Evaluation of D-genome synthetic hexaploid wheats and advanced derivatives for powdery mildew resistance

Abstract

The present study was undertaken to characterize 32 D-genome synthetic hexaploid wheats (SHWs) of an Elite-II subset and their 60 advanced derivatives. At seedling stage under controlled glasshouse conditions in Murree, the SHWs showed complete resistance/ immune to susceptible disease reactions viz., two (6.25%) were immune, eighteen (56.25%) were resistant, nine (28.12%) were intermediate, whereas three (9.37%) were susceptible. The BW/SH derivatives also demonstrated complete resistance/ immune to intermediate reactions viz., 51 (85%) were immune, 5 (8.33%) were resistant while 4 (6.66%) were intermediate. Adult plant resistance (APR) evaluated at the hill off-station summer site in Kaghan was 100% in SHWs (32/32) and 80% (48/60) in BW/SH derivatives. Several genotypes provided resistance at both plant stages viz., 20 (62.5%) SHWs and 45 (75%) BW/SH derivatives. All the entries were checked for the presence of Pm4b, Pm9, Pm16 and Pm30 resistance genes using linked SSR markers. The marker Xgwm382.2A flanked the gene Pm4b in one SH and 5 BW/SH derivatives. Pm9 gene was identified using two markers viz., Xgwm4.4A detected Pm9 in one SH and 27 BW/SH while Xgwm332.7A detected same gene in one SH and 13 BW/SH derivatives. Pm16 and Pm30 genes were present in one SH entry and in 2 BW/SH derivatives, detected by Xgwm159.5B. The findings revealed that 37.5% (12 entries) of the SHs and 5% (3) of the 60 BW/SH derivatives possessed APR. These observations add strength to exploit both intraspecific and interspecific strategies for allelic enrichment within wheat pre-breeding / breeding programs.

Full text

Pak. J. Bot., 49(2): 735-743, 2017.
EVALUATION OF D-GENOME SYNTHETIC HEXAPLOID WHEATS AND ADVANCED
DERIVATIVES FOR POWDERY MILDEW RESISTANCE
KHOLA RAFIQUE1, CHAUDHARY ABDUL RAUF1, ALVINA GUL2, HADI BUX3*, AHMAD ALI4,
RABIA ASMA MEMON3, SUMAIRA FARRAKH5 AND ABDUL MUJEEB-KAZI6,7
1Department of Plant Pathology, PMAS Arid Agriculture University Rawalpindi, Pakistan
2Atta-ur-Rahman School of Applied Biosciences (ASAB), National University of Sciences and Technology (NUST), Islamabad, Pakistan
3Institute of Plant Sciences, University of Sindh, Jamshoro, Pakistan
4Center of Plant Sciences and Biodiversity, University of Swat, Pakistan
5Department of Biosciences, COMSATS Institute of Information Technology, Islamabad, Pakistan6
6Department of Botany, University of Sargodha, Sargodha, Pakistan
7Texas A&M University, Texas, USA
*Corresponding author: hadiqau@gmail.com
Abstract
The present study was undertaken to characterize 32 D-genome synthetic hexaploid wheats (SHWs) of an Elite-II sub-
set and their 60 advanced derivatives. At seedling stage under controlled glasshouse conditions in Murree, the SHWs
showed complete resistance/ immune to susceptible disease reactions viz., two (6.25%) were immune, eighteen (56.25%)
were resistant, nine (28.12%) were intermediate, whereas three (9.37%) were susceptible. The BW/SH derivatives also
demonstrated complete resistance/ immune to intermediate reactions viz., 51 (85%) were immune, 5 (8.33%) were resistant
while 4 (6.66%) were intermediate. Adult plant resistance (APR) evaluated at the hill off-station summer site in Kaghan was
100% in SHWs (32/32) and 80% (48/60) in BW/SH derivatives. Several genotypes provided resistance at both plant stages
viz., 20 (62.5%) SHWs and 45 (75%) BW/SH derivatives. All the entries were checked for the presence of Pm4b, Pm9,
Pm16 and Pm30 resistance genes using linked SSR markers. The marker Xgwm382.2A flanked the gene Pm4b in one SH
and 5 BW/SH derivatives. Pm9 gene was identified using two markers viz., Xgwm4.4A detected Pm9 in one SH and 27
BW/SH while Xgwm332.7A detected same gene in one SH and 13 BW/SH derivatives. Pm16 and Pm30 genes were present
in one SH entry and in 2 BW/SH derivatives, detected by Xgwm159.5B. The findings revealed that 37.5% (12 entries) of the
SHs and 5% (3) of the 60 BW/SH derivatives possessed APR. These observations add strength to exploit both intraspecific
and interspecific strategies for allelic enrichment within wheat pre-breeding / breeding programs.
Key words: Synthetic hexaploid wheat and derivatives, Erysiphe graminis f. sp. tritici, Powdery mildew resistance, Pm
resistance genes, SSR markers.
Introduction
Wheat powdery mildew caused by the biotrophic
foliar pathogen Erysiphe graminis DC. f. sp. tritici
Marchal (syn. Blumeria graminis f. sp. tritici) is an
economically important disease of wheat that occurs
globally. It has been reported to be widespread across
Africa, Asia, Australia, Europe and the Americas. This
biotic stress greatly affects grain yield, volume, weight and
grain quality characteristics (Everts et al., 2001).
Presently, it is becoming an emerging threat to wheat
production in Pakistan and is globally causing substantial
yield losses that necessitate the development of control
strategies. Chemical control methods for powdery mildew
aided by cultural practices can be erratic in effectiveness,
costly and hazardous to environment (Hardwick et al.,
1994). Thus, host genetic resistance is the most convenient
control method for powdery mildew and hence attempts
are being made to evolve new resistant varieties to
eliminate fungicide usage for reducing yield losses and
provide environmental safety. There are more than 78
genes/ alleles at 50 genetic loci (Pm1-Pm53, Pm18=Pm1c,
Pm22=Pm1e, Pm23=Pm4c, Pm31=Pm21) reported for
powdery mildew resistance in bread wheat and its relatives
(Hao et al., 2015; Petersen et al., 2015) and out of 50
genetic loci, 11 have been mapped on the A-genome, 26
on the B-genome and 13 on the D-genome (Elkot et al.,
2015). Synthetic wheat hexaploids (2n=6x=42; AABBDD)
have been developed and reportedly (Mujeeb-Kazi, 2003)
possess multiple resistances against various biotic and
abiotic stresses (Mujeeb-Kazi et al., 2008, Bux et al.,
2012, Ogbonnaya et al., 2013). These genetic stocks are
the product of interspecific hybrids between Triticum
turgidum and Aegilops tauschii accessions that have
resulted in over 1000 unique combinations from which
various sub-sets have been structured. The SH wheats in
general form a rich reservoir for evaluation of various
stresses that limit wheat productivity (Mujeeb-Kazi et al.,
2004). They are also considered as new allelic sources for
powdery mildew resistance diversity. This study
specifically focused on the evaluation and characterization
of the Elite II sub-set of 32 SH entries and 60 bread
wheat/synthetic (BW/SH) advanced derivatives involving
commercial bread wheat cultivars.
The use of molecular markers linked to the traits of
interest in breeding for disease and pest resistance genes
can enhance selection accuracy during breeding. Simple
sequence repeat (SSR) markers are highly polymorphic,
chromosome arm specific and are being widely used for
genetic diversity studies. The two-fold objectives of the
present work were to evaluate powdery mildew via
seedling and adult plant screening of Elite-II SH wheats
and BW/SH advanced derivatives and detecting powdery
mildew resistance genes using linked SSR markers.

KHOLA RAFIQUE ET AL.,
736
Materials and Methods
Germplasm: 32 SHWs and 60 bread wheat/ synthetic
(BW/SH) advance derivatives were used in this study.
Inoculum: Bulk inoculum from the initial mildew
infections that occurred naturally in the Kaghan valley
was collected. Inoculum was collected and increased as
described by Duggal et al. (2000). The same bulk
inoculum was used for screening at seedling and adult
plant stages.
Evaluation of seedling resistance: The germplasm was
evaluated for reaction to powdery mildew and planted in
pots under controlled glass house conditions in Murree,
Pakistan. A completely randomized design (CRD) with
three replications was used. The experiment was
inoculated 18 days after planting. After inoculation,
seedlings were maintained under regimens of 16-19oC
and 12 hr/ day lighting. Disease severity was recorded
using 0-9 scale as described by McNeal et al. (1971),
whereas infection types were characterized as 0 =
completely resistant (immune), 1-3 = resistant, 4-6 =
intermediate and 7-9 = highly susceptible.
Evaluation of adult plant resistance (APR): For the
evaluation of APR, the test material was field planted in
Kaghan, Pakistan during the summer crop cycle (June to
October) in 2 meter rows with row to row distance of 1 ft
and exposed to inoculum present naturally in abundance.
The whole experiment was grown in a separate plot
bordered by a susceptible wheat and analyzed for
powdery mildew diversity. The test material was scored
for resistance/ susceptibility and the scoring followed the
protocol of Duggal et al. (2000) according to a 0 to 9
scale as mentioned under in vitro screening.
Molecular diagnostics: Molecular diagnostics of Pm
resistant genes involved in providing resistance either at
adult, seedling or at both stages was applied on all the
SH entries and the BW/SH advanced derivatives. SSR
markers (Table 1) were employed for detecting the
presence of four genes (Pm4b, Pm9, Pm16 and Pm30)
that contribute to powdery mildew resistance in wheat
germplasm following standard procedures reported for
each marker. DNA extraction was done using the
protocol of Weining and Langridge (1991) with minor
modifications.
Results
Evaluation of seedling resistance: Different infection
types (ITs) were recorded in the SH entries and the BW/SH
advanced derivatives at the seedling stage (Table 2).
a. Elite-II SH: The results showed significant variation in
disease response of the SH wheats against the inoculated
pathogen that ranged from complete resistant/ immune to
highly susceptible (Tables 2 and 5). Among 32 SH
wheats, 20 (62.5%) were resistant at seedling stage, of
which, 2 SH (6.25%) provided complete resistance/
immune response while 18 BW/SH (56.25%) showed
resistance. Nine (28.12%) showed intermediate reaction,
and three (9.37%) were susceptible.
b. BW/SH advanced derivatives: Similar variable
disease response was observed among BW/SH advanced
derivatives that ranged from complete resistance/ immune
to intermediate (Tables 2 and 6). Out of 60 BW/SH, 56
(93.3%) entries were resistant, 85% (51 entries) showed
immune reaction and 8.33% (5) showed resistance. The
remaining 4 entries of the 60 (6.66%) were found
intermediate in their reaction.
Table 1. Microsatellite (SSR) markers employed for the detection of Pm genes in resistant synthetic based germplasm.
No.
Locus
Primer
Sequence
Pm gene
References
1.
2A
Xgwm-382-125
F: GTCAGATAACGCCGTCCAAT
R: CTACGTGCACCACCATTTTG
Pm4b
Yi et al. (2008)
2.
4A
Xgwm-4-253
F: GCTGATGCATATAATGCTGT
R:CACTGTCTGTATCACTCTGCT
Pm9
Srnic et al. (2005)
3.
7A
Xgwm-332-212
F: AGCCAGCAAGTCACCAAAAC
R:AGTGCTGGAAAGAGTAGTTTTG
Pm9
Srnic et al. (2005)
4.
5B
Xgwm-159-201
F: GGGCCAACACTGGAACAC
R: GCAGAAGCTTGTTGGTAGGC
Pm16, Pm30
Chen et al. (2005)
Table 2. Powdery mildew evaluation for seedling and adult plant resistance.
IT* range
Reaction
Number of lines tested at seedling stage
Number of lines tested at adult plant stage
Elite-II
Advanced derivatives
Elite-II
Advanced derivatives
0
Immune
2
51
-
6
1-3
Resistant
18
5
32
42
4-6
Intermediate
9
4
-
12
7-9
Susceptible
3
-
-
-
* IT = Infection types

EVALUATION OF D-GENOME SYNTHETIC HEXAPLOIDS WHEATS
737
Table 3. Lines of Elite-II synthetic hexaploids (SH) and bread wheat/SH advanced derivatives resistant to
powdery mildew at both seedling and adult plant stages.
Immune/ Resistant
reaction
Accession numbers
Elite-II
Advanced derivatives
0-3
2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 16, 17,
18, 19, 22, 26, 29, 30, 31, 32
1, 3, 4, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21,
22, 23, 24, 25, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 52, 54
Table 4. Sources of adult plant resistance (IT <3 on a 0-9 scale) to
powdery mildew identified in the synthetic wheat (SH) Elite-II set and
bread wheat/SH advanced derivatives tested under field conditions.
Resistant
reaction
Accession numbers
Elite-II
Advanced
derivatives
0
-
-
1
1, 4, 13, 14, 15, 20, 21, 23, 24, 25, 27, 28
5, 28
2
-
6
3
-
-
Evaluation of adult plant resistance: The screening
results showed different response of the entries in the
field against the pathogen inoculum.
a. Elite-II SH: A significant difference was observed in
disease response among the Elite-II SH when tested in the
field compared to the seedling stage. All the 32 entries
(100%) of Elite-II SH tested at adult stage were similar in
their reaction to pathogen inoculum in the field and
showed resistance categorized according to 1-3 scale
range (Tables 2 and 5).
b. BW/SH Advanced derivatives: BW/SH entries
showed similar range of disease response at adult stage in
the field as noted at seedling stage i.e. complete
resistance/ immune to intermediate (Tables 2 and 6).
Based on screening results, the tested entries were
categorized as immune, resistant and intermediate. 80%
of the BW/SH were resistant, of which, 10% (6 entries)
showed complete resistance/ immune response and 70%
(42) showed resistance. The entries that showed
intermediate response included 12 entries (20%).
Screening at both stages of the crop showed that most
of the genotypes resistant at seedling stage were also
resistant at the adult plant stage. Such as, 20 (62.5%) SH
wheats and 45 (75%) of the BW/SH advanced derivatives
were found to be significantly resistant with resistance
expressed both at the seedling and adult plant stages (Table
3). The significant findings of the study revealed that out of
the tested germplasm, 37.5% (12) of the SH entries and 5%
(3) of 60 BW/SH advanced derivatives possessed only
APR against powdery mildew (Table 4). These identified
SH entries with APR were scored 1-3 (resistant) following
disease rating scale at adult stage in the field while
categorized intermediate (4-6) and susceptible (7-9) at
seedling stage. Similarly, the BW/SH entries with APR
were grouped under resistant category (1-3) at adult stage
while intermediate (4-6) at seedling stage. These results
suggested that these entries with APR are likely an
important source for durable resistance in the field.
Molecular diagnostics of Pm resistant genes using
linked SSR markers: In this study, SSR markers were
used for the amplification of Pm resistance genes.
Marker-assisted selection revealed the presence of four
Pm genes i.e. Pm4b, Pm9 (Fig. 1), Pm16 and Pm30
responsible for powdery mildew resistance in the SH
entries and the BW/SH advanced derivatives. The
resistant genotypes that showed the presence of Pm genes
were scored as (+) and those with the absence of Pm
genes were indicated as (-) (Tables 5 and 6).
Discussion
Genomic diversity is paramount for wheat yield
sustainability and for this, stress durability is vital. Various
biotic and abiotic stresses are production constraints and
often genetic diversity limitations emerge that necessitate
new alleles to be identified and exploited. Synthetic wheats
are such novel resources that have emerged about two
decades ago (Mujeeb-Kazi & Hettel, 1995) and have been
in pre-breeding usage globally across multiple facets that
embrace basic, strategic and applied research scenarios.
They have multiple disease resistances (MDR) and are of
prime value in wheat breeding (Ogbonnaya et al., 2008).
Synthetic hexaploid wheats resulting from Ae. tauschii
crosses with durum wheat cultivars, exhibit the genetic
diversity for various biotic stresses (Mujeeb-Kazi et al.,
2008). It is further attributed that Ae. tauschii, the diploid D
genome progenitor of hexaploid bread wheat is an arsenal
for providing diversity for numerous major/ minor biotic
and abiotic stresses that limit wheat productivity globally
and therefore currently occupies a very high priority in
wheat breeding (Coghlan, 2006; Simonite, 2006). This
view had earlier also been advocated by Mujeeb-Kazi
(2003, 2005 and 2006), Mujeeb-Kazi et al. (1996) that
unequivocally recognized Ae. tauschii as being a rich
source of valuable genes for resistance to various wheat
diseases including powdery mildew and pests. In this study,
the high frequency of mildew resistance was observed in
D-genome synthetic hexaploid wheats (SH’s) and in D
genome derived advanced derivatives (BW/SH) likely the
presence of diverse resistance sources against powdery
mildew in the D genome donor accessions coupled with
complimentation of resistance sources that might be within
the A and B genomes of the durum parents. Several mildew
resistance genes from Aegilops species have been
introduced into common wheat (Heun & Friebe, 1990).
The results of this study demonstrate that novel
sources of powdery mildew resistance are available in D-
genome synthetic sets and the BW/SH advanced
derivatives. It has been recognized that lines resistant at
seedling stage also provide a good level of field or APR
(Ma et al., 1995). A similar result was found in the SH
wheats (62.5%) and the BW/SH advanced derivatives
(75%). All these SH and BW/SH lines have shown
excellent resistance against powdery mildew at both
stages. It is well recognized that most genes, which confer
mildew resistance at the seedling stage, also confer good
level of APR. This supports our observations for these
new genetic stocks under study.

KHOLA RAFIQUE ET AL.,
738

EVALUATION OF D-GENOME SYNTHETIC HEXAPLOIDS WHEATS
739

KHOLA RAFIQUE ET AL.,
740

EVALUATION OF D-GENOME SYNTHETIC HEXAPLOIDS WHEATS
741
Fig. 1. SSR amplification of Pm9 (253bp) in BW/SH advanced derivatives using primer Xgwm-4.
Synthetics with both seedling and APR are more
attractive and preferred for utilization in wheat breeding
programs. However, we must consider race specific and
non-specific resistance that impinges upon resistance
durability that is crucial for sustainable agriculture.
Race-specific resistance against wheat mildew has been
widely studied and utilized in breeding programs. It does
have less affectivity for disease control as a result of the
rapid adaptation of pathogen populations on cultivars
possessing such type of disease resistance based upon
major gene presence. Race-specific resistant cultivars
and varieties offer temporary control of powdery mildew
that lasts only two to five years (Brown et al., 1997). On
the other hand, non-race specific resistance is often
durable and remains effective for longer periods under
disease conducive environments (Johnson, 1984).
Previous studies have identified and demonstrated APR
as durable against wheat powdery mildew. Similar
observations were also found in this study where twelve
entries viz. 1, 4, 13, 14, 15, 20, 21, 23, 24, 25, 27 and 28
of the Elite II SH and three (5, 6 and 28) BW/SH
advanced derivatives possessed APR under field
conditions. Therefore, the identification of APR to
mildew in the SH’s and the BW/SH advanced
derivatives validates them as being new sources of
resistance, which could be durable and highly desirable
for agricultural practicality. These could be an essential
source for utilization in wheat breeding against mildew.
Molecular markers are powerful tools to identify
genes of interest and have been used to genetically and
physically locate Pm genes in the wheat genome (Huang
& Roder, 2004). In the present study, the SSR marker
Xgwm-382 amplified the PCR fragment in one SH wheat
and in five BW/SH advanced derivatives with a size of
125bp in Pm4b. The results were in accordance with Yi et
al. (2008) in which it was confirmed that the 125bp allele
was the indicator for the presence of Pm4b gene located
on the chromosome 2AL. The gene was derived from T.
carthlicum (Alam et al., 2011). The entries detected with
Pm4b gene showed varied reactions viz. complete
resistance/ immune (3 BW/SH advanced derivatives) at
seedling stage and resistance (one SH wheat and two
BW/SH advanced derivative) at later growth stage (APR)
in the study (Tables 5 and 6). Similarly, Hysing et al.
(2007) observed complete resistance against powdery
mildew and identified the presence of Pm4b alone and in
combination with other genes in several land races and
cultivars. Recently, according to Emara et al. (2016),
complete efficacy of Pm4b gene in bread wheat cultivars
against 42 powdery mildew isolates was observed in 2013
while intermediate efficacy was revealed in 2014. Two
SSR markers were employed to detect the presence of
Pm9 resistance gene found in the hexaploid common
wheat (Ahmadi & Moore, 2007) and located on the long
arm of chromosome 7AL. Polymorphism between SH
wheats and the BW/SH advanced derivatives were
observed at the Xgwm-4 and Xgwm-332 SSR loci. A
253bp fragment was observed at the Xgwm-4 locus in
only one SH entry and 27 BW/SH advanced derivatives.
A 212 bp fragment was observed at the Xgwm-332 locus
in only one SH and in 13 genotypes of BW/SH advanced
derivative entries. Srnic et al. (2005) reported that Pm9
was linked with the SSR locus Xgwm-4 at 253bp and
Xgwm-332 at 212bp on chromosome 4AL and 7AL
respectively. The SH entry displayed APR while BW/SH
advanced derivatives showed varied (complete resistance/
immune to intermediate) responses at both stages. Hysing
et al. (2007) observed that gene combinations
Pm1a+Pm2+Pm9 conferred resistance in bread wheat
landraces and cultivars against 11 mildew isolates.
Powdery mildew resistance genes Pm16 and Pm30 share
common origin and chromosome location i.e. short arm of
chromosome 5B linked to SSR locus Xgwm-159 at 201bp
(Chen et al., 2005). Both genes have been derived from T.
turgidum var. dicoccoides (Alam et al., 2013). The results
indicated that both genes (201bp) were present in one SH
wheat with APR and two BW/SH advanced derivative
genotypes possessing complete resistance/ immune
response at seedling and resistance at adult stage.
Likewise, Emara et al. (2016) reported complete (100%)
resistance of Pm16 gene against 42 mildew isolates at
both seedling and adult plant stages of bread wheats.
Earlier, Pm30 gene has also been identified as a single
dominant gene associated with mildew resistance at
seedling stage of hexaploid wheat (Liu et al., 2002). The
presence of the powdery mildew resistant genes with

KHOLA RAFIQUE ET AL.,
742
tightly linked and flanking markers identified and
reported here should aid in the incorporation of these
powdery mildew resistance genes into future cultivars.
The assessment of the screening data and the presence
of Pm genes permits the suggestion that the reported genes
are essentially responsible for the resistance expressed
either at seedling or adult stage or both in identified
resistant entries. The observation on the involvement of Pm
genes in APR suggested that among SHs, entry 14 showed
the presence of all four Pm genes, of which, one or all the
genes might be involved in APR. This suggested that all
these are minor genes that showed non-race specific
resistance and provided APR in the field. In the remaining
entries, the absence of genes showed that some other major
or minor Pm genes were involved in disease resistance.
Similarly, among the BW/SHs, APR showed by entry 5
possessed Pm9 gene as minor gene involved in durable
resistance while the other two entries showed the absence
of the identified genes. These Pm genes involved in APR
identified in germplasm entries can be incorporated into
high yielding varieties. Also, the pyramiding of all these
reported genes resistant against different pathogen races
into one variety would provide an alternative way of
utilization of these resistance genes resources for breeding
new resistant wheat lines and cultivars with more durable
disease resistance.
Conclusion
Resistance identified in this study is associated with
chromosomes 2AL, 4AL, 7AL and 5B. It opens up doors
whereby greater emphasis must be given to target those
genes that are located on D genome chromosomes and
rigidly screen the bread wheats for their presence before
entering them in a crossing program with synthetic wheats
that has such a target gene identified. This corrective forward
course will also open up doors for conducting precision
direct crossing (Gill & Raupp, 1987) options. Integrated
different alleles at the SH level will generate derivatives that
would be more breeder user-friendly as the swift
introgression of simultaneous novel sources would add
greater efficiency to wheat breeding. This gene assembly
holds future promise and hence is mentioned as a way
forward that exploits the SH wheats in a unique manner.
References
Alam, M.A., F. Xue, C.Y. Wang and W.Q. Ji. 2011. Powdery
mildew resistance genes in wheat: Identification and
genetic analysis. J. Mol. Biol. Res., 1: 20-39.
Alam, M.A., F. Xue, M. Ali, C. Wang and J. Wanquan. 2013.
Identification and molecular mapping of powdery mildew
resistance gene Pmg25 in common wheat originated from
wild emmer (Triticum turgidum var. dicoccoides). Pak. J.
Bot., 45: 203-208.
Ahmadi, H. and K. Moore. 2007. Inheritance and chromosomal
location of powdery mildew resistance gene in wild wheat
Triticum turgidum var. dicoccoides. Plant Pathol. J., 6:
164-168.
Brown, J.K.M., E.M. Foster and R.B. O'Hara. 1997. Adaptation
of powdery mildew populations to cereal varieties in
relation to durable and non-durable resistance. In: The
gene-for-gene relationship in plant-parasite interactions.
(Eds.): Crute, I.R., E.B. Holub and J.J. Burdon. CAB.
International, UK, pp 119-138.
Bux, H., M. Ashraf, F. Hussain, A.R. Rattu and M.
Fayyaz. 2012. Characterization of wheat germplasm
for stripe rust (Puccini striiformis f. sp. tritici)
resistance AJCS., 6(1): 116-120.
Chen, X.M., Y.H. Luo, X.C. Xia, L.Q. Xia, X. Chen, Z.L. Ren,
Z.H He and J.Z. Jia. 2005. Chromosomal location of
powdery mildew resistance gene Pm16 in wheat using SSR
marker analysis. Plant Breed., 124: 225-228.
Coghlan, A. 2006. Synthetic wheat offers hope to the world.
New Scientist, 11th February. 2006.
Duggal, V., G.J. Jellis, T.W. Hollins and R. Stratford. 2000.
Resistance to powdery mildew in mutant lines of the
susceptible wheat cultivar Hobbit ‘sib’. Plant Path., 49:
468-476.
Elkot, A.F.A., P. Chhuneja, S. Kaur, M. Saluja, B. Keller and K.
Singh. 2015. Marker assisted transfer of two powdery
mildew resistance genes PmTb7A.1 and PmTb7A.2 from
Triticum boeoticum (Boiss.) to Triticum aestivum (L.).
PLoS ONE, 10(6): e0128297.
Emara, H.M., A.F. Omar, M.M. El-Shamy and M.E. Mohamed.
2016. Identification of Pm24, Pm35 and Pm37 in thirteen
Egyptian bread wheat cultivars using SSR markers. Ciencia
e Agrotecnologia, 40: 279-287.
Everts, K.L., S. Leath and P.L. Finney. 2001. Impact of powdery
mildew on milling and baking quality of soft red winter
wheat. Plant Dis., 85: 423-429.
Gill, B.S. and W.J. Raupp. 1987. Direct gene transfers from
Aegilops squarrosa L. to hexaploid wheat. Crop Sci., 27:
445-450.
Hao, Y., R. Parks, C. Cowger, Z. Chen, Y. Wang, D. Bland, J.P.
Murphy, M. Guedira, G. Brown-Guedira and J. Johnson.
2015. Molecular characterization of a new powdery mildew
resistance gene Pm54 in soft red winter wheat. Theor. Appl.
Genet., 128: 465-476.
Hardwick, N.V., J.E.E. Jenkins, B. Collins and S.J. Groves.
1994. Powdery mildew (Erysiphe graminis) on winter
wheat: control with fungicides and the effects on yield.
Crop Prot., 13: 93-98.
Heun, M. and B. Friebe. 1990. Introgression of powdery mildew
resistance from rye into wheat. Phytopath., 80: 242-245.
Huang, X.Q. and M.S. Roder. 2004. Molecular mapping of
powdery mildew resistance genes in wheat: A review.
Euphytica, 137: 203-223.
Hysing, S.C., A. Merker, E. Liljeroth, R.M.D. Koebner, F.J.
Zeller and S.L.K. Hsam. 2007. Powdery mildew resistance
in 155 Nordic bread wheat cultivars and landraces.
Hereditas, 144: 102-119.
Johnson, R. 1984. A critical analysis of durable resistance. Ann.
Rev. Phytopathol., 22: 309-330.
Liu, Z., Q. Sun, Z. Ni, E. Nevo and T. Yang. 2002. Molecular
characterization of a novel powdery mildew resistance gene
Pm30 in wheat originating from wild emmer. Euphytica,
123: 21-29.
Ma, H., R.P. Singh and A. Mujeeb-Kazi. 1995. Suppression/
expression of resistance to stripe rust in hexaploid wheat
(Triticum turgidum x T. tauschii). Euphytica, 83: 87-93.
McNeal, F.H., C.F. Konzak, E.P. Smith, W.S. Tate and T.S.
Russell. 1971. A uniform system for recording and
processing cereal research data U.S. dept. Agric. Res. Serv.,
34: 121-143.
Mujeeb-Kazi, A. 2003. New genetic stocks for durum and bread
wheat improvement. Tenth International Wheat Genetics
Symposium, Paestum, Italy. pp. 772-774.
Mujeeb-Kazi, A. 2005. Wide Crosses for durum wheat
improvement. In: Durum Wheat Breeding: Current
approaches and future strategies. (Eds.): Roya, C., M.N.
Nachit, N. DiFonzo, J.L. Araus, W.H. Pfeiffer and G.A.
Slafer. The Haworth Press Inc., pp. 703-743.

EVALUATION OF D-GENOME SYNTHETIC HEXAPLOIDS WHEATS
743
Mujeeb-Kazi, A. 2006. Utilization of genetic resources for bread
wheat improvement. CRC Series (Eds.): Singh, R.P. and
P.P. Jauhar. pp. 61-97.
Mujeeb-Kazi, A. and G.P. Hettel. 1995. Utilizing wild grass
biodiversity in wheat improvement: 15 years of wide cross
research at CIMMYT. CIMMYT Report 2. pp 1-140.
Mujeeb-Kazi, A., V. Rosas and S. Roldan. 1996. Conservation
of the genetic variation of Triticum tauschii (Coss.)
Schmalh. (Aegilops squarrosa auct. non L.) in synthetic
hexaploid wheats (T. turgidum L. s. lat. X T. tauschii; 2n =
6x = 42, AABBDD) and its potential utilization for wheat
improvement. Genet. Resour. Crop Evol., 43: 129-134.
Mujeeb-Kazi, A., R. Delgado, A. Cortes, S.D. Cano, V. Rosas
and J. Sanchez. 2004. Progress in exploiting Aegilops
tauschii for wheat improvement. Ann. Wheat Newsl., 50:
79-88.
Mujeeb-Kazi, A., A. Gul, M. Farooq, S. Rizwan and I. Ahmad.
2008. Rebirth of synthetic hexaploids with global
implications for wheat improvement. Aus. J. Agric. Res.,
59: 391-398.
Ogbonnaya, F.C., M. Imtiaz, H.S. Bariana, M. McLean, M.M.
Shankar, G.J. Hollaway, R.M. Trethowan, E.S. Lagudah
and M. van Ginkel. 2008. Mining synthetic hexaploids for
multiple disease resistance to improve bread wheat. Aus. J.
Agric. Res., 59: 421-431.
Ogbonnaya, F.C., O. Abdalla, A. Mujeeb-Kazi, A.G. Kazi, S.X.
Xu, N. Gosman, E.S. Lagudah, D. Bonnett, M.E. Sorrells
and H. Tsujimoto. 2013. Synthetic hexaploids: Harnessing
species of the primary gene pool for wheat improvement.
Ed. Janick, John Wiley/Blackwell Publishers J. Plant
Breed. Reviews, 37: 35-122.
Petersen, S., J.H. Lyerly, M.L. Worthington, W.R. Parks, C.
Cowger, D.S. Marshall, G. Brown-Guedira and J.P.
Murphy. 2015. Mapping of powdery mildew resistance
gene Pm53 introgressed from Aegilops speltoides into soft
red winter wheat. Theor. Appl. Genet., 128: 303-312.
Simonite, T. 2006. Ancient genetic tricks shape up wheat:
turning back the evolutionary clock offers better crops for
dry regions. Nature on line reporting on Jan. 03, 2006.
Srnic, G., J.P. Murphy, J.H. Lyerly, S. Leath and D.S Marshall.
2005. Inheritance and chromosomal assignment of powdery
mildew resistance genes in two winter wheat germplasm
lines. Crop Sci., 45: 1578-1586.
Weining, B. and P. Langridge. 1991. Identification and mapping
polymorphism in cereals based on PCR. Theor. Appl.
Genet., 82: 209-216.
Yi, Y.J., H.Y. Liu, X.Q. Huang, L.Z. An, F. Wang and X.L.
Wang. 2008. Development of molecular markers linked to
the wheat powdery mildew resistance gene Pm4b and
marker validation for molecular breeding. Plant Breed.,
127: 116-120.
(Received for publication 17 February 2016))