Content uploaded by Qixing Zhou
Author content
All content in this area was uploaded by Qixing Zhou on Nov 21, 2018
Content may be subject to copyright.
Full Terms & Conditions of access and use can be found at
http://www.tandfonline.com/action/journalInformation?journalCode=tcjp20
Download by: [Alberta Government Library] Date: 02 October 2017, At: 07:52
Canadian Journal of Plant Pathology
ISSN: 0706-0661 (Print) 1715-2992 (Online) Journal homepage: http://www.tandfonline.com/loi/tcjp20
First report of Verticillium dahliae Kleb. causing
wilt symptoms in canola (Brassica napus L.) in
North America
Sheau-Fang Hwang, Stephen E. Strelkov, Hafiz U. Ahmed, Qixing Zhou,
Heting Fu, Rudolph Fredua-Agyeman & George D. Turnbull
To cite this article: Sheau-Fang Hwang, Stephen E. Strelkov, Hafiz U. Ahmed, Qixing Zhou,
Heting Fu, Rudolph Fredua-Agyeman & George D. Turnbull (2017): First report of Verticillium
dahliae Kleb. causing wilt symptoms in canola (Brassica napus L.) in North America, Canadian
Journal of Plant Pathology, DOI: 10.1080/07060661.2017.1375996
To link to this article: http://dx.doi.org/10.1080/07060661.2017.1375996
Accepted author version posted online: 06
Sep 2017.
Published online: 25 Sep 2017.
Submit your article to this journal
Article views: 52
View related articles
View Crossmark data
Soilborne pathogens/Agents pathogènes telluriques
First report of Verticillium dahliae Kleb. causing wilt symptoms in
canola (Brassica napus L.) in North America
SHEAU-FANG HWANG
1
, STEPHEN E. STRELKOV
2
, HAFIZ U. AHMED
1
, QIXING ZHOU
1
, HETING FU
1
,
RUDOLPH FREDUA-AGYEMAN
1
AND GEORGE D. TURNBULL
1
1
Crop Diversification Centre North, Alberta Agriculture and Forestry, Edmonton AB T5Y 6H3, Canada
2
Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton AB T6G 2P5, Canada
(Accepted 1 September 2017)
Abstract: In Canada, Verticillium wilt of canola (Brassica napus L.), caused by Verticillium longisporum, was first confirmed in Manitoba in
2014. Verticillium dahliae, however, has not been reported to cause this disease. In 2016, a field survey in Alberta revealed canola plants with
vascular wilt symptoms. Symptomatic plants were collected and infected stem tissue was cultured on agar medium, with one isolate designated
A1-SS05 identified as a putative Verticillium spp. based on its colony characteristics. The colony was off-white in colour with a felt-like
surface. On potato dextrose agar, the underside of the colony was dark only in the central area with radiating ridges. On Howell’s medium,
only the test isolate exhibited polyphenol oxidase activity. The isolate formed conidiophores with 4–5 verticillate phialides. Mean conidial
length was 5.96 µm (range of 4.65–6.64 µm) and mean width was 2.37 µm (range of 1.71–2.79 µm). The isolate also produced irregularly
elongated chain-like microsclerotia of various sizes. Based on these criteria, isolate A1-SS05 was tentatively identified as V. dahliae.
Sequencing of PCR products amplified with the primer sets ITS5/4 and VeruniF2/VeruniR3 revealed 99 and 100% identity, respectively, with
V. dahliae sequences in GenBank, confirming the identity of this isolate. The isolate was pathogenic on the canola cultivar ‘Westar’, causing
wilt symptoms, stunting, and leaf yellowing and senescence. Microscopic analysis of infected vascular tissues revealed irregular shaped
microsclerotia, as were observed in pure culture. This is the first report of V. dahliae causing Verticillium wilt of canola in North America.
Keywords: Brassica napus, canola, Verticillium longisporum,V. dahliae, Verticillium wilt
Résumé: Au Canada, l’apparition de la flétrissure verticillienne du canola (Brassica napus L.), causée par Verticillium longisporum, a été
initialement confirmée au Manitoba en 2014. Par ailleurs, on n’a jamais rapporté que Verticillium dahliae causait cette maladie. En 2016, une
étude menée sur le terrain en Alberta a permis de détecter des plants de canola affichant des symptômes de flétrissure vasculaire. Des plants
symptomatiques ont été collectés, puis les tissus infectés des tiges ont été cultivés sur agar, ce qui a permis d’identifier, en se basant sur les
caractéristiques de la colonie, un isolat putatif de Verticillium spp. désigné A1-SS05. La colonie était blanc cassé et sa surface ressemblait à du
feutre. Sur de la gélose dextrosée à la pomme de terre, en dessous, la colonie déployait des crêtes, mais elle était foncée seulement en son
centre. Sur milieu Howell, seul l’isolat d’essai a affiché une activité polyphénol-oxydase. L’isolat a produit des conidiophores comportant 4 ou
5 phialides verticillées. La longueur moyenne des conidies était de 5,96 µm (écart de 4.65 à 6.64 µm) et leur largeur moyenne était de 2.37 µm
(écart de 1.71 à 2.79 µm). L’isolat a également produit des microsclérotes en forme de chaînes de longueurs différentes, irrégulièrement
allongées. En se basant sur ces critères, l’isolat A1-SS05 a été provisoirement identifié en tant que V. dahliae. Le séquençage des produits de la
PCR amplifiés avec les jeux d’amorces ITS5/4 et VeruniF2/VeruniR3 a révélé une similitude de 99% et de 100%, respectivement, avec les
séquences de V. dahliae de la GenBank, confirmant l’identité de l’isolat. L’isolat était virulent à l’égard du cultivar de canola ‘Westar’, causant
des symptômes de flétrissure, de rabougrissement, de jaunissement des feuilles et de sénescence. L’analyse microscopique des tissus
vasculaires infectés a révélé des microsclérotes de forme irrégulière, comme ceux de la culture pure. Il s’agit de la première mention de V.
dahliae causant la flétrissure verticillienne chez le canola en Amérique du Nord.
Correspondence to: Stephen E. Strelkov. E-mail: stephen.strelkov@ualberta.ca
Can. J. Plant Pathol., 2017
https://doi.org/10.1080/07060661.2017.1375996
© 2017 The Canadian Phytopathological Society
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
Mots clés: Brassica napus, canola, flétrissure verticillienne, Verticillium longisporum,V. dahliae
Introduction
Canola or oilseed rape (Brassica napus L.) is one of the
major oilseed crops grown worldwide. In Canada, there
are several major diseases associated with canola produc-
tion. These include clubroot (Plasmodiophora brassicae
Woronin), blackleg (Leptosphaeria maculans (Desm.)
Ces. & de Not. (anamorph Phoma lingam Tode ex Fr.)),
Sclerotinia stem rot (Sclerotinia sclerotiorum (Lib.) de
Bary), and the seedling blight/root rot complex
(Fusarium spp., Pythium spp. and Rhizoctonia solani
Kühn) (Bailey et al. 2003; Rempel et al. 2014).
Vascular wilt diseases caused by soil-borne pathogens
are among the most devastating plant diseases worldwide
(Tjamos & Beckman 1989). In Canada, vascular wilt
caused by F. avenaceum (Fr.) Sacc. and F. oxysporum
Schlecht. emend. Snyder & Hansen was reported to occur
on canola in the Peace River and north-east agricultural
regions of Alberta, as well as in Manitoba (Bailey et al.
2003; Canola Council of Canada 2016a). Verticillium wilt
caused by Verticillium dahliae Kleb. and V. albo-atrum
Reinke & Beth is a major constraint to potato (Solanum
tuberosum L.) and sunflower (Helianthus annuus L.)
production in Manitoba (Rashid et al. 2006,2015;
Alkher et al. 2009a).
Verticillium wilt of oilseed rape, caused by Verticillium
longisporum (C. Stark) Karapapa, Bainbr. & Heale, has
been reported in Sweden, Germany, France and Poland
(Sadowski et al. 1995; Zielinski & Sadowski 1995;
Karapapa et al. 1997; Zeise & von Tiedemann 2002;
Dixelius et al. 2005), and Japan (Eastburn & Paul
2007). In Canada, canola plants showing symptoms con-
sistent with infection by Verticillium spp. were first
observed in Manitoba in 2014, and the pathogen also
was detected in canola stubble collected from British
Columbia, Alberta, Saskatchewan, Manitoba, Ontario
and Quebec by the Canadian Food Inspection Agency
(CFIA) in 2015 (CFIA, 2016; Canola Council of Canada
2016b). Using molecular diagnostics, the causal agent of
the symptoms was identified as V. longisporum. There
are, however, no records of field-grown canola plants
with symptoms of Verticillium wilt in Canada.
Currently, there is still some disagreement regarding
the validity of V. longisporum as a separate species
(Fahleson et al. 2004), because Verticillium isolates with
shorter spores also can infect crucifers (Collins et al.
2003), while long-spored V. longisporum isolates can
infect plant species outside the Brassicaceae family
(Fahleson et al. 2004). For specific detection of V. dahliae
and V. longisporum, the primer sets VDS1/VDS2 (Li
et al.1999), VaF1/VaR1 (Banno et al. 2011), VlspF1/
VlspR4 (Banno et al. 2011), VeruniF2/VeruniR3 (Ikeda
et al. 2012) and VTA2F/VTA2R (Tran et al. 2013) were
utilized. With these primers, V. dahliae and V. longis-
porum could be distinguished based upon the size of the
amplicons obtained. Thus far, however, none of these
primers are single species-specific.
The increasing prevalence of Verticillium wilt in cru-
ciferous vegetables, and the recent identification of symp-
toms resembling Verticillium wilt on canola in Canada,
has sparked concern among Canadian growers of this
crop, since the potential for economic losses could be
high. During a field survey conducted in Alberta in
August 2016, patches of plants showing symptoms of
wilting were observed in a canola crop near Morinville.
The objective of this study was to determine the identity
of the pathogen causing this wilt.
Materials and methods
Sample collection and pathogen isolation
During a field survey conducted in Alberta in August
2016, patches of plants showing symptoms of wilting
reminiscent of Verticillium wilt were observed in a canola
crop near Morinville. This crop was grown on a field that
had been planted to alfalfa from 2010–2012, wheat in
2013, canola in 2014, and wheat and canola again in
2015 and 2016, respectively. Plants at the flowering to
pod development stages displaying wilting (Fig. 1) were
collected and examined for the possible causes of the
symptoms, and the associated pathogens were isolated.
Root and stem sections (1–2 cm long) were cut and
peeled. The sections were surface-sterilized by soaking
in a 5.25% NaOCl (full strength commercial bleach)
solution for 1 min, followed by soaking in 95% ethanol
for 2 min. Each surface-sterilized section was then rinsed
three times in sterile distilled water (SDW). The tissue
sections were blotted with sterilized blotter paper, placed
on water agar (WA) containing 50 ppm streptomycin
sulphate, and incubated at 22°C ± 2°C under darkness.
The plates were examined weekly for 4 weeks. The
emerging fungal colonies were transferred onto potato
dextrose agar (PDA) for identification. Fungal colonies
were purified by single-spore culturing. Eight single-
spore isolates (A1-SS18, A1-SS54, A1-SS28, A1-SS01,
A1-SS05, A1-SS21, A1-SS06 and A1-SS11) were
obtained. For comparative purposes, diseased canola
S.-F. Hwang et al.2
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
stubble received from Manitoba and known to be infected
with V. longisporum was also used to isolate V. long-
isporum in pure culture (single-spore isolate VL-MB)
following the same procedure. A single-spore isolate of
V. dahliae (isolate E W27T
1
-2) was received from the
Department of Agricultural, Food and Nutritional
Science, University of Alberta (J.P. Tewari collection),
for use as a reference isolate. The isolates were stored
on PDA slants at 4°C for later use.
Identification of isolates
Morphological criteria. For morphological characteriza-
tion, a representative isolate from canola, A1-SS05, was
grown on PDA in Petri dishes maintained at 25°C under
darkness for 20 days. The isolate was identified based on
colony morphology, the size of the conidia, shape of the
microsclerotia, and number of phialides (Hawksworth &
Talboys 1970; Karapapa et al. 1997; Steventon et al.
2002). To determine the size of the conidia, 50 conidia
from 14-day-old cultures were measured with a micro-
meter under the microscope.
Polyphenol oxidase activity. The polyphenol oxidase
activity of isolates A1-SS05 and VL-MB, representing
V. dahliae and V. longisporum, respectively, were
assessed on Howell’s medium (5.0 g sucrose, 5.0 g
Bacto peptone, 3.0 g Bacto yeast extract, 1.36 g of
KH
2
PO
4
, 1.38 g of K
2
HPO
4
, 0.5 g MgSO
4
_7H
2
O,
20.0 g agar and 1.0 L distilled water) containing 1%
tannic acid (Eckert 1962; Howell 1970). Mycelial agar
plugs (9 mm diameter) were cut with a cork borer from
the margins of 3-week old fungal cultures, placed on the
medium and incubated at 25°C in the dark for 10 days.
The production of a dark zone around the mycelial plug
indicated that polyphenol oxidase activity was present.
DNA extraction, PCR amplification and sequencing
From diseased tissue samples. Canola stems showing
symptoms characteristic of Verticillium wilt were cut
vertically and the darker areas containing microsclerotia
were cut into small pieces (2 mm in length). The pieces
were used for DNA extraction using a 2% CTAB method
(Doyle & Doyle 1987). The DNA concentration and
quality were estimated with a NanoDrop 1000
Spectrophotometer (Thermo Scientific, Wilmington, DE).
From growing cultures. Prior to DNA extraction, eight
putative V. dahliae isolates, one isolate of V. longisporum
(VL-MB), and one reference isolate of V. dahliae were
cultured in Difco potato-dextrose broth (PDB) (BD
Diagnostic Systems, Franklin Lakes, NJ) with no shaking
for 7 days at room temperature (20°C ± 2°C) under
constant light. Approximately 25 mg of mycelium was
collected from each isolate for genomic DNA extraction
using the modified rapid mini-preparation method of
Feng et al. (2010). The concentration and quality of the
DNA was estimated as described above.
PCR amplification, sequencing and identification of
species
The internal transcribed spacers (ITS) were amplified by
PCR using the primer sets ITS5/ITS4 (White et al.
1990). In addition, PCR amplification with the primer
sets VaF1/VaR1, VlspF1/VlspR4 (Banno et al. 2011)
and VeruniF2/VeruniR3 (Ikeda et al. 2012)(Tab le 1)
was conducted in a total reaction volume of 25 µL.
The reaction mixture contained EconoTaq® Plus 2X
Master Mix (Lucigen, Middleton, WI), 0.5 µM of each
primer, and 20 ng of genomic DNA. The PCR amplifi-
cation conditions were set as follows: 5 min at 95°C
followed by 35 cycles at 94°C for 60 s or 30 s at 50°C
(Tab le 1), and 60 s at 72°C with a final extension of
10 min at 72°C. The amplicons were mixed with a Safe-
Red loading dye (Applied Biological Materials,
Richmond, BC) and separated on a 1.0% agarose gel
in 1× Tris-acetate-EDTA (TAE) buffer at 100 V for 2 h.
The gels were visualized under UV light with a Gel Doc
XR System (BIO-RAD, Columbus OH).
PCR products amplified from the putative V. dahliae
isolates were purified with a Wizard® SV Gel and PCR
Clean-Up System (Promega, Madison, WI). All purified
amplicons were sequenced directly at the University of
Alberta, Molecular Biology Service Unit (Edmonton,
AB). The DNA sequences were compared with entries
in the National Center for Biotechnology Information
(NCBI) database (http://www.ncbi.nlm.nih.gov) using
the batch BLAST program hosted at Greengenes (http://
greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi).
Table 1. Primers used in the present study.
Primer Sequence (5ʹ-3ʹ) Reference
ITS5 GGAAGTAAAAGTCGTAACAAGG White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC
VaF1 CCGCCGGTACATCAGTCTCTTTA Banno et al. (2011)
VaR1 GGGACTCCGATGCGAGCTGTAAT
VlspF1 AGCCTGAGTCACGAGAGATATGGG Banno et al. (2011)
VlspR4 CAAACCACGCCACTGCATTCTCGT
VeruniF2 TCGTAGTAGAAGCTCGGCCTCCGGTC Ikeda et al. (2012)
VeruniR3 TAAGAAGTCGGCGTACTACCGGGGT
Verticillium wilt on canola in Alberta 3
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
Pathogenicity tests
Pathogenicity testing was conducted with the canola V.
dahliae single-spore isolate A1-SS05 under greenhouse
conditions. The isolate was grown in shake-culture in
PDB at 25°C in darkness for 7 days. A conidial suspen-
sion was obtained from a 7-day-old culture by filtration
through 4 layers of gauze, the spore concentration was
measured with a hemocytometer and adjusted to
~1 × 10
6
conidia mL
−1
. Seedlings of canola ‘Westar ’
were grown in sand (Target Products Ltd, Calgary, AB).
Seven days after seeding, the seedlings were uprooted,
any remaining sand was washed away with tap water,
the roots were soaked in the conidial suspension for
1 min, and transplanted into a fresh cup (10.5-cm
diam. with five holes at the bottom) filled with PGX
soil mix (Premier Horticulture, Riviêre du Loup, QC).
Thirty seedlings were inoculated and transplanted at a
density of five plants per cup, with six replicates, and
grown in a greenhouse maintained at 25°C ± 5°C with
16/8 h light/dark periods. An uninoculated control also
was included. The experiment was set up in a rando-
mized complete block design with six replications. Data
on plant height and disease incidence were recorded
21 days after transplanting. The plants showing disease
symptoms were used to re-isolate the pathogen and its
identity was confirmed based on morphological charac-
teristics and PCR analysis with the primer sets men-
tioned above. The experiment was repeated once. Data
sets were tested for homogeneity of variance using a
normal probability plot. A paired t-test was used to
compare the means of inoculated treatments with the
non-inoculated control.
Results
Disease symptoms
The naturally infected, field-collected canola plants
showed a variety of symptoms, including wilting with
drooping at the top of the plant, leaf yellowing, defolia-
tion and deformation of pods at the late flowering stage
(Fig. 1a, b). Close stereo-microscopic observation
revealed the presence of black stripes or discolourations
on the infected stems (Fig. 2a); brownish discolourations
of the pith at the early stage of infection (Fig. 2b); and
later, complete colonization of the pith with the formation
of microsclerotia (Fig. 2c). Germination of microsclerotia
within the epidermis of the stem also was observed,
which produced conidia externally on conidiophores
(Fig. 2d) and gave a powdery appearance to the stem
surface (Fig. 2e).
Species identification
Morphological criteria. The morphological and cultural
characteristics of Verticillium isolate A1-SS05 obtained
from diseased canola tissue are shown in Fig. 3(a, b).
Colonies on PDA after 14 days of incubation were off-
white with a felt-like surface, and the underside was
dark only in the central area, with radiating ridges. In
contrast, V. longisporum (VL-MB) produced greyish-
velvety colonies with cream-coloured margins
(Fig. 3c), and the underside of the colony was dark
with a light-cream margin (Fig. 3d). On Howell’smed-
ium, isolate A1-SS05 formed a dark zone around the
mycelial plug, indicating extracellular polyphenol
Fig. 1 (Colour online) (a) Symptoms of Verticillium wilt on naturally infected canola plants under field conditions, Morinville, Alberta, 2016;
(b) Comparison of healthy (left) and Verticillium wilt affected (right) plants, which show leaf yellowing, defoliation and deformation of pods at
the late flowering stage.
S.-F. Hwang et al.4
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
Fig. 2 (Colour online) Symptoms of Verticillium wilt on canola stems. (a) Vertical black stripe or discolouration on the outside of the stem; (b)
Early stage of pith infection with a brown discolouration even when exterior of the plant is green; (c) Pith fully colonized by the pathogen,
producing black microsclerotia; (d, e) Germination of the microsclerotia on the epidermis, producing conidia externally on conidiophores,
which give a powdery appearance on the stem surface, as described by Heale & Karapapa (1999).
Fig. 3 (Colour online) Cultural characteristics of Verticillium isolates. (a, b) Verticillium dahliae, front view (a) and underside view (b); (c, d)
Verticillium longisporum, front view (c) and underside view (d). Cultures were grown on potato dextrose agar for 14 days; (e) V. dahliae on
Howell’s medium with tannic acid, showing a dark zone around the mycelial plug, indicating extracellular polyphenol oxidase activity; (f) V.
longisporum without a zone. The photos on Howell’s medium were taken 12 days after plating.
Verticillium wilt on canola in Alberta 5
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
oxidase activity (Fig. 3e). In contrast, V. longisporum
did not appear to possess polyphenol oxidase activity
(Fig. 3f). The mean length of conidia of isolate A1-
SS05 was 5.96 µm (range of 4.65–6.64 µm), and the
mean width was 2.37 µm (range of 1.71–2.79 µm). The
isolate produced spherical microsclerotia of various
sizes in irregular chains (Fig. 4a–c). In V. longisporum,
mean length of conidia was 6.72 µm, with a range of
5.48–8.08 µm, and mean width was 1.69 µm, with a
range of 1.35–1.97 µm. Isolate A1-SS05 produced
elongate to spherical microsclerotia of various sizes
(Fig. 4d–f). Collectively, the colony growth and mor-
phological observations suggested that Verticillium iso-
late A1-SS05 from canola was V. dahliae.
Molecular identification. PCR of the ITS region of iso-
late A1-SS05 with the primer set ITS5/ITS4 produced
a ~ 500 bp amplicon, which shared 99% identity with
ITS sequences (Fig. 5a)ofV. dahliae available in
GenBank (HQ839784). No amplification product was
detected from either V. dahliae or V. longisporum when
the primers VaF1/VaR1 and VlspF1/VlspR4 were used
under the conditions of Banno et al. (2011). In contrast,
PCR with the Verticillium-specific primer set VeruniF2/
VeruniR3 produced an amplicon of ~800 bp with the V.
dahliae isolates, and an amplicon of ~1.6 kb for the V.
longisporum isolate (Fig. 6). PCR with the primers
VeruniF2/VeruniR3 produced a 600–700 bp product
from all eight isolates from canola, which was found
to share 100% identity with V. dahliae sequences
(U33637 and AF104926) in GenBank (Fig. 5b). All
of the sequences have been deposited in GenBank
(accession nos. KY704085–KY704097).
Pathogenicity tests
Inoculation with V. dahliae isolate A1-SS05 on canola
‘West a r ’produced symptoms that included wilting,
leaf yellowing, leaf senescence and plant stunting
(Fig. 7a–d). The symptoms appeared at the seedling
stage (21 days after planting) as well as at the late
flowering stage. Microscopic examination of the
infected vascular tissue revealed irregularly shaped
microsclerotia, which were also seen in pure culture
(Fig. 7e). Approximately 7% of the inoculated seed-
lings showed symptoms of Verticillium wilt, and plant
height was reduced by 15% compared with the non-
inoculated control (Fig. 8). Isolates of V. dahliae were
re-isolated from the infected tissue and the identity
confirmed based on conidial and conidiophore mor-
phology, as well as by PCR with the specificITS
primers described above.
Fig. 4 (Colour online) Comparison of Verticillium dahliae (a, b, c) with Verticillium longisporum (d, e, f) grown on PDA. (a) Conidiophores
of V. dahliae with masses of conidia (×40); (b) Conidia; and (c) Irregularly-shaped microsclerotia with conidia. (d) Conidiophores of V.
longisporum with masses of conidia (×40); (e) Conidia; (f) Microsclerotia. Bars = 10 µm.
S.-F. Hwang et al.6
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
Fig. 5 (Colour online) (a) Full alignment of the internal transcribed spacers from purified Verticillium isolates recovered from canola, and
reference isolates of Verticillium dahliae (GenBank accession no. HQ839784) and Verticillium longisporum (HQ206920 and HE972018). VL-
MB (KY704095), single-spore isolate of Verticillium longisporum from tissue sample from Manitoba; V. d. UofA (KY7040088), V. dahliae
isolate E W27T
1
-2 from University of Alberta; single-spore isolates from the diseased canola sample from Morinville, Alberta were A1-SS18
(KY704089), A1-SS54 (KY704090), A1-SS28 (KY704087), A1-SS21 (KY704088), A1-SS05 (KY704086), A1-SS01 (KY704085). Isolates
A1-SS06 (KY704093 and A1-SS11 (KY704094) are single-spore isolates which were re-isolated from the canola cultivar ‘Westar’following a
pathogenicity test conducted in the greenhouse. The numbers in the parentheses are the accession numbers of the sequences deposited in
GenBank. (b) Full alignment of the sequences amplified from diseased plant samples with specific primers VeruniF2/VeruniR3
(TCGTAGTAGAAGCTCGGCCTCCGGTC/TAAGAAGTCGGCGTACTACCGGGGT) and with sequences from GenBank (accession nos.
AF104926 and U33637). Infected plant tissue pieces were labelled as 2 and 3 which were used for DNA extraction; for each DNA sample, two
sequences were obtained, which were labelled as 2A and 2B, 3A and 3B, respectively.
(Continued)
Verticillium wilt on canola in Alberta 7
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
Discussion
Verticillium longisporum and its close relative, V. dahliae
(Karapapa et al. 1997), have been reported to cause
vascular wilts on B. oleracea and B. rapa. Originally, V.
longisporum was regarded as a variant of V. dahliae, but
now it is considered to be a hybrid between V. dahliae
and Verticillium albo-atrum Rein. & Bert. (Inderbitzin
et al. 2011a). The host range of V. dahliae, the most
economically important species of the Verticillium
genus, is comprised of more than 200 plant species
(Pegg & Brady 2002; Inderbitzin et al. 2011b), including
cotton (Gossypium hirsutum L.), cucurbits (family
Cucurbitaceae), alfalfa (Medicago sativa L.), sunflower
(Helianthus annuus L.), eggplant (Solanum melongana
L.), mint (Mentha spp.), strawberry (Fragaria x ananassa
Duchesne), tomato (Solanum lycopersicum L.) and potato
(Solanum tuberosum L.) (Domsch et al. 1980;
Schnathorst 1981; Pegg 1984; Subbarao et al. 1995;
Bhat and Subbarao 1999). Although it is considered to
be weakly pathogenic on most cruciferous plants (Krikun
& Bernier 1987), Yu et al. (2016) showed that V. dahliae
can infect horseradish (Armoracia rusticana G. Gaertn.,
B. Mey. & Scherb.), causing internal root discolouration.
Verticillium longisporum generally has been found to
be a virulent pathogen on cruciferous hosts, including
oilseed rape/canola, and earlier studies reported that its
host range is limited to the Brassicaceae (Horiuchi et al.
1990; Baig 1991; Koike et al. 1996; Karapapa et al.
1997). Later studies, however, showed that V. longis-
porum can infect other plant species (Fahleson et al.
2003; Johansson et al. 2006), which may act as a bridge
between susceptible crops. In a pathogenicity assay,
Karapapa et al. (1997)found that all of the isolates of
V. longisporum tested were virulent on rapeseed, whereas
Fig. 5 (Continued)
S.-F. Hwang et al.8
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
the tested V. dahliae strains were non-pathogenic. In a
different study, however, V. dahliae was found (in most
cases) to be able to infect the roots of oilseed rape
(Johansson 2006; Zhou et al. 2006). Similarly, Eynck
et al. (2007) demonstrated that V. dahliae could colonize
the root tissue of B. napus, but was unable to colonize the
shoots. Yao et al. (2015) inoculated Arabidopsis thaliana
with V. dahliae isolates obtained from different hosts and
found that a potato isolate was highly aggressive on
potato but weakly pathogenic on Arabidopsis, whereas a
sunflower isolate that was weakly aggressive on potato
was highly aggressive on Arabidopsis.
Verticillium dahliae and V. longisporum both are soil-
borne hemibiotrophs, which infect through the roots,
colonize the upper plant in the biotrophic stage, and
then produce microsclerotia –small, hard masses of fun-
gal cells –in the necrotrophic stage (Zhou et al. 2006;
Eynck et al. 2007; Knüfer et al. 2017). The pathogens
overwinter in the soil as microsclerotia, which are capable
of surviving for at least 14 years (Wilhelm 1955),
although the number of viable microsclerotia declines
over time. Microsclerotia germinate and infect the plants
directly through the roots, generally at the seedling stage.
As the plant grows, the fungus colonizes and spreads
upward through the vascular system, disrupting the
uptake and translocation of water and nutrients from the
soil (Fradin & Thomma 2006; Eynck et al. 2007). After
crossing the root endodermis, the fungus enters the xylem
and produces conidia that are transported by the water
stream throughout the plant, causing chlorosis, stunting
Fig. 6 (Colour online) Agarose gel of the amplicons obtained by
PCR analysis of DNA from single-spore isolates using Verticillium-
specific primers VeruniF2/VeruniR3. Lane M represents 1 kb ladder,
lanes 1 and 2 display 800 bp bands of V. dahliae, lanes 3 and 4 show
1.6 kb bands of V. longisporum, and lane 5 is a negative control
consisting of loading buffer only. Lanes are numbered left to right.
Fig. 7 (Colour online) Pathogenicity test of Verticillium dahliae on canola cultivar ‘Westar’.(a) Inoculated and (b) non-inoculated control
treatments; inoculated plants show leaf yellowing, stunting and wilting; (c) Healthy (left) and stunted (right) plants 21 days after planting; (d)
Healthy (left) and wilted (right) plants at the late flowering stage; (e) Vertical black stripe or discolouration on the stem, showing
microsclerotia. The plants were inoculated with a spore suspension of V. dahliae (isolate A1-SS05) from wilted canola plants collected in
Morinville, AB, 2016.
Verticillium wilt on canola in Alberta 9
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
and early senescence (Johansson et al. 2006). During host
senescence, microsclerotia are produced, which are
released back into the soil during decomposition of
plant materials (Fradin and Thomma 2006).
Isolates of V. longisporum from cruciferous hosts (pri-
marily rapeseed) from Japan and many European coun-
tries are near-diploid (Karapapa et al. 1997; Zeise & von
Tiedemann 2001, 2002). The fungus produces long con-
idia (7.1–8.8 µm) on long conidiophores with 3–4 phia-
lides per node, forms irregular, elongated microsclerotia,
and on a modified medium with tannic acid it does not
exhibit extracellular polyphenol oxidase activity
(Karapapa et al. 1997). In contrast, V. dahliae isolates
have been detected in a variety of hosts and locations, and
are haploid, produce short conidia (3.5–5.5 µm) on rela-
tively short conidiophores with 4–5 phialides per node,
form more or less spherical, compact microsclerotia, and
on a modified medium with tannic acid exhibit extracel-
lular polyphenol oxidase activity (Karapapa et al. 1997).
On a molecular level, V. longisporum and V. dahliae
isolates are also distinguishable based on their character-
istic randomly amplified polymorphic DNA (RAPD)
banding arrays (Koike et al. 1996).
Verticillium longisporum infection has caused plant
fresh weight losses of 38, 22 and 14% in Pak Choi
(Brassica rapa subsp. chinensis L.), cauliflower (B. oler-
acea var. botrytis L.) and broccoli (B. oleracea var.
italica Plenck.), respectively (Zeise & von Tiedemann
2002). In oilseed crops, V. longisporum infection results
in the development of faint black stripes on the stems.
These appear darker if the stem is rubbed or if the
epidermis or cortex is removed (Eastburn & Paul 2007).
Microsclerotia develop late in the growing season and the
disease causes premature senescence and ripening, result-
ing in yield reductions of up to 50–70% (Kroeker 1976;
Dunker et al. 2008). In cauliflower, V. dahliae causes
chlorosis of the lower leaves, defoliation, stunting and
wilting (Koike et al. 1994).
Diseased plant samples showing typical symptoms of
Verticillium wilt were collected in this study from a
canola crop near Morinville, Alberta. The symptoms
included leaf yellowing, stunting, defoliation, vascular
discolouration, and wilting that caused drooping at the
top of the plants. Recovered isolates were identified as V.
dahliae. The symptoms on canola were similar to those
caused by V. dahliae on cauliflower in California (Koike
et al. 1994). In the present study, symptoms including
wilting were observed on the canola ‘Westar’after inocu-
lation with V. dahliae. In contrast, in a previous study,
inoculation of oilseed rape with V. longisporum resulted
in symptoms that included dark unilateral stripes on
otherwise healthy stems, and the formation of microscler-
otia in the stem cortex beneath the epidermis at maturity
(Depotter et al. 2016). Since V. longisporum did not cause
wilt symptoms on oilseed rape, Depotter et al. (2016)
proposed ‘Verticillium stem striping’as the common
name for Verticillium infections of oilseed rape.
Environmental factors can influence the development
and expression of symptoms caused by V. longisporum
on cauliflower and oilseed rape (Depotter et al. 2016), so
it is possible that wilt symptoms on B. napus might be
due to the cropping of summer varieties in Canada as
opposed to winter varieties in Europe, where no wilt
symptoms have been detected. It is also likely that
different pathotypes of V. longisporum or V. dahliae
are prevalent in Canada.
The polyphenol oxidase test has been used to differ-
entiate V. dahliae from V. longisporum.Inmostcases,
V. dahliae has a strong association with polyphenol
oxidase activity, while V. longisporum does not
(Karapapa et al. 1997;Depotteretal.2016). In the
current study, both the reference culture of V. dahliae
and the isolate A1-SS05 exhibited polyphenol oxidase
activity, while there was no activity in V. longisporum.
Based on its morphological characteristics, polyphenol
oxidase activity and the molecular analyses, the isolate
A1-SS05 was identified as V. dahliae. To our knowl-
edge, this is the first report of V. dahliae causing wilt
of canola in North America. Further studies are
required to determine the degree to which V. dahliae
may threaten the production of this crop in Alberta and
other canola growing regions of the Prairies. It is likely
that the amount of pathogen inoculum will continue to
increase, since canola is intensively cultivated in
Alberta. Presently, no strategies have been evaluated
for the management of Verticillium wilt or
Verticillium stripe of canola in Canada.
Fig. 8 (Colour online) Effect of inoculation with Verticillium dahliae
on disease incidence and height of plants of the canola cultivar
‘Wes tar ’. Data are the means of six replications × two repetitions.
Means followed by the same letter are not significantly different at
P≤0.05 according to the paired t-test.
S.-F. Hwang et al.10
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
Previously, V. dahliae has not been found in associa-
tion with cruciferous plants (with the exception of cauli-
flower as reported by Koike et al. 1994) and V.
longisporum has been reported almost exclusively in
conjunction with the Brassicaceae. Eynck et al. (2007)
evaluated host-pathogen interactions between B. napus
and these Verticillium species and observed that the
spores of both species germinated close to the main and
lateral roots, the hyphae were intensely interwoven with
the root hairs, and that they colonized and penetrated the
root and grew inside the cortex. Unlike V. longisporum,
however, V. dahliae colonized the host tissues poorly and
caused limited infection. In the current study, V. dahliae
caused wilting at the seedling stage, although symptoms
of infection also were expressed at later plant growth
stages; this is considered to be the normal time-frame
for the manifestation of Verticillium wilt symptoms
(Zhou et al. 2006). It is possible that the planting of
canola in short rotations in many regions of Alberta
may have selected for more aggressive strains of V. dah-
liae, which could successfully colonize and infect this
host. There is a high level of diversity and pathogenic
variability in populations of V. dahliae isolated from
potato and sunflower (Uppal et al. 2008; Alkher et al.
2009a). This pathogen has a high capacity for cross-
infection (Daayf 2015), and one study showed that after
serial inoculations with a weakly aggressive isolate of V.
dahliae from potato, the isolate became more aggressive
on both potato and sunflower (Alkher et al. 2009b).
Verticillium dahliae has a wide host range (Pegg &
Brady 2002; Inderbitzin et al. 2011b). Krikun & Bernier
(1987) studied the effect of growing wheat (Triticum
aestivum L.), barley (Hordeum vulgare L.), oat (Avena
sativa L.), pea (Pisum sativum L.), faba bean (Vicia faba
L.), mustard (Brassica juncea L.), and rapeseed (B. napus
L., B. rapa L.) in substrates individually inoculated with
two V. dahliae isolates, one from pea and another from
potato. The isolates were pathogenic on all of the crops,
and produced microsclerotia on the above and below
ground parts of the plants. This wide host range might
play a significant role in maintaining the inoculum poten-
tial, although monocots have sometimes been considered
to be non-hosts of V. dahliae (McCain et al. 1981). Other
field crops, including alfalfa, clover, cotton, hops, mint,
safflower and sunflower also are susceptible to
Verticillium wilt (McCain et al. 1981; Rashid &
Desjardins 2015). For the management of Verticillium
wilt in these crops, cultivar resistance, the use of optimal
fertilizer rates, avoidance of over-irrigation and contami-
nated seed, soil fumigation, and the control of susceptible
weeds have been recommended (Berlanger & Powelson
2000; Zeise & Steinbach 2004). Soil amendments (Bailey
& Lazarovits 2003), green manures (Davis et al. 1996),
and biocontrol agents (Uppal et al. 2008; El Hadrami
et al. 2011) also are promising eco-friendly strategies
for the management of soil-borne diseases. In a study
by El Hadrami et al. (2011), four bacterial strains and
extracts from Canadian milkvetch (Astragalus canadensis
L.) were found to effectively reduce the severity of
Verticillium wilt of potato caused by V. dahliae. Further
information on this pathogen in Alberta cropping systems
will be necessary for the successful management of
Verticillium wilt. A common strategy for controlling
wilt diseases is to reduce inoculum in the soil (Harris
et al. 1993). Therefore, an appropriate technique for mea-
suring the amount of V. dahliae in the soil is essential for
studying the effectiveness of different strategies for redu-
cing soil inoculum levels.
Verticillium dahliae can persist and survive in the soil
as microsclerotia for 14 years (Wilhelm 1955) and is very
difficult to control (Fradin et al. 2009). The fungus also
can be transmitted as microsclerotia in infested soil
through movement of farm machinery and vehicles, as
well as with seeds. Therefore, to minimize the spread of
Verticillium wilt of canola, strategies such as equipment
sanitation, mitigation of soil and water erosion, and culti-
vating disease-free fields before infested fields should be
practiced, as has been recommended for another soil-
borne disease in Alberta, clubroot of canola (Howard
et al. 2010). It is also important to determine which
strains of V. dahliae have the potential to be more harmful
to canola in order to design a successful disease manage-
ment strategy.
Acknowledgements
The assistance of Sturgeon Valley Fertilizer Co. in locat-
ing the infested field is gratefully acknowledged.
Financial and in-kind support from the canola industry,
Alberta Agriculture and Forestry, and the University of
Alberta is gratefully appreciated.
References
Alkher H, El Hadrami A, Rashid KY, Adam LR, Daayf F. 2009a.
Cross-pathogenicity of Verticillium dahliae between potato and sun-
flower. Eur J Plant Pathol. 124:505–519.
Alkher H, El Hadrami A, Rashid KY, Adam LR, Daayf F. 2009b.
Pathogenic variation of Verticillium dahliae after serial passes through
potato and sunflower. Can J Plant Pathol. 31:427–438.
Baig AM. 1991. The possible role of glucosinolates in the resistance of
oilseed rape (Brassica napus L.) to Verticillium dahliae Kleb [PhD
thesis]. London (UK): King’s College, University of London.
Bailey KL, Gossen BD, Gugel RK, Morrall RAA. 2003. Diseases of
field crops in Canada. 3rd ed. Saskatoon (SK): Canadian
Verticillium wilt on canola in Alberta 11
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
Phytopathological Society, University Extension Press, University of
Saskatchewan.
Bailey KL, Lazarovits G. 2003. Suppressing soil-borne diseases with
residue management and organic amendments. Soil Till Res. 72:169–
180.
Banno S, Saito H, Sakai H, Urushibara T, Ikeda K, Kabe T,
Kemmoch I, Fujimura M. 2011. Quantitative nested real-time PCR
detection of Verticillium longisporum and V. dahliae in the soil of
cabbage fields. J Gen Plant Pathol. 77:282–291.
Berlanger I, Powelson ML. 2000. Verticillium wilt. Plant Health Instr.
[updated 2005]. DOI:10.1094/PHI-I-2000-0801-01
Bhat RG, Subbarao KV. 1999. Host range specificity in Verticillium
dahliae. Phytopathology. 89:1218–1225.
Canad ia n Fo od I ns pe ction Agency. 2016. Verticillium wilt –Verticillium
longisporum. [accessed 2017 Jul 31]. http://www.inspection.gc.ca/plants/
plant-pests-invasive-species/diseases/verticillium-wilt/eng/
1420746212959/1420746213803.
Canola Council of Canada. 2016a. Canola Encyclopedia. [accessed 2017
Jul 31]. http://www.canolacouncil.org/canola-encyclopedia/diseases/seed
ling-disease-complex/.
Canola Council of Canada. 2016b. Canola Encyclopedia. [accessed 2017 Jul
31]. http://www.canolacouncil.org/canola-encyclopedia/diseases/verticillium/.
Collins A, Okoli CAN, Morton A, Parry D, Edwards SG, Barbara
DJ. 2003. Isolates of Verticillium dahliae pathogenic to crucifers are of at
least three distinct molecular types. Phytopathology. 93:364–376.
Daayf F. 2015. Verticillium wilts in crop plants –pathogen invasion and
host defense responses. Can J Plant Pathol. 37:8–20.
Davis JR, Huisman OC, Westerman DT, Hafez SL, Everson DO,
Sorensen LH, Schneider AT. 1996. Effects of green manure on verti-
cillium wilt of potato. Phytopathology. 86:444–453.
Depotter JRL, Deketelaere S, Inderbitzin P, Tiedemann A, von Höfte
M, Subbarao KV, Wood TA, Thomma BPHJ. 2016.Verticillium
longisporum, the invisible threat to oilseed rape and other brassicaceous
plant hosts. Mol Plant Pathol. 17:1004–1016.
Dixelius C, Happstadius I, Berg G. 2005. Verticillium wilt on Brassica
oilseed crops –a Swedish perspective. J Swed Seed Assoc. 115:36–48.
Domsch KH, Gams W, Anderson TH. 1980. Nectria (Fr.) 1849,
Verticillium Nees ex link 1824. Compendium of Soil Fungi. Vol. 1.
New York: Academic Press; p. 829–845.
Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small
quantities of fresh leaf tissue. Phytochem Bull. 19:11–15.
Dunker S, Keunecke H, Steinbach P, von Tiedemann A. 2008. Impact
of Verticillium longisporum on yield and morphology of winter oilseed
rape (Brassica napus) in relation to systemic spread in the plant. J
Phytopathol. 156:698–707.
Eastburn DM, Paul VH. 2007. Verticillium Wilt. In: Rim me r S R,
Sha tt uc k V I, Buchwa ld t L , editors. Compendium of Brassica diseases.
St Paul (MN): The American Phytopathological Society Press; p. 47–50.
Eckert JW. 1962. Fungistatic and phytotoxic properties of some derivatives
of nitrobenzene. Phytopathology. 52:642–649.
El Hadrami A, Adam LR, Daayf F. 2011. Biocontrol treatments confer
protection against Verticillium dahliae infection of potato by inducing
anti-microbial metabolites. Mol Plant-Micro Inter. 24:328–335.
Eynck C, Koopmann B, Gruenewaldt-Stoecker G, Karlovsky P, von
Tiedemann A. 2007. Differential interactions of Verticillium longis-
porum and V. dahliae with Brassica napus detected with molecular and
histological techniques. Eur J Plant Pathol. 118:259–274.
Fahleson J, Hu Q, Dixelius C. 2004. Phylogenetic analysis of
Verticillium species based on nuclear and mitochondrial sequences.
Arch Microbiol. 181:435–442.
Fahleson J, Lagercrantz U, Hu Q, Steventon L, Dixelius C. 2003.
Estimation of genetic variation among Verticillium isolates using AFLP.
Eur J Plant Pathol. 109:361–371.
Feng J, Hwang R, Chang KF, Hwang SF, Strelkov SE, Gossen BD,
Zhou Q. 2010. An inexpensive method for extraction of genomic DNA
from fungal mycelia. Can J Plant Pathol. 32:396–401.
Fradin EF, Thomma BPHJ. 2006. Physiology and molecular aspects of
Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol
Plant Pathol. 7:71–86.
Fradin EF, Zhang Z, Ayala JCJ, Castroverde CDM, Nazar RN, Robb
J, Liu CM, Thomma BPHJ. 2009. Genetic dissection of Verticillium
wilt resistance mediated by tomato Ve1. Plant Physiol. 150:320–332.
Harris DC, Yang JR, Ridout MS. 1993. The detection and estimation of
Verticillium dahliae in naturally infested soil. Plant Pathol. 42:238–250.
Hawksworth DL, Talboys PW. 1970.Verticillium dahliae. CMI
Descriptions of Pathogenic Fungi and Bacteria No. 256. Wallingford
(UK): CAB International.
Heale JB, Karapapa VK. 1999. The Verticillium threat to Canada’s major
oilseed crop: canola. Can J Plant Pathol. 21:1–7.
Horiuchi S, Hagiwara H, Takeuchi S. 1990. Host specificity of isolates
of Verticillium dahliae towards cruciferous and solanaceous hosts. In:
Hor nb y D , editors. Biological control of soil-borne plant pathogens.
Oxon (UK): CAB International; p. 285–298.
Howard RJ, Strelkov SE, Harding MW. 2010. Clubroot of cruciferous
crops - new perspectives on an old disease. Can J Plant Pathol. 32:43–57.
Howell CR. 1970. Differential enzyme synthesis by haploid and diploid
forms of Verticillium albo-atrum. Phytopathology. 60:488–490.
Ikeda K, Banno S, Watanabe K, Fujinaga M, Ogiso H, Sakai H,
Tanaka H, Miki S, Shibata S, Shiraishi T, et al. 2012. Association
of Verticillium dahliae and Verticillium longisporum with Chinese cab-
bage yellows and their distribution in the main production areas of Japan.
J Gen Plant Pathol. 78:331–337.
Inderbitzin P, Bostock RM, Davis RM, Usami T, Platt HW, Subbarao
KV. 2011a. Phylogenetics and taxonomy of the fungal vascular wilt pathogen
Verticillium, with the descriptions of five new species. PLoS One. 6:e28341.
Inderbitzin P, Davis RM, Bostock RM, Subbarao KV. 2011b. The
ascomycete Verticillium longisporum is a hybrid and a plant pathogen
with an expanded host range. PLoS One. 6:e18260.
Johansson A. 2006.Verticillium longisporum, infection, host range, pre-
valence and plant defence responses [Licentiate thesis]. Uppsala:
Swedish University of Agricultural Sciences.
Johansson A, Goud JC, Dixelius C. 2006. Plant host range of
Verticillium longisporum and microsclerotia density in Swedish soils.
Eur J Plant Pathol. 114:139–149.
Karapapa VK, Bainbridge BW, Heale JB. 1997. Morphological and
molecular characterization of Verticillium longisporum comb. nov.,
pathogenic to oilseed rape. Mycol Res. 101:1281–1294.
Knüfer J, Lopisso DT, Koopmann B, Karlovsky P, von Tiedmann A.
2017. Assessment of latent infection with Verticillium longisporum in
field-grown oilseed rape by qPCR. Eur J Plant Pathol. 147:819–831.
Koike M, Fujita M, Nagao H, Ohshima S. 1996. Random amplified
polymorphic DNA analysis of Japanese isolates of Verticillium dahliae
and Verticillium albo-atrum. Plant Dis. 80:1224–1227.
Koike ST, Subbarao KV, Davis RM, Gordon TR, Hubbard JC. 1994.
Verticillium wilt of cauliflower in California. Plant Dis. 78:1116–1121.
Krikun J, Bernier CC. 1987. Infection of several crop species by two
isolates of Verticillium dahliae. Can J Plant Pathol. 9:241–245.
Kroeker G. 1976.Verticillium dahliae on Brassica oilseed crops in
Sweden. In: Proceedings of the Second International Verticillium
Symposium; Berkeley, CA: University of California Press; p. 28–29.
Li KN, Ro us e DI , Ey es to ne E J, German TL. 1999. The generation of
specific DNA primers using random amplified polymorphic DNA and its
application to Verticillium dahliae. Mycol Res. 103:1361–1368.
McCain AH, Raabe RD, Wilhelm S. 1981. Plants resistant to or suscep-
tible to Verticillium wilt. Leaflet 2703. Berkeley (CA): University of
California, The University of California Cooperative Extension.
S.-F. Hwang et al.12
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
Pegg GF. 1984. The impact of Verticillium diseases in agriculture.
Phytopathol Mediterr. 23:176–192.
Pegg GF, Brady BL. 2002. Verticillium Wilts. Wallingford (Oxfordshire):
CABI Publishing.
Rashid KY, Desjardins ML. 2015. Diseases of sunflower in Manitoba in
2014. Can Plant Dis Surv. 95:185–187.
Ra shi d KY, De sjar din s ML , Kam ini ski D E. 2015. Diseases of sunflower in
Manitoba and Saskatoon in 2005. Can Plant Dis Surv. 86:114–115.
Rashid KY, Desjardins ML, Kaminski DA. 2006. Disease of sunflower
survey in Manitoba in 2005. Can Plant Dis Surv. 86:114–115.
Rempel CB, Hutton SN, Jurke CJ. 2014. Clubroot and the importance of
canola in Canada. Can J Plant Pathol. 36(S1):19–26.
Sadowski CA, Zielinski D, Klepin J, Zawislak K. 1995. The health
status of winter rape cultivated for many years with monoculture and
crop rotation. In: Proceedings of the 9th International Rapeseed
Congress; July 4–7; Cambridge, UK: Cambridge University Press; p.
1228–1230.
Schnathorst WC. 1981. Life cycle and epidemiology of Verticillium. In:
Mac e M E, Be ll AA, B eckmann CH, editors. Fungal wilt diseases of
plants. New York: Academic Press; p. 81–111.
Steventon L, Fahleson J, Hu Q, Dixelius C. 2002. Identification of the
causal agent of Verticillium wilt of winter oilseed rape in Sweden as
Verticillium longisporum. Mycol Res. 106:570–578.
Subbarao KV, Chassot A, Gordon TR, Hubbard JC, Bonello P, Mulin
R, Okamoto D, Davis RM, Koike ST. 1995. Host range of Verticillium
dahliae from cauliflower and genetic relationships and cross pathogeni-
cities of isolates from different crops. Phytopathology. 85:1105–1112.
Tjamos EC, Beckman CH. 1989. Vascular wilt diseases of plants: basic
studies and control. NATO ASI Series H: Cell Biology. Berlin: Springer-
Verlag.
Tran VT, Braus-Stromeyer SA, Timpner C, Braus GH. 2013.
Molecular diagnosis to discriminate pathogen and a pathogen species of
the hybrid Verticillium longisporum on the oilseed crop Brassica napus.
Appl Microbiol Biotechnol. 97:4467–4483.
Uppal AK, El Hadrami A, Adam LR, Tenuta M, Daayf F. 2008.
Biological control of potato Verticillium wilt under controlled and field
conditions using selected bacterial antagonists and plant extracts. Biol
Control. 44:90–100.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In: Inn is
MA, Gel fa nd D H, S ni nsky JJ, White TJ , editors. PCR Protocols: A
Guide to Methods and Applications. San Diego, CA: Academic Press; p.
315–321.
Wilhelm S. 1955. Longevity of the Verticillium wilt fungus in the labora-
tory and field. Phytopathology. 45:180–181.
Yao Z, Islam MR, Badawi MA, Daayf F. 2015. Overexpression of
StrbohA in Arabidopsis thaliana enhances defence responses against
Verticillium dahliae. Physiol Mol Plant Pathol. 90:105–114.
Yu JM, Cafarov IH, Babadoost M. 2016. Morphology, molecular iden-
tity, and pathogenicity of Verticillium dahliae and V. longisporum asso-
ciated with internally discolored horseradish roots. Plant Dis. 100:749–
757.
Zeise K, Steinbach P. 2004. Schwarze Rapswurzeln und der Vormarsch
der Verticillium-Rapswelke [Black root of rapeseed and the advance of
Verticillium wilt of rape]. Raps. 4:170–174.
Zeise K , vo n Tiede ma nn A . 2001. Morphological and physiological
differentiation among vegetative compatibility groups of Verticillium
dahliae in relation to V. longisporum. J Phytopathol. 149:469–475.
Zeise K, von Tiedemann A. 2002. Host specialization among vegetative
compatibility groups of Verticillium dahliae in relation to Verticillium
longisporum. J Phytopathol. 150:112–119.
Zhou L, Hu Q, Johansson A, Dixelius C. 2006.Verticillium longis-
porum and V. dahliae: Infection and disease in Brassica napus. Plant
Pathol. 55:137–144.
Zielinski D, Sadowski C. 1995. A preliminary study on Verticillium
dahliae Kleb. in winter oilseed rape in Poland. In: Proceedings of the
9th International Rapeseed Congress; July 4–7; Cambridge, UK:
Cambridge University Press; p. 649–651.
Verticillium wilt on canola in Alberta 13
Downloaded by [Alberta Government Library] at 07:52 02 October 2017
