); F
(4, 25)
= 2.85;
P#0.04]. An increase in Nr5a1 with E2 treatment was
found (P#0.01). To explore whether a difference in
Nr5a1 mRNA levels would exist later, we examined the
pituitary glands at 5 weeks. In these mice, the males
showed no statistically significant main effect of treat-
ment on Nr5a1 mRNA levels [Fig. 2(c); F
(4, 17)
= 0.94; P=
0.47]. However, in females, an effect of treatment was
seen [F
(4, 18)
= 4.92; P#0.007], and the Nr5a1 mRNA
levels were decreased with the BPA0.05 and E2 exposures
[Fig. 2(d); P#0.002 and P#7310
25
].
To further explore the gonadotrope lineage during
neonatal exposure to E2 or BPA, Lhb mRNA expression
was analyzed. With neonatal dosing, a statistically sig-
nificant effect of exposure on Lhb mRNA levels was
found in males [F
(4, 25)
= 4.04; P#0.01] and females
[F
(4, 25)
= 9.70; P#7310
25
]. BPA exposure did not
statistically significantly alter Lhb mRNA levels. How-
ever, E2 significantly decreased the levels of Lhb mRNA
Table 1. PND7 Wet Weights and Measurements
Variable
Weight, g
Testes, %BW Ovaries, %BW Uteri, %BW Liver, %BW
AGD, mm/gBW
Male Female Male Female
Control 4.725 4.417 0.175 0.049 0.093 3.118 1.14 0.91
BPA0.05 4.217 3.995 0.177 0.038
a
0.094 3.012 1.16 0.82
BPA0.5 4.611 4.250 0.170 0.043 0.096 3.137 1.10 0.83
BPA50 4.606 4.483 0.179 0.044 0.104 3.201 1.20 0.82
E2 4.683 4.555 0.183 0.057 0.195
a
3.163 1.15 0.82
Abbreviations: AGD, anogenital distance; gBW, grams of body weight; %BW, percentage of body weight.
122 Eckstrum et al Bisphenol A Effects on Postnatal Pituitary Gland Endocrinology, January 2018, 159(1):119–131
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
in both males [Fig. 2(e); P#0.04] and females [Fig. 2(f);
P#0.0005] at PND7. Immunohistochemistry for LHb
did not revealany obvious differences inthe BPA treatment
groups in females (Supplemental Fig. 1). Additionally,
mRNA levels for the common a-subunit Cga were ex-
amined at PND7 and were not statistically significantly
affected by exposure in males [F
(4, 24)
=0.78;P= 0.55] or
females [F
(4, 24)
= 0.40; P= 0.81]. We next examined the
5-week-old mice. For the Lhb mRNA levels, no statis-
tically significant effect of BPA or E2 exposure was found
in males [Fig. 2(g); F
(4, 17)
= 0.78; P= 0.55]. A statistically
significant effect of exposure was found for females
[Fig. 2(h); F
(4, 19)
= 11.61; P#6310
25
]. No statistically
significant difference was found in Lhb mRNA with BPA
exposure; however, suppression of Lhb mRNA occurred
with E2 exposure [Fig. 2(h); P#6310
25
]. Despite
finding effects on the gonadotrope lineage with E2
treatment, no statistically significant effects were found
on the timing of puberty, as assessed by preputial sep-
aration or vaginal opening with E2 or BPA treatment
(Table 3).
Experiment 1: low levels of BPA exposure decreased
Pit1 mRNA in males only, without altering hormone
transcript levels
PIT1 is a transcription factor found exclusively in the
pituitary gland and is important in the development of
lactotropes, somatotropes, and thyrotropes and expres-
sion of their respective hormones. A statistically signifi-
cant effect of exposure on Pit1 mRNA levels was found in
males [Fig. 3(a); F
(4, 25)
= 3.23; P#0.03]. The lowest
doses of BPA, BPA0.05 and BPA0.5, decreased the levels
of Pit1 mRNA (P#0.002 and P#0.007, respectively);
however, BPA50 and E2 had no statistically significant
effect on Pit1 mRNA during this period. In females,
exposure did not have a statistically significant effect on
Pit1 mRNA [Fig. 3(b); F
(4, 25)
= 1.84; P= 0.15]. To
determine whether the decrease in Pit1 mRNA in males
would correspond with a decrease in protein, western
blot analysis was performed. No statistically significant
change in PIT1 protein was seen with any treatment
group in the males at PND7 [Fig. 3(c)]. Additionally,
immunohistochemistry for PIT1 did not reveal any ob-
vious differences in the treatment groups in the males
(Supplemental Fig. 1). PIT1 is a transcriptional regulator
of Gh,Prl,andTshb. Consequently, we examined
mRNA expression of these hormones to determine
whether BPA-mediated repression of Pit1 mRNA resul-
ted in downstream effects on hormone mRNA expres-
sion. A statistically significant effect of exposure was
found for Prl mRNA levels in males [F
(4, 25)
= 53.86; P#
6310
212
] and females [F
(4, 25)
= 17.81; P#1310
26
].
BPA had no substantial effect on Prl mRNA; however, the
increase in Prl mRNA with E2 was statistically significant
in males [Fig. 3(d); P#1310
25
] and females [Fig. 3(e);
P#0.0002]. Neither BPA nor E2 had any statistically
significant effect on Gh mRNA levels in males [Fig. 3(f);
F
(4, 25)
= 1.17; P= 0.35] or females [Fig. 3(g); F
(4, 25)
=
0.68; P= 0.61]. BPA and E2 also had no statistically
significant effects on Tshb mRNA levels in males
[Fig. 3(h); F
(4, 24)
= 0.92; P= 0.47] or females [Fig. 3(i);
F
(4, 24)
= 1.76; P= 0.17]. Finally, to determine whether the
decrease in Pit1 mRNA seen in males at PND7 would be
present after removal of BPA, we examined the 5-week-
old mice. No statistically significant effect of exposure
was found at 5 weeks in the males [Fig. 3(j); F
(4, 17)
= 0.28;
P= 0.89] or females [Fig. 3(k); F
(4, 18)
= 0.42; P= 0.79].
Experiment 1: BPA decreased Pomc mRNA in a
dose- and sex-specific manner
The last lineage examined was the TPIT lineage, which
includes the corticotrope and melanotrope cells. At
PND7, no statistically significant effect of BPA or E2
exposure was found on Tpit mRNA levels in males
[Fig. 4(a); F
(4, 25)
= 0.29; P= 0.88] or females [Fig. 4(b);
F
(4, 25)
= 0.74; P= 0.57]. A statistically significant effect of
exposure on Pomc mRNA levels was observed in males
[F
(4, 24)
= 4.01, P#0.01] and females [F
(4, 25)
= 3.31, P#
0.03]. The middle dose of BPA, BPA0.5, and E2 both
decreased Pomc mRNA in males [Fig. 4(c); P#0.02; P#
0.01]. In contrast, exposure to the lowest dose of BPA,
BPA0.05, and the highest dose, BPA50, showed no sta-
tistically significant change in Pomc mRNA [Fig. 4(c)]. In
females, Pomc mRNA was reduced with exposure to
Table 2. Five-Week Wet Weights and Measurements
Variable
Weight, g
Testes, %BW Ovaries, %BW Uteri, %BW Liver, %BW
AGD, mm/gBW
Male Female Male Female
Control 27.446 23.517 0.499 0.092 0.792 6.470 0.47 0.28
BPA0.05 26.950 22.350 0.506 0.112 0.937 6.570 0.50 0.29
BPA0.5 27.813 23.083 0.509 0.095 0.689 5.373 0.49 0.30
BPA50 29.743 23.136 0.505 0.110 0.760 6.309 0.51 0.31
E2 27.111 24.675 0.573 0.080 0.598 6.842 0.48 0.28
Abbreviations: AGD, anogenital distance; gBW, grams of body weight; %BW, percentage of body weight.
doi: 10.1210/en.2017-00565 https://academic.oup.com/endo 123
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
BPA0.5, BPA50, and E2 [Fig. 4(d); P#0.04, P#0.02,
and P#0.01, respectively]. No statistically significant
change in Pomc mRNA was observed with the BPA0.05
dose. However, POMC immunostaining and cortico-
trope number appeared unaffected by exposure in females
(Supplemental Fig. 1). Next, intrapituitary POMC
protein levels were examined by western blot analysis in
both males [Fig. 4(e)] and females [Fig. 4(f)], and no
statistically significant changes in protein levels were
detected in either sex. Next, Pomc mRNA levels were
Figure 1. Proliferation was not changed by neonatal exposure to BPA or E2. Proliferation was measured by Mki67 mRNA levels in (a) males and
(b) females at PND7, demonstrating no statistically significant change in proliferation. Also, at 5 weeks, no statistically significant change was
observed in proliferation in (c) males or (d) females (n = 3 to 6 for each sex). Circles represent individual mice, and average is represented by
a line. Proliferation, as assessed by phosphorylated histone H3 expression in sections of PND7 females, was similar among (e) control-, (f)
BPA0.05-, (g) BPA0.5-, and (h) BPA50-treated pituitary glands. Proliferation in male pituitary glands was also similar among (i) control, (j)
BPA0.05, (k) BPA0.5, and (l) BPA50 exposure (n = 3 to 4 for each sex and each condition).
124 Eckstrum et al Bisphenol A Effects on Postnatal Pituitary Gland Endocrinology, January 2018, 159(1):119–131
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
assessed at 5 weeks. No statistically significant changes in
Pomc mRNA were observed in males [Fig. 4(g); F
(4, 17)
= 0.81;
P= 0.53]. In females, a statistically significant effect of
treatment was seen [F
(4, 17)
=4.18;P#0.02]. BPA0.5-
treated females had lower Pomc mRNA levels compared
with the levels in the control females [Fig. 4(h); P#0.03].
Those treated with BPA0.05 (P= 0.10), BPA50 (P= 0.08),
andE2(P= 0.09) had levels approaching statistical
significance.
Experiment 2: E2 and BPA decrease Pomc mRNA
directly at the pituitary
Owing to the striking suppression of Pomc mRNA in
vivo with both E2 and BPA, we sought to determine
whether these changes resulted from direct effects at the
level of the pituitary. PND1 pituitary glands were placed
in culture and treated with either E2 (10
28
M) or BPA
(4.4 310
25
M). In both males and females, E2 decreased
Pomc mRNA levels directly at the pituitary [Fig. 5(a)].
Next, pituitary glands were treated with BPA, which
substantially reduced Pomc mRNA in both sexes, similar
to the effects with E2 [Fig. 5(b)], suggesting these com-
pounds can act directly at the pituitary to exact changes in
Pomc expression similar to that found in vivo.
Experiment 2: Pomc mRNA is decreased by ESR1 and
ESR2 in females and by GPER in males
Because Pomc was suppressed by E2 and BPA directly
at the pituitary, the precise estrogen signaling pathway
that might be involved in this process was examined.
First, the pituitary glands were treated with an ESR1
selective agonist, PPT. PPT alone was unable to statis-
tically significantly suppress levels of Pomc mRNA [Fig.
6(a); male, P= 0.09; female, P= 0.17]. Next, pituitary
glands were treated with the ESR2 selective agonist,
DPN. DPN alone was also unable to statistically signif-
icantly suppress the levels of Pomc mRNA [Fig. 6(b);
male, P= 0.79; female, P= 0.93]. Because PPT or DPN
alone did not suppress Pomc sufficiently, the pituitary
glands were cotreated with PPT and DPN to determine
whether activation of both ESR1 and ESR2 would lead to
Figure 2. Gonadotrope markers were unchanged by neonatal BPA exposure, despite regulation by E2. Gonadotrope marker Nr5a1 mRNA was
measured in (a) males and (b) females at PND7, with no response to BPA. At 5 weeks, no effect of BPA or E2 was found in (c) males. (d)
However, suppression of Nr5a1 mRNA expression was found in females with exposure to BPA0.05 and E2. Lhb mRNA was decreased by E2 in (e)
males and (f) females at PND7 but (e) was unchanged by BPA. (g) At 5 weeks, Lhb was unaltered by any treatment group in males. (h) In females
at 5 weeks, E2 caused substantial repression of Lhb mRNA. For PND7, n = 5 to 6; for 5 weeks, n = 3 to 6. Circles represent individual mice, and
average is represented by a line.
#
P#0.05.
Table 3. Puberty Measurements
Variable Preputial Separation (d) Vaginal Opening (d)
Control 23.695 22.514
BPA0.05 23.700 23.533
BPA0.5 24.222 23.167
BPA50 24.104 23.422
E2 25.780 21.667
Day (d) of preputial separation and vaginal opening were monitored and
averaged for males (n = 3 to 5) and females (n = 4 to 6).
doi: 10.1210/en.2017-00565 https://academic.oup.com/endo 125
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
relevant repression. This cotreatment was able to sup-
press Pomc mRNA in females but not in males [Fig. 6(c);
male, P= 0.71; female, P#0.002].
To determine whether this regulation of Pomc might
occur through membrane estrogen receptors, pituitary
glands were treated with an estrogen dendrimer con-
jugate. This compound is too large to enter the nucleus
and thus only activates estrogen receptors in the plasma
membrane or cytoplasmic sites. Treatment of pituitary
glands with this compound did not lead to any statis-
tically significant changes in Pomc expression [Fig. 6(d);
male, P= 0.26; female, P= 0.91]. Next, cotreatment of
PPT, DPN, and estrogen dendrimer conjugate, meant to
activate both membrane and nuclear signaling path-
ways, showed suppression of Pomc in females but,
again, not in males [Fig. 6(e); male, P= 0.37; female, P#
0.003]. Finally, pituitary glands were treated with the
GPER selective agonist G1. G1 was able to decrease the
levels of Pomc mRNA in males but not in females [Fig.
6(f); male, P#0.01; female, P= 0.64]. This showed
that suppression of Pomc can occur through multi-
ple pathways and can be different between males
and females.
Discussion
We have demonstrated that critical windows of de-
velopment exist in which the mouse pituitary gland is
sensitive to BPA exposure and that differential effects
occur based on age and sex. Embryonic exposure to 0.5
or 50 mg/kg/d BPA increased pituitary proliferation and
gonadotrope number in a sex-specific manner (29).
Exposure to BPA during the neonatal period did not
affect proliferation and also had little effect on gona-
dotropes. However, we did see a decrease in Pit1
mRNA expression with lower doses of BPA in males
and sex-specific decreases in Pomc mRNA with ex-
posure to BPA and E2. Pomc mRNA regulation by BPA
and E2 can occur at the level of the pituitary in males
and females; however, sex-specific downregulation of
Pomc mRNA levels occurs with distinct estrogen re-
ceptor agonists. Therefore, these findings highlight that
the pituitary is dynamically affected by BPA exposure
in a sex-specific manner and emphasize the need for
examining different periods of exposure and times
after exposure.
Previously, our laboratory showed that embryonic
exposure to BPA in mice led to an increase in progenitor
proliferation and differentiation to the gonadotrope
Figure 3. BPA suppressed Pit1 mRNA at low doses in males but did
not alter transcription of PIT1 lineage hormones. Pit1 mRNA was
decreased at PND7 with 0.05 and 0.5 mg/kg/d BPA in (a) males but
not (b) females. (c) However, PIT1 protein was not changed by BPA
or E2 in males by western blot analysis. Prl mRNA was not altered
by BPA but was increased with E2 in (d) males and (e) females. No
difference was seen in Gh mRNA with any treatment in (f) males or
(g) females. Also, no difference in Tshb mRNA with BPA or E2
exposure in (h) males or (i) females was detected. Pit1 mRNA at
5 weeks was not changed in (j) males or (k) females. For quantitative
Figure 3. (Continued). PCR, n = 3 to 6; for PND7 western blot,
n = 3. Circles represent individual mice, and average is represented
by a line.
#
P#0.05.
126 Eckstrum et al Bisphenol A Effects on Postnatal Pituitary Gland Endocrinology, January 2018, 159(1):119–131
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
lineage at PND0 in females (29). We found that the effect
of neonatal exposure to BPA was not similar to the effects
observed with embryonic dosing. Neonatal exposure
demonstrated no substantial change in proliferation or
gonadotropes in either sex. A higher concentration of
50 mg/kg/d BPA and direct stimulation of the neonatal
pituitary also did not regulate Lhb and Fshb mRNA (31),
demonstrating effectively that in the neonatal pituitary,
gonadotropes are less affected by BPA exposure than
during embryogenesis. Many reasons could exist for why
the neonatal period did not respond to BPA the same as
during the embryonic period. Pituitary cell composition
and receptor levels vary during the developmental period
(40–42), which could alter the precise cellular dynamics
leading to these changes. Additionally, the functionality
of the HPG axis during these two periods might play a
role. Development of the HPG axis begins before birth (2)
and is of critical importance to the pituitary, because both
hpg (hypogonadal) mice lacking gonadotropin-releasing
hormone (GnRH) and kisspeptin receptor, GPR54,
knockout mice have lower serum gonadotropin levels at
birth (41, 43). However, after birth, the pituitary does not
respond to GnRH with increased luteinizing hormone
release until 2 weeks of age, despite a high frequency of
GnRH stimulation in the first week of life (44). This
suggests that the pituitary is hyporesponsive to stimuli
during the neonatal period, in contrast to the embryo or
the adult. Perhaps, late during the embryonic period, the
HPG axis and regulation of proliferation and Lhb mRNA
is active; however, after birth, the responsiveness of the
pituitary to GnRH and proliferation signals is decreased,
preventing disruption of Lhb mRNA and proliferation by
BPA during the neonatal period.
Despite an absence of similar changes in the neonatal
and embryonic periods, effects were observed that were
specific to neonatal exposure. The lowest doses of BPA,
within the range of human exposure, decreased Pit1
mRNA in males. To the best of our knowledge, BPA has
not been previously shown to affect Pit1 transcription.
This could be a nonestrogenic action because the
same effect was not seen with E2. However, E2 has
been shown to increase Pit1 mRNA in cell lines and
somatotrope-specific estrogen receptor-aknockout
mice in adults (45). It is possible that regulation of Pit1
mRNA by E2 was not seen in our experiments because
of the neonatal timing. BPA has been shown to bind
different receptors, including the androgen receptor,
estrogen-related receptor, thyroid hormone recep-
tor, peroxisome proliferator-activated receptor, aryl
hydrocarbon receptor, and glucocorticoid receptor
(46, 47). Therefore, it is possible that BPA might be
acting through one of these other receptors to reduce
Pit1 mRNA levels. Despite the decrease in Pit1 mRNA
with low doses of BPA in males, we did not see any effect
on the transcript levels of Prl,Gh,orTshb.Further-
more, we did not find any change in the protein levels of
PIT1, supporting the lack of changes in the transcrip-
tion of genes regulated by PIT1. These data suggest
the pituitary might use compensatory mechanisms to
Figure 4. Pomc mRNA was suppressed by BPA and E2 neonatal
exposure. Tpit mRNA was unchanged by BPA or E2 at PND7 in (a)
males and (b) females. Pomc mRNA was (c) decreased with 0.5 mg/kg/d
BPA and E2 at PND7 in males and (d) decreased with 0.5 mg/kg/d
BPA, 50 mg/kg/d BPA, and E2 in females. POMC protein was
unchanged by BPA in (e) males and (f) females. (g) Pomc mRNA was
not different with treatment at 5 weeks in males. (h) However,
a persistent decrease was seen in females treated with 0.5 mg/kg/d
BPA. For quantitative PCR, n = 3 to 6; for PND7 western blot, n = 3.
Circles represent individual mice, and average of combined sexes is
represented by a line.
#
P#0.05.
doi: 10.1210/en.2017-00565 https://academic.oup.com/endo 127
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
maintain consistent levels of PIT1 in the presence of
BPA exposure.
Neonatal BPA exposure also had striking effects on the
TPIT lineage that were not seen after embryonic dosing.
We observed a decrease in Pomc mRNA in the E2-,
BPA0.5-, and BPA50-exposed females and with BPA0.5
and E2 exposure in males, independent of the Tpit
mRNA changes. E2 exposure via an implanted 0.5-mg
pellet in the adult rat has been shown to reduce Pomc
mRNA in the pituitary, which also leads to decreased
plasma adrenocorticotropic hormone (ACTH) and cor-
ticosterone levels when stressed (48). Seeing the same
suppression of Pomc in the neonate suggests that the
mechanism by which this inhibition occurs is established
early on. However, the precise mechanism is unclear.
BPA50-exposed males did not show a statistically
significant decrease in Pomc mRNA. This represents a
crucial sex difference in Pomc mRNA regulation with
varying amounts of exposure and, potentially, a non-
monotonic dose response in males. Despite this, we did
not see a decrease in intrapituitary POMC protein ex-
pression or cell number. There could be a variety of
explanations, such as increased translation, to compen-
sate for decreased transcription. Alternatively, it could be
that hormone release is also affected,
and intrapituitary POMC levels are
kept consistent. Other studies in rats
have demonstrated the ability of 2 or
40 mg/kg/d BPA to regulate Pomc
mRNA levels and blood ACTH levels
in males compared with females in
response to stress (24, 49), emphasiz-
ing the importance of sex as a variable
in research on the HPA axis.
Of the parameters examined, few
statistically significant effects of BPA
exposure at 5 weeks after neonatal
dosing. A decrease was seen in Nr5a1
in BPA0.05-treated female pituitary
glands at 5 weeks; however, no cor-
responding decrease was seen in Lhb.
Additionally, changes in Pit1 at PND7
were not seen at 5 weeks. However, a
suppression of Pomc in BPA0.5-treated
females was found at 5 weeks, sug-
gesting the possibility of lasting effects
on the stress axis. Despite the relative
lack of changes due to BPA, E2 ex-
posure affected the reproductive axis
of 5-week females, leading to lower
Nr5a1 and Lhb levels and persistent
estrus. Therefore, neonatal E2 expo-
sure might have permanently altered
the HPG axis, which could affect fertility in females.
Although the effects of BPA were minimal on the 5-week
old pituitary gland, it is possible that changes could be
present at different time points. Additionally, these data
highlight that it is vital to examine exposure during
critical windows of development.
The strongest effect of neonatal dosing was a decrease
in Pomc mRNA with both E2 and BPA. Further analysis
demonstrated that this decrease might be a direct effect on
the pituitary itself. Although it has been reported that E2
can regulate Pomc mRNA, conflicting findings have been
reported on the direction and mechanism. In the adult rat
pituitary, E2 decreased Pomc mRNA, leading to de-
creased stress-related ACTH release (48). This effect,
however, might not be due to a direct effect on the pi-
tuitary gland because, in adult anterior pituitary-cultured
cells, E2 treatment did not alter Pomc mRNA expression.
However, in the neurointermediate lobe, E2 treatment
increased Pomc mRNA (50). In contrast, neonatal tes-
tosterone propionate decreased Pomc mRNA in the
adult, and treatment of E2 returned the levels of Pomc
mRNA to normal (51). Pomc is also expressed in the
hypothalamus, and E2 treatment decreases Pomc mRNA
in embryonic hypothalamic cultures (52). Alternatively,
Figure 5. Pomc mRNA was suppressed by BPA and E2 in pituitary cultures. Pomc mRNA was
suppressed by (a) 10
28
M estradiol and (b) 4.4 310
25
M BPA in pituitary explant cultures in
both males and females (E2 males, n = 6 to 10; E2 females, n = 10 to 15; BPA males, n = 9
to 15, BPA females, n = 7 to 14).
#
P#0.05.
128 Eckstrum et al Bisphenol A Effects on Postnatal Pituitary Gland Endocrinology, January 2018, 159(1):119–131
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
in adult mice, E2 increased Pomc mRNA in POMC-
expressing neurons (53). Although different effects of
E2 on Pomc expression have been observed, it is clear
that E2 can regulate Pomc in an age-dependent and sex-
specific manner. The mechanism by which estradiol
regulates Pomc expression is not well understood;
however, in the hypothalamus ESR1 colocalizes with
POMC-expressing neurons (54), suggesting a role for
ESR1. In our studies of the neonatal pituitary gland,
ESR1 and ESR2, together, decreased the levels of Pomc
mRNA in females, but not in males. In contrast, acti-
vation of GPER decreased the levels of Pomc mRNA in
males but not in females. This interesting observation
can be explained by differing levels of estrogen recep-
tors or isoforms of the receptors. In the adult pituitary
gland, estrogen receptor mRNA isoforms are differen-
tially expressed in males and females. In addition, pitu-
itary expression of these isoforms can vary in females
depending onthe stage of the estrous cycle (55). Therefore,
it is possible that differences in receptor expression or
activation during this neonatal period could lead to the
differing pathways for Pomc mRNA downregulation and
should be further explored. However, it seems that
despite the possible differences in the roles of the various
estrogen receptors, it is clear that estrogen stimulation in
the neonatal pituitary leads to decreased Pomc mRNA
expression.
Conclusions
Overall, we found contrasting effects of BPA exposure in
the embryonic vs the neonatal period. This might be
demonstrating that the critical window for proliferation
and gonadotrope regulation is embryonic, and the critical
window for corticotrope regulation is neonatal. After
removal of BPA, minimal statistically significant effects
were seen, potentially demonstrating the plasticity of the
pituitary in regulating itself to maintain the proper cell
number and hormonal signaling. A commonality in both
the embryonic and the neonatal periods was the exis-
tence of sex-specific effects, which could hint at either
baseline differences in male and female pituitary glands
or differences in hormone signaling, both worthy of
further exploration. Finally, in our studies, we began to
explore the mechanism of estrogenic regulation of Pomc
mRNA. We observed that receptor-selective agonists
have sex-specific effects on Pomc gene expression. This
might suggest that BPA can activate different estrogen
receptors in males and females and, therefore, could
be a potential mechanism by which BPA mediates sex-
specific effects.
Acknowledgments
We thank Karen Weis and Liying Gao for technical assistance.
Financial Support: This work was supported by the Na-
tional Institutes of Health (Grant R01 DK076647 to L.T.R.;
Grant P01 ES022848 to J.A.F.; Grant DK015556 to J.A.K.; and
Grant T32 ES007326 to K.S.E. and W.W.). This work was also
supported by the Environmental Protection Agency (Grant RD-
83459301 to J.A.F.) and the Midwest Society of Toxicology
(Young Investigator Award to K.S.E.).
Correspondence: Lori T. Raetzman, PhD, Department
of Molecular and Integrative Physiology, University of Illi-
nois at Urbana-Champaign, 524 Burrill Hall, 407 South
Goodwin Avenue, Urbana, Illinois 61801. E-mail: raetzman@
life.illinois.edu.
Disclosure Summary: The authors have nothing to
disclose.
Figure 6. Pomc mRNA was regulated by various estrogen receptors in a sex-specific manner. (a) ESR1 selective agonist PPT and (b) ESR2 selective
agonist DPN did not affect Pomc mRNA. (c) PPT and DPN showed decreased Pomc mRNA in females. (d) Membrane estrogen signaling agonist,
estrogen dendrimer conjugate (ED), showed no regulation of Pomc mRNA. (e) PPT plus DPN plus ED decreased Pomc mRNA in females. (f) Finally,
the GPER agonist, G1, decreased Pomc mRNA in males. PPT males, n = 11; PPT females, n = 9 to 10; DPN males, n = 9 to 10; DPN females, n =
8; PPT plus DPN males, n = 11; PPT plus DPN females, n = 8 to 10; ED males, n = 10; ED females, n = 9; PPT plus DPN plus ED males, n = 7 to
13; PPT plus DPN plus ED females, n = 9 to 12; G1 males, n = 9 to 10; G1 females, n = 6 to 10.
#
P#0.05.
doi: 10.1210/en.2017-00565 https://academic.oup.com/endo 129
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
References
1. Davis SW, Ellsworth BS, Per´ez Millan MI, Gergics P, Schade V,
Foyouzi N, Brinkmeier ML, Mortensen AH, Camper SA. Pituitary
gland development and disease: from stem cell to hormone pro-
duction. Curr Top Dev Biol. 2013;106:1–47.
2. Pointis G, Mahoudeau JA. Release of immuno-reactive and bi-
ologically active LH from fetal mouse pituitary in response to
synthetic gonadotropin releasing factor (LRF). Experientia. 1976;
32(10):1347–1348.
3. Milkovi´c S, Milkovi´c K, Paunovi´c J. The initiation of fetal adre-
nocorticotrophic activity in the rat. Endocrinology. 1973;92(2):
380–384.
4. Homma T, Sakakibara M, Yamada S, Kinoshita M, Iwata K,
Tomikawa J, Kanazawa T, Matsui H, Takatsu Y, Ohtaki T,
Matsumoto H, Uenoyama Y, Maeda K, Tsukamura H. Significance
of neonatal testicular sex steroids to defeminize anteroventral
periventricular kisspeptin neurons and the GnRH/LH surge system
in male rats. Biol Reprod. 2009;81(6):1216–1225.
5. McCormick CM, Furey BF, Child M, Sawyer MJ, Donohue SM.
Neonatal sex hormones have “organizational”effects on the
hypothalamic-pituitary-adrenal axis of male rats. Brain Res Dev
Brain Res. 1998;105(2):295–307.
6. Shelby MD. NTP-CERHR monograph on the potential human
reproductive and developmental effects of bisphenol A. NTP
CERHR Mon. 2008;7–9(22):1–64 passim.
7. Herbst AL. The current status of the DES-exposed population.
Obstet Gynecol Annu. 1981;10:267–278.
8. Markey CM, Michaelson CL, Veson EC, Sonnenschein C, Soto
AM. The mouse uterotrophic assay: a reevaluation of its validity in
assessing the estrogenicity of bisphenol A. Environ Health Perspect.
2001;109(1):55–60.
9. Markey CM, Wadia PR, Rubin BS, Sonnenschein C, Soto AM.
Long-term effects of fetal exposure to low doses of the xenoestrogen
bisphenol-A in the female mouse genital tract. Biol Reprod. 2005;
72(6):1344–1351.
10. Vandenberg LN, Hauser R, Marcus M, Olea N, Welshons WV.
Human exposure to bisphenol A (BPA). Reprod Toxicol. 2007;
24(2):139–177.
11. Nishihara E, Nagayama Y, Inoue S, Hiroi H, Muramatsu M,
Yamashita S, Koji T. Ontogenetic changes in the expression of
estrogen receptor alpha and beta in rat pituitary gland detected by
immunohistochemistry. Endocrinology. 2000;141(2):615–620.
12. Ogasawara K, Nogami H, Tsuda MC, Gustafsson JA, Korach KS,
Ogawa S, Harigaya T, Hisano S. Hormonal regulation of prolactin
cell development in the fetal pituitary gland of the mouse. Endo-
crinology. 2009;150(2):1061–1068.
13. Hazell GG, Yao ST, Roper JA, Prossnitz ER, O’Carroll AM, Lolait
SJ. Localisation of GPR30, a novel G protein-coupled oestrogen
receptor, suggests multiple functions in rodent brain and peripheral
tissues. J Endocrinol. 2009;202(2):223–236.
14. Mitra SW, Hoskin E, Yudkovitz J, Pear L, Wilkinson HA, Hayashi
S, Pfaff DW, Ogawa S, Rohrer SP, Schaeffer JM, McEwen BS, Alves
SE. Immunolocalization of estrogen receptor beta in the mouse
brain: comparison with estrogen receptor alpha. Endocrinology.
2003;144(5):2055–2067.
15. Merchenthaler I, Lane MV, Numan S, Dellovade TL. Distribution
of estrogen receptor alpha and beta in the mouse central nervous
system: in vivo autoradiographic and immunocytochemical ana-
lyses. J Comp Neurol. 2004;473(2):270–291.
16. Losa-Ward SM, Todd KL, McCaffrey KA, Tsutsui K, Patisaul HB.
Disrupted organization of RFamide pathways in the hypothalamus
is associated with advanced puberty in female rats neonatally ex-
posed to bisphenol A. Biol Reprod. 2012;87(2):28.
17. Monje L, Varayoud J, Mu~
noz-de-Toro M, Luque EH, Ramos JG.
Exposure of neonatal female rats to bisphenol A disrupts hypo-
thalamic LHRH pre-mRNA processing and estrogen receptor alpha
expression in nuclei controlling estrous cyclicity. Reprod Toxicol.
2010;30(4):625–634.
18. Fern´andez M, Bianchi M, Lux-Lantos V, Libertun C. Neonatal
exposure to bisphenol a alters reproductive parameters and
Appendix. Antibody Table
Peptide/Protein
Target
Antigen
Sequence
(if Known) Name of Antibody
Manufacturer,
Catalog No.,
and/or Name of
Individual
Providing
the Antibody
Species Raised in;
Monoclonal or
Polyclonal
Dilution
Used RRID
ACTH Human ACTH
AA 1-24
Polyclonal rabbit
anti-human ACTH
DakoCytomation,
A0571
Rabbit; polyclonal 1:250 No longer
commercially
available
Mouse b-actin NA b-Actin (D6A8)
rabbit mAb
Cell Signaling
Technology,
8457
Rabbit; monoclonal 1:1000 AB_10950489
Chicken a-tubulin NA Mouse anti–a-tubulin
monoclonal antibody,
unconjugated,
clone DM1A
Sigma-Aldrich,
T9026
Mouse; monoclonal 1:5000 AB_477593
Rat PIT1 NA Anti-PIT1 Simon Rhodes Rabbit; polyclonal 1:1000 Not commercially
available
Rat bLH NA Anti-rbLH-IC National Hormone
and Peptide
Program,
Dr. A.F. Parlow
Rabbit; polyclonal 1:1000 AB_2665533
Human
phosphorylated
histone H3
Histone H3 at
serine 10
Anti-phosphorylated
histone H3 (Ser10)
antibody
Millipore Rabbit; polyclonal 1:1000 AB_310177
Abbreviations: AA, amino acid; AB, antibody; LHb, luteinizing hormone-b; mAb, monoclonal antibody; NA, not available; rbLH-IC, rat LH bfor
immunocytochemistry; RRID, Research Resource Identifier.
130 Eckstrum et al Bisphenol A Effects on Postnatal Pituitary Gland Endocrinology, January 2018, 159(1):119–131
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
gonadotropin releasing hormone signaling in female rats. Environ
Health Perspect. 2009;117(5):757–762.
19. Wang W, Hafner KS, Flaws JA. In utero bisphenol A exposure
disrupts germ cell nest breakdown and reduces fertility with age in
the mouse. Toxicol Appl Pharmacol. 2014;276(2):157–164.
20. Howdeshell KL, Hotchkiss AK, Thayer KA, Vandenbergh JG, vom
Saal FS. Exposure to bisphenol A advances puberty. Nature. 1999;
401(6755):763–764.
21. Khurana S, Ranmal S, Ben-Jonathan N. Exposure of newborn male
and female rats to environmental estrogens: delayed and sustained
hyperprolactinemia and alterations in estrogen receptor expression.
Endocrinology. 2000;141(12):4512–4517.
22. Ramirez MC, Bourguignon NS, Bonaventura MM, Lux-Lantos V,
Libertun C, Becu-Villalobos D. Neonatal xenoestrogen exposure
alters growth hormone-dependent liver proteins and genes in adult
female rats. Toxicol Lett. 2012;213(3):325–331.
23. Zoeller RT, Bansal R, Parris C. Bisphenol-A, an environmental con-
taminant that acts as a thyroid hormone receptor antagonist in vitro,
increases serum thyroxine, and alters RC3/neurogranin expression in
the developing rat brain. Endocrinology. 2005;146(2):607–612.
24. Chen F, Zhou L, Bai Y, Zhou R, Chen L. Sex differences in the adult
HPA axis and affective behaviors are altered by perinatal exposure
to a low dose of bisphenol A. Brain Res. 2014;1571:12–24.
25. Patchev VK, Hayashi S, Orikasa C, Almeida OF. Implications of
estrogen-dependent brain organization for gender differences in
hypothalamo-pituitary-adrenal regulation. FASEB J. 1995;9(5):
419–423.
26. Rubin BS, Lenkowski JR, Schaeberle CM, Vandenberg LN,
Ronsheim PM, Soto AM. Evidence of altered brain sexual
differentiation in mice exposed perinatally to low, environmen-
tally relevant levels of bisphenol A. Endocrinology. 2006;147(8):
3681–3691.
27. Cao J, Mickens JA, McCaffrey KA, Leyrer SM, Patisaul HB.
Neonatal Bisphenol A exposure alters sexually dimorphic gene
expression in the postnatal rat hypothalamus. Neurotoxicology.
2012;33(1):23–36.
28. Stahlhut RW, Welshons WV, Swan SH. Bisphenol A data in
NHANES suggest longer than expected half-life, substantial non-
food exposure, or both. Environ Health Perspect. 2009;117(5):
784–789.
29. Brannick KE, Craig ZR, Himes AD, Peretz JR, Wang W, Flaws JA,
Raetzman LT. Prenatal exposure to low doses of bisphenol A in-
creases pituitary proliferation and gonadotroph number in female
mice offspring at birth. Biol Reprod. 2012;87(4):82.
30. Wu YJ, Chen DW, Liu JL, Zhang JH, Luo HS, Cui S. Estradiol
promotes pituitary cell proliferation and gonadotroph differenti-
ation at different doses and with different mechanisms in chick
embryo. Steroids. 2009;74(4-5):441–448.
31. Eckstrum KS, Weis KE, Baur NG, Yoshihara Y, Raetzman LT.
Icam5 expression exhibits sex differences in the neonatal pituitary
and is regulated by estradiol and bisphenol A. Endocrinology.
2016;157(4):1408–1420.
32. Lakind JS, Naiman DQ. Bisphenol A (BPA) daily intakes in the
United States: estimates from the 2003-2004 NHANES urinary
BPA data. J Expo Sci Environ Epidemiol. 2008;18(6):608–615.
33. US Environmental Protection Agency. Health assessment in-
formation on bisphenol A (CASRN 80-05-7). Available at:http://
cfpub.epa.gov/ncea/iris/index.cfm?fuseaction=iris.showQuickview&
substance_nmbr=0356#reforal. First online 1998. Accessed 24
August 2017.
34. Gremeaux L, Fu Q, Chen J, Vankelecom H. Activated phenotype of the
pituitary stem/progenitor cell compartment during the early-postnatal
maturation phase of the gland. Stem Cells Dev. 2012;21(5):801–813.
35. Caligioni CS. Assessing reproductive status/stages in mice. Curr
Protoc Neurosci. 2009;Appendix 4:Appendix 4I.
36. Harrington WR, Kim SH, Funk CC, Madak-Erdogan Z, Schiff R,
Katzenellenbogen JA, Katzenellenbogen BS. Estrogen dendrimer
conjugates that preferentially activate extranuclear, nongenomic
versus genomic pathways of estrogen action. Mol Endocrinol.
2006;20(3):491–502.
37. Kim SH, Katzenellenbogen JA. Hormone-PAMAM dendrimer
conjugates: polymer dynamics and tether structure affect ligand
access to receptors. Angew Chem Int Ed Engl. 2006;45(43):
7243–7248.
38. Nantie LB, Himes AD, Getz DR, Raetzman LT. Notch signaling in
postnatal pituitary expansion: proliferation, progenitors, and cell
specification. Mol Endocrinol. 2014;28(5):731–744.
39. Goldberg LB, Aujla PK, Raetzman LT. Persistent expression of
activated Notch inhibits corticotrope and melanotrope differenti-
ation and results in dysfunction of the HPA axis. Dev Biol. 2011;
358(1):23–32.
40. Yoshimura F, Harumiya K, Kiyama H. Light and electron mi-
croscopic studies of the cytogenesis of anterior pituitary cells in
perinatal rats in reference to the development of target organs. Arch
Histol Jpn. 1970;31(3):333–369.
41. Carbajo-P´erez E, Watanabe YG. Cellular proliferation in the an-
terior pituitary of the rat during the postnatal period. Cell Tissue
Res. 1990;261(2):333–338.
42. Pasqualini C, Guivarc’h D, Boxberg YV, Nothias F, Vincent JD,
Vernier P. Stage- and region-specific expression of estrogen receptor
aisoforms during ontogeny of the pituitary gland. Endocrinology.
1999;140(6):2781–2789.
43. Poling MC, Kauffman AS. Sexually dimorphic testosterone secretion
in prenatal and neonatal mice is independent of kisspeptin-Kiss1r
and GnRH signaling. Endocrinology. 2012;153(2):782–793.
44. Glanowska KM, Burger LL, Moenter SM. Development of
gonadotropin-releasing hormone secretion and pituitary response.
J Neurosci. 2014;34(45):15060–15069.
45. Avtanski D, Novaira HJ, Wu S, Romero CJ, Kineman R, Luque
RM, Wondisford F, Radovick S. Both estrogen receptor aand b
stimulate pituitary GH gene expression. Mol Endocrinol. 2014;
28(1):40–52.
46. Acconcia F, Pallottini V, Marino M. Molecular mechanisms of
action of BPA. Dose Response. 2015;13(4):1559325815610582.
47. Prasanth GK, Divya LM, Sadasivan C. Bisphenol-A can bind to
human glucocorticoid receptor as an agonist: an in silico study.
J Appl Toxicol. 2010;30(8):769–774.
48. Redei E, Li L, Halasz I, McGivern RF, Aird F. Fast glucocorticoid
feedback inhibition of ACTH secretion in the ovariectomized rat:
effect of chronic estrogen and progesterone. Neuroendocrinology.
1994;60(2):113–123.
49. Panagiotidou E, Zerva S, Mitsiou DJ, Alexis MN, Kitraki E.
Perinatal exposure to low-dose bisphenol A affects the neuro-
endocrine stress response in rats. J Endocrinol. 2014;220(3):
207–218.
50. Matsumura R, Takeuchi S, Takahashi S. Effect of estrogen on
melanocortin-3 receptor mRNA expression in mouse pituitary
glands in vivo and in vitro. Neuroendocrinology. 2004;80(3):
143–151.
51. Seale JV, Wood SA, Atkinson HC, Harbuz MS, Lightman SL.
Postnatal masculinization alters the HPA axis phenotype in the
adult female rat. J Physiol. 2005;563(Pt 1):265–274.
52. Gao Y, He JR, Kapcala LP. Estrogen inhibits hypothalamic pro-
opiomelanocortin gene expression in hypothalamic neuronal cul-
tures. Brain Res Dev Brain Res. 1997;45(2):340–344.
53. PelletierG,LiS,Luu-TheV,LabrieF.Oestrogenicregulationofpro-
opiomelanocortin, neuropeptide Y and corticotrophin-releasing hormone
mRNAs in mouse hypothalamus. J Neuroendocrinol.2007;19(6):
426–431.
54. de Souza FSJ, Nasif S, L ´opez-Leal R, Levi DH, Low MJ, Rubinsten M.
The estrogen receptor acolocalizes with proopiomelanocortin in hy-
pothalamic neurons and bin ds to a conserved motif present in the neuron-
specific enhancer nPE2. Eur J Pharmacol. 2011;660(1):181–187.
55. Demay F, Tiffoche C, Thieulant M-L. Sex- and cell-specific ex-
pression of an estrogen receptor isoform in the pituitary gland.
Neuroendocrinology. 1996;63(6):522–529.
doi: 10.1210/en.2017-00565 https://academic.oup.com/endo 131
Downloaded from https://academic.oup.com/endo/article-abstract/159/1/119/4349657 by guest on 19 May 2020
