ArticlePDF Available

Novel deletion alleles of a C. elegans gene Y48E1C.1, named as tm5468, tm5625 and tm5626

Authors:
Sayaka Hori at Nara Women's University
Sayaka Hori
Yuji Suehiro at Tokyo Women's Medical University
Yuji Suehiro
Sawako Yoshina
Sawako Yoshina
Sawako Yoshina
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Shohei Mitani at Tokyo Women's Medical University
Shohei Mitani
Download full-text PDF
Read full-text
Download citation

Abstract

We report tm5468, tm5625 and tm5626 as novel deletion alleles of the gene Y48E1C.1 that is the only ortholog of human calmodulin-lysine N-methyltransferase (CAMKMT)1. CAMKMT encodes an evolutionarily conserved enzyme class I protein methyltransferase that acts in the formation of trimethyllysine in calmodulin for calcium-dependent signaling2. CAMKMT mutation is associated with Hypotonia-cystinuria syndrome in human2,3. The alleles were isolated from the comprehensive screening of gene deletions generated by TMP/UV4. In the screening, all the alleles were detected by nested PCR using the following primer sets, 5’- TCAAGCCACGCCCACACTTA-3’ and 5’- GAAGGCATACAGTGGGGGTA-3’ for the first round PCR and 5’- CGCCCACACTTAATGGTTAT-3’ and 5’- GGGCAGTGTAGGGATACTGT-3’ for the second round PCR. By Sanger sequencing, the 30 bp flanking sequences of the alleles tm5468, tm5625 and tm5626 were identified as AATCCTTCACACACCACAACAGAAATCCTA - [384 bp deletion] -CGAGGTCACGCCCACACATTGGGCGGAGTT, CCGATGCTCCGTGCTGCTCCAAGTGCTCCG - [627 bp deletion + 9 bp insertion (TAATCTTGT)] - AGTACTCCTACAGTATCCCTACACTGCCCC, and AAAAAAGGATGACGTCACAGTTGCTCCGAT - [256 bp deletion] - ACGCCGATTCGGCAGCCGAATGATCTACAG, respectively. Based on the information about the splicing isoforms of Y48E1C.1 (WormBase, http://www.wormbase.org, WS259), the forth exon of Y48E1C.1a, Y48E1C.1b (annotated as non cording RNA) and the second exon of Y48E1C.1d transcripts are deleted in tm5468, tm5625 and tm5626 (Fig. 1). Presumably, all of the alleles do not affect Y48E1C.1c. According to information of protein in Wormbase, this exon contains a predicted some motif, suggesting hypothetical functional deficiency of Y48E1C.1a Y48E1C.1b, and Y48E1C.1d in the deletion mutants. In addition, these alleles are expected to be usable for comparing functions among the isoform c and the other isoforms. However, no visually obvious phenotypes (Let, Unc, and Dpy) were observed in tm5468, tm5625 and tm5626.
Available via license: CC BY
Content may be subject to copyright.
10/03/2017 – Open Access
Novel deletion alleles of a C. elegans gene Y48E1C.1, named
as tm5468, tm5625 and tm5626
Sayaka Hori1, Yuji Suehiro1, Sawako Yoshina1, and Shohei Mitani1
1. Department of Physiology, Tokyo Women’s Medical University School of Medicine, Shinjuku-ku, Tokyo, 162-8666, Japan
Description:
We report tm5468, tm5625 and tm5626 as novel deletion alleles of the gene Y48E1C.1 that is the only ortholog of
human calmodulin-lysine N-methyltransferase (CAMKMT)1. CAMKMT encodes an evolutionarily conserved
enzyme class I protein methyltransferase that acts in the formation of trimethyllysine in calmodulin for calcium-
dependent signaling2. CAMKMT mutation is associated with Hypotonia-cystinuria syndrome in human2,3. The alleles
were isolated from the comprehensive screening of gene deletions generated by TMP/UV4. In the screening, all the
alleles were detected by nested PCR using the following primer sets, 5’- TCAAGCCACGCCCACACTTA-3’ and 5’-
GAAGGCATACAGTGGGGGTA-3’ for the first round PCR and 5’- CGCCCACACTTAATGGTTAT-3’ and 5’-
GGGCAGTGTAGGGATACTGT-3’ for the second round PCR. By Sanger sequencing, the 30 bp flanking sequences
of the alleles tm5468, tm5625 and tm5626 were identified as AATCCTTCACACACCACAACAGAAATCCTA -
[384 bp deletion] -CGAGGTCACGCCCACACATTGGGCGGAGTT,
CCGATGCTCCGTGCTGCTCCAAGTGCTCCG - [627 bp deletion + 9 bp insertion (TAATCTTGT)] -
AGTACTCCTACAGTATCCCTACACTGCCCC, and AAAAAAGGATGACGTCACAGTTGCTCCGAT - [256
bp deletion] - ACGCCGATTCGGCAGCCGAATGATCTACAG, respectively. Based on the information about the
splicing isoforms of Y48E1C.1 (WormBase, http://www.wormbase.org, WS259), the forth exon of Y48E1C.1a,
Y48E1C.1b (annotated as non cording RNA) and the second exon of Y48E1C.1d transcripts are deleted in tm5468,
tm5625 and tm5626 (Fig. 1). Presumably, all of the alleles do not affect Y48E1C.1c. According to information of
protein in Wormbase, this exon contains a predicted some motif, suggesting hypothetical functional deficiency of
Y48E1C.1a Y48E1C.1b, and Y48E1C.1d in the deletion mutants. In addition, these alleles are expected to be usable
for comparing functions among the isoform c and the other isoforms. However, no visually obvious phenotypes (Let,
Unc, and Dpy) were observed in tm5468, tm5625 and tm5626.
Fig. 1 Location of the novel alleles
II Kb
13415 13416 13417 13418 13419 13420 13421 13422 13423 13424 13425
Y48E1C.1c
Y48E1C.1a
Y48E1C.1b
Y48E1C.1d.3
Y48E1C.1d.2
Y48E1C.1d.1
tm5468
tm5625
tm5626
UTR or
Exon of ncRNA CDS
10/03/2017 – Open Access
Reagents
FX05468 Y48E1C.1 (tm5468) II (Not outcrossed)
FX05625 Y48E1C.1 (tm5625) II (Not outcrossed)
FX05626 Y48E1C.1 (tm5626) II (Not outcrossed)
References
Magnani R, Dirk LM, Trievel RC, Houtz RL. Calmodulin methyltransferase is an evolutionarily conserved enzyme
that trimethylates Lys-115 in calmodulin. Nat Commun. 2010;1:43. doi: 10.1038/ncomms1044. PubMed PMID:
20975703.
Magen S, Magnani R, Haziza S, Hershkovitz E, Houtz R, Cambi F, Parvari R. Human calmodulin methyltransferase:
expression, activity on calmodulin, and Hsp90 dependence. PLoS One. 2012;7(12):e52425. doi:
10.1371/journal.pone.0052425. PubMed PMID: 23285036.
Bartholdi D, Asadollahi R, Oneda B, Schmitt-Mechelke T, Tonella P, Baumer A, Rauch A. Further delineation of
genotype-phenotype correlation in homozygous 2p21 deletion syndromes: first description of patients without
cystinuria. Am J Med Genet A. 2013; Aug 161A(8):1853-1859. doi: 10.1002/ajmg.a.35994 PubMed PMID:23794250.
Gengyo-Ando K, Mitani S. Characterization of mutations induced by ethyl methanesulfonate, UV, and
trimethylpsoralen in the nematode Caenorhabditis elegans. Biochem Biophys Res Commun. 2000; Mar 5:269(1):64-
69. doi: 10.1006/bbrc.2000.2260 PubMed PMID: 10694478.
Funding:
National BioResource Project
Reviewed by James Lee
Received 08/30/2017, Accepted 10/03/2017. Available starting WormBase release WS263, Published Online
10/03/2017.
Copyright: © 2017. This is an open-access article distributed under the terms of the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author
and source are credited.
Citation: Hori, S; Suehiro, Y; Yoshina, S; Mitani S. (2017): Novel deletion alleles of a C. elegans gene Y48E1C.1,
named as tm5468, tm5625 and tm5626. Micropublication: biology. Dataset. https://doi.org/10.17912/W2CQ14
ResearchGate has not been able to resolve any citations for this publication.
Human Calmodulin Methyltransferase: Expression, Activity on Calmodulin, and Hsp90 Dependence
Article
Full-text available
Deletion of the first exon of calmodulin-lysine N-methyltransferase (CaM KMT, previously C2orf34) has been reported in two multigene deletion syndromes, but additional studies on the gene have not been reported. Here we show that in the cells from 2p21 deletion patients the loss of CaM KMT expression results in accumulation of hypomethylated calmodulin compared to normal controls, suggesting that CaM KMT is essential for calmodulin methylation and there are no compensatory mechanisms for CaM methylation in humans. We have further studied the expression of this gene at the transcript and protein levels. We have identified 2 additional transcripts in cells of the 2p21 deletion syndrome patients that start from alternative exons positioned outside the deletion region. One of them starts in the 2(nd) known exon, the other in a novel exon. The transcript starting from the novel exon was also identified in a variety of tissues from normal individuals. These new transcripts are not expected to produce proteins. Immunofluorescent localization of tagged CaM KMT in HeLa cells indicates that it is present in both the cytoplasm and nucleus of cells whereas the short isoform is localized to the Golgi apparatus. Using Western blot analysis we show that the CaM KMT protein is broadly expressed in mouse tissues. Finally we demonstrate that the CaM KMT interacts with the middle portion of the Hsp90 molecular chaperon and is probably a client protein since it is degraded upon treatment of cells with the Hsp90 inhibitor geldanamycin. These findings suggest that the CaM KMT is the major, possibly the single, methyltransferase of calmodulin in human cells with a wide tissue distribution and is a novel Hsp90 client protein. Thus our data provides basic information for a gene potentially contributing to the patient phenotype of two contiguous gene deletion syndromes.
View
Further Delineation of Genotype-Phenotype Correlation in Homozygous 2p21 Deletion Syndromes: First Description of Patients Without Cystinuria
Article
  • Aug 2013
  • AM J MED GENET A
Homozygous contiguous gene deletion syndromes are rare. On 2p21, however, several overlapping homozygous gene deletion syndromes have been described, all presenting with cystinuria but otherwise distinct phenotypes. Hypotonia-cystinuria syndrome (HCS, OMIM606407) is characterized by infantile hypotonia, poor feeding, and growth hormone deficiency. Affected individuals carry homozygous deletions including the cystinuria gene SLC3A1 and the adjacent PREPL gene. Larger homozygous deletions in this region encompassing the PPM1B, SLC3A1, PREPL, and C2orf34 (CAMKMT) genes result in a more severe phenotype, the 2p21 deletion syndrome. A phenotype intermediate to HCS and the 2p21 deletion syndrome is termed atypical HCS and is caused by deletion of SLC3A1, PREPL, and C2orf34 (CAMKMT). Using high resolution SNP array molecular karyotyping we identified two siblings with a homozygous deletion of 83 kb partially encompassing the genes PREPL and C2orf34 (CAMKMT), but not the SLC3A1 gene. The affected siblings display a recognizable phenotype which is similar to atypical HCS with regard to growth failure and neuro-muscular features, but is characterized by lack of cystinuria. The patients also exhibit features which have not been reported to date such as cleft palate and genital abnormalities. In conclusion, we report the first patients with a homozygous 2p21 deletion syndrome without cystinuria and further delineate the complex genotype-phenotype correlations of homozygous microdeletion syndromes of this region. © 2013 Wiley Periodicals, Inc.
View
Calmodulin methyltransferase is an evolutionarily conserved enzyme that trimethylates Lys-115 in calmodulin
Article
  • Jul 2010
Calmodulin (CaM) is a key mediator of calcium-dependent signalling and is subject to regulatory post-translational modifications, including trimethylation of Lys-115. In this paper, we identify a class I, non-SET domain protein methyltransferase, calmodulin-lysine N-methyltransferase (EC 2.1.1.60). A polypeptide chosen from a fraction enriched in calmodulin methyltransferase activity was trypsinized and analysed by tandem mass spectrometry. The amino-acid sequence obtained identified conserved, homologous proteins of unknown function across a wide range of species, thus implicating a broad role for lysine methylation in calcium-dependent signalling. Encoded by c2orf34, the human homologue is a component of two related multigene deletion syndromes in humans. Human, rat, frog, insect and plant homologues were cloned and Escherichia coli-recombinant proteins catalysed the formation of a trimethyllysyl residue at position 115 in CaM, as verified by product analyses and mass spectrometry.
View
Characterization of Mutations Induced by Ethyl Methanesulfonate, UV, and Trimethylpsoralen in the Nematode Caenorhabditis elegans
Article
  • Apr 2000
The genome project of the nematode Caenorhabditis elegans is completed. It is important and useful to disrupt nematode genes to know their function. We treated wild-type animals with potential candidates for mutagens for reverse genetics, EMS (ethyl methanesulfonate), short-wavelength UV, and long-wavelength UV in the presence of TMP (trimethylpsoralen). We estimated forward mutation rates by counting the occurrence of a marker unc-22 mutation. We found that the forward mutation rate by TMP/UV could be comparable with EMS by improving the frequency one order higher than before. We next isolated mutants of another marker gene ben-1 and examined the probability for the deletion mutations by PCR and sequencing. Deletion mutations were found only by TMP/UV method, which suggested TMP/UV is the choice for deletion mutagenesis among these methods. As a pilot experiment, we could isolate actual deletion mutations at a much higher frequency than previously.
View