Isolation, Characterization and Serological Study of Avibacterium paragallinarum field isolates from Indian Poultry

Abstract

A total of 65 nasal swab samples from Infectious coryza suspected poultry birds were collected from different geographical locations of India during 2013 to 2015 and subjected to isolation of organism, biochemical and serological characterization of isolates by Page scheme along with confirmation by PCR. Biochemically, the isolates demonstrated abilities to utilize four sugars i.e. Glucose, Mannitol, Sorbitol and Sucrose, whereas two sugars Galactose and Trehalose were not fermented by them. All isolates were able to convert nitrate to nitrite. The isolates were negative for catalase, H2S production and Indole test and showed absence of oxidase activity. Among 17 field isolates of Avibacterium paragallinarum, along with serovar A and serovar C, there is presence of serovar B. Out of 17 isolates, the serovar C was prevalent with 47% and serovar A was 27%, whereas serovar B was found to be only 11% and 2 strains were non-typable. This is the first confirmed report of presence of serovar B in Indian poultry isolates.

Full text

JAPSC
Journal of Animal and Poultry Sciences, 2016, 5 (1): 13-20
Available online at http://www.JAPSC.com
Isolation, Characterization and Serological Study of Avibacterium paragallinarum field
isolates from Indian Poultry
V. V. Patil1*, D. N. Mishra2 and D. V. Mane3
1Biotechnology Research Centre, Department of Biotechnology, College of Computer Sciences and IT,
Latur-413531, India
2Swami Ramanand Teerth Marathwada University Sub- Centre, Latur-413531, India
3Indovax Private Limited, Gurgaon-122001, India
Abstract
A total of 65 nasal swab samples from Infectious coryza suspected poultry birds were collected from different
geographical locations of India during 2013 to 2015 and subjected to isolation of organism, biochemical and
serological characterization of isolates by Page scheme along with confirmation by PCR. Biochemically, the isolates
demonstrated abilities to utilize four sugars i.e. Glucose, Mannitol, Sorbitol and Sucrose, whereas two sugars Galactose
and Trehalose were not fermented by them. All isolates were able to convert nitrate to nitrite. The isolates were negative
for catalase, H2S production and Indole test and showed absence of oxidase activity. Among 17 field isolates of
Avibacterium paragallinarum, along with serovar A and serovar C, there is presence of serovar B. Out of 17 isolates, the
serovar C was prevalent with 47% and serovar A was 27%, whereas serovar B was found to be only 11% and 2 strains
were non-typable. This is the first confirmed report of presence of serovar B in Indian poultry isolates.
Key words: Avibacterium paragallinarum, Infectious coryza, India, Poultry.
*Corresponding author: Tel: +918275516747;
E-mail address: vihang.patil11@gmail.com

Patil et al. / Journal of Animal and Poultry Sciences (JAPSC), 2016, 5(1): 13-20
14
Introduction
Infectious coryza (IC) is a highly contagious disease of chicken (Gallus gallus) affecting primarily
upper respiratory tract and is caused by a bacterium, Avibacterium paragallinarum. IC affected birds show
serous nasal discharge, sneezing, depression and slight facial edema (Chauhan et al., 2007), and results into
heavy economic loss due to poor growth performance in growing birds and marked reduction (10-40%) in
egg production in layers. Infectious Coryza is a cosmopolitan disease, present everywhere chickens are
raised. However, it is considered as an exotic disease in New Zealand, which is the only country that appears
to be free from Avibacterium paragallinarum (Vargas &Terzolo, 2004).
In India, Infectious Coryza outbreaks have been reported earlier (Rajurkar et al., 2010). It is a
continuous threat to both meat chickens and layers. Serological identification of pathogen seems to be an
important feature in the development of vaccines. The first serological classification of Avibacterium
paragallinarum was performed in 1962 by Page who recognized three different serovars termed A, B and C.
The Page scheme has been widely used in many parts of the world since then (Poernomo et al., 2000).
In India, Tongaonkar et al. (2003) have confirmed the presence of Page serovar A and C. But there is no
confirmed report of Page serovar B being recorded till now. However, frequencies of occurrence of the
disease, vaccine failure and occurrence of Page serovar B in countries geographically closer to India like
China (Zhang et al., 2003), Thailand (Chukiatsiri et al., 2010), Indonesia (Poernomo et al., 2000) have been
reported. Unfortunately, information regarding Infectious Coryza outbreaks in India has not been duly
published. To understand the magnitude of this detrimental disease with serovar B as a causal factor, it is
essential to establish serological involvement of Avibacterium paragallinarum in Indian context. The present
study is devoted to in this direction.
Materials and Methods
Clinical sample collection
Clinical samples (nasal discharge /swab) of birds of different age groups showing typical symptoms of
Infectious Coryza were brought to research laboratory by using Bragg’s modified transport medium (Bragg
et al., 2004). A total of 65 clinical samples were collected from different geographical locations of India
during 2013 to 2015 and subjected to biochemical tests along with confirmation of PCR and serological
characterization by a Page scheme.
Isolation of organism
The nasal swab samples were streaked on Blood Tryptose Agar (BTA) plates and these agar plates were
cross streaked by Staphylococcus aureus (feeder culture) to observe satellitic phenomenon (Bragg et al.,
2002). The plates were incubated at 37oC for 48 hrs in candle jar. After incubation, the plates were observed

Patil et al. / Journal of Animal and Poultry Sciences (JAPSC), 2016, 5(1): 13-20
15
for growth and satellitic phenomenon. The dew drop colonies with satellitic growth were used for further
biochemical investigation. TN/SN medium was used to perform biochemical and other tests (Poernomo et
al., 2000).
Staining, Biochemical and Serological Characterization
I) Gram staining
Gram staining was done to determine the shape and Gram’s nature of isolates as described by Chauhan
et al. (2007).
II) Sugar fermentation test
The sugar fermentation test was performed for six basic carbohydrates i.e. Galactose, Glucose,
Mannitol, Sorbitol, Sucrose and Trehalose as per Blackall et al. (1997).
III) Other Biochemical tests
Along with sugar fermentation tests, catalase test, indole production, hydrogen sulphide production and
nitrate reduction tests were also carried out. Tests were performed to check hemolysis and requirement of
factor X and V (Akhtar et al., 2001).
IV) PCR test
For final confirmation, species specific PCR (HPG-2 PCR) was carried out as per protocol described by
Chen et al. (1996). In this test, a pair of primers was used with sequence-
F1 (TGAGGGTAGTCTTGCACGCGAAT) and R1 (CAAGGTATCGATCGTCTCTCTACT).
V) Serotyping of isolates
The serological characterization was performed by using a Page scheme of serotyping in which
Haemagglutination (HA) and Haemagglutination Inhibition (HI) tests were carried out as described by
Blackall et al. (1990).
Results
Isolation Staining, Biochemical and Serological Characterization of organism
All seventeen isolates from suspected samples showed dew drop colonies with satellitic growth as
shown in Figure 1. The isolates were further used to carry out Gram staining, sugar fermentation and other
tests for biochemical properties. As presented in Table 1 all isolates were found as Gram negative bacilli.
The isolates also demonstrated the ability to utilize four sugars i.e. Glucose, Mannitol, Sorbitol and Sucrose
which were indicated acolour change from red to yellow whereas two sugars Galactose and Trehalose were
not fermented by them. In catalase test, no bubble formation was observed, indicating catalase negative
nature of the isolates. No purple colour formation indicated absence of oxidase activity.

Patil et al. / Journal of Animal and Poultry Sciences (JAPSC), 2016, 5(1): 13-20
16
Figure 1. Satellitic Growth of Avibacterium paragallinarum cross streaked with Staphylococcus aureus
Table 1.Biochemical Characterization of Avibacterium paragallinarumfield isolates
Isolate Code
Gram Nature
Sugar Fermentation Test
Galactose
Glucose
Mannitol
Sorbitol
Sucrose
Trehalose
Other Biochemical Properties
Catalase
Indole Production
H2S Production
Nitrate Reduction
Hemolysis on BA
NAD Dependence
HPG2-PCR
1
Negative R
ods
-
+
+
+
+
-
-
-
-
+
-
+
+
2
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
3
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
4
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
5
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
6
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
7
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
8
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
9
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
10
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
11
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
12
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
13
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
14
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
15
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
16
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
17
Negative Rods
-
+
+
+
+
-
-
-
-
+
-
+
+
The isolates further showed negative results for H2S production and Indole test. In Nitrate reduction test,
all isolates were able to convert nitrate to nitrite, which is demonstrated by formation of the deep red colour
in broth after incubation.
PCR Test
In species specific PCR test (HPG2-PCR), all isolates were able to produce a 0.5kb DNA fragment upon
amplification with given combination of N1and R1 primers (Figure 2). No other amplification was observed.

Patil et al. / Journal of Animal and Poultry Sciences (JAPSC), 2016, 5(1): 13-20
17
Figure 2. HPG-2 PCR confirmations of field isolates of Avibacterium paragallinarum
1 to 3: Avibacterium paragallinarum (Field isolates)
4: No Template Control (NTC)
R: Reference strain of Avibacterium paragallinarum
M: 100bp DNA Ladder
Serotyping of isolates
The overall serotyping results revealed that all three Page serovars i.e. A, B and C are present in India
for Infectious Coryza (Figure 3).Out of 17 isolates, five were serovar A, two were serovar B and eight were
serovar C whereas two field isolates were non-typable. The presence of Avibacterium paragallinarum was
observed in all major poultry rearing states of India including Punjab, Haryana, Maharashtra, Andhra
Pradesh, Tamil Nadu, etc.. All three serovars i.e. Serovar A, B and C were found in Punjab and Andhra
Pradesh. Similarly two un-typable strains were also recovered from same states (Table 2) .
Figure 3. Page Serotyping scheme for Avibacterium paragallinarum

Patil et al. / Journal of Animal and Poultry Sciences (JAPSC), 2016, 5(1): 13-20
18
Table 2. Serological Distribution of Avibacterium paragallinarum field isolates
Field isolates
Bird type
Vaccinated
(Yes/ No)
Region
Serotype
Isolate 1
Commercial Layers
Yes
Andhra Pradesh
A
Isolate 2
Commercial Lay
ers
Yes
Andhra Pradesh
A
Isolate 3
Layer Breeders
Yes
Tamil Nadu
A
Isolate 4
Commercial Layers
No
Punjab
A
Isolate 5
Commercial Layers
No
Rajasthan
A
Isolate 6
Layer Breeders
Yes
Punjab
B
Isolate 7
Commercial Layers
Yes
Andhra Pradesh
B
Isolate 8
Com
mercial Layers
No
Andhra Pradesh
C
Isolate 9
Commercial Layers
Yes
Karnataka
C
Isolate 10
Commercial Layers
Yes
Haryana
C
Isolate 11
Commercial Layers
Yes
Punjab
C
Isolate 12
Commercial Broilers
No
Haryana
C
Isolate 13
Broiler Breeders
Yes
Haryana
C
Isolate 14
Commercial Layers
Yes
Maharashtra
C
Isolate 15
Commercial Layers
Yes
Maharashtra
C
Isolate 16
Commercial Layers
Yes
Andhra Pradesh
NT
Isolate 17
Commercial Layers
Yes
Punjab
NT
Discussion
The results of biochemical tests, HPG2- PCR for all isolates confirmed the presence of Avibacterium
paragallinarum collected samples. The results of Gram’s staining, Carbohydrate fermentation pattern and
other biochemical tests matches with results reported by Rajurkar et al. (2010); Byarugaba et al. (2006) and
Bragg et al. (2002).The isolates were able to utilize NAD as a growth factor unlike some of the African
strains where these were NAD independent (Bragg et al., 1997).
The present study represents the serological data of some of the major states of India where extensive
poultry farming is carried out.
It is essential to note that out of 17 field isolates, 13 were collected from vaccinated birds and 4 were
from non-vaccinated birds, but all 17 field isolates showed emergence of coryza disease indicating strongly
presence of local variant strain(s) of Avibacterium paragallinarum. Similar types of results were reported by
Zhang et al. (2003), Bragg et al. (2002), Poernomo et al. (2000) and Bragg et al. (1997). Along with this
improper vaccine handling and vaccination technique may be some other reasons for vaccine failure. But
possible local variants may play substantial role in vaccine failure, disease reemergence and increasing
magnitude of the disease.
The serological study of Avibacterium paragallinarum field isolates shows that 2 out of 17 isolates are
serovar B. In India for the first time we have identified presence of this serovar. The only previous
characterization of Indian field isolates of Avibacterium paragallinarum reported presence of serovar A and
C only (Tongaonkar et al., 2003). It is essential to note that some workers have already indicated the
presence of serovar B in Asian countries including China (Zhang et al., 2003), Thailand (Chukiatsiri et al.,
2010), Indonesia (Poernomo et al., 2000).

Patil et al. / Journal of Animal and Poultry Sciences (JAPSC), 2016, 5(1): 13-20
19
In the present investigation, we were able to collect 17 field isolates from seven states of India, out of
which serovar C was 47% and serovar A was 27%, whereas serovar B was found to be only 11% and 2
strains were non-typable. This study further explains that there is no region sero- specificity in disease
formation of Infectious Coryza.
Conclusion
Overall, this work has provided very important information regarding Indian field isolates of
Avibacterium paragallinarum causing Infectious Coryza. This set of information also displays the emergence
of possible local variants of Avibacterium paragallinarum which needs more attention and timely
intervention for remedy. Our study indicated that along with serovar A and serovar C, there is presence of
serovar B in India. This is the first confirmatory report of serovar B in Indian poultry isolates. This serovar is
not only present in India, but possibly also a playing substantial role in vaccine failure and disease
(Infectious coryza) reemergence in Indian poultry otherwise.
Conflict of Interest
The authors declare no competing financial interest.
References
Akhtar, S., A. R. Bhatt, and K. Muhammad. 2001. Clinico-Therapeutic Observations on an Outbreak of Infectious Coryza.
International Journal of Agriculture and Biology, 3(4): 531-532.
Blackall, P.J., E. L. Eavers, and G. Aus. 1990.Serotyping of Haemophilus paragallinarum by the Page scheme: comparison of the
use of agglutination and hemagglutination-inhibition tests. Avian Diseases, 34: 643-645.
Blackall, P.J. 1997. Infectious Coryza: Overview of the Disease and New Diagnostic Options. Clinical Microbiology Reviews, 12(4):
627-632.
Bragg, R. R., J. M. Greyling, and J. A. Verschoor. 1997. Isolation and identification of NAD- independent bacteria from chicken
with symptoms of infectious Coryza. Avian Pathology, 26:595-606
Bragg, R. R. 2002. Isolation of serovar C-3 Haemophilus paragallinarum from Zimbabwe: A further indication of the need for the
production of vaccines against infectious coryza containing local isolates of H. paragallinarum. Onderstepoort Journal of
Veterinary Research, 69: 129-132.
Bragg, R.R., V. R. Jansen, H. E. Van, and J.Albertyn. 2004. The testing and modification of a commercially available transport
medium for the transportation of pure cultures of Haemophilus paragallinarum for serotyping. Onderstepoort Journal of
Veterinary Research, 71: 93-98.
Byarugaba, D. K., U. M. Minga, P.S. Gwakisa, E. R. Katunguka, M. Bisgaard, and J. E. Olsen. 2006. Occurrence, isolation and
characterisation of Avibacterium paragallinarumfrom poultry in Uganda. Proceedings of the 11th International Symposium on
Veterinary Epidemiology and Economics.
Chauhan, H. V. S., and S. Roy.2007. Poultry Diseases Diagnosis and Treatment. 3rded. New Age International Publication, New
Delhi, India
Chen, X., J. K. Miflin, P. Zhang, and P. J. Blackall. 1996. Development and application of DNA probes and PCR tests for
Haemophilusparagallinarum. Avian Diseases, 40(2): 398-407.
Chukiatsiri, K., S. Chotinun, and N. Chansiripornchai. 2010. An outbreak of Avibacterium paragllainarum serovar B in Thai Layer
farm. Thai Journal of Veterinary Medicine, 40: 441-444.
Poernomo, S., R. M. Sutarma, and P. J. Blackall. 2000. Characterization of isolates of Haemophilus paragallinarum from Indonesia.
Australian Veterinary Journal, 78(11):759-762.

Patil et al. / Journal of Animal and Poultry Sciences (JAPSC), 2016, 5(1): 13-20
20
Rajurkar, R., A. Roy, and M. M. Yadav. 2010. An overview on Epidemiologic investigations of Infectious Coryza. Veterinary World,
2(10):401-403.
Tongaonkar, S. S., S. G. Deshmukh, S. D. Kubal, and P. J. Blackall. 2003. Characterization of Indian Isolates of Haemophilus
paragallinarum. Page 107 in: Proc7th World Poultry Science Association Pacific Federation Conference/ 12th Australian poultry
and Stock feed Convention. Gold Coast, Queensland, Australia.
Vargas, E. S., and H. R., Terzolo. 2004. Haemophilus paragallinarum: Etiology of infectious Coryza. Veterinaria Mexico, 35(3):
245-259.
Zhang, P. J., M. Miao, H. Sun, Y. Gong, and P. J. Blackall. 2003. Infectious Coryza due to Haemphilusparagallinarum serovar B in
China. Australian Veterinary Journal, 81(1 & 2):96-97.