ArticlePDF Available

Novel deletion alleles of a C. elegans gene Y73E7A.1, named as tm6429 and tm6475

Authors:
Sayaka Hori at Nara Women's University
Sayaka Hori
Yuji Suehiro at Tokyo Women's Medical University
Yuji Suehiro
Sawako Yoshina
Sawako Yoshina
Sawako Yoshina
  • This person is not on ResearchGate, or hasn't claimed this research yet.
S Hori
S Hori
S Hori
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Show all 5 authorsHide
Download full-text PDF
Read full-text
Download citation

Abstract and Figures

We report tm6429 and tm6475 as novel deletion alleles of the gene Y73E7A.1 that is a homologue of mammalian Coiled-coil domain containing 124 (Ccdc124)1. The Ccdc124 is a conserved gene from invertebrates to human. In human cell lines, Ccdc124 is a component of the centrosome during interphase and at the G2/M transition. During cell division, Ccdc124 relocates to the midbody at telophase and acts as an essential molecular component in cytokinesis2. The alleles were isolated from the comprehensive screening of gene deletions generated by TMP/UV3. In the screening, both the alleles were detected by nested PCR using the following primer sets, 5’-GTGTGAATCGAGGAGGCGCA-3’ and 5’-TTTCCAGTCCGGCAGGCGAT-3’ for first round PCR and 5’- AACGGCAAACGCGCTCTATG-3’ and 5’- CGTGTGCACGTGGAAGTCCA-3’ for second round PCR. By Sanger sequencing, the 30bp flanking sequences of the alleles tm6429 and tm6475 were identified as TTTTAAATCGATTTTTGAGCACCAAAATTA- [355 bp deletion + 1 bp insertion (T)] – TTAAAAATGAGAAAAAATGGGGAAAAAATT and CAAACGCGCTCTATGGAGAATGTGGAATTA- [242 bp deletion] - TTTTATATAGGATTTTAATTTTCAGGCCAC, respectively. Based on the information about the splicing isoforms of Y73E7A.1 (WormBase, http://www.wormbase.org, WS259), the start codon of Y73E7A.1a and Y73E7A.1b transcripts are deleted in tm6429 and tm6475, respectively (Fig. 1), suggesting that those alleles may be usable for the analysis of isoform specific function.
Figures - available via license: CC BY
Content may be subject to copyright.
Available via license: CC BY
Content may be subject to copyright.
10/03/2017 – Open Access
Novel deletion alleles of a C. elegans gene Y73E7A.1, named
as tm6429 and tm6475
Yuji Suehiro1, Sawako Yoshina1, Sayaka Hori1 and Shohei Mitani1
1. Department of physiology, School of Medicine, Tokyo Women’s Medical University, Shinjuku-ku, Tokyo, 162-8666, Japan
Description:
We report tm6429 and tm6475 as novel deletion alleles of the gene Y73E7A.1 that is a homologue of mammalian
Coiled-coil domain containing 124 (Ccdc124)1. The Ccdc124 is a conserved gene from invertebrates to human. In
human cell lines, Ccdc124 is a component of the centrosome during interphase and at the G2/M transition. During cell
division, Ccdc124 relocates to the midbody at telophase and acts as an essential molecular component in cytokinesis2.
The alleles were isolated from the comprehensive screening of gene deletions generated by TMP/UV3. In the
screening, both the alleles were detected by nested PCR using the following primer sets, 5’-
GTGTGAATCGAGGAGGCGCA-3’ and 5’-TTTCCAGTCCGGCAGGCGAT-3’ for first round PCR and 5’-
AACGGCAAACGCGCTCTATG-3’ and 5’- CGTGTGCACGTGGAAGTCCA-3’ for second round PCR. By Sanger
sequencing, the 30bp flanking sequences of the alleles tm6429 and tm6475 were identified as
TTTTAAATCGATTTTTGAGCACCAAAATTA- [355 bp deletion + 1 bp insertion (T)] –
TTAAAAATGAGAAAAAATGGGGAAAAAATT and CAAACGCGCTCTATGGAGAATGTGGAATTA- [242
bp deletion] - TTTTATATAGGATTTTAATTTTCAGGCCAC, respectively. Based on the information about the
splicing isoforms of Y73E7A.1 (WormBase, http://www.wormbase.org, WS259), the start codon of Y73E7A.1a and
Y73E7A.1b transcripts are deleted in tm6429 and tm6475, respectively (Fig. 1), suggesting that those alleles may be
usable for the analysis of isoform specific function.
Reagents
FX06429 Y73E7A.1 (tm6429) I (Not outcrossed)
FX06475 Y73E7A.1 (tm6475) I (Not outcrossed)
Fig. 1 Location of the novel alleles
References
Shaye DD, Greenwald I. OrthoList: a compendium of C. elegans genes with human orthologs. PLoS One.
2011;6(5):e20085. doi: 10.1371/journal.pone.0020085. Epub 2011 May 25. PubMed PMID:21647448.
Telkoparan P, Erkek S, Yaman E, Alotaibi H, Bayık D, Tazebay UH. Coiled-coil domain containing protein 124 is a
novel centrosome and midbody protein that interacts with the Ras-guanine nucleotide exchange factor 1B and is
involved in cytokinesis. PLoS One. 2013 Jul 19;8(7):e69289. doi: 10.1371/journal.pone.0069289. PMID: 23894443.
10/03/2017 – Open Access
Gengyo-Ando K, Mitani S. Characterization of mutations induced by ethyl methanesulfonate, UV, and
trimethylpsoralen in the nematode Caenorhabditis elegans. Biochem Biophys Res Commun. 2000 Mar 5;269(1):64-
9. doi:10.1006/bbrc.2000.2260. PubMed PMID:10694478.
Funding:
National BioResource Project
Reviewed by Pei-Yin Shih
Received 08/30/2017, Accepted 10/03/2017. Available starting WormBase release WS263, Published Online
10/03/2017.
Copyright: © 2017. This is an open-access article distributed under the terms of the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author
and source are credited.
Citation: Suehiro, Y; Yoshina, S; Hori, S; Mitani, S. (2017): Novel deletion alleles of a C. elegans gene Y73E7A.1,
named as tm6429 and tm6475. Micropublication: biology. Dataset. https://doi.org/10.17912/W2808M
ResearchGate has not been able to resolve any citations for this publication.
Coiled-Coil Domain Containing Protein 124 Is a Novel Centrosome and Midbody Protein That Interacts with the Ras-Guanine Nucleotide Exchange Factor 1B and Is Involved in Cytokinesis
Article
Full-text available
Cytokinetic abscission is the cellular process leading to physical separation of two postmitotic sister cells by severing the intercellular bridge. The most noticeable structural component of the intercellular bridge is a transient organelle termed as midbody, localized at a central region marking the site of abscission. Despite its major role in completion of cytokinesis, our understanding of spatiotemporal regulation of midbody assembly is limited. Here, we report the first characterization of coiled-coil domain-containing protein-124 (Ccdc124), a eukaryotic protein conserved from fungi-to-man, which we identified as a novel centrosomal and midbody protein. Knockdown of Ccdc124 in human HeLa cells leads to accumulation of enlarged and multinucleated cells; however, centrosome maturation was not affected. We found that Ccdc124 interacts with the Ras-guanine nucleotide exchange factor 1B (RasGEF1B), establishing a functional link between cytokinesis and activation of localized Rap2 signaling at the midbody. Our data indicate that Ccdc124 is a novel factor operating both for proper progression of late cytokinetic stages in eukaryotes, and for establishment of Rap2 signaling dependent cellular functions proximal to the abscission site.
View
OrthoList: A Compendium of C. elegans Genes with Human Orthologs
Article
Full-text available
C. elegans is an important model for genetic studies relevant to human biology and disease. We sought to assess the orthology between C. elegans and human genes to understand better the relationship between their genomes and to generate a compelling list of candidates to streamline RNAi-based screens in this model. We performed a meta-analysis of results from four orthology prediction programs and generated a compendium, "OrthoList", containing 7,663 C. elegans protein-coding genes. Various assessments indicate that OrthoList has extensive coverage with low false-positive and false-negative rates. Part of this evaluation examined the conservation of components of the receptor tyrosine kinase, Notch, Wnt, TGF-ß and insulin signaling pathways, and led us to update compendia of conserved C. elegans kinases, nuclear hormone receptors, F-box proteins, and transcription factors. Comparison with two published genome-wide RNAi screens indicated that virtually all of the conserved hits would have been obtained had just the OrthoList set (∼38% of the genome) been targeted. We compiled Ortholist by InterPro domains and Gene Ontology annotation, making it easy to identify C. elegans orthologs of human disease genes for potential functional analysis. We anticipate that OrthoList will be of considerable utility to C. elegans researchers for streamlining RNAi screens, by focusing on genes with apparent human orthologs, thus reducing screening effort by ∼60%. Moreover, we find that OrthoList provides a useful basis for annotating orthology and reveals more C. elegans orthologs of human genes in various functional groups, such as transcription factors, than previously described.
View
Characterization of Mutations Induced by Ethyl Methanesulfonate, UV, and Trimethylpsoralen in the Nematode Caenorhabditis elegans
Article
  • Apr 2000
The genome project of the nematode Caenorhabditis elegans is completed. It is important and useful to disrupt nematode genes to know their function. We treated wild-type animals with potential candidates for mutagens for reverse genetics, EMS (ethyl methanesulfonate), short-wavelength UV, and long-wavelength UV in the presence of TMP (trimethylpsoralen). We estimated forward mutation rates by counting the occurrence of a marker unc-22 mutation. We found that the forward mutation rate by TMP/UV could be comparable with EMS by improving the frequency one order higher than before. We next isolated mutants of another marker gene ben-1 and examined the probability for the deletion mutations by PCR and sequencing. Deletion mutations were found only by TMP/UV method, which suggested TMP/UV is the choice for deletion mutagenesis among these methods. As a pilot experiment, we could isolate actual deletion mutations at a much higher frequency than previously.
View